HOMD Banner
Taxonomy: V4.3   |  16S rRNA RefSeq: V16.03   |  Genomic RefSeq: V11.03   |  Viruses: V1.2

BAKTAGenome Explorer: Corynebacterium amycolatum (GCA_946220795.1)

Select a Genome:
BAKTA Annotations for GCA_946220795.1
Genome Selected: Corynebacterium amycolatum
ContigsBases CDSrRNA tmRNAtRNA
101 2617116 2273 0 1 45
[Table]   [AA Fasta]      [Browser]   [Text]   [Excel]  
Search & Sort all 4655 Records
Search These Records: Clear
Sort Column:   Molecule   PID   NA   AA   Gene  Gene Product  Reverse
Annotation Table [page:1]    |    Number of Records Found: 4655 [10 Pages]    |    Previous Page <==> Next Page    |    Jump to Page: [ 1  2  3  4  5  6  7  8  9  10  ]
Notes:   1- Column headers only sort the current page. 2- Select [NA] or [AA] links to show sequences.
Region Protein-ID Type Genome
Viewer		 Range
(bp)		 Show Sequences
(length) NA / AA		 BAKTA
Gene		 BAKTA
GeneProduct
1 CAMIBV010000001.1 GCA946220795_00001 CDS open 140-742 _na     200_aa hypothetical protein
2 CAMIBV010000001.1 GCA946220795_00002 CDS open 739-1368 _na     209_aa hypothetical protein
3 CAMIBV010000001.1 GCA946220795_00003 CDS open 1410-2567 _na     385_aa hypothetical protein
4 CAMIBV010000001.1 GCA946220795_00004 CDS open 2592-3380 _na     262_aa hypothetical protein
5 CAMIBV010000001.1 GCA946220795_00005 CDS open 3486-3716 _na     76_aa hypothetical protein
6 CAMIBV010000001.1 GCA946220795_00006 CDS open 3799-5799 _na     666_aa ADP-ribosyltransferase
7 CAMIBV010000001.1 GCA946220795_00007 CDS open 5944-7596 _na     550_aa DEAD/DEAH box helicase
8 CAMIBV010000001.1 GCA946220795_00008 CDS open 7602-8093 _na     163_aa hypothetical protein
9 CAMIBV010000001.1 GCA946220795_00009 CDS open 8322-8825 _na     167_aa hypothetical protein
10 CAMIBV010000001.1 GCA946220795_00010 CDS open 8846-9370 _na     174_aa hypothetical protein
11 CAMIBV010000001.1 GCA946220795_00011 CDS open 9467-10165 _na     232_aa HNH endonuclease family protein
12 CAMIBV010000001.1 GCA946220795_00012 CDS open 10353-11420 _na     355_aa tyrosine-type recombinase/integrase
13 CAMIBV010000001.1 GCA946220795_00013 CDS open 12073-13245 _na     390_aa hypothetical protein
14 CAMIBV010000001.1 GCA946220795_00014 CDS open 13505-14461 _na     318_aa DUF932 domain-containing protein
15 CAMIBV010000001.1 GCA946220795_00015 CDS open 14611-15012 _na     133_aa hypothetical protein
16 CAMIBV010000001.1 GCA946220795_00016 CDS open 15060-15680 _na     206_aa exonuclease domain-containing protein
17 CAMIBV010000001.1 GCA946220795_00017 CDS open 16070-17041 _na     323_aa hypothetical protein
18 CAMIBV010000001.1 GCA946220795_00018 CDS open 17199-17894 _na     231_aa DUF2786 domain-containing protein
19 CAMIBV010000001.1 GCA946220795_00019 CDS open 18050-18634 _na     194_aa hypothetical protein
20 CAMIBV010000001.1 GCA946220795_00020 CDS open 18658-18930 _na     90_aa hypothetical protein
21 CAMIBV010000001.1 GCA946220795_00021 CDS open 18992-19573 _na     193_aa hypothetical protein
22 CAMIBV010000001.1 GCA946220795_00022 CDS open 19739-20104 _na     121_aa hypothetical protein
23 CAMIBV010000001.1 GCA946220795_00023 CDS open 20101-21138 _na     345_aa hypothetical protein
24 CAMIBV010000001.1 GCA946220795_00024 CDS open 21308-22108 _na     266_aa hypothetical protein
25 CAMIBV010000001.1 GCA946220795_00025 CDS open 22197-23018 _na     273_aa rusA RusA family crossover junction endodeoxyribonuclease
26 CAMIBV010000001.1 GCA946220795_00026 CDS open 23158-24645 _na     495_aa hypothetical protein
27 CAMIBV010000001.1 GCA946220795_00027 CDS open 24684-25205 _na     173_aa single-stranded DNA-binding protein
28 CAMIBV010000001.1 GCA946220795_00028 CDS open 25432-26109 _na     225_aa hypothetical protein
29 CAMIBV010000001.1 GCA946220795_00029 CDS open 26112-27038 _na     308_aa hypothetical protein
30 CAMIBV010000001.1 GCA946220795_00030 CDS open 27084-27722 _na     212_aa PolC-type DNA polymerase III
31 CAMIBV010000001.1 GCA946220795_00031 CDS open 27817-28764 _na     315_aa ADP-ribosylglycohydrolase family protein
32 CAMIBV010000001.1 GCA946220795_00032 CDS open 28968-31451 _na     827_aa FtsK/SpoIIIE domain-containing protein
33 CAMIBV010000001.1 GCA946220795_00033 CDS open 31521-31973 _na     150_aa hypothetical protein
34 CAMIBV010000001.1 GCA946220795_00034 CDS open 32133-32840 _na     235_aa N-acetyltransferase
35 CAMIBV010000001.1 GCA946220795_00035 CDS open 32955-33209 _na     84_aa hypothetical protein
36 CAMIBV010000001.1 GCA946220795_00036 CDS open 33211-33417 _na     68_aa hypothetical protein
37 CAMIBV010000001.1 GCA946220795_00037 CDS open 33420-34214 _na     264_aa metal-dependent hydrolase
38 CAMIBV010000001.1 GCA946220795_00038 CDS open 34282-34545 _na     87_aa hypothetical protein
39 CAMIBV010000001.1 GCA946220795_00039 CDS open 34552-34869 _na     105_aa hypothetical protein
40 CAMIBV010000001.1 GCA946220795_00040 CDS open 34866-35057 _na     63_aa hypothetical protein
41 CAMIBV010000001.1 GCA946220795_00041 CDS open 35080-35505 _na     141_aa DUF3846 domain-containing protein
42 CAMIBV010000001.1 GCA946220795_00042 CDS open 35726-36085 _na     119_aa hypothetical protein
43 CAMIBV010000001.1 GCA946220795_00043 CDS open 36112-36609 _na     165_aa hypothetical protein
44 CAMIBV010000001.1 GCA946220795_00044 CDS open 36877-37251 _na     124_aa DUF4313 domain-containing protein
45 CAMIBV010000001.1 GCA946220795_00045 CDS open 38064-38426 _na     120_aa hypothetical protein
46 CAMIBV010000001.1 GCA946220795_00046 CDS open 38568-39815 _na     415_aa hypothetical protein
47 CAMIBV010000001.1 GCA946220795_00047 CDS open 39846-42542 _na     898_aa hypothetical protein
48 CAMIBV010000001.1 GCA946220795_00048 CDS open 42599-43513 _na     304_aa hypothetical protein
49 CAMIBV010000001.1 GCA946220795_00049 CDS open 43636-45477 _na     613_aa hypothetical protein
50 CAMIBV010000001.1 GCA946220795_00050 CDS open 45479-46753 _na     424_aa AAA family ATPase
51 CAMIBV010000001.1 GCA946220795_00051 CDS open 46864-47256 _na     130_aa hicB antitoxin HicB
52 CAMIBV010000001.1 GCA946220795_00052 CDS open 47253-47474 _na     73_aa hicA type II toxin-antitoxin system HicA family toxin
53 CAMIBV010000001.1 GCA946220795_00053 CDS open 48015-48392 _na     125_aa DUF2599 domain-containing protein
54 CAMIBV010000001.1 GCA946220795_00054 CDS open 48412-48636 _na     74_aa hypothetical protein
55 CAMIBV010000001.1 GCA946220795_00055 CDS open 49327-50052 _na     241_aa Abi family protein
56 CAMIBV010000001.1 GCA946220795_00056 CDS open 50325-52748 _na     807_aa SMC family ATPase
57 CAMIBV010000001.1 GCA946220795_00057 CDS open 52762-54093 _na     443_aa hypothetical protein
58 CAMIBV010000001.1 GCA946220795_00058 CDS open 54360-55217 _na     285_aa hypothetical protein
59 CAMIBV010000001.1 GCA946220795_00059 CDS open 55234-55662 _na     142_aa hypothetical protein
60 CAMIBV010000001.1 GCA946220795_00060 CDS open 55695-56003 _na     102_aa hypothetical protein
61 CAMIBV010000001.1 GCA946220795_00061 CDS open 56127-56243 _na     38_aa hypothetical protein
62 CAMIBV010000001.1 GCA946220795_00062 CDS open 56230-57102 _na     290_aa hypothetical protein
63 CAMIBV010000001.1 GCA946220795_00063 CDS open 57239-58543 _na     434_aa WVD2 family protein
64 CAMIBV010000001.1 GCA946220795_00064 CDS open 59123-60190 _na     355_aa repA replication protein RepA
65 CAMIBV010000001.1 GCA946220795_00065 CDS open 60537-64895 _na     1452_aa cutinase family protein
66 CAMIBV010000001.1 GCA946220795_00066 CDS open 64956-65282 _na     108_aa integration host factor%2C actinobacterial type
67 CAMIBV010000001.1 GCA946220795_00067 CDS open 65367-66167 _na     266_aa hypothetical protein
68 CAMIBV010000001.1 GCA946220795_00068 CDS open 67019-67369 _na     116_aa hypothetical protein
69 CAMIBV010000001.1 GCA946220795_00069 CDS open 67369-67689 _na     106_aa hypothetical protein
70 CAMIBV010000001.1 GCA946220795_00070 CDS open 67886-70336 _na     816_aa recG ATP-dependent DNA helicase RecG
71 CAMIBV010000001.1 GCA946220795_00071 CDS open 70378-70785 _na     135_aa hypothetical protein
72 CAMIBV010000001.1 GCA946220795_00072 CDS open 70782-72329 _na     515_aa MinD/ParA family protein
73 CAMIBV010000001.1 GCA946220795_00073 CDS open 72476-72958 _na     160_aa hypothetical protein
74 CAMIBV010000001.1 GCA946220795_00074 CDS open 72948-74042 _na     364_aa parA ParA family protein
75 CAMIBV010000001.1 GCA946220795_00075 CDS open 74353-74670 _na     105_aa hypothetical protein
76 CAMIBV010000001.1 GCA946220795_00076 CDS open 75099-75341 _na     80_aa hypothetical protein
77 CAMIBV010000001.1 GCA946220795_00077 CDS open 75627-76115 _na     162_aa hypothetical protein
78 CAMIBV010000001.1 GCA946220795_00078 CDS open 76251-77270 _na     339_aa DUF4192 domain-containing protein
79 CAMIBV010000001.1 GCA946220795_00079 CDS open 77572-78483 _na     303_aa DUF4192 domain-containing protein
80 CAMIBV010000001.1 GCA946220795_00080 CDS open 78688-79068 _na     126_aa hypothetical protein
81 CAMIBV010000001.1 GCA946220795_00081 CDS open 79246-79560 _na     104_aa hypothetical protein
82 CAMIBV010000001.1 GCA946220795_00082 CDS open 79799-80416 _na     205_aa hypothetical protein
83 CAMIBV010000001.1 GCA946220795_00083 CDS open 80718-81113 _na     131_aa hypothetical protein
84 CAMIBV010000001.1 GCA946220795_00084 CDS open 81216-81830 _na     204_aa hypothetical protein
85 CAMIBV010000001.1 GCA946220795_00085 CDS open 81908-82165 _na     85_aa helix-turn-helix domain-containing protein
86 CAMIBV010000001.1 GCA946220795_00086 CDS open 82225-82653 _na     142_aa hypothetical protein
87 CAMIBV010000001.1 GCA946220795_00087 CDS open 82731-82907 _na     58_aa hypothetical protein
88 CAMIBV010000001.1 GCA946220795_00088 CDS open 83043-83582 _na     179_aa hypothetical protein
89 CAMIBV010000001.1 GCA946220795_00089 CDS open 83675-84499 _na     274_aa hypothetical protein
90 CAMIBV010000001.1 GCA946220795_00090 CDS open 84610-85881 _na     423_aa hypothetical protein
91 CAMIBV010000001.1 GCA946220795_00091 CDS open 85967-88600 _na     877_aa traM TraD/TraG TraM recognition site domain-containing protein
92 CAMIBV010000001.1 GCA946220795_00092 CDS open 88697-90301 _na     534_aa conjugal transfer protein
93 CAMIBV010000001.1 GCA946220795_00093 CDS open 90426-90716 _na     96_aa hypothetical protein
94 CAMIBV010000001.1 GCA946220795_00094 CDS open 90735-91304 _na     189_aa hypothetical protein
95 CAMIBV010000001.1 GCA946220795_00095 CDS open 91317-94385 _na     1022_aa ATP-binding protein
96 CAMIBV010000001.1 GCA946220795_00096 CDS open 94477-97656 _na     1059_aa hypothetical protein
97 CAMIBV010000001.1 GCA946220795_00097 CDS open 97677-98117 _na     146_aa hypothetical protein
98 CAMIBV010000001.1 GCA946220795_00098 CDS open 98105-98401 _na     98_aa hypothetical protein
99 CAMIBV010000001.1 GCA946220795_00099 CDS open 98525-99181 _na     218_aa hypothetical protein
100 CAMIBV010000001.1 GCA946220795_00100 CDS open 100358-100624 _na     88_aa hypothetical protein
101 CAMIBV010000001.1 GCA946220795_00001 gene open 140-742
102 CAMIBV010000001.1 GCA946220795_00002 gene open 739-1368
103 CAMIBV010000001.1 GCA946220795_00003 gene open 1410-2567
104 CAMIBV010000001.1 GCA946220795_00004 gene open 2592-3380
105 CAMIBV010000001.1 GCA946220795_00005 gene open 3486-3716
106 CAMIBV010000001.1 GCA946220795_00006 gene open 3799-5799
107 CAMIBV010000001.1 GCA946220795_00007 gene open 5944-7596
108 CAMIBV010000001.1 GCA946220795_00008 gene open 7602-8093
109 CAMIBV010000001.1 GCA946220795_00009 gene open 8322-8825
110 CAMIBV010000001.1 GCA946220795_00010 gene open 8846-9370
111 CAMIBV010000001.1 GCA946220795_00011 gene open 9467-10165
112 CAMIBV010000001.1 GCA946220795_00012 gene open 10353-11420
113 CAMIBV010000001.1 GCA946220795_00013 gene open 12073-13245
114 CAMIBV010000001.1 GCA946220795_00014 gene open 13505-14461
115 CAMIBV010000001.1 GCA946220795_00015 gene open 14611-15012
116 CAMIBV010000001.1 GCA946220795_00016 gene open 15060-15680
117 CAMIBV010000001.1 GCA946220795_00017 gene open 16070-17041
118 CAMIBV010000001.1 GCA946220795_00018 gene open 17199-17894
119 CAMIBV010000001.1 GCA946220795_00019 gene open 18050-18634
120 CAMIBV010000001.1 GCA946220795_00020 gene open 18658-18930
121 CAMIBV010000001.1 GCA946220795_00021 gene open 18992-19573
122 CAMIBV010000001.1 GCA946220795_00022 gene open 19739-20104
123 CAMIBV010000001.1 GCA946220795_00023 gene open 20101-21138
124 CAMIBV010000001.1 GCA946220795_00024 gene open 21308-22108
125 CAMIBV010000001.1 GCA946220795_00025 gene open 22197-23018 rusA
126 CAMIBV010000001.1 GCA946220795_00026 gene open 23158-24645
127 CAMIBV010000001.1 GCA946220795_00027 gene open 24684-25205
128 CAMIBV010000001.1 GCA946220795_00028 gene open 25432-26109
129 CAMIBV010000001.1 GCA946220795_00029 gene open 26112-27038
130 CAMIBV010000001.1 GCA946220795_00030 gene open 27084-27722
131 CAMIBV010000001.1 GCA946220795_00031 gene open 27817-28764
132 CAMIBV010000001.1 GCA946220795_00032 gene open 28968-31451
133 CAMIBV010000001.1 GCA946220795_00033 gene open 31521-31973
134 CAMIBV010000001.1 GCA946220795_00034 gene open 32133-32840
135 CAMIBV010000001.1 GCA946220795_00035 gene open 32955-33209
136 CAMIBV010000001.1 GCA946220795_00036 gene open 33211-33417
137 CAMIBV010000001.1 GCA946220795_00037 gene open 33420-34214
138 CAMIBV010000001.1 GCA946220795_00038 gene open 34282-34545
139 CAMIBV010000001.1 GCA946220795_00039 gene open 34552-34869
140 CAMIBV010000001.1 GCA946220795_00040 gene open 34866-35057
141 CAMIBV010000001.1 GCA946220795_00041 gene open 35080-35505
142 CAMIBV010000001.1 GCA946220795_00042 gene open 35726-36085
143 CAMIBV010000001.1 GCA946220795_00043 gene open 36112-36609
144 CAMIBV010000001.1 GCA946220795_00044 gene open 36877-37251
145 CAMIBV010000001.1 GCA946220795_00045 gene open 38064-38426
146 CAMIBV010000001.1 GCA946220795_00046 gene open 38568-39815
147 CAMIBV010000001.1 GCA946220795_00047 gene open 39846-42542
148 CAMIBV010000001.1 GCA946220795_00048 gene open 42599-43513
149 CAMIBV010000001.1 GCA946220795_00049 gene open 43636-45477
150 CAMIBV010000001.1 GCA946220795_00050 gene open 45479-46753
151 CAMIBV010000001.1 GCA946220795_00051 gene open 46864-47256 hicB
152 CAMIBV010000001.1 GCA946220795_00052 gene open 47253-47474 hicA
153 CAMIBV010000001.1 GCA946220795_00053 gene open 48015-48392
154 CAMIBV010000001.1 GCA946220795_00054 gene open 48412-48636
155 CAMIBV010000001.1 GCA946220795_00055 gene open 49327-50052
156 CAMIBV010000001.1 GCA946220795_00056 gene open 50325-52748
157 CAMIBV010000001.1 GCA946220795_00057 gene open 52762-54093
158 CAMIBV010000001.1 GCA946220795_00058 gene open 54360-55217
159 CAMIBV010000001.1 GCA946220795_00059 gene open 55234-55662
160 CAMIBV010000001.1 GCA946220795_00060 gene open 55695-56003
161 CAMIBV010000001.1 GCA946220795_00061 gene open 56127-56243
162 CAMIBV010000001.1 GCA946220795_00062 gene open 56230-57102
163 CAMIBV010000001.1 GCA946220795_00063 gene open 57239-58543
164 CAMIBV010000001.1 GCA946220795_00064 gene open 59123-60190 repA
165 CAMIBV010000001.1 GCA946220795_00065 gene open 60537-64895
166 CAMIBV010000001.1 GCA946220795_00066 gene open 64956-65282
167 CAMIBV010000001.1 GCA946220795_00067 gene open 65367-66167
168 CAMIBV010000001.1 GCA946220795_00068 gene open 67019-67369
169 CAMIBV010000001.1 GCA946220795_00069 gene open 67369-67689
170 CAMIBV010000001.1 GCA946220795_00070 gene open 67886-70336 recG
171 CAMIBV010000001.1 GCA946220795_00071 gene open 70378-70785
172 CAMIBV010000001.1 GCA946220795_00072 gene open 70782-72329
173 CAMIBV010000001.1 GCA946220795_00073 gene open 72476-72958
174 CAMIBV010000001.1 GCA946220795_00074 gene open 72948-74042 parA
175 CAMIBV010000001.1 GCA946220795_00075 gene open 74353-74670
176 CAMIBV010000001.1 GCA946220795_00076 gene open 75099-75341
177 CAMIBV010000001.1 GCA946220795_00077 gene open 75627-76115
178 CAMIBV010000001.1 GCA946220795_00078 gene open 76251-77270
179 CAMIBV010000001.1 GCA946220795_00079 gene open 77572-78483
180 CAMIBV010000001.1 GCA946220795_00080 gene open 78688-79068
181 CAMIBV010000001.1 GCA946220795_00081 gene open 79246-79560
182 CAMIBV010000001.1 GCA946220795_00082 gene open 79799-80416
183 CAMIBV010000001.1 GCA946220795_00083 gene open 80718-81113
184 CAMIBV010000001.1 GCA946220795_00084 gene open 81216-81830
185 CAMIBV010000001.1 GCA946220795_00085 gene open 81908-82165
186 CAMIBV010000001.1 GCA946220795_00086 gene open 82225-82653
187 CAMIBV010000001.1 GCA946220795_00087 gene open 82731-82907
188 CAMIBV010000001.1 GCA946220795_00088 gene open 83043-83582
189 CAMIBV010000001.1 GCA946220795_00089 gene open 83675-84499
190 CAMIBV010000001.1 GCA946220795_00090 gene open 84610-85881
191 CAMIBV010000001.1 GCA946220795_00091 gene open 85967-88600 traM
192 CAMIBV010000001.1 GCA946220795_00092 gene open 88697-90301
193 CAMIBV010000001.1 GCA946220795_00093 gene open 90426-90716
194 CAMIBV010000001.1 GCA946220795_00094 gene open 90735-91304
195 CAMIBV010000001.1 GCA946220795_00095 gene open 91317-94385
196 CAMIBV010000001.1 GCA946220795_00096 gene open 94477-97656
197 CAMIBV010000001.1 GCA946220795_00097 gene open 97677-98117
198 CAMIBV010000001.1 GCA946220795_00098 gene open 98105-98401
199 CAMIBV010000001.1 GCA946220795_00099 gene open 98525-99181
200 CAMIBV010000001.1 GCA946220795_00100 gene open 100358-100624
201 CAMIBV010000002.1 regulatory_region open 21335-21517 Cobalamin riboswitch aptamer
202 CAMIBV010000002.1 GCA946220795_00101 CDS open 386-1213 _na     275_aa RDD family protein
203 CAMIBV010000002.1 GCA946220795_00102 CDS open 1260-2459 _na     399_aa FR47-like family protein
204 CAMIBV010000002.1 GCA946220795_00103 CDS open 2463-3044 _na     193_aa peptide deformylase
205 CAMIBV010000002.1 GCA946220795_00104 CDS open 3236-3592 _na     118_aa DUF3263 domain-containing protein
206 CAMIBV010000002.1 GCA946220795_00105 CDS open 3644-4558 _na     304_aa LytR/CpsA/Psr regulator C-terminal domain-containing protein
207 CAMIBV010000002.1 GCA946220795_00106 CDS open 4781-5338 _na     185_aa Lipoprotein
208 CAMIBV010000002.1 GCA946220795_00107 CDS open 5356-6579 _na     407_aa glutamate--cysteine ligase
209 CAMIBV010000002.1 GCA946220795_00108 CDS open 6750-7100 _na     116_aa Na+/H+ antiporter subunit
210 CAMIBV010000002.1 GCA946220795_00109 CDS open 7097-7507 _na     136_aa monovalent cation/H+ antiporter complex subunit F
211 CAMIBV010000002.1 GCA946220795_00110 CDS open 7488-8141 _na     217_aa Na+/H+ antiporter subunit E
212 CAMIBV010000002.1 GCA946220795_00111 CDS open 8138-9844 _na     568_aa Na+/H+ antiporter subunit D
213 CAMIBV010000002.1 GCA946220795_00112 CDS open 9834-10349 _na     171_aa Na(+)/H(+) antiporter subunit C
214 CAMIBV010000002.1 GCA946220795_00113 CDS open 10346-13519 _na     1057_aa Na+/H+ antiporter subunit A
215 CAMIBV010000002.1 GCA946220795_00114 CDS open 13720-14274 _na     184_aa Acetyl-CoA acetyltransferase
216 CAMIBV010000002.1 GCA946220795_00115 CDS open 14500-15885 _na     461_aa Peptidase M20/M25/M40 family protein
217 CAMIBV010000002.1 GCA946220795_00116 CDS open 16253-17878 _na     541_aa groL chaperonin GroEL
218 CAMIBV010000002.1 GCA946220795_00117 CDS open 18867-19766 _na     299_aa ppk2 polyphosphate kinase 2
219 CAMIBV010000002.1 GCA946220795_00118 CDS open 20004-21125 _na     373_aa Peroxidase
220 CAMIBV010000002.1 GCA946220795_00119 CDS open 21207-21362 _na     51_aa hypothetical protein
221 CAMIBV010000002.1 GCA946220795_00120 CDS open 21557-23866 _na     769_aa metE 5-methyltetrahydropteroyltriglutamate--homocysteine S-methyltransferase
222 CAMIBV010000002.1 GCA946220795_00121 CDS open 24172-25293 _na     373_aa Peroxidase
223 CAMIBV010000002.1 GCA946220795_00122 CDS open 25403-27124 _na     573_aa AMP-binding protein
224 CAMIBV010000002.1 GCA946220795_00123 CDS open 27215-31261 _na     1348_aa Amino acid adenylation domain protein
225 CAMIBV010000002.1 GCA946220795_00124 CDS open 31258-32112 _na     284_aa iclR IclR helix-turn-helix domain protein
226 CAMIBV010000002.1 GCA946220795_00125 CDS open 32270-32566 _na     98_aa Rhodanese-like domain protein
227 CAMIBV010000002.1 GCA946220795_00126 CDS open 32720-33193 _na     157_aa Inorganic pyrophosphatase
228 CAMIBV010000002.1 GCA946220795_00127 CDS open 33306-34796 _na     496_aa dacB D-alanyl-D-alanine carboxypeptidase/D-alanyl-D-alanine-endopeptidase
229 CAMIBV010000002.1 GCA946220795_00128 CDS open 34845-36125 _na     426_aa amidase
230 CAMIBV010000002.1 GCA946220795_00129 CDS open 36106-37191 _na     361_aa tRNA(Ile)-lysidine synthase
231 CAMIBV010000002.1 GCA946220795_00130 CDS open 37313-37897 _na     194_aa hpt hypoxanthine phosphoribosyltransferase
232 CAMIBV010000002.1 GCA946220795_00131 CDS open 38181-40832 _na     883_aa ftsH ATP-dependent zinc metalloprotease FtsH
233 CAMIBV010000002.1 GCA946220795_00132 CDS open 40842-41417 _na     191_aa folE GTP cyclohydrolase I FolE
234 CAMIBV010000002.1 GCA946220795_00133 CDS open 41459-42445 _na     328_aa folP dihydropteroate synthase
235 CAMIBV010000002.1 GCA946220795_00134 CDS open 42451-42855 _na     134_aa folB dihydroneopterin aldolase
236 CAMIBV010000002.1 GCA946220795_00135 CDS open 42852-43364 _na     170_aa folK 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase
237 CAMIBV010000002.1 GCA946220795_00136 CDS open 43367-43873 _na     168_aa DUF3180 domain-containing protein
238 CAMIBV010000002.1 GCA946220795_00137 CDS open 43870-45129 _na     419_aa DUF6779 domain-containing protein
239 CAMIBV010000002.1 GCA946220795_00138 CDS open 45245-46114 _na     289_aa Prephenate dehydrogenase family protein
240 CAMIBV010000002.1 GCA946220795_00139 CDS open 46212-47330 _na     372_aa panC pantoate--beta-alanine ligase
241 CAMIBV010000002.1 GCA946220795_00140 CDS open 47468-47884 _na     138_aa panD aspartate 1-decarboxylase
242 CAMIBV010000002.1 GCA946220795_00141 CDS open 48138-50333 _na     731_aa Phosphatase
243 CAMIBV010000002.1 GCA946220795_00142 CDS open 50384-51916 _na     510_aa lysS lysine--tRNA ligase
244 CAMIBV010000002.1 GCA946220795_00143 CDS open 52043-53548 _na     501_aa Calcineurin-like phosphoesterase domain-containing protein
245 CAMIBV010000002.1 GCA946220795_00144 CDS open 53671-55077 _na     468_aa Acyl-CoA dehydrogenase%2C C-terminal domain protein
246 CAMIBV010000002.1 GCA946220795_00145 CDS open 55120-56331 _na     403_aa Acyl-CoA dehydrogenase%2C C-terminal domain protein
247 CAMIBV010000002.1 GCA946220795_00146 CDS open 56643-57590 _na     315_aa hypothetical protein
248 CAMIBV010000002.1 GCA946220795_00147 CDS open 57583-58170 _na     195_aa hypothetical protein
249 CAMIBV010000002.1 GCA946220795_00148 CDS open 58234-58941 _na     235_aa hypothetical protein
250 CAMIBV010000002.1 GCA946220795_00149 CDS open 58952-61720 _na     922_aa vWA domain-containing protein
251 CAMIBV010000002.1 GCA946220795_00150 CDS open 61768-65598 _na     1276_aa tubulin-like doman-containing protein
252 CAMIBV010000002.1 GCA946220795_00151 CDS open 65598-68303 _na     901_aa hypothetical protein
253 CAMIBV010000002.1 GCA946220795_00152 CDS open 68328-70589 _na     753_aa hypothetical protein
254 CAMIBV010000002.1 GCA946220795_00153 CDS open 70589-73216 _na     875_aa hypothetical protein
255 CAMIBV010000002.1 GCA946220795_00154 CDS open 73240-74520 _na     426_aa hypothetical protein
256 CAMIBV010000002.1 GCA946220795_00155 CDS open 74527-75555 _na     342_aa TRAFAC clade GTPase domain-containing protein
257 CAMIBV010000002.1 GCA946220795_00156 CDS open 75607-76962 _na     451_aa hypothetical protein
258 CAMIBV010000002.1 GCA946220795_00157 CDS open 77113-78570 _na     485_aa metallophosphoesterase family protein
259 CAMIBV010000002.1 GCA946220795_00158 CDS open 78625-79485 _na     286_aa hypothetical protein
260 CAMIBV010000002.1 GCA946220795_00159 CDS open 79573-81291 _na     572_aa AMP-binding enzyme family protein
261 CAMIBV010000002.1 GCA946220795_00160 CDS open 81487-81744 _na     85_aa hypothetical protein
262 CAMIBV010000002.1 GCA946220795_00161 CDS open 81854-82567 _na     237_aa Secreted protein
263 CAMIBV010000002.1 GCA946220795_00162 CDS open 82570-83319 _na     249_aa Secreted protein
264 CAMIBV010000002.1 GCA946220795_00163 CDS open 83514-84272 _na     252_aa hypothetical protein
265 CAMIBV010000002.1 GCA946220795_00164 CDS open 84269-85603 _na     444_aa MFS transporter
266 CAMIBV010000002.1 GCA946220795_00165 CDS open 85590-86489 _na     299_aa grpE Nucleotide exchange factor GrpE
267 CAMIBV010000002.1 GCA946220795_00166 CDS open 86605-88224 _na     539_aa Carbohydrate kinase%2C FGGY family
268 CAMIBV010000002.1 GCA946220795_00167 CDS open 88224-88814 _na     196_aa hypothetical protein
269 CAMIBV010000002.1 GCA946220795_00168 CDS open 88811-90406 _na     531_aa non-specific serine/threonine protein kinase
270 CAMIBV010000002.1 GCA946220795_00169 CDS open 90379-91251 _na     290_aa hypothetical protein
271 CAMIBV010000002.1 GCA946220795_00170 CDS open 91672-92124 _na     150_aa Secreted protein
272 CAMIBV010000002.1 GCA946220795_00171 CDS open 92336-95014 _na     892_aa ATP-dependent Clp protease ATP-binding protein
273 CAMIBV010000002.1 GCA946220795_00172 CDS open 95015-95191 _na     58_aa DUF4236 domain-containing protein
274 CAMIBV010000002.1 GCA946220795_00173 CDS open 95261-96448 _na     395_aa Secretory lipase family protein
275 CAMIBV010000002.1 GCA946220795_00174 CDS open 96586-97518 _na     310_aa Adenine DNA glycosylase
276 CAMIBV010000002.1 GCA946220795_00175 CDS open 97590-98180 _na     196_aa Carbonic anhydrase
277 CAMIBV010000002.1 GCA946220795_00176 CDS open 98185-98904 _na     239_aa Secreted protein
278 CAMIBV010000002.1 GCA946220795_00177 CDS open 98901-100055 _na     384_aa radA DNA repair protein RadA
279 CAMIBV010000002.1 GCA946220795_00101 gene open 386-1213
280 CAMIBV010000002.1 GCA946220795_00102 gene open 1260-2459
281 CAMIBV010000002.1 GCA946220795_00103 gene open 2463-3044
282 CAMIBV010000002.1 GCA946220795_00104 gene open 3236-3592
283 CAMIBV010000002.1 GCA946220795_00105 gene open 3644-4558
284 CAMIBV010000002.1 GCA946220795_00106 gene open 4781-5338
285 CAMIBV010000002.1 GCA946220795_00107 gene open 5356-6579
286 CAMIBV010000002.1 GCA946220795_00108 gene open 6750-7100
287 CAMIBV010000002.1 GCA946220795_00109 gene open 7097-7507
288 CAMIBV010000002.1 GCA946220795_00110 gene open 7488-8141
289 CAMIBV010000002.1 GCA946220795_00111 gene open 8138-9844
290 CAMIBV010000002.1 GCA946220795_00112 gene open 9834-10349
291 CAMIBV010000002.1 GCA946220795_00113 gene open 10346-13519
292 CAMIBV010000002.1 GCA946220795_00114 gene open 13720-14274
293 CAMIBV010000002.1 GCA946220795_00115 gene open 14500-15885
294 CAMIBV010000002.1 GCA946220795_00116 gene open 16253-17878 groL
295 CAMIBV010000002.1 GCA946220795_00117 gene open 18867-19766 ppk2
296 CAMIBV010000002.1 GCA946220795_00118 gene open 20004-21125
297 CAMIBV010000002.1 GCA946220795_00119 gene open 21207-21362
298 CAMIBV010000002.1 GCA946220795_00120 gene open 21557-23866 metE
299 CAMIBV010000002.1 GCA946220795_00121 gene open 24172-25293
300 CAMIBV010000002.1 GCA946220795_00122 gene open 25403-27124
301 CAMIBV010000002.1 GCA946220795_00123 gene open 27215-31261
302 CAMIBV010000002.1 GCA946220795_00124 gene open 31258-32112 iclR
303 CAMIBV010000002.1 GCA946220795_00125 gene open 32270-32566
304 CAMIBV010000002.1 GCA946220795_00126 gene open 32720-33193
305 CAMIBV010000002.1 GCA946220795_00127 gene open 33306-34796 dacB
306 CAMIBV010000002.1 GCA946220795_00128 gene open 34845-36125
307 CAMIBV010000002.1 GCA946220795_00129 gene open 36106-37191
308 CAMIBV010000002.1 GCA946220795_00130 gene open 37313-37897 hpt
309 CAMIBV010000002.1 GCA946220795_00131 gene open 38181-40832 ftsH
310 CAMIBV010000002.1 GCA946220795_00132 gene open 40842-41417 folE
311 CAMIBV010000002.1 GCA946220795_00133 gene open 41459-42445 folP
312 CAMIBV010000002.1 GCA946220795_00134 gene open 42451-42855 folB
313 CAMIBV010000002.1 GCA946220795_00135 gene open 42852-43364 folK
314 CAMIBV010000002.1 GCA946220795_00136 gene open 43367-43873
315 CAMIBV010000002.1 GCA946220795_00137 gene open 43870-45129
316 CAMIBV010000002.1 GCA946220795_00138 gene open 45245-46114
317 CAMIBV010000002.1 GCA946220795_00139 gene open 46212-47330 panC
318 CAMIBV010000002.1 GCA946220795_00140 gene open 47468-47884 panD
319 CAMIBV010000002.1 GCA946220795_00141 gene open 48138-50333
320 CAMIBV010000002.1 GCA946220795_00142 gene open 50384-51916 lysS
321 CAMIBV010000002.1 GCA946220795_00143 gene open 52043-53548
322 CAMIBV010000002.1 GCA946220795_00144 gene open 53671-55077
323 CAMIBV010000002.1 GCA946220795_00145 gene open 55120-56331
324 CAMIBV010000002.1 GCA946220795_00146 gene open 56643-57590
325 CAMIBV010000002.1 GCA946220795_00147 gene open 57583-58170
326 CAMIBV010000002.1 GCA946220795_00148 gene open 58234-58941
327 CAMIBV010000002.1 GCA946220795_00149 gene open 58952-61720
328 CAMIBV010000002.1 GCA946220795_00150 gene open 61768-65598
329 CAMIBV010000002.1 GCA946220795_00151 gene open 65598-68303
330 CAMIBV010000002.1 GCA946220795_00152 gene open 68328-70589
331 CAMIBV010000002.1 GCA946220795_00153 gene open 70589-73216
332 CAMIBV010000002.1 GCA946220795_00154 gene open 73240-74520
333 CAMIBV010000002.1 GCA946220795_00155 gene open 74527-75555
334 CAMIBV010000002.1 GCA946220795_00156 gene open 75607-76962
335 CAMIBV010000002.1 GCA946220795_00157 gene open 77113-78570
336 CAMIBV010000002.1 GCA946220795_00158 gene open 78625-79485
337 CAMIBV010000002.1 GCA946220795_00159 gene open 79573-81291
338 CAMIBV010000002.1 GCA946220795_00160 gene open 81487-81744
339 CAMIBV010000002.1 GCA946220795_00161 gene open 81854-82567
340 CAMIBV010000002.1 GCA946220795_00162 gene open 82570-83319
341 CAMIBV010000002.1 GCA946220795_00163 gene open 83514-84272
342 CAMIBV010000002.1 GCA946220795_00164 gene open 84269-85603
343 CAMIBV010000002.1 GCA946220795_00165 gene open 85590-86489 grpE
344 CAMIBV010000002.1 GCA946220795_00166 gene open 86605-88224
345 CAMIBV010000002.1 GCA946220795_00167 gene open 88224-88814
346 CAMIBV010000002.1 GCA946220795_00168 gene open 88811-90406
347 CAMIBV010000002.1 GCA946220795_00169 gene open 90379-91251
348 CAMIBV010000002.1 GCA946220795_00170 gene open 91672-92124
349 CAMIBV010000002.1 GCA946220795_00171 gene open 92336-95014
350 CAMIBV010000002.1 GCA946220795_00172 gene open 95015-95191
351 CAMIBV010000002.1 GCA946220795_00173 gene open 95261-96448
352 CAMIBV010000002.1 GCA946220795_00174 gene open 96586-97518
353 CAMIBV010000002.1 GCA946220795_00175 gene open 97590-98180
354 CAMIBV010000002.1 GCA946220795_00176 gene open 98185-98904
355 CAMIBV010000002.1 GCA946220795_00177 gene open 98901-100055 radA
356 CAMIBV010000003.1 rep_origin open 4622-5316
357 CAMIBV010000003.1 repeat_region open 51118-51995 CRISPR array with 14 repeats of length 36%2C consensus sequence GCTGGGGATTGGTTCTCATTTCCCCTGATAGACTTC and spacer length 28
358 CAMIBV010000003.1 GCA946220795_00178 CDS open 365-1321 _na     318_aa Chromosome partitioning protein
359 CAMIBV010000003.1 GCA946220795_00179 CDS open 1600-2283 _na     227_aa rsmG 16S rRNA (guanine(527)-N(7))-methyltransferase RsmG
360 CAMIBV010000003.1 GCA946220795_00180 CDS open 2556-3704 _na     382_aa yidC membrane protein insertase YidC
361 CAMIBV010000003.1 GCA946220795_00181 CDS open 3791-4123 _na     110_aa yidD membrane protein insertion efficiency factor YidD
362 CAMIBV010000003.1 GCA946220795_00182 CDS open 4083-4463 _na     126_aa rnpA ribonuclease P protein component
363 CAMIBV010000003.1 GCA946220795_00183 CDS open 5317-7065 _na     582_aa dnaA chromosomal replication initiator protein DnaA
364 CAMIBV010000003.1 GCA946220795_00184 CDS open 7579-8769 _na     396_aa dnaN DNA polymerase III subunit beta
365 CAMIBV010000003.1 GCA946220795_00185 CDS open 8779-9978 _na     399_aa recF DNA replication/repair protein RecF
366 CAMIBV010000003.1 GCA946220795_00186 CDS open 9984-10646 _na     220_aa DUF721 domain-containing protein
367 CAMIBV010000003.1 GCA946220795_00187 CDS open 10936-12975 _na     679_aa gyrB DNA topoisomerase (ATP-hydrolyzing) subunit B
368 CAMIBV010000003.1 GCA946220795_00188 CDS open 13071-13958 _na     295_aa Alpha/beta hydrolase family protein
369 CAMIBV010000003.1 GCA946220795_00189 CDS open 14000-15958 _na     652_aa phospholipase C
370 CAMIBV010000003.1 GCA946220795_00190 CDS open 15972-16310 _na     112_aa Type II toxin-antitoxin system death-on-curing family toxin
371 CAMIBV010000003.1 GCA946220795_00191 CDS open 16307-16534 _na     75_aa copG Ribbon-helix-helix%2C copG family protein
372 CAMIBV010000003.1 GCA946220795_00192 CDS open 16719-19322 _na     867_aa gyrA DNA gyrase subunit A
373 CAMIBV010000003.1 GCA946220795_00193 CDS open 19327-19659 _na     110_aa DUF3566 domain-containing protein
374 CAMIBV010000003.1 GCA946220795_00196 CDS open 20134-20928 _na     264_aa ABC transporter ATP-binding protein
375 CAMIBV010000003.1 GCA946220795_00197 CDS open 20932-21960 _na     342_aa ABC transporter substrate-binding protein
376 CAMIBV010000003.1 GCA946220795_00198 CDS open 21960-22874 _na     304_aa ABC transporter permease
377 CAMIBV010000003.1 GCA946220795_00199 CDS open 22971-23195 _na     74_aa PLDc N-terminal domain-containing protein
378 CAMIBV010000003.1 GCA946220795_00200 CDS open 23311-24183 _na     290_aa Late embryogenesis abundant protein
379 CAMIBV010000003.1 GCA946220795_00201 CDS open 24458-25024 _na     188_aa Peptidyl-prolyl cis-trans isomerase
380 CAMIBV010000003.1 GCA946220795_00202 CDS open 25721-25990 _na     89_aa crgA cell division protein CrgA
381 CAMIBV010000003.1 GCA946220795_00203 CDS open 26126-26797 _na     223_aa aminodeoxychorismate/anthranilate synthase component II
382 CAMIBV010000003.1 GCA946220795_00204 CDS open 26801-28861 _na     686_aa pknB Stk1 family PASTA domain-containing Ser/Thr kinase
383 CAMIBV010000003.1 GCA946220795_00205 CDS open 28915-30399 _na     494_aa non-specific serine/threonine protein kinase
384 CAMIBV010000003.1 GCA946220795_00206 CDS open 30402-31838 _na     478_aa Penicillin-binding protein A
385 CAMIBV010000003.1 GCA946220795_00207 CDS open 31839-33200 _na     453_aa Cell cycle family protein
386 CAMIBV010000003.1 GCA946220795_00208 CDS open 33197-34552 _na     451_aa Stage II sporulation E family protein
387 CAMIBV010000003.1 GCA946220795_00209 CDS open 34549-35010 _na     153_aa FHA domain-containing protein
388 CAMIBV010000003.1 GCA946220795_00210 CDS open 35159-36067 _na     302_aa FHA domain-containing protein
389 CAMIBV010000003.1 GCA946220795_00212 CDS open 36846-37097 _na     83_aa iron chaperone
390 CAMIBV010000003.1 GCA946220795_00213 CDS open 37106-38488 _na     460_aa Drug resistance MFS transporter%2C drug:H+ antiporter-2 family protein
391 CAMIBV010000003.1 GCA946220795_00214 CDS open 38472-39164 _na     230_aa ABC transporter family protein
392 CAMIBV010000003.1 GCA946220795_00215 CDS open 39161-40168 _na     335_aa Phosphatidate phosphatase APP1 catalytic domain-containing protein
393 CAMIBV010000003.1 GCA946220795_00216 CDS open 40268-40594 _na     108_aa Transglycosylase-like domain protein
394 CAMIBV010000003.1 GCA946220795_00217 CDS open 40591-41820 _na     409_aa HNH endonuclease family protein
395 CAMIBV010000003.1 GCA946220795_00218 CDS open 42115-42636 _na     173_aa Acetyltransferase
396 CAMIBV010000003.1 GCA946220795_00219 CDS open 42779-44578 _na     599_aa hypothetical protein
397 CAMIBV010000003.1 GCA946220795_00220 CDS open 44719-46725 _na     668_aa P-loop NTPase fold protein
398 CAMIBV010000003.1 GCA946220795_00221 CDS open 46747-47784 _na     345_aa L-glyceraldehyde 3-phosphate reductase
399 CAMIBV010000003.1 GCA946220795_00222 CDS open 47931-49259 _na     442_aa Peptidase
400 CAMIBV010000003.1 GCA946220795_00223 CDS open 49460-49660 _na     66_aa hypothetical protein
401 CAMIBV010000003.1 GCA946220795_00224 CDS open 49852-50346 _na     164_aa Helicase
402 CAMIBV010000003.1 GCA946220795_00225 CDS open 52034-52357 _na     107_aa cas2 CRISPR-associated endonuclease Cas2
403 CAMIBV010000003.1 GCA946220795_00226 CDS open 52357-53259 _na     300_aa cas1 type II CRISPR-associated endonuclease Cas1
404 CAMIBV010000003.1 GCA946220795_00227 CDS open 53256-56549 _na     1097_aa cas9 type II CRISPR RNA-guided endonuclease Cas9
405 CAMIBV010000003.1 GCA946220795_00228 CDS open 56874-57209 _na     111_aa YCII-related domain-containing protein
406 CAMIBV010000003.1 GCA946220795_00229 CDS open 57223-58074 _na     283_aa Short chain dehydrogenase family protein
407 CAMIBV010000003.1 GCA946220795_00230 CDS open 58071-59288 _na     405_aa Saccharopine dehydrogenase
408 CAMIBV010000003.1 GCA946220795_00231 CDS open 59395-60603 _na     402_aa Major facilitator superfamily (MFS) profile domain-containing protein
409 CAMIBV010000003.1 GCA946220795_00232 CDS open 60755-62104 _na     449_aa Fic/DOC family protein
410 CAMIBV010000003.1 GCA946220795_00233 CDS open 62017-62403 _na     128_aa Iron-sulfur protein
411 CAMIBV010000003.1 GCA946220795_00234 CDS open 62434-63150 _na     238_aa Pyridoxal phosphate homeostasis protein
412 CAMIBV010000003.1 GCA946220795_00235 CDS open 63208-64407 _na     399_aa DUF2029 domain-containing protein
413 CAMIBV010000003.1 GCA946220795_00236 CDS open 64420-66837 _na     805_aa hrpB ATP-dependent helicase HrpB
414 CAMIBV010000003.1 GCA946220795_00237 CDS open 66881-67774 _na     297_aa Cation diffusion facilitator transporter family protein
415 CAMIBV010000003.1 GCA946220795_00238 CDS open 67928-68875 _na     315_aa Serine aminopeptidase S33 domain-containing protein
416 CAMIBV010000003.1 GCA946220795_00239 CDS open 68888-69388 _na     166_aa Methylated-DNA--protein-cysteine methyltransferase
417 CAMIBV010000003.1 GCA946220795_00240 CDS open 69392-70054 _na     220_aa Nitroreductase family protein
418 CAMIBV010000003.1 GCA946220795_00241 CDS open 70072-72132 _na     686_aa Flavin oxidoreductase / NADH oxidase family protein
419 CAMIBV010000003.1 GCA946220795_00242 CDS open 72316-73077 _na     253_aa SDR family oxidoreductase
420 CAMIBV010000003.1 GCA946220795_00243 CDS open 73102-73833 _na     243_aa SDR family oxidoreductase
421 CAMIBV010000003.1 GCA946220795_00244 CDS open 73916-75613 _na     565_aa AMP-binding enzyme family protein
422 CAMIBV010000003.1 GCA946220795_00245 CDS open 76152-76985 _na     277_aa GmrSD restriction endonucleases C-terminal domain-containing protein
423 CAMIBV010000003.1 GCA946220795_00246 CDS open 77280-81920 _na     1546_aa gltB glutamate synthase large subunit
424 CAMIBV010000003.1 GCA946220795_00247 CDS open 81913-83454 _na     513_aa Dihydropyrimidine dehydrogenase subunit A
425 CAMIBV010000003.1 GCA946220795_00248 CDS open 83509-83829 _na     106_aa heavy metal-binding domain-containing protein
426 CAMIBV010000003.1 GCA946220795_00249 CDS open 83991-84980 _na     329_aa LCP family protein
427 CAMIBV010000003.1 GCA946220795_00250 CDS open 85347-87224 _na     625_aa capD Capsule biosynthesis protein CapD
428 CAMIBV010000003.1 GCA946220795_00251 CDS open 87243-88487 _na     414_aa Polysaccharide biosynthesis protein C-terminal domain-containing protein
429 CAMIBV010000003.1 GCA946220795_00178 gene open 365-1321
430 CAMIBV010000003.1 GCA946220795_00179 gene open 1600-2283 rsmG
431 CAMIBV010000003.1 GCA946220795_00180 gene open 2556-3704 yidC
432 CAMIBV010000003.1 GCA946220795_00181 gene open 3791-4123 yidD
433 CAMIBV010000003.1 GCA946220795_00182 gene open 4083-4463 rnpA
434 CAMIBV010000003.1 GCA946220795_00183 gene open 5317-7065 dnaA
435 CAMIBV010000003.1 GCA946220795_00184 gene open 7579-8769 dnaN
436 CAMIBV010000003.1 GCA946220795_00185 gene open 8779-9978 recF
437 CAMIBV010000003.1 GCA946220795_00186 gene open 9984-10646
438 CAMIBV010000003.1 GCA946220795_00187 gene open 10936-12975 gyrB
439 CAMIBV010000003.1 GCA946220795_00188 gene open 13071-13958
440 CAMIBV010000003.1 GCA946220795_00189 gene open 14000-15958
441 CAMIBV010000003.1 GCA946220795_00190 gene open 15972-16310
442 CAMIBV010000003.1 GCA946220795_00191 gene open 16307-16534 copG
443 CAMIBV010000003.1 GCA946220795_00192 gene open 16719-19322 gyrA
444 CAMIBV010000003.1 GCA946220795_00193 gene open 19327-19659
445 CAMIBV010000003.1 GCA946220795_00196 gene open 20134-20928
446 CAMIBV010000003.1 GCA946220795_00197 gene open 20932-21960
447 CAMIBV010000003.1 GCA946220795_00198 gene open 21960-22874
448 CAMIBV010000003.1 GCA946220795_00199 gene open 22971-23195
449 CAMIBV010000003.1 GCA946220795_00200 gene open 23311-24183
450 CAMIBV010000003.1 GCA946220795_00201 gene open 24458-25024
451 CAMIBV010000003.1 GCA946220795_00202 gene open 25721-25990 crgA
452 CAMIBV010000003.1 GCA946220795_00203 gene open 26126-26797
453 CAMIBV010000003.1 GCA946220795_00204 gene open 26801-28861 pknB
454 CAMIBV010000003.1 GCA946220795_00205 gene open 28915-30399
455 CAMIBV010000003.1 GCA946220795_00206 gene open 30402-31838
456 CAMIBV010000003.1 GCA946220795_00207 gene open 31839-33200
457 CAMIBV010000003.1 GCA946220795_00208 gene open 33197-34552
458 CAMIBV010000003.1 GCA946220795_00209 gene open 34549-35010
459 CAMIBV010000003.1 GCA946220795_00210 gene open 35159-36067
460 CAMIBV010000003.1 GCA946220795_00212 gene open 36846-37097
461 CAMIBV010000003.1 GCA946220795_00213 gene open 37106-38488
462 CAMIBV010000003.1 GCA946220795_00214 gene open 38472-39164
463 CAMIBV010000003.1 GCA946220795_00215 gene open 39161-40168
464 CAMIBV010000003.1 GCA946220795_00216 gene open 40268-40594
465 CAMIBV010000003.1 GCA946220795_00217 gene open 40591-41820
466 CAMIBV010000003.1 GCA946220795_00218 gene open 42115-42636
467 CAMIBV010000003.1 GCA946220795_00219 gene open 42779-44578
468 CAMIBV010000003.1 GCA946220795_00220 gene open 44719-46725
469 CAMIBV010000003.1 GCA946220795_00221 gene open 46747-47784
470 CAMIBV010000003.1 GCA946220795_00222 gene open 47931-49259
471 CAMIBV010000003.1 GCA946220795_00223 gene open 49460-49660
472 CAMIBV010000003.1 GCA946220795_00224 gene open 49852-50346
473 CAMIBV010000003.1 GCA946220795_00225 gene open 52034-52357 cas2
474 CAMIBV010000003.1 GCA946220795_00226 gene open 52357-53259 cas1
475 CAMIBV010000003.1 GCA946220795_00227 gene open 53256-56549 cas9
476 CAMIBV010000003.1 GCA946220795_00228 gene open 56874-57209
477 CAMIBV010000003.1 GCA946220795_00229 gene open 57223-58074
478 CAMIBV010000003.1 GCA946220795_00230 gene open 58071-59288
479 CAMIBV010000003.1 GCA946220795_00231 gene open 59395-60603
480 CAMIBV010000003.1 GCA946220795_00232 gene open 60755-62104
481 CAMIBV010000003.1 GCA946220795_00233 gene open 62017-62403
482 CAMIBV010000003.1 GCA946220795_00234 gene open 62434-63150
483 CAMIBV010000003.1 GCA946220795_00235 gene open 63208-64407
484 CAMIBV010000003.1 GCA946220795_00236 gene open 64420-66837 hrpB
485 CAMIBV010000003.1 GCA946220795_00237 gene open 66881-67774
486 CAMIBV010000003.1 GCA946220795_00238 gene open 67928-68875
487 CAMIBV010000003.1 GCA946220795_00239 gene open 68888-69388
488 CAMIBV010000003.1 GCA946220795_00240 gene open 69392-70054
489 CAMIBV010000003.1 GCA946220795_00241 gene open 70072-72132
490 CAMIBV010000003.1 GCA946220795_00242 gene open 72316-73077
491 CAMIBV010000003.1 GCA946220795_00243 gene open 73102-73833
492 CAMIBV010000003.1 GCA946220795_00244 gene open 73916-75613
493 CAMIBV010000003.1 GCA946220795_00245 gene open 76152-76985
494 CAMIBV010000003.1 GCA946220795_00246 gene open 77280-81920 gltB
495 CAMIBV010000003.1 GCA946220795_00247 gene open 81913-83454
496 CAMIBV010000003.1 GCA946220795_00248 gene open 83509-83829
497 CAMIBV010000003.1 GCA946220795_00249 gene open 83991-84980
498 CAMIBV010000003.1 GCA946220795_00250 gene open 85347-87224 capD
499 CAMIBV010000003.1 GCA946220795_00251 gene open 87243-88487
500 CAMIBV010000003.1 GCA946220795_00194 gene open 19864-19937 trnI