BAKTAGenome Explorer: Actinomyces oris clade-893 (GCA_946221355.1)
Select a Genome:
|
BAKTA Annotations for GCA_946221355.1
|
Search & Sort all 5252 Records
| ||||||||||||||||||
Notes: 1- Column headers only sort the current page. 2- Select [NA] or [AA] links to show sequences.
| Region | Protein-ID | Type | Genome Viewer |
Range (bp) |
Show Sequences (length) NA / AA |
BAKTA Gene |
BAKTA GeneProduct |
|
|---|---|---|---|---|---|---|---|---|
| 1001 | CAMIKZ010000013.1 | GCA946221355_00499 | gene | open | 31428-32039 | citB | ||
| 1002 | CAMIKZ010000013.1 | GCA946221355_00500 | gene | open | 32084-32485 | |||
| 1003 | CAMIKZ010000013.1 | GCA946221355_00501 | gene | open | 32555-34102 | ffh | ||
| 1004 | CAMIKZ010000014.1 | GCA946221355_00502 | CDS | open | 167-859 | _na 230_aa | Lipoprotein | |
| 1005 | CAMIKZ010000014.1 | GCA946221355_00503 | CDS | open | 1083-1847 | _na 254_aa | Serine/arginine repetitive matrix protein 1 | |
| 1006 | CAMIKZ010000014.1 | GCA946221355_00504 | CDS | open | 2260-2949 | _na 229_aa | hypothetical protein | |
| 1007 | CAMIKZ010000014.1 | GCA946221355_00505 | CDS | open | 3174-3476 | _na 100_aa | WXG100 family type VII secretion target | |
| 1008 | CAMIKZ010000014.1 | GCA946221355_00506 | CDS | open | 3718-4425 | _na 235_aa | SAF domain-containing protein | |
| 1009 | CAMIKZ010000014.1 | GCA946221355_00507 | CDS | open | 4425-5183 | _na 252_aa | CobQ/CobB/MinD/ParA nucleotide binding domain-containing protein | |
| 1010 | CAMIKZ010000014.1 | GCA946221355_00508 | CDS | open | 5180-6496 | _na 438_aa | cpaF | CpaF family protein |
| 1011 | CAMIKZ010000014.1 | GCA946221355_00509 | CDS | open | 6493-7368 | _na 291_aa | Bacterial type II secretion system domain protein F | |
| 1012 | CAMIKZ010000014.1 | GCA946221355_00510 | CDS | open | 7365-8288 | _na 307_aa | Bacterial type II secretion system domain protein F | |
| 1013 | CAMIKZ010000014.1 | GCA946221355_00511 | CDS | open | 8434-8643 | _na 69_aa | Flagellin Flp1-like domain-containing protein | |
| 1014 | CAMIKZ010000014.1 | GCA946221355_00512 | CDS | open | 8704-9099 | _na 131_aa | Peptidase M20 | |
| 1015 | CAMIKZ010000014.1 | GCA946221355_00513 | CDS | open | 9096-9593 | _na 165_aa | TadE-like protein | |
| 1016 | CAMIKZ010000014.1 | GCA946221355_00514 | CDS | open | 9590-10045 | _na 151_aa | tadE | Pilus assembly protein TadE |
| 1017 | CAMIKZ010000014.1 | GCA946221355_00515 | CDS | open | 10042-12723 | _na 893_aa | Bacterial transcriptional activator domain-containing protein | |
| 1018 | CAMIKZ010000014.1 | GCA946221355_00516 | CDS | open | 12736-17397 | _na 1553_aa | FtsK/SpoIIIE family protein | |
| 1019 | CAMIKZ010000014.1 | GCA946221355_00517 | CDS | open | 17938-20136 | _na 732_aa | DUF6571 domain-containing protein | |
| 1020 | CAMIKZ010000014.1 | GCA946221355_00518 | CDS | open | 20874-21488 | _na 204_aa | hypothetical protein | |
| 1021 | CAMIKZ010000014.1 | GCA946221355_00519 | CDS | open | 21380-21808 | _na 142_aa | Transposase IS4-like domain-containing protein | |
| 1022 | CAMIKZ010000014.1 | GCA946221355_00520 | CDS | open | 22810-23601 | _na 263_aa | hypothetical protein | |
| 1023 | CAMIKZ010000014.1 | GCA946221355_00521 | CDS | open | 23774-23923 | _na 49_aa | Transposase | |
| 1024 | CAMIKZ010000014.1 | GCA946221355_00522 | CDS | open | 25024-25950 | _na 308_aa | hypothetical protein | |
| 1025 | CAMIKZ010000014.1 | GCA946221355_00523 | CDS | open | 26246-27010 | _na 254_aa | Conserved domain protein | |
| 1026 | CAMIKZ010000014.1 | GCA946221355_00524 | CDS | open | 27219-27440 | _na 73_aa | Antitoxin | |
| 1027 | CAMIKZ010000014.1 | GCA946221355_00525 | CDS | open | 27437-27829 | _na 130_aa | pilT | Twitching motility protein PilT |
| 1028 | CAMIKZ010000014.1 | GCA946221355_00526 | CDS | open | 28368-29072 | _na 234_aa | Lipoprotein | |
| 1029 | CAMIKZ010000014.1 | GCA946221355_00527 | CDS | open | 29383-29886 | _na 167_aa | dps | DNA protection during starvation protein 2 |
| 1030 | CAMIKZ010000014.1 | GCA946221355_00528 | CDS | open | 30128-31450 | _na 440_aa | amyA | Glycosyl hydrolase family 13 catalytic domain-containing protein |
| 1031 | CAMIKZ010000014.1 | GCA946221355_00529 | CDS | open | 31709-32755 | _na 348_aa | araC | Transcriptional regulator%2C AraC family |
| 1032 | CAMIKZ010000014.1 | GCA946221355_00502 | gene | open | 167-859 | |||
| 1033 | CAMIKZ010000014.1 | GCA946221355_00503 | gene | open | 1083-1847 | |||
| 1034 | CAMIKZ010000014.1 | GCA946221355_00504 | gene | open | 2260-2949 | |||
| 1035 | CAMIKZ010000014.1 | GCA946221355_00505 | gene | open | 3174-3476 | |||
| 1036 | CAMIKZ010000014.1 | GCA946221355_00506 | gene | open | 3718-4425 | |||
| 1037 | CAMIKZ010000014.1 | GCA946221355_00507 | gene | open | 4425-5183 | |||
| 1038 | CAMIKZ010000014.1 | GCA946221355_00508 | gene | open | 5180-6496 | cpaF | ||
| 1039 | CAMIKZ010000014.1 | GCA946221355_00509 | gene | open | 6493-7368 | |||
| 1040 | CAMIKZ010000014.1 | GCA946221355_00510 | gene | open | 7365-8288 | |||
| 1041 | CAMIKZ010000014.1 | GCA946221355_00511 | gene | open | 8434-8643 | |||
| 1042 | CAMIKZ010000014.1 | GCA946221355_00512 | gene | open | 8704-9099 | |||
| 1043 | CAMIKZ010000014.1 | GCA946221355_00513 | gene | open | 9096-9593 | |||
| 1044 | CAMIKZ010000014.1 | GCA946221355_00514 | gene | open | 9590-10045 | tadE | ||
| 1045 | CAMIKZ010000014.1 | GCA946221355_00515 | gene | open | 10042-12723 | |||
| 1046 | CAMIKZ010000014.1 | GCA946221355_00516 | gene | open | 12736-17397 | |||
| 1047 | CAMIKZ010000014.1 | GCA946221355_00517 | gene | open | 17938-20136 | |||
| 1048 | CAMIKZ010000014.1 | GCA946221355_00518 | gene | open | 20874-21488 | |||
| 1049 | CAMIKZ010000014.1 | GCA946221355_00519 | gene | open | 21380-21808 | |||
| 1050 | CAMIKZ010000014.1 | GCA946221355_00520 | gene | open | 22810-23601 | |||
| 1051 | CAMIKZ010000014.1 | GCA946221355_00521 | gene | open | 23774-23923 | |||
| 1052 | CAMIKZ010000014.1 | GCA946221355_00522 | gene | open | 25024-25950 | |||
| 1053 | CAMIKZ010000014.1 | GCA946221355_00523 | gene | open | 26246-27010 | |||
| 1054 | CAMIKZ010000014.1 | GCA946221355_00524 | gene | open | 27219-27440 | |||
| 1055 | CAMIKZ010000014.1 | GCA946221355_00525 | gene | open | 27437-27829 | pilT | ||
| 1056 | CAMIKZ010000014.1 | GCA946221355_00526 | gene | open | 28368-29072 | |||
| 1057 | CAMIKZ010000014.1 | GCA946221355_00527 | gene | open | 29383-29886 | dps | ||
| 1058 | CAMIKZ010000014.1 | GCA946221355_00528 | gene | open | 30128-31450 | amyA | ||
| 1059 | CAMIKZ010000014.1 | GCA946221355_00529 | gene | open | 31709-32755 | araC | ||
| 1060 | CAMIKZ010000015.1 | GCA946221355_00530 | CDS | open | 134-2461 | _na 775_aa | NAD-specific glutamate dehydrogenase | |
| 1061 | CAMIKZ010000015.1 | GCA946221355_00531 | CDS | open | 2747-3667 | _na 306_aa | comF | ComF family protein |
| 1062 | CAMIKZ010000015.1 | GCA946221355_00532 | CDS | open | 3884-4534 | _na 216_aa | hpf | ribosome hibernation-promoting factor%2C HPF/YfiA family |
| 1063 | CAMIKZ010000015.1 | GCA946221355_00533 | CDS | open | 4636-6423 | _na 595_aa | Spore gernimation protein | |
| 1064 | CAMIKZ010000015.1 | GCA946221355_00534 | CDS | open | 6420-8279 | _na 619_aa | mtrB | MtrAB system histidine kinase MtrB |
| 1065 | CAMIKZ010000015.1 | GCA946221355_00535 | CDS | open | 8338-9018 | _na 226_aa | mtrA | MtrAB system response regulator MtrA |
| 1066 | CAMIKZ010000015.1 | GCA946221355_00536 | CDS | open | 9288-10607 | _na 439_aa | Glycerophosphoryl diester phosphodiesterase membrane domain-containing protein | |
| 1067 | CAMIKZ010000015.1 | GCA946221355_00537 | CDS | open | 10615-11301 | _na 228_aa | Protein-glutamine gamma-glutamyltransferase-like C-terminal domain-containing protein | |
| 1068 | CAMIKZ010000015.1 | GCA946221355_00538 | CDS | open | 11298-12509 | _na 403_aa | DUF4350 domain-containing protein | |
| 1069 | CAMIKZ010000015.1 | GCA946221355_00539 | CDS | open | 12506-13609 | _na 367_aa | AAA family ATPase | |
| 1070 | CAMIKZ010000015.1 | GCA946221355_00540 | CDS | open | 13675-14967 | _na 430_aa | DUF58 domain-containing protein | |
| 1071 | CAMIKZ010000015.1 | GCA946221355_00541 | CDS | open | 14991-15932 | _na 313_aa | Stage II sporulation protein M | |
| 1072 | CAMIKZ010000015.1 | GCA946221355_00542 | CDS | open | 16001-16882 | _na 293_aa | RDD family protein | |
| 1073 | CAMIKZ010000015.1 | GCA946221355_00543 | CDS | open | 16941-17180 | _na 79_aa | Trm112 family protein | |
| 1074 | CAMIKZ010000015.1 | GCA946221355_00544 | CDS | open | 17177-17563 | _na 128_aa | DUF3499 domain-containing protein | |
| 1075 | CAMIKZ010000015.1 | GCA946221355_00545 | CDS | open | 17846-18148 | _na 100_aa | Peptidase | |
| 1076 | CAMIKZ010000015.1 | GCA946221355_00546 | CDS | open | 18180-20135 | _na 651_aa | Prevent-host-death protein | |
| 1077 | CAMIKZ010000015.1 | GCA946221355_00547 | CDS | open | 20132-24211 | _na 1359_aa | Glycosyltransferase | |
| 1078 | CAMIKZ010000015.1 | GCA946221355_00548 | CDS | open | 24208-24528 | _na 106_aa | whiB | Transcriptional regulator WhiB |
| 1079 | CAMIKZ010000015.1 | GCA946221355_00549 | CDS | open | 24968-25648 | _na 226_aa | TIGR03089 family protein | |
| 1080 | CAMIKZ010000015.1 | GCA946221355_00550 | CDS | open | 25682-26872 | _na 396_aa | manA | mannose-6-phosphate isomerase%2C class I |
| 1081 | CAMIKZ010000015.1 | GCA946221355_00551 | CDS | open | 26905-27486 | _na 193_aa | rfbC | dTDP-4-dehydrorhamnose 3%2C5-epimerase |
| 1082 | CAMIKZ010000015.1 | GCA946221355_00552 | CDS | open | 27690-28562 | _na 290_aa | rfbA | glucose-1-phosphate thymidylyltransferase RfbA |
| 1083 | CAMIKZ010000015.1 | GCA946221355_00553 | CDS | open | 28653-30221 | _na 522_aa | DUF2142 domain-containing protein | |
| 1084 | CAMIKZ010000015.1 | GCA946221355_00554 | CDS | open | 30276-31205 | _na 309_aa | dTDP-4-dehydrorhamnose reductase | |
| 1085 | CAMIKZ010000015.1 | GCA946221355_00555 | CDS | open | 31361-32482 | _na 373_aa | rfaB | Glycosyltransferase subfamily 4-like N-terminal domain-containing protein |
| 1086 | CAMIKZ010000015.1 | GCA946221355_00530 | gene | open | 134-2461 | |||
| 1087 | CAMIKZ010000015.1 | GCA946221355_00531 | gene | open | 2747-3667 | comF | ||
| 1088 | CAMIKZ010000015.1 | GCA946221355_00532 | gene | open | 3884-4534 | hpf | ||
| 1089 | CAMIKZ010000015.1 | GCA946221355_00533 | gene | open | 4636-6423 | |||
| 1090 | CAMIKZ010000015.1 | GCA946221355_00534 | gene | open | 6420-8279 | mtrB | ||
| 1091 | CAMIKZ010000015.1 | GCA946221355_00535 | gene | open | 8338-9018 | mtrA | ||
| 1092 | CAMIKZ010000015.1 | GCA946221355_00536 | gene | open | 9288-10607 | |||
| 1093 | CAMIKZ010000015.1 | GCA946221355_00537 | gene | open | 10615-11301 | |||
| 1094 | CAMIKZ010000015.1 | GCA946221355_00538 | gene | open | 11298-12509 | |||
| 1095 | CAMIKZ010000015.1 | GCA946221355_00539 | gene | open | 12506-13609 | |||
| 1096 | CAMIKZ010000015.1 | GCA946221355_00540 | gene | open | 13675-14967 | |||
| 1097 | CAMIKZ010000015.1 | GCA946221355_00541 | gene | open | 14991-15932 | |||
| 1098 | CAMIKZ010000015.1 | GCA946221355_00542 | gene | open | 16001-16882 | |||
| 1099 | CAMIKZ010000015.1 | GCA946221355_00543 | gene | open | 16941-17180 | |||
| 1100 | CAMIKZ010000015.1 | GCA946221355_00544 | gene | open | 17177-17563 | |||
| 1101 | CAMIKZ010000015.1 | GCA946221355_00545 | gene | open | 17846-18148 | |||
| 1102 | CAMIKZ010000015.1 | GCA946221355_00546 | gene | open | 18180-20135 | |||
| 1103 | CAMIKZ010000015.1 | GCA946221355_00547 | gene | open | 20132-24211 | |||
| 1104 | CAMIKZ010000015.1 | GCA946221355_00548 | gene | open | 24208-24528 | whiB | ||
| 1105 | CAMIKZ010000015.1 | GCA946221355_00549 | gene | open | 24968-25648 | |||
| 1106 | CAMIKZ010000015.1 | GCA946221355_00550 | gene | open | 25682-26872 | manA | ||
| 1107 | CAMIKZ010000015.1 | GCA946221355_00551 | gene | open | 26905-27486 | rfbC | ||
| 1108 | CAMIKZ010000015.1 | GCA946221355_00552 | gene | open | 27690-28562 | rfbA | ||
| 1109 | CAMIKZ010000015.1 | GCA946221355_00553 | gene | open | 28653-30221 | |||
| 1110 | CAMIKZ010000015.1 | GCA946221355_00554 | gene | open | 30276-31205 | |||
| 1111 | CAMIKZ010000015.1 | GCA946221355_00555 | gene | open | 31361-32482 | rfaB | ||
| 1112 | CAMIKZ010000016.1 | GCA946221355_00556 | CDS | open | 642-1658 | _na 338_aa | hypothetical protein | |
| 1113 | CAMIKZ010000016.1 | GCA946221355_00557 | CDS | open | 1720-2448 | _na 242_aa | azlC | Azaleucine resistance protein AzlC |
| 1114 | CAMIKZ010000016.1 | GCA946221355_00558 | CDS | open | 2442-2765 | _na 107_aa | azlD | Branched-chain amino acid transporter AzlD |
| 1115 | CAMIKZ010000016.1 | GCA946221355_00559 | CDS | open | 2746-3540 | _na 264_aa | DUF1211 domain-containing protein | |
| 1116 | CAMIKZ010000016.1 | GCA946221355_00560 | CDS | open | 4090-4998 | _na 302_aa | menH | AB hydrolase-1 domain-containing protein |
| 1117 | CAMIKZ010000016.1 | GCA946221355_00561 | CDS | open | 5144-6532 | _na 462_aa | salY | ABC3 transporter permease C-terminal domain-containing protein |
| 1118 | CAMIKZ010000016.1 | GCA946221355_00562 | CDS | open | 6567-7406 | _na 279_aa | lolD | ABC transporter domain-containing protein |
| 1119 | CAMIKZ010000016.1 | GCA946221355_00563 | CDS | open | 7624-8349 | _na 241_aa | nth | endonuclease III |
| 1120 | CAMIKZ010000016.1 | GCA946221355_00564 | CDS | open | 8669-9346 | _na 225_aa | crp | Crp/Fnr family transcriptional regulator |
| 1121 | CAMIKZ010000016.1 | GCA946221355_00565 | CDS | open | 9503-9694 | _na 63_aa | DUF4177 domain-containing protein | |
| 1122 | CAMIKZ010000016.1 | GCA946221355_00566 | CDS | open | 9753-10088 | _na 111_aa | whiB | Transcriptional regulator WhiB |
| 1123 | CAMIKZ010000016.1 | GCA946221355_00567 | CDS | open | 10606-12681 | _na 691_aa | peptidoglycan glycosyltransferase | |
| 1124 | CAMIKZ010000016.1 | GCA946221355_00568 | CDS | open | 12733-13719 | _na 328_aa | yaeI | Calcineurin-like phosphoesterase domain-containing protein |
| 1125 | CAMIKZ010000016.1 | GCA946221355_00569 | CDS | open | 13956-14870 | _na 304_aa | 3-oxoacyl-[acyl-carrier protein] reductase | |
| 1126 | CAMIKZ010000016.1 | GCA946221355_00570 | CDS | open | 15142-15690 | _na 182_aa | ymdB | O-acetyl-ADP-ribose deacetylase |
| 1127 | CAMIKZ010000016.1 | GCA946221355_00572 | CDS | open | 16783-17244 | _na 153_aa | hypothetical protein | |
| 1128 | CAMIKZ010000016.1 | GCA946221355_00573 | CDS | open | 17450-17983 | _na 177_aa | Tat (Twin-arginine translocation) pathway signal sequence | |
| 1129 | CAMIKZ010000016.1 | GCA946221355_00574 | CDS | open | 18463-20091 | _na 542_aa | Diacylglycerol kinase family protein | |
| 1130 | CAMIKZ010000016.1 | GCA946221355_00575 | CDS | open | 20285-21595 | _na 436_aa | murT | Lipid II isoglutaminyl synthase (glutamine-hydrolyzing) subunit MurT |
| 1131 | CAMIKZ010000016.1 | GCA946221355_00576 | CDS | open | 21592-22347 | _na 251_aa | gatD | Lipid II isoglutaminyl synthase (glutamine-hydrolyzing) subunit GatD |
| 1132 | CAMIKZ010000016.1 | GCA946221355_00577 | CDS | open | 22686-22886 | _na 66_aa | pspC | Phage shock protein PspC N-terminal domain-containing protein |
| 1133 | CAMIKZ010000016.1 | GCA946221355_00578 | CDS | open | 23290-23685 | _na 131_aa | feoA | FeoA domain protein |
| 1134 | CAMIKZ010000016.1 | GCA946221355_00579 | CDS | open | 23682-25811 | _na 709_aa | feoB | ferrous iron transport protein B |
| 1135 | CAMIKZ010000016.1 | GCA946221355_00580 | CDS | open | 25894-26430 | _na 178_aa | nifU | NIF system FeS cluster assembly NifU C-terminal domain-containing protein |
| 1136 | CAMIKZ010000016.1 | GCA946221355_00581 | CDS | open | 26677-27054 | _na 125_aa | Ferrous iron transporter FeoA-like domain-containing protein | |
| 1137 | CAMIKZ010000016.1 | GCA946221355_00582 | CDS | open | 27051-29150 | _na 699_aa | feoB | ferrous iron transport protein B |
| 1138 | CAMIKZ010000016.1 | GCA946221355_00583 | CDS | open | 29395-29895 | _na 166_aa | yjhB | Nudix hydrolase domain-containing protein |
| 1139 | CAMIKZ010000016.1 | GCA946221355_00584 | CDS | open | 30108-30620 | _na 170_aa | VOC domain-containing protein | |
| 1140 | CAMIKZ010000016.1 | GCA946221355_00585 | CDS | open | 30996-31223 | _na 75_aa | Toxin-antitoxin system antitoxin subunit | |
| 1141 | CAMIKZ010000016.1 | GCA946221355_00586 | CDS | open | 31220-31621 | _na 133_aa | pilT | Twitching motility protein PilT |
| 1142 | CAMIKZ010000016.1 | GCA946221355_00556 | gene | open | 642-1658 | |||
| 1143 | CAMIKZ010000016.1 | GCA946221355_00557 | gene | open | 1720-2448 | azlC | ||
| 1144 | CAMIKZ010000016.1 | GCA946221355_00558 | gene | open | 2442-2765 | azlD | ||
| 1145 | CAMIKZ010000016.1 | GCA946221355_00559 | gene | open | 2746-3540 | |||
| 1146 | CAMIKZ010000016.1 | GCA946221355_00560 | gene | open | 4090-4998 | menH | ||
| 1147 | CAMIKZ010000016.1 | GCA946221355_00561 | gene | open | 5144-6532 | salY | ||
| 1148 | CAMIKZ010000016.1 | GCA946221355_00562 | gene | open | 6567-7406 | lolD | ||
| 1149 | CAMIKZ010000016.1 | GCA946221355_00563 | gene | open | 7624-8349 | nth | ||
| 1150 | CAMIKZ010000016.1 | GCA946221355_00564 | gene | open | 8669-9346 | crp | ||
| 1151 | CAMIKZ010000016.1 | GCA946221355_00565 | gene | open | 9503-9694 | |||
| 1152 | CAMIKZ010000016.1 | GCA946221355_00566 | gene | open | 9753-10088 | whiB | ||
| 1153 | CAMIKZ010000016.1 | GCA946221355_00567 | gene | open | 10606-12681 | |||
| 1154 | CAMIKZ010000016.1 | GCA946221355_00568 | gene | open | 12733-13719 | yaeI | ||
| 1155 | CAMIKZ010000016.1 | GCA946221355_00569 | gene | open | 13956-14870 | |||
| 1156 | CAMIKZ010000016.1 | GCA946221355_00570 | gene | open | 15142-15690 | ymdB | ||
| 1157 | CAMIKZ010000016.1 | GCA946221355_00572 | gene | open | 16783-17244 | |||
| 1158 | CAMIKZ010000016.1 | GCA946221355_00573 | gene | open | 17450-17983 | |||
| 1159 | CAMIKZ010000016.1 | GCA946221355_00574 | gene | open | 18463-20091 | |||
| 1160 | CAMIKZ010000016.1 | GCA946221355_00575 | gene | open | 20285-21595 | murT | ||
| 1161 | CAMIKZ010000016.1 | GCA946221355_00576 | gene | open | 21592-22347 | gatD | ||
| 1162 | CAMIKZ010000016.1 | GCA946221355_00577 | gene | open | 22686-22886 | pspC | ||
| 1163 | CAMIKZ010000016.1 | GCA946221355_00578 | gene | open | 23290-23685 | feoA | ||
| 1164 | CAMIKZ010000016.1 | GCA946221355_00579 | gene | open | 23682-25811 | feoB | ||
| 1165 | CAMIKZ010000016.1 | GCA946221355_00580 | gene | open | 25894-26430 | nifU | ||
| 1166 | CAMIKZ010000016.1 | GCA946221355_00581 | gene | open | 26677-27054 | |||
| 1167 | CAMIKZ010000016.1 | GCA946221355_00582 | gene | open | 27051-29150 | feoB | ||
| 1168 | CAMIKZ010000016.1 | GCA946221355_00583 | gene | open | 29395-29895 | yjhB | ||
| 1169 | CAMIKZ010000016.1 | GCA946221355_00584 | gene | open | 30108-30620 | |||
| 1170 | CAMIKZ010000016.1 | GCA946221355_00585 | gene | open | 30996-31223 | |||
| 1171 | CAMIKZ010000016.1 | GCA946221355_00586 | gene | open | 31220-31621 | pilT | ||
| 1172 | CAMIKZ010000016.1 | GCA946221355_00571 | gene | open | 15969-16042 | trnP | ||
| 1173 | CAMIKZ010000016.1 | GCA946221355_00571 | tRNA | open | 15969-16042 | trnP | tRNA-Pro(cgg) | |
| 1174 | CAMIKZ010000017.1 | GCA946221355_00587 | CDS | open | 88-459 | _na 123_aa | hypothetical protein | |
| 1175 | CAMIKZ010000017.1 | GCA946221355_00588 | CDS | open | 348-635 | _na 95_aa | rpsF | 30S ribosomal protein S6 |
| 1176 | CAMIKZ010000017.1 | GCA946221355_00589 | CDS | open | 884-3337 | _na 817_aa | peptidoglycan glycosyltransferase | |
| 1177 | CAMIKZ010000017.1 | GCA946221355_00590 | CDS | open | 3888-5264 | _na 458_aa | dcuB | Anaerobic C4-dicarboxylate transporter DcuB |
| 1178 | CAMIKZ010000017.1 | GCA946221355_00591 | CDS | open | 5414-8830 | _na 1138_aa | PPi-type phosphoenolpyruvate carboxykinase | |
| 1179 | CAMIKZ010000017.1 | GCA946221355_00592 | CDS | open | 9130-9288 | _na 52_aa | DUF4175 domain-containing protein | |
| 1180 | CAMIKZ010000017.1 | GCA946221355_00593 | CDS | open | 9288-10061 | _na 257_aa | srtA | Sortase |
| 1181 | CAMIKZ010000017.1 | GCA946221355_00594 | CDS | open | 10256-10771 | _na 171_aa | crgA | Cell division protein CrgA |
| 1182 | CAMIKZ010000017.1 | GCA946221355_00595 | CDS | open | 11216-12070 | _na 284_aa | Peptidase S54 rhomboid domain-containing protein | |
| 1183 | CAMIKZ010000017.1 | GCA946221355_00596 | CDS | open | 12258-12779 | _na 173_aa | ppiB | Peptidyl-prolyl cis-trans isomerase |
| 1184 | CAMIKZ010000017.1 | GCA946221355_00597 | CDS | open | 12957-13502 | _na 181_aa | Apolipoprotein A1/A4/E domain | |
| 1185 | CAMIKZ010000017.1 | GCA946221355_00598 | CDS | open | 13660-14418 | _na 252_aa | Heavy-metal chelation domain-containing protein | |
| 1186 | CAMIKZ010000017.1 | GCA946221355_00599 | CDS | open | 14775-17621 | _na 948_aa | Collagen-binding protein | |
| 1187 | CAMIKZ010000017.1 | GCA946221355_00600 | CDS | open | 17725-18573 | _na 282_aa | HTH araC/xylS-type domain-containing protein | |
| 1188 | CAMIKZ010000017.1 | GCA946221355_00601 | CDS | open | 18570-19037 | _na 155_aa | Integron-associated effector binding protein domain-containing protein | |
| 1189 | CAMIKZ010000017.1 | GCA946221355_00602 | CDS | open | 19085-20056 | _na 323_aa | qor | Mycocerosic acid synthase |
| 1190 | CAMIKZ010000017.1 | GCA946221355_00603 | CDS | open | 20193-20693 | _na 166_aa | marR | MarR family protein |
| 1191 | CAMIKZ010000017.1 | GCA946221355_00604 | CDS | open | 20695-20919 | _na 74_aa | xRE | HTH cro/C1-type domain-containing protein |
| 1192 | CAMIKZ010000017.1 | GCA946221355_00605 | CDS | open | 20895-21284 | _na 129_aa | DUF3147 domain-containing protein | |
| 1193 | CAMIKZ010000017.1 | GCA946221355_00606 | CDS | open | 21394-21912 | _na 172_aa | HXXEE domain-containing protein | |
| 1194 | CAMIKZ010000017.1 | GCA946221355_00608 | CDS | open | 22118-22252 | _na 44_aa | DLW-39 family protein | |
| 1195 | CAMIKZ010000017.1 | GCA946221355_00610 | CDS | open | 22406-22903 | _na 165_aa | DUF3566 domain-containing protein | |
| 1196 | CAMIKZ010000017.1 | GCA946221355_00611 | CDS | open | 22900-25581 | _na 893_aa | gyrA | DNA gyrase subunit A |
| 1197 | CAMIKZ010000017.1 | GCA946221355_00612 | CDS | open | 25650-27677 | _na 675_aa | gyrB | DNA topoisomerase (ATP-hydrolyzing) subunit B |
| 1198 | CAMIKZ010000017.1 | GCA946221355_00613 | CDS | open | 28004-28678 | _na 224_aa | PF05258 family protein | |
| 1199 | CAMIKZ010000017.1 | GCA946221355_00614 | CDS | open | 28671-29888 | _na 405_aa | recF | DNA replication/repair protein RecF |
| 1200 | CAMIKZ010000017.1 | GCA946221355_00615 | CDS | open | 29902-31032 | _na 376_aa | dnaN | DNA polymerase III subunit beta |
| 1201 | CAMIKZ010000017.1 | GCA946221355_00587 | gene | open | 88-459 | |||
| 1202 | CAMIKZ010000017.1 | GCA946221355_00588 | gene | open | 348-635 | rpsF | ||
| 1203 | CAMIKZ010000017.1 | GCA946221355_00589 | gene | open | 884-3337 | |||
| 1204 | CAMIKZ010000017.1 | GCA946221355_00590 | gene | open | 3888-5264 | dcuB | ||
| 1205 | CAMIKZ010000017.1 | GCA946221355_00591 | gene | open | 5414-8830 | |||
| 1206 | CAMIKZ010000017.1 | GCA946221355_00592 | gene | open | 9130-9288 | |||
| 1207 | CAMIKZ010000017.1 | GCA946221355_00593 | gene | open | 9288-10061 | srtA | ||
| 1208 | CAMIKZ010000017.1 | GCA946221355_00594 | gene | open | 10256-10771 | crgA | ||
| 1209 | CAMIKZ010000017.1 | GCA946221355_00595 | gene | open | 11216-12070 | |||
| 1210 | CAMIKZ010000017.1 | GCA946221355_00596 | gene | open | 12258-12779 | ppiB | ||
| 1211 | CAMIKZ010000017.1 | GCA946221355_00597 | gene | open | 12957-13502 | |||
| 1212 | CAMIKZ010000017.1 | GCA946221355_00598 | gene | open | 13660-14418 | |||
| 1213 | CAMIKZ010000017.1 | GCA946221355_00599 | gene | open | 14775-17621 | |||
| 1214 | CAMIKZ010000017.1 | GCA946221355_00600 | gene | open | 17725-18573 | |||
| 1215 | CAMIKZ010000017.1 | GCA946221355_00601 | gene | open | 18570-19037 | |||
| 1216 | CAMIKZ010000017.1 | GCA946221355_00602 | gene | open | 19085-20056 | qor | ||
| 1217 | CAMIKZ010000017.1 | GCA946221355_00603 | gene | open | 20193-20693 | marR | ||
| 1218 | CAMIKZ010000017.1 | GCA946221355_00604 | gene | open | 20695-20919 | xRE | ||
| 1219 | CAMIKZ010000017.1 | GCA946221355_00605 | gene | open | 20895-21284 | |||
| 1220 | CAMIKZ010000017.1 | GCA946221355_00606 | gene | open | 21394-21912 | |||
| 1221 | CAMIKZ010000017.1 | GCA946221355_00608 | gene | open | 22118-22252 | |||
| 1222 | CAMIKZ010000017.1 | GCA946221355_00610 | gene | open | 22406-22903 | |||
| 1223 | CAMIKZ010000017.1 | GCA946221355_00611 | gene | open | 22900-25581 | gyrA | ||
| 1224 | CAMIKZ010000017.1 | GCA946221355_00612 | gene | open | 25650-27677 | gyrB | ||
| 1225 | CAMIKZ010000017.1 | GCA946221355_00613 | gene | open | 28004-28678 | |||
| 1226 | CAMIKZ010000017.1 | GCA946221355_00614 | gene | open | 28671-29888 | recF | ||
| 1227 | CAMIKZ010000017.1 | GCA946221355_00615 | gene | open | 29902-31032 | dnaN | ||
| 1228 | CAMIKZ010000017.1 | GCA946221355_00607 | gene | open | 22010-22085 | trnA | ||
| 1229 | CAMIKZ010000017.1 | GCA946221355_00609 | gene | open | 22283-22356 | trnI | ||
| 1230 | CAMIKZ010000017.1 | GCA946221355_00607 | tRNA | open | 22010-22085 | trnA | tRNA-Ala(tgc) | |
| 1231 | CAMIKZ010000017.1 | GCA946221355_00609 | tRNA | open | 22283-22356 | trnI | tRNA-Ile(gat) | |
| 1232 | CAMIKZ010000018.1 | repeat_region | open | 27286-28331 | CRISPR array with 15 repeats of length 36%2C consensus sequence GTCGCAGTTCCTTCGGGAACTGCACTTCATTGAGGC and spacer length 35 | |||
| 1233 | CAMIKZ010000018.1 | GCA946221355_00616 | CDS | open | 105-1229 | _na 374_aa | AAA family ATPase | |
| 1234 | CAMIKZ010000018.1 | GCA946221355_00617 | CDS | open | 1226-3772 | _na 848_aa | DUF5682 domain-containing protein | |
| 1235 | CAMIKZ010000018.1 | GCA946221355_00618 | CDS | open | 3769-4944 | _na 391_aa | VWA domain-containing protein | |
| 1236 | CAMIKZ010000018.1 | GCA946221355_00619 | CDS | open | 4941-7082 | _na 713_aa | SWIM-type domain-containing protein | |
| 1237 | CAMIKZ010000018.1 | GCA946221355_00620 | CDS | open | 7268-10957 | _na 1229_aa | DUF4132 domain-containing protein | |
| 1238 | CAMIKZ010000018.1 | GCA946221355_00621 | CDS | open | 11101-13413 | _na 770_aa | PQQ enzyme repeat protein | |
| 1239 | CAMIKZ010000018.1 | GCA946221355_00622 | CDS | open | 13566-15827 | _na 753_aa | DUF4132 domain-containing protein | |
| 1240 | CAMIKZ010000018.1 | GCA946221355_00623 | CDS | open | 15941-17128 | _na 395_aa | mnmA | tRNA 2-thiouridine(34) synthase MnmA |
| 1241 | CAMIKZ010000018.1 | GCA946221355_00624 | CDS | open | 17530-17826 | _na 98_aa | hypothetical protein | |
| 1242 | CAMIKZ010000018.1 | GCA946221355_00625 | CDS | open | 18022-18387 | _na 121_aa | DUF5655 domain-containing protein | |
| 1243 | CAMIKZ010000018.1 | GCA946221355_00626 | CDS | open | 18544-19731 | _na 395_aa | Type I-U CRISPR-associated protein Cas7 | |
| 1244 | CAMIKZ010000018.1 | GCA946221355_00627 | CDS | open | 19731-21296 | _na 521_aa | csb2 | type I-U CRISPR-associated protein Csb2 |
| 1245 | CAMIKZ010000018.1 | GCA946221355_00628 | CDS | open | 21293-23980 | _na 895_aa | cas3u | type I-U CRISPR-associated helicase/endonuclease Cas3 |
| 1246 | CAMIKZ010000018.1 | GCA946221355_00629 | CDS | open | 23980-25011 | _na 343_aa | Aldehyde dehydrogenase | |
| 1247 | CAMIKZ010000018.1 | GCA946221355_00630 | CDS | open | 25217-26497 | _na 426_aa | CRISPR-associated endonuclease Cas1 | |
| 1248 | CAMIKZ010000018.1 | GCA946221355_00631 | CDS | open | 26628-26810 | _na 60_aa | hypothetical protein | |
| 1249 | CAMIKZ010000018.1 | GCA946221355_00632 | CDS | open | 26810-27109 | _na 99_aa | cas2 | CRISPR-associated endonuclease Cas2 |
| 1250 | CAMIKZ010000018.1 | GCA946221355_00633 | CDS | open | 28434-29654 | _na 406_aa | cysteine desulfurase | |
| 1251 | CAMIKZ010000018.1 | GCA946221355_00634 | CDS | open | 29788-30432 | _na 214_aa | hypothetical protein | |
| 1252 | CAMIKZ010000018.1 | GCA946221355_00616 | gene | open | 105-1229 | |||
| 1253 | CAMIKZ010000018.1 | GCA946221355_00617 | gene | open | 1226-3772 | |||
| 1254 | CAMIKZ010000018.1 | GCA946221355_00618 | gene | open | 3769-4944 | |||
| 1255 | CAMIKZ010000018.1 | GCA946221355_00619 | gene | open | 4941-7082 | |||
| 1256 | CAMIKZ010000018.1 | GCA946221355_00620 | gene | open | 7268-10957 | |||
| 1257 | CAMIKZ010000018.1 | GCA946221355_00621 | gene | open | 11101-13413 | |||
| 1258 | CAMIKZ010000018.1 | GCA946221355_00622 | gene | open | 13566-15827 | |||
| 1259 | CAMIKZ010000018.1 | GCA946221355_00623 | gene | open | 15941-17128 | mnmA | ||
| 1260 | CAMIKZ010000018.1 | GCA946221355_00624 | gene | open | 17530-17826 | |||
| 1261 | CAMIKZ010000018.1 | GCA946221355_00625 | gene | open | 18022-18387 | |||
| 1262 | CAMIKZ010000018.1 | GCA946221355_00626 | gene | open | 18544-19731 | |||
| 1263 | CAMIKZ010000018.1 | GCA946221355_00627 | gene | open | 19731-21296 | csb2 | ||
| 1264 | CAMIKZ010000018.1 | GCA946221355_00628 | gene | open | 21293-23980 | cas3u | ||
| 1265 | CAMIKZ010000018.1 | GCA946221355_00629 | gene | open | 23980-25011 | |||
| 1266 | CAMIKZ010000018.1 | GCA946221355_00630 | gene | open | 25217-26497 | |||
| 1267 | CAMIKZ010000018.1 | GCA946221355_00631 | gene | open | 26628-26810 | |||
| 1268 | CAMIKZ010000018.1 | GCA946221355_00632 | gene | open | 26810-27109 | cas2 | ||
| 1269 | CAMIKZ010000018.1 | GCA946221355_00633 | gene | open | 28434-29654 | |||
| 1270 | CAMIKZ010000018.1 | GCA946221355_00634 | gene | open | 29788-30432 | |||
| 1271 | CAMIKZ010000019.1 | GCA946221355_00635 | CDS | open | 244-651 | _na 135_aa | hypothetical protein | |
| 1272 | CAMIKZ010000019.1 | GCA946221355_00636 | CDS | open | 820-1455 | _na 211_aa | hypothetical protein | |
| 1273 | CAMIKZ010000019.1 | GCA946221355_00637 | CDS | open | 1888-3342 | _na 484_aa | wcaJ | Exopolysaccharide biosynthesis polyprenyl glycosylphosphotransferase |
| 1274 | CAMIKZ010000019.1 | GCA946221355_00638 | CDS | open | 3342-3782 | _na 146_aa | Bacterial sugar transferase domain-containing protein | |
| 1275 | CAMIKZ010000019.1 | GCA946221355_00639 | CDS | open | 3779-10069 | _na 2096_aa | Fibronectin type-III domain-containing protein | |
| 1276 | CAMIKZ010000019.1 | GCA946221355_00640 | CDS | open | 10150-11115 | _na 321_aa | mMP0363 | AAA+ ATPase domain-containing protein |
| 1277 | CAMIKZ010000019.1 | GCA946221355_00641 | CDS | open | 11121-12500 | _na 459_aa | DUF58 domain-containing protein | |
| 1278 | CAMIKZ010000019.1 | GCA946221355_00642 | CDS | open | 12497-15082 | _na 861_aa | Transglutaminase | |
| 1279 | CAMIKZ010000019.1 | GCA946221355_00643 | CDS | open | 15079-18429 | _na 1116_aa | FHA domain-containing protein | |
| 1280 | CAMIKZ010000019.1 | GCA946221355_00644 | CDS | open | 18557-20023 | _na 488_aa | sPS1 | non-specific serine/threonine protein kinase |
| 1281 | CAMIKZ010000019.1 | GCA946221355_00645 | CDS | open | 20023-22182 | _na 719_aa | FHA domain-containing protein | |
| 1282 | CAMIKZ010000019.1 | GCA946221355_00646 | CDS | open | 23005-23550 | _na 181_aa | hypothetical protein | |
| 1283 | CAMIKZ010000019.1 | GCA946221355_00647 | CDS | open | 23683-25593 | _na 636_aa | ccmA | heme ABC exporter ATP-binding protein CcmA |
| 1284 | CAMIKZ010000019.1 | GCA946221355_00648 | CDS | open | 25593-26579 | _na 328_aa | ispE | 4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase |
| 1285 | CAMIKZ010000019.1 | GCA946221355_00649 | CDS | open | 26576-27670 | _na 364_aa | rsmA | 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA |
| 1286 | CAMIKZ010000019.1 | GCA946221355_00650 | CDS | open | 27789-28724 | _na 311_aa | G5 domain-containing protein | |
| 1287 | CAMIKZ010000019.1 | GCA946221355_00651 | CDS | open | 28894-29916 | _na 340_aa | G5 domain-containing protein | |
| 1288 | CAMIKZ010000019.1 | GCA946221355_00635 | gene | open | 244-651 | |||
| 1289 | CAMIKZ010000019.1 | GCA946221355_00636 | gene | open | 820-1455 | |||
| 1290 | CAMIKZ010000019.1 | GCA946221355_00637 | gene | open | 1888-3342 | wcaJ | ||
| 1291 | CAMIKZ010000019.1 | GCA946221355_00638 | gene | open | 3342-3782 | |||
| 1292 | CAMIKZ010000019.1 | GCA946221355_00639 | gene | open | 3779-10069 | |||
| 1293 | CAMIKZ010000019.1 | GCA946221355_00640 | gene | open | 10150-11115 | mMP0363 | ||
| 1294 | CAMIKZ010000019.1 | GCA946221355_00641 | gene | open | 11121-12500 | |||
| 1295 | CAMIKZ010000019.1 | GCA946221355_00642 | gene | open | 12497-15082 | |||
| 1296 | CAMIKZ010000019.1 | GCA946221355_00643 | gene | open | 15079-18429 | |||
| 1297 | CAMIKZ010000019.1 | GCA946221355_00644 | gene | open | 18557-20023 | sPS1 | ||
| 1298 | CAMIKZ010000019.1 | GCA946221355_00645 | gene | open | 20023-22182 | |||
| 1299 | CAMIKZ010000019.1 | GCA946221355_00646 | gene | open | 23005-23550 | |||
| 1300 | CAMIKZ010000019.1 | GCA946221355_00647 | gene | open | 23683-25593 | ccmA | ||
| 1301 | CAMIKZ010000019.1 | GCA946221355_00648 | gene | open | 25593-26579 | ispE | ||
| 1302 | CAMIKZ010000019.1 | GCA946221355_00649 | gene | open | 26576-27670 | rsmA | ||
| 1303 | CAMIKZ010000019.1 | GCA946221355_00650 | gene | open | 27789-28724 | |||
| 1304 | CAMIKZ010000019.1 | GCA946221355_00651 | gene | open | 28894-29916 | |||
| 1305 | CAMIKZ010000020.1 | GCA946221355_00652 | CDS | open | 117-1196 | _na 359_aa | hypothetical protein | |
| 1306 | CAMIKZ010000020.1 | GCA946221355_00653 | CDS | open | 1372-6171 | _na 1599_aa | hrpA | ATP-dependent RNA helicase HrpA |
| 1307 | CAMIKZ010000020.1 | GCA946221355_00654 | CDS | open | 6455-7822 | _na 455_aa | WD40 repeat domain-containing protein | |
| 1308 | CAMIKZ010000020.1 | GCA946221355_00655 | CDS | open | 7896-8717 | _na 273_aa | Alpha/beta hydrolase | |
| 1309 | CAMIKZ010000020.1 | GCA946221355_00656 | CDS | open | 9052-9972 | _na 306_aa | cutC | PF03932 family protein CutC |
| 1310 | CAMIKZ010000020.1 | GCA946221355_00657 | CDS | open | 10030-10944 | _na 304_aa | fieF | Cation efflux protein cytoplasmic domain-containing protein |
| 1311 | CAMIKZ010000020.1 | GCA946221355_00658 | CDS | open | 11154-11963 | _na 269_aa | Glycine transporter domain-containing protein | |
| 1312 | CAMIKZ010000020.1 | GCA946221355_00659 | CDS | open | 12012-12329 | _na 105_aa | Protoporphyrinogen oxidase | |
| 1313 | CAMIKZ010000020.1 | GCA946221355_00660 | CDS | open | 12490-12819 | _na 109_aa | hypothetical protein | |
| 1314 | CAMIKZ010000020.1 | GCA946221355_00661 | CDS | open | 13061-14335 | _na 424_aa | Phosphatidate phosphatase APP1 catalytic domain-containing protein | |
| 1315 | CAMIKZ010000020.1 | GCA946221355_00662 | CDS | open | 14488-15759 | _na 423_aa | DUF2029 domain-containing protein | |
| 1316 | CAMIKZ010000020.1 | GCA946221355_00663 | CDS | open | 15907-17160 | _na 417_aa | Major facilitator superfamily (MFS) profile domain-containing protein | |
| 1317 | CAMIKZ010000020.1 | GCA946221355_00664 | CDS | open | 17275-18576 | _na 433_aa | Ig-like domain-containing protein | |
| 1318 | CAMIKZ010000020.1 | GCA946221355_00665 | CDS | open | 18989-19855 | _na 288_aa | PPM-type phosphatase domain-containing protein | |
| 1319 | CAMIKZ010000020.1 | GCA946221355_00666 | CDS | open | 19852-21237 | _na 461_aa | FHA domain-containing protein | |
| 1320 | CAMIKZ010000020.1 | GCA946221355_00667 | CDS | open | 21337-22170 | _na 277_aa | FHA domain-containing protein | |
| 1321 | CAMIKZ010000020.1 | GCA946221355_00668 | CDS | open | 22187-23104 | _na 305_aa | DUF2993 domain-containing protein | |
| 1322 | CAMIKZ010000020.1 | GCA946221355_00669 | CDS | open | 23324-24664 | _na 446_aa | AAA+ ATPase domain-containing protein | |
| 1323 | CAMIKZ010000020.1 | GCA946221355_00670 | CDS | open | 24688-25689 | _na 333_aa | mMP0362 | DUF58 domain-containing protein |
| 1324 | CAMIKZ010000020.1 | GCA946221355_00671 | CDS | open | 25693-26214 | _na 173_aa | Alpha-amylase | |
| 1325 | CAMIKZ010000020.1 | GCA946221355_00672 | CDS | open | 26208-27320 | _na 370_aa | VWA domain-containing protein | |
| 1326 | CAMIKZ010000020.1 | GCA946221355_00673 | CDS | open | 27317-28420 | _na 367_aa | VWFA domain-containing protein | |
| 1327 | CAMIKZ010000020.1 | GCA946221355_00674 | CDS | open | 28417-29445 | _na 342_aa | Tetratricopeptide repeat protein | |
| 1328 | CAMIKZ010000020.1 | GCA946221355_00652 | gene | open | 117-1196 | |||
| 1329 | CAMIKZ010000020.1 | GCA946221355_00653 | gene | open | 1372-6171 | hrpA | ||
| 1330 | CAMIKZ010000020.1 | GCA946221355_00654 | gene | open | 6455-7822 | |||
| 1331 | CAMIKZ010000020.1 | GCA946221355_00655 | gene | open | 7896-8717 | |||
| 1332 | CAMIKZ010000020.1 | GCA946221355_00656 | gene | open | 9052-9972 | cutC | ||
| 1333 | CAMIKZ010000020.1 | GCA946221355_00657 | gene | open | 10030-10944 | fieF | ||
| 1334 | CAMIKZ010000020.1 | GCA946221355_00658 | gene | open | 11154-11963 | |||
| 1335 | CAMIKZ010000020.1 | GCA946221355_00659 | gene | open | 12012-12329 | |||
| 1336 | CAMIKZ010000020.1 | GCA946221355_00660 | gene | open | 12490-12819 | |||
| 1337 | CAMIKZ010000020.1 | GCA946221355_00661 | gene | open | 13061-14335 | |||
| 1338 | CAMIKZ010000020.1 | GCA946221355_00662 | gene | open | 14488-15759 | |||
| 1339 | CAMIKZ010000020.1 | GCA946221355_00663 | gene | open | 15907-17160 | |||
| 1340 | CAMIKZ010000020.1 | GCA946221355_00664 | gene | open | 17275-18576 | |||
| 1341 | CAMIKZ010000020.1 | GCA946221355_00665 | gene | open | 18989-19855 | |||
| 1342 | CAMIKZ010000020.1 | GCA946221355_00666 | gene | open | 19852-21237 | |||
| 1343 | CAMIKZ010000020.1 | GCA946221355_00667 | gene | open | 21337-22170 | |||
| 1344 | CAMIKZ010000020.1 | GCA946221355_00668 | gene | open | 22187-23104 | |||
| 1345 | CAMIKZ010000020.1 | GCA946221355_00669 | gene | open | 23324-24664 | |||
| 1346 | CAMIKZ010000020.1 | GCA946221355_00670 | gene | open | 24688-25689 | mMP0362 | ||
| 1347 | CAMIKZ010000020.1 | GCA946221355_00671 | gene | open | 25693-26214 | |||
| 1348 | CAMIKZ010000020.1 | GCA946221355_00672 | gene | open | 26208-27320 | |||
| 1349 | CAMIKZ010000020.1 | GCA946221355_00673 | gene | open | 27317-28420 | |||
| 1350 | CAMIKZ010000020.1 | GCA946221355_00674 | gene | open | 28417-29445 | |||
| 1351 | CAMIKZ010000021.1 | GCA946221355_00675 | CDS | open | 119-310 | _na 63_aa | hypothetical protein | |
| 1352 | CAMIKZ010000021.1 | GCA946221355_00676 | CDS | open | 685-2514 | _na 609_aa | Tetratricopeptide repeat protein | |
| 1353 | CAMIKZ010000021.1 | GCA946221355_00677 | CDS | open | 4013-4312 | _na 99_aa | hypothetical protein | |
| 1354 | CAMIKZ010000021.1 | GCA946221355_00678 | CDS | open | 5432-5695 | _na 87_aa | Tetratricopeptide repeat protein | |
| 1355 | CAMIKZ010000021.1 | GCA946221355_00679 | CDS | open | 5791-6516 | _na 241_aa | rplQ | 50S ribosomal protein L17 |
| 1356 | CAMIKZ010000021.1 | GCA946221355_00680 | CDS | open | 6547-7548 | _na 333_aa | DNA-directed RNA polymerase subunit alpha | |
| 1357 | CAMIKZ010000021.1 | GCA946221355_00681 | CDS | open | 7706-8107 | _na 133_aa | rpsK | 30S ribosomal protein S11 |
| 1358 | CAMIKZ010000021.1 | GCA946221355_00682 | CDS | open | 8169-8543 | _na 124_aa | rpsM | 30S ribosomal protein S13 |
| 1359 | CAMIKZ010000021.1 | GCA946221355_00683 | CDS | open | 8709-8822 | _na 37_aa | rpmJ | 50S ribosomal protein L36 |
| 1360 | CAMIKZ010000021.1 | GCA946221355_00684 | CDS | open | 8856-9077 | _na 73_aa | infA | translation initiation factor IF-1 |
| 1361 | CAMIKZ010000021.1 | GCA946221355_00685 | CDS | open | 9365-10246 | _na 293_aa | map | type I methionyl aminopeptidase |
| 1362 | CAMIKZ010000021.1 | GCA946221355_00686 | CDS | open | 10382-10969 | _na 195_aa | adk | adenylate kinase |
| 1363 | CAMIKZ010000021.1 | GCA946221355_00687 | CDS | open | 10966-12267 | _na 433_aa | secY | preprotein translocase subunit SecY |
| 1364 | CAMIKZ010000021.1 | GCA946221355_00688 | CDS | open | 12618-13094 | _na 158_aa | rplO | 50S ribosomal protein L15 |
| 1365 | CAMIKZ010000021.1 | GCA946221355_00689 | CDS | open | 13096-13302 | _na 68_aa | rpmD | 50S ribosomal protein L30 |
| 1366 | CAMIKZ010000021.1 | GCA946221355_00690 | CDS | open | 13302-14009 | _na 235_aa | rpsE | 30S ribosomal protein S5 |
| 1367 | CAMIKZ010000021.1 | GCA946221355_00691 | CDS | open | 14044-14424 | _na 126_aa | rplR | 50S ribosomal protein L18 |
| 1368 | CAMIKZ010000021.1 | GCA946221355_00692 | CDS | open | 14427-14966 | _na 179_aa | rplF | 50S ribosomal protein L6 |
| 1369 | CAMIKZ010000021.1 | GCA946221355_00693 | CDS | open | 14988-15386 | _na 132_aa | rpsH | 30S ribosomal protein S8 |
| 1370 | CAMIKZ010000021.1 | GCA946221355_00694 | CDS | open | 15445-15630 | _na 61_aa | rpsN | type Z 30S ribosomal protein S14 |
| 1371 | CAMIKZ010000021.1 | GCA946221355_00695 | CDS | open | 15632-16189 | _na 185_aa | rplE | 50S ribosomal protein L5 |
| 1372 | CAMIKZ010000021.1 | GCA946221355_00696 | CDS | open | 16192-16536 | _na 114_aa | rplX | 50S ribosomal protein L24 |
| 1373 | CAMIKZ010000021.1 | GCA946221355_00697 | CDS | open | 16539-16907 | _na 122_aa | rplN | 50S ribosomal protein L14 |
| 1374 | CAMIKZ010000021.1 | GCA946221355_00698 | CDS | open | 17476-17769 | _na 97_aa | rpsQ | 30S ribosomal protein S17 |
| 1375 | CAMIKZ010000021.1 | GCA946221355_00699 | CDS | open | 17766-18011 | _na 81_aa | rpmC | 50S ribosomal protein L29 |
| 1376 | CAMIKZ010000021.1 | GCA946221355_00700 | CDS | open | 18011-18430 | _na 139_aa | rplP | 50S ribosomal protein L16 |
| 1377 | CAMIKZ010000021.1 | GCA946221355_00701 | CDS | open | 18434-19255 | _na 273_aa | rpsC | 30S ribosomal protein S3 |
| 1378 | CAMIKZ010000021.1 | GCA946221355_00702 | CDS | open | 19255-19632 | _na 125_aa | rplV | 50S ribosomal protein L22 |
| 1379 | CAMIKZ010000021.1 | GCA946221355_00703 | CDS | open | 19664-19942 | _na 92_aa | rpsS | 30S ribosomal protein S19 |
| 1380 | CAMIKZ010000021.1 | GCA946221355_00704 | CDS | open | 19957-20793 | _na 278_aa | rplB | 50S ribosomal protein L2 |
| 1381 | CAMIKZ010000021.1 | GCA946221355_00705 | CDS | open | 20820-21122 | _na 100_aa | rplW | 50S ribosomal protein L23 |
| 1382 | CAMIKZ010000021.1 | GCA946221355_00706 | CDS | open | 21119-21763 | _na 214_aa | rplD | 50S ribosomal protein L4 |
| 1383 | CAMIKZ010000021.1 | GCA946221355_00707 | CDS | open | 21768-22436 | _na 222_aa | rplC | 50S ribosomal protein L3 |
| 1384 | CAMIKZ010000021.1 | GCA946221355_00708 | CDS | open | 22445-22753 | _na 102_aa | rpsJ | 30S ribosomal protein S10 |
| 1385 | CAMIKZ010000021.1 | GCA946221355_00709 | CDS | open | 23012-24250 | _na 412_aa | Sortase | |
| 1386 | CAMIKZ010000021.1 | GCA946221355_00710 | CDS | open | 24488-26095 | _na 535_aa | Fimbrial structural subunit | |
| 1387 | CAMIKZ010000021.1 | GCA946221355_00711 | CDS | open | 26246-29107 | _na 953_aa | Fimbrial protein | |
| 1388 | CAMIKZ010000021.1 | GCA946221355_00675 | gene | open | 119-310 | |||
| 1389 | CAMIKZ010000021.1 | GCA946221355_00676 | gene | open | 685-2514 | |||
| 1390 | CAMIKZ010000021.1 | GCA946221355_00677 | gene | open | 4013-4312 | |||
| 1391 | CAMIKZ010000021.1 | GCA946221355_00678 | gene | open | 5432-5695 | |||
| 1392 | CAMIKZ010000021.1 | GCA946221355_00679 | gene | open | 5791-6516 | rplQ | ||
| 1393 | CAMIKZ010000021.1 | GCA946221355_00680 | gene | open | 6547-7548 | |||
| 1394 | CAMIKZ010000021.1 | GCA946221355_00681 | gene | open | 7706-8107 | rpsK | ||
| 1395 | CAMIKZ010000021.1 | GCA946221355_00682 | gene | open | 8169-8543 | rpsM | ||
| 1396 | CAMIKZ010000021.1 | GCA946221355_00683 | gene | open | 8709-8822 | rpmJ | ||
| 1397 | CAMIKZ010000021.1 | GCA946221355_00684 | gene | open | 8856-9077 | infA | ||
| 1398 | CAMIKZ010000021.1 | GCA946221355_00685 | gene | open | 9365-10246 | map | ||
| 1399 | CAMIKZ010000021.1 | GCA946221355_00686 | gene | open | 10382-10969 | adk | ||
| 1400 | CAMIKZ010000021.1 | GCA946221355_00687 | gene | open | 10966-12267 | secY | ||
| 1401 | CAMIKZ010000021.1 | GCA946221355_00688 | gene | open | 12618-13094 | rplO | ||
| 1402 | CAMIKZ010000021.1 | GCA946221355_00689 | gene | open | 13096-13302 | rpmD | ||
| 1403 | CAMIKZ010000021.1 | GCA946221355_00690 | gene | open | 13302-14009 | rpsE | ||
| 1404 | CAMIKZ010000021.1 | GCA946221355_00691 | gene | open | 14044-14424 | rplR | ||
| 1405 | CAMIKZ010000021.1 | GCA946221355_00692 | gene | open | 14427-14966 | rplF | ||
| 1406 | CAMIKZ010000021.1 | GCA946221355_00693 | gene | open | 14988-15386 | rpsH | ||
| 1407 | CAMIKZ010000021.1 | GCA946221355_00694 | gene | open | 15445-15630 | rpsN | ||
| 1408 | CAMIKZ010000021.1 | GCA946221355_00695 | gene | open | 15632-16189 | rplE | ||
| 1409 | CAMIKZ010000021.1 | GCA946221355_00696 | gene | open | 16192-16536 | rplX | ||
| 1410 | CAMIKZ010000021.1 | GCA946221355_00697 | gene | open | 16539-16907 | rplN | ||
| 1411 | CAMIKZ010000021.1 | GCA946221355_00698 | gene | open | 17476-17769 | rpsQ | ||
| 1412 | CAMIKZ010000021.1 | GCA946221355_00699 | gene | open | 17766-18011 | rpmC | ||
| 1413 | CAMIKZ010000021.1 | GCA946221355_00700 | gene | open | 18011-18430 | rplP | ||
| 1414 | CAMIKZ010000021.1 | GCA946221355_00701 | gene | open | 18434-19255 | rpsC | ||
| 1415 | CAMIKZ010000021.1 | GCA946221355_00702 | gene | open | 19255-19632 | rplV | ||
| 1416 | CAMIKZ010000021.1 | GCA946221355_00703 | gene | open | 19664-19942 | rpsS | ||
| 1417 | CAMIKZ010000021.1 | GCA946221355_00704 | gene | open | 19957-20793 | rplB | ||
| 1418 | CAMIKZ010000021.1 | GCA946221355_00705 | gene | open | 20820-21122 | rplW | ||
| 1419 | CAMIKZ010000021.1 | GCA946221355_00706 | gene | open | 21119-21763 | rplD | ||
| 1420 | CAMIKZ010000021.1 | GCA946221355_00707 | gene | open | 21768-22436 | rplC | ||
| 1421 | CAMIKZ010000021.1 | GCA946221355_00708 | gene | open | 22445-22753 | rpsJ | ||
| 1422 | CAMIKZ010000021.1 | GCA946221355_00709 | gene | open | 23012-24250 | |||
| 1423 | CAMIKZ010000021.1 | GCA946221355_00710 | gene | open | 24488-26095 | |||
| 1424 | CAMIKZ010000021.1 | GCA946221355_00711 | gene | open | 26246-29107 | |||
| 1425 | CAMIKZ010000022.1 | GCA946221355_00712 | CDS | open | 63-473 | _na 136_aa | hypothetical protein | |
| 1426 | CAMIKZ010000022.1 | GCA946221355_00713 | CDS | open | 1115-1552 | _na 145_aa | Bacterial SCP orthologue domain-containing protein | |
| 1427 | CAMIKZ010000022.1 | GCA946221355_00714 | CDS | open | 1687-3339 | _na 550_aa | RNB domain-containing protein | |
| 1428 | CAMIKZ010000022.1 | GCA946221355_00715 | CDS | open | 3353-3871 | _na 172_aa | tetR | Transcriptional regulator%2C TetR family |
| 1429 | CAMIKZ010000022.1 | GCA946221355_00716 | CDS | open | 3908-4774 | _na 288_aa | eamA | EamA domain-containing protein |
| 1430 | CAMIKZ010000022.1 | GCA946221355_00717 | CDS | open | 4845-6707 | _na 620_aa | purF | amidophosphoribosyltransferase |
| 1431 | CAMIKZ010000022.1 | GCA946221355_00718 | CDS | open | 6868-8022 | _na 384_aa | purM | Phosphoribosylformylglycinamidine cyclo-ligase |
| 1432 | CAMIKZ010000022.1 | GCA946221355_00719 | CDS | open | 8289-8492 | _na 67_aa | DUF3073 domain-containing protein | |
| 1433 | CAMIKZ010000022.1 | GCA946221355_00720 | CDS | open | 8933-11413 | _na 826_aa | DNA 3'-5' helicase | |
| 1434 | CAMIKZ010000022.1 | GCA946221355_00721 | CDS | open | 11415-17990 | _na 2191_aa | DEAD/DEAH box helicase | |
| 1435 | CAMIKZ010000022.1 | GCA946221355_00722 | CDS | open | 18212-18490 | _na 92_aa | Antitoxin | |
| 1436 | CAMIKZ010000022.1 | GCA946221355_00723 | CDS | open | 18852-19799 | _na 315_aa | dprA | DNA processing protein DprA |
| 1437 | CAMIKZ010000022.1 | GCA946221355_00724 | CDS | open | 19796-20530 | _na 244_aa | phosphoribosyltransferase | |
| 1438 | CAMIKZ010000022.1 | GCA946221355_00725 | CDS | open | 20728-20979 | _na 83_aa | Sigma-70%2C region 4 | |
| 1439 | CAMIKZ010000022.1 | GCA946221355_00726 | CDS | open | 21467-22852 | _na 461_aa | Divergent AAA domain protein | |
| 1440 | CAMIKZ010000022.1 | GCA946221355_00727 | CDS | open | 23022-27662 | _na 1546_aa | site-specific DNA-methyltransferase (adenine-specific) | |
| 1441 | CAMIKZ010000022.1 | GCA946221355_00712 | gene | open | 63-473 | |||
| 1442 | CAMIKZ010000022.1 | GCA946221355_00713 | gene | open | 1115-1552 | |||
| 1443 | CAMIKZ010000022.1 | GCA946221355_00714 | gene | open | 1687-3339 | |||
| 1444 | CAMIKZ010000022.1 | GCA946221355_00715 | gene | open | 3353-3871 | tetR | ||
| 1445 | CAMIKZ010000022.1 | GCA946221355_00716 | gene | open | 3908-4774 | eamA | ||
| 1446 | CAMIKZ010000022.1 | GCA946221355_00717 | gene | open | 4845-6707 | purF | ||
| 1447 | CAMIKZ010000022.1 | GCA946221355_00718 | gene | open | 6868-8022 | purM | ||
| 1448 | CAMIKZ010000022.1 | GCA946221355_00719 | gene | open | 8289-8492 | |||
| 1449 | CAMIKZ010000022.1 | GCA946221355_00720 | gene | open | 8933-11413 | |||
| 1450 | CAMIKZ010000022.1 | GCA946221355_00721 | gene | open | 11415-17990 | |||
| 1451 | CAMIKZ010000022.1 | GCA946221355_00722 | gene | open | 18212-18490 | |||
| 1452 | CAMIKZ010000022.1 | GCA946221355_00723 | gene | open | 18852-19799 | dprA | ||
| 1453 | CAMIKZ010000022.1 | GCA946221355_00724 | gene | open | 19796-20530 | |||
| 1454 | CAMIKZ010000022.1 | GCA946221355_00725 | gene | open | 20728-20979 | |||
| 1455 | CAMIKZ010000022.1 | GCA946221355_00726 | gene | open | 21467-22852 | |||
| 1456 | CAMIKZ010000022.1 | GCA946221355_00727 | gene | open | 23022-27662 | |||
| 1457 | CAMIKZ010000023.1 | GCA946221355_00728 | CDS | open | 692-2419 | _na 575_aa | formate--tetrahydrofolate ligase | |
| 1458 | CAMIKZ010000023.1 | GCA946221355_00729 | CDS | open | 2485-3879 | _na 464_aa | ugpB | ABC transporter substrate-binding protein |
| 1459 | CAMIKZ010000023.1 | GCA946221355_00730 | CDS | open | 3888-4841 | _na 317_aa | ugpE | ABC transporter%2C permease protein |
| 1460 | CAMIKZ010000023.1 | GCA946221355_00731 | CDS | open | 4855-5766 | _na 303_aa | ugpA | ABC transmembrane type-1 domain-containing protein |
| 1461 | CAMIKZ010000023.1 | GCA946221355_00732 | CDS | open | 5879-8059 | _na 726_aa | galA | alpha-galactosidase |
| 1462 | CAMIKZ010000023.1 | GCA946221355_00733 | CDS | open | 8250-9392 | _na 380_aa | ROK family transcriptional regulator | |
| 1463 | CAMIKZ010000023.1 | GCA946221355_00734 | CDS | open | 9491-11014 | _na 507_aa | FAD/NAD(P)-binding domain-containing protein | |
| 1464 | CAMIKZ010000023.1 | GCA946221355_00735 | CDS | open | 11019-11405 | _na 128_aa | gcvH | glycine cleavage system protein GcvH |
| 1465 | CAMIKZ010000023.1 | GCA946221355_00736 | CDS | open | 11451-12716 | _na 421_aa | gcvT | glycine cleavage system aminomethyltransferase GcvT |
| 1466 | CAMIKZ010000023.1 | GCA946221355_00737 | CDS | open | 12747-15668 | _na 973_aa | gcvP | aminomethyl-transferring glycine dehydrogenase |
| 1467 | CAMIKZ010000023.1 | GCA946221355_00738 | CDS | open | 15844-17505 | _na 553_aa | miaB | tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB |
| 1468 | CAMIKZ010000023.1 | GCA946221355_00739 | CDS | open | 17591-18061 | _na 156_aa | ybjN | YbjN domain-containing protein |
| 1469 | CAMIKZ010000023.1 | GCA946221355_00740 | CDS | open | 18382-18858 | _na 158_aa | ybjN | YbjN domain-containing protein |
| 1470 | CAMIKZ010000023.1 | GCA946221355_00741 | CDS | open | 18864-19859 | _na 331_aa | miaA | tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA |
| 1471 | CAMIKZ010000023.1 | GCA946221355_00742 | CDS | open | 19870-20820 | _na 316_aa | Diaminopimelate epimerase | |
| 1472 | CAMIKZ010000023.1 | GCA946221355_00743 | CDS | open | 20903-22306 | _na 467_aa | brnQ | branched-chain amino acid transport system II carrier protein |
| 1473 | CAMIKZ010000023.1 | GCA946221355_00744 | CDS | open | 22335-23843 | _na 502_aa | Major facilitator superfamily (MFS) profile domain-containing protein | |
| 1474 | CAMIKZ010000023.1 | GCA946221355_00745 | CDS | open | 23898-24536 | _na 212_aa | Methyltransferase small domain protein | |
| 1475 | CAMIKZ010000023.1 | GCA946221355_00746 | CDS | open | 24563-25936 | _na 457_aa | Major facilitator superfamily (MFS) profile domain-containing protein | |
| 1476 | CAMIKZ010000023.1 | GCA946221355_00728 | gene | open | 692-2419 | |||
| 1477 | CAMIKZ010000023.1 | GCA946221355_00729 | gene | open | 2485-3879 | ugpB | ||
| 1478 | CAMIKZ010000023.1 | GCA946221355_00730 | gene | open | 3888-4841 | ugpE | ||
| 1479 | CAMIKZ010000023.1 | GCA946221355_00731 | gene | open | 4855-5766 | ugpA | ||
| 1480 | CAMIKZ010000023.1 | GCA946221355_00732 | gene | open | 5879-8059 | galA | ||
| 1481 | CAMIKZ010000023.1 | GCA946221355_00733 | gene | open | 8250-9392 | |||
| 1482 | CAMIKZ010000023.1 | GCA946221355_00734 | gene | open | 9491-11014 | |||
| 1483 | CAMIKZ010000023.1 | GCA946221355_00735 | gene | open | 11019-11405 | gcvH | ||
| 1484 | CAMIKZ010000023.1 | GCA946221355_00736 | gene | open | 11451-12716 | gcvT | ||
| 1485 | CAMIKZ010000023.1 | GCA946221355_00737 | gene | open | 12747-15668 | gcvP | ||
| 1486 | CAMIKZ010000023.1 | GCA946221355_00738 | gene | open | 15844-17505 | miaB | ||
| 1487 | CAMIKZ010000023.1 | GCA946221355_00739 | gene | open | 17591-18061 | ybjN | ||
| 1488 | CAMIKZ010000023.1 | GCA946221355_00740 | gene | open | 18382-18858 | ybjN | ||
| 1489 | CAMIKZ010000023.1 | GCA946221355_00741 | gene | open | 18864-19859 | miaA | ||
| 1490 | CAMIKZ010000023.1 | GCA946221355_00742 | gene | open | 19870-20820 | |||
| 1491 | CAMIKZ010000023.1 | GCA946221355_00743 | gene | open | 20903-22306 | brnQ | ||
| 1492 | CAMIKZ010000023.1 | GCA946221355_00744 | gene | open | 22335-23843 | |||
| 1493 | CAMIKZ010000023.1 | GCA946221355_00745 | gene | open | 23898-24536 | |||
| 1494 | CAMIKZ010000023.1 | GCA946221355_00746 | gene | open | 24563-25936 | |||
| 1495 | CAMIKZ010000024.1 | GCA946221355_00747 | CDS | open | 933-1505 | _na 190_aa | soxR | HTH merR-type domain-containing protein |
| 1496 | CAMIKZ010000024.1 | GCA946221355_00748 | CDS | open | 1778-2254 | _na 158_aa | BFN domain-containing protein | |
| 1497 | CAMIKZ010000024.1 | GCA946221355_00749 | CDS | open | 2385-3035 | _na 216_aa | soxR | HTH merR-type domain-containing protein |
| 1498 | CAMIKZ010000024.1 | GCA946221355_00750 | CDS | open | 3146-3598 | _na 150_aa | fHA | FHA domain-containing protein |
| 1499 | CAMIKZ010000024.1 | GCA946221355_00751 | CDS | open | 3856-6555 | _na 899_aa | pepN | aminopeptidase N |
| 1500 | CAMIKZ010000024.1 | GCA946221355_00752 | CDS | open | 6637-8112 | _na 491_aa | gndA | NADP-dependent phosphogluconate dehydrogenase |

