BAKTAGenome Explorer: Actinomyces oris clade-893 (GCA_946221355.1)
Select a Genome:
|
BAKTA Annotations for GCA_946221355.1
|
Search & Sort all 5252 Records
| ||||||||||||||||||
Notes: 1- Column headers only sort the current page. 2- Select [NA] or [AA] links to show sequences.
| Region | Protein-ID | Type | Genome Viewer |
Range (bp) |
Show Sequences (length) NA / AA |
BAKTA Gene |
BAKTA GeneProduct |
|
|---|---|---|---|---|---|---|---|---|
| 2001 | CAMIKZ010000035.1 | GCA946221355_00992 | gene | open | 4664-5530 | |||
| 2002 | CAMIKZ010000035.1 | GCA946221355_00993 | gene | open | 5822-6313 | fluC | ||
| 2003 | CAMIKZ010000035.1 | GCA946221355_00994 | gene | open | 6310-7047 | crcB | ||
| 2004 | CAMIKZ010000035.1 | GCA946221355_00995 | gene | open | 7040-8770 | |||
| 2005 | CAMIKZ010000035.1 | GCA946221355_00996 | gene | open | 8851-10317 | ansP | ||
| 2006 | CAMIKZ010000035.1 | GCA946221355_00997 | gene | open | 10314-11180 | |||
| 2007 | CAMIKZ010000035.1 | GCA946221355_00998 | gene | open | 11405-12967 | araJ | ||
| 2008 | CAMIKZ010000035.1 | GCA946221355_00999 | gene | open | 13082-14929 | |||
| 2009 | CAMIKZ010000035.1 | GCA946221355_01000 | gene | open | 15204-15293 | |||
| 2010 | CAMIKZ010000035.1 | GCA946221355_01001 | gene | open | 15577-18555 | |||
| 2011 | CAMIKZ010000035.1 | GCA946221355_01002 | gene | open | 18714-19367 | |||
| 2012 | CAMIKZ010000035.1 | GCA946221355_01003 | gene | open | 19369-19770 | arsR | ||
| 2013 | CAMIKZ010000035.1 | GCA946221355_01004 | gene | open | 19976-20980 | |||
| 2014 | CAMIKZ010000035.1 | GCA946221355_01005 | gene | open | 21234-21950 | |||
| 2015 | CAMIKZ010000035.1 | GCA946221355_01006 | gene | open | 22158-22892 | |||
| 2016 | CAMIKZ010000036.1 | GCA946221355_01007 | CDS | open | 19-207 | _na 62_aa | hypothetical protein | |
| 2017 | CAMIKZ010000036.1 | GCA946221355_01008 | CDS | open | 292-1281 | _na 329_aa | galE | UDP-glucose 4-epimerase GalE |
| 2018 | CAMIKZ010000036.1 | GCA946221355_01009 | CDS | open | 1480-2484 | _na 334_aa | DNA-binding protein | |
| 2019 | CAMIKZ010000036.1 | GCA946221355_01010 | CDS | open | 2528-3079 | _na 183_aa | N5-carboxyaminoimidazole ribonucleotide mutase | |
| 2020 | CAMIKZ010000036.1 | GCA946221355_01011 | CDS | open | 3131-4426 | _na 431_aa | 5-(carboxyamino)imidazole ribonucleotide synthase | |
| 2021 | CAMIKZ010000036.1 | GCA946221355_01012 | CDS | open | 4493-5764 | _na 423_aa | Integral membrane protein | |
| 2022 | CAMIKZ010000036.1 | GCA946221355_01013 | CDS | open | 5814-6368 | _na 184_aa | GtrA/DPMS transmembrane domain-containing protein | |
| 2023 | CAMIKZ010000036.1 | GCA946221355_01014 | CDS | open | 6480-7211 | _na 243_aa | VTT domain-containing protein | |
| 2024 | CAMIKZ010000036.1 | GCA946221355_01015 | CDS | open | 7257-8333 | _na 358_aa | baeS | Signal transduction histidine-protein kinase/phosphatase MprB |
| 2025 | CAMIKZ010000036.1 | GCA946221355_01016 | CDS | open | 8420-9091 | _na 223_aa | ompR | DNA-binding response regulator |
| 2026 | CAMIKZ010000036.1 | GCA946221355_01017 | CDS | open | 9309-10457 | _na 382_aa | acyC | Guanylate cyclase domain-containing protein |
| 2027 | CAMIKZ010000036.1 | GCA946221355_01018 | CDS | open | 10547-11464 | _na 305_aa | BPL/LPL catalytic domain-containing protein | |
| 2028 | CAMIKZ010000036.1 | GCA946221355_01019 | CDS | open | 11568-12164 | _na 198_aa | Nucleoside triphosphate pyrophosphatase | |
| 2029 | CAMIKZ010000036.1 | GCA946221355_01020 | CDS | open | 12178-12849 | _na 223_aa | marR | MarR family transcriptional regulator |
| 2030 | CAMIKZ010000036.1 | GCA946221355_01021 | CDS | open | 13550-14326 | _na 258_aa | hypothetical protein | |
| 2031 | CAMIKZ010000036.1 | GCA946221355_01022 | CDS | open | 14265-14435 | _na 56_aa | rpmG | 50S ribosomal protein L33 |
| 2032 | CAMIKZ010000036.1 | GCA946221355_01026 | CDS | open | 15032-15529 | _na 165_aa | yajQ | YajQ family cyclic di-GMP-binding protein |
| 2033 | CAMIKZ010000036.1 | GCA946221355_01027 | CDS | open | 15550-16194 | _na 214_aa | citB | DNA-binding response regulator |
| 2034 | CAMIKZ010000036.1 | GCA946221355_01028 | CDS | open | 16182-17447 | _na 421_aa | comP | histidine kinase |
| 2035 | CAMIKZ010000036.1 | GCA946221355_01029 | CDS | open | 17544-18566 | _na 340_aa | Aminoglycoside phosphotransferase domain-containing protein | |
| 2036 | CAMIKZ010000036.1 | GCA946221355_01030 | CDS | open | 18563-19105 | _na 180_aa | AAA family ATPase | |
| 2037 | CAMIKZ010000036.1 | GCA946221355_01031 | CDS | open | 19110-19979 | _na 289_aa | htpX | zinc metalloprotease HtpX |
| 2038 | CAMIKZ010000036.1 | GCA946221355_01032 | CDS | open | 20013-20597 | _na 194_aa | N-acetyltransferase domain-containing protein | |
| 2039 | CAMIKZ010000036.1 | GCA946221355_01033 | CDS | open | 20712-21692 | _na 326_aa | ferredoxin--NADP(+) reductase | |
| 2040 | CAMIKZ010000036.1 | GCA946221355_01007 | gene | open | 19-207 | |||
| 2041 | CAMIKZ010000036.1 | GCA946221355_01008 | gene | open | 292-1281 | galE | ||
| 2042 | CAMIKZ010000036.1 | GCA946221355_01009 | gene | open | 1480-2484 | |||
| 2043 | CAMIKZ010000036.1 | GCA946221355_01010 | gene | open | 2528-3079 | |||
| 2044 | CAMIKZ010000036.1 | GCA946221355_01011 | gene | open | 3131-4426 | |||
| 2045 | CAMIKZ010000036.1 | GCA946221355_01012 | gene | open | 4493-5764 | |||
| 2046 | CAMIKZ010000036.1 | GCA946221355_01013 | gene | open | 5814-6368 | |||
| 2047 | CAMIKZ010000036.1 | GCA946221355_01014 | gene | open | 6480-7211 | |||
| 2048 | CAMIKZ010000036.1 | GCA946221355_01015 | gene | open | 7257-8333 | baeS | ||
| 2049 | CAMIKZ010000036.1 | GCA946221355_01016 | gene | open | 8420-9091 | ompR | ||
| 2050 | CAMIKZ010000036.1 | GCA946221355_01017 | gene | open | 9309-10457 | acyC | ||
| 2051 | CAMIKZ010000036.1 | GCA946221355_01018 | gene | open | 10547-11464 | |||
| 2052 | CAMIKZ010000036.1 | GCA946221355_01019 | gene | open | 11568-12164 | |||
| 2053 | CAMIKZ010000036.1 | GCA946221355_01020 | gene | open | 12178-12849 | marR | ||
| 2054 | CAMIKZ010000036.1 | GCA946221355_01021 | gene | open | 13550-14326 | |||
| 2055 | CAMIKZ010000036.1 | GCA946221355_01022 | gene | open | 14265-14435 | rpmG | ||
| 2056 | CAMIKZ010000036.1 | GCA946221355_01026 | gene | open | 15032-15529 | yajQ | ||
| 2057 | CAMIKZ010000036.1 | GCA946221355_01027 | gene | open | 15550-16194 | citB | ||
| 2058 | CAMIKZ010000036.1 | GCA946221355_01028 | gene | open | 16182-17447 | comP | ||
| 2059 | CAMIKZ010000036.1 | GCA946221355_01029 | gene | open | 17544-18566 | |||
| 2060 | CAMIKZ010000036.1 | GCA946221355_01030 | gene | open | 18563-19105 | |||
| 2061 | CAMIKZ010000036.1 | GCA946221355_01031 | gene | open | 19110-19979 | htpX | ||
| 2062 | CAMIKZ010000036.1 | GCA946221355_01032 | gene | open | 20013-20597 | |||
| 2063 | CAMIKZ010000036.1 | GCA946221355_01033 | gene | open | 20712-21692 | |||
| 2064 | CAMIKZ010000036.1 | GCA946221355_01023 | gene | open | 14496-14569 | trnM | ||
| 2065 | CAMIKZ010000036.1 | GCA946221355_01024 | gene | open | 14608-14680 | trnT | ||
| 2066 | CAMIKZ010000036.1 | GCA946221355_01025 | gene | open | 14791-14872 | trnY | ||
| 2067 | CAMIKZ010000036.1 | GCA946221355_01023 | tRNA | open | 14496-14569 | trnM | tRNA-Met(cat) | |
| 2068 | CAMIKZ010000036.1 | GCA946221355_01024 | tRNA | open | 14608-14680 | trnT | tRNA-Thr(ggt) | |
| 2069 | CAMIKZ010000036.1 | GCA946221355_01025 | tRNA | open | 14791-14872 | trnY | tRNA-Tyr(gta) | |
| 2070 | CAMIKZ010000037.1 | GCA946221355_01034 | CDS | open | 255-1715 | _na 486_aa | ferrochelatase | |
| 2071 | CAMIKZ010000037.1 | GCA946221355_01035 | CDS | open | 1708-3204 | _na 498_aa | glutamyl-tRNA reductase | |
| 2072 | CAMIKZ010000037.1 | GCA946221355_01036 | CDS | open | 3395-4747 | _na 450_aa | uroporphyrinogen decarboxylase | |
| 2073 | CAMIKZ010000037.1 | GCA946221355_01037 | CDS | open | 4744-6423 | _na 559_aa | Putative protoporphyrinogen oxidase | |
| 2074 | CAMIKZ010000037.1 | GCA946221355_01038 | CDS | open | 6553-7905 | _na 450_aa | hemC | hydroxymethylbilane synthase |
| 2075 | CAMIKZ010000037.1 | GCA946221355_01039 | CDS | open | 7910-9055 | _na 381_aa | Uroporphyrinogen-III synthase | |
| 2076 | CAMIKZ010000037.1 | GCA946221355_01040 | CDS | open | 9364-10413 | _na 349_aa | hemB | porphobilinogen synthase |
| 2077 | CAMIKZ010000037.1 | GCA946221355_01041 | CDS | open | 10522-11970 | _na 482_aa | hemL | glutamate-1-semialdehyde 2%2C1-aminomutase |
| 2078 | CAMIKZ010000037.1 | GCA946221355_01042 | CDS | open | 12039-12980 | _na 313_aa | Protein-ADP-ribose hydrolase | |
| 2079 | CAMIKZ010000037.1 | GCA946221355_01043 | CDS | open | 13119-13499 | _na 126_aa | cnoX | Thioredoxin |
| 2080 | CAMIKZ010000037.1 | GCA946221355_01044 | CDS | open | 13924-14832 | _na 302_aa | Lipoprotein | |
| 2081 | CAMIKZ010000037.1 | GCA946221355_01045 | CDS | open | 15148-16338 | _na 396_aa | Fido domain-containing protein | |
| 2082 | CAMIKZ010000037.1 | GCA946221355_01046 | CDS | open | 17282-17569 | _na 95_aa | hypothetical protein | |
| 2083 | CAMIKZ010000037.1 | GCA946221355_01047 | CDS | open | 17562-18356 | _na 264_aa | Lipoprotein | |
| 2084 | CAMIKZ010000037.1 | GCA946221355_01048 | CDS | open | 18399-19151 | _na 250_aa | Putative voltage-gated potassium channel | |
| 2085 | CAMIKZ010000037.1 | GCA946221355_01049 | CDS | open | 19312-19626 | _na 104_aa | relE | Addiction module toxin RelE |
| 2086 | CAMIKZ010000037.1 | GCA946221355_01050 | CDS | open | 19636-19908 | _na 90_aa | copG | CopG family transcriptional regulator |
| 2087 | CAMIKZ010000037.1 | GCA946221355_01051 | CDS | open | 20076-21155 | _na 359_aa | asd | aspartate-semialdehyde dehydrogenase |
| 2088 | CAMIKZ010000037.1 | GCA946221355_01034 | gene | open | 255-1715 | |||
| 2089 | CAMIKZ010000037.1 | GCA946221355_01035 | gene | open | 1708-3204 | |||
| 2090 | CAMIKZ010000037.1 | GCA946221355_01036 | gene | open | 3395-4747 | |||
| 2091 | CAMIKZ010000037.1 | GCA946221355_01037 | gene | open | 4744-6423 | |||
| 2092 | CAMIKZ010000037.1 | GCA946221355_01038 | gene | open | 6553-7905 | hemC | ||
| 2093 | CAMIKZ010000037.1 | GCA946221355_01039 | gene | open | 7910-9055 | |||
| 2094 | CAMIKZ010000037.1 | GCA946221355_01040 | gene | open | 9364-10413 | hemB | ||
| 2095 | CAMIKZ010000037.1 | GCA946221355_01041 | gene | open | 10522-11970 | hemL | ||
| 2096 | CAMIKZ010000037.1 | GCA946221355_01042 | gene | open | 12039-12980 | |||
| 2097 | CAMIKZ010000037.1 | GCA946221355_01043 | gene | open | 13119-13499 | cnoX | ||
| 2098 | CAMIKZ010000037.1 | GCA946221355_01044 | gene | open | 13924-14832 | |||
| 2099 | CAMIKZ010000037.1 | GCA946221355_01045 | gene | open | 15148-16338 | |||
| 2100 | CAMIKZ010000037.1 | GCA946221355_01046 | gene | open | 17282-17569 | |||
| 2101 | CAMIKZ010000037.1 | GCA946221355_01047 | gene | open | 17562-18356 | |||
| 2102 | CAMIKZ010000037.1 | GCA946221355_01048 | gene | open | 18399-19151 | |||
| 2103 | CAMIKZ010000037.1 | GCA946221355_01049 | gene | open | 19312-19626 | relE | ||
| 2104 | CAMIKZ010000037.1 | GCA946221355_01050 | gene | open | 19636-19908 | copG | ||
| 2105 | CAMIKZ010000037.1 | GCA946221355_01051 | gene | open | 20076-21155 | asd | ||
| 2106 | CAMIKZ010000038.1 | GCA946221355_01052 | CDS | open | 612-2051 | _na 479_aa | pafA | Pup--protein ligase |
| 2107 | CAMIKZ010000038.1 | GCA946221355_01053 | CDS | open | 2054-2266 | _na 70_aa | Prokaryotic ubiquitin-like protein Pup | |
| 2108 | CAMIKZ010000038.1 | GCA946221355_01054 | CDS | open | 2326-4005 | _na 559_aa | dop | depupylase/deamidase Dop |
| 2109 | CAMIKZ010000038.1 | GCA946221355_01055 | CDS | open | 4002-5723 | _na 573_aa | arc | proteasome ATPase |
| 2110 | CAMIKZ010000038.1 | GCA946221355_01056 | CDS | open | 5716-6807 | _na 363_aa | tRNA (adenine(58)-N(1))-methyltransferase catalytic subunit TRM61 C-terminal domain-containing protein | |
| 2111 | CAMIKZ010000038.1 | GCA946221355_01057 | CDS | open | 6837-7631 | _na 264_aa | cFP29 | family 1 encapsulin nanocompartment shell protein |
| 2112 | CAMIKZ010000038.1 | GCA946221355_01058 | CDS | open | 7628-8812 | _na 394_aa | efeB | Dyp-type peroxidase |
| 2113 | CAMIKZ010000038.1 | GCA946221355_01059 | CDS | open | 8927-10048 | _na 373_aa | Peptidase M50 domain-containing protein | |
| 2114 | CAMIKZ010000038.1 | GCA946221355_01060 | CDS | open | 10348-11133 | _na 261_aa | recB | Recombinase RecB |
| 2115 | CAMIKZ010000038.1 | GCA946221355_01061 | CDS | open | 11520-12605 | _na 361_aa | YeeE/YedE family protein | |
| 2116 | CAMIKZ010000038.1 | GCA946221355_01062 | CDS | open | 12685-12906 | _na 73_aa | tusA | UPF0033 domain-containing protein |
| 2117 | CAMIKZ010000038.1 | GCA946221355_01063 | CDS | open | 12930-13910 | _na 326_aa | pdxI | NADP-dependent oxidoreductase domain-containing protein |
| 2118 | CAMIKZ010000038.1 | GCA946221355_01064 | CDS | open | 13950-14708 | _na 252_aa | Iron ABC transporter ATP-binding protein | |
| 2119 | CAMIKZ010000038.1 | GCA946221355_01065 | CDS | open | 14705-15688 | _na 327_aa | Iron chelate uptake ABC transporter%2C FeCT family%2C permease protein | |
| 2120 | CAMIKZ010000038.1 | GCA946221355_01066 | CDS | open | 15681-16703 | _na 340_aa | Iron ABC transporter permease | |
| 2121 | CAMIKZ010000038.1 | GCA946221355_01067 | CDS | open | 16700-17791 | _na 363_aa | Fe/B12 periplasmic-binding domain-containing protein | |
| 2122 | CAMIKZ010000038.1 | GCA946221355_01068 | CDS | open | 17980-18306 | _na 108_aa | DNA primase | |
| 2123 | CAMIKZ010000038.1 | GCA946221355_01069 | CDS | open | 18378-19478 | _na 366_aa | ndh | Mercuric reductase |
| 2124 | CAMIKZ010000038.1 | GCA946221355_01070 | CDS | open | 19527-20885 | _na 452_aa | Zn-dependent oligopeptidase | |
| 2125 | CAMIKZ010000038.1 | GCA946221355_01052 | gene | open | 612-2051 | pafA | ||
| 2126 | CAMIKZ010000038.1 | GCA946221355_01053 | gene | open | 2054-2266 | |||
| 2127 | CAMIKZ010000038.1 | GCA946221355_01054 | gene | open | 2326-4005 | dop | ||
| 2128 | CAMIKZ010000038.1 | GCA946221355_01055 | gene | open | 4002-5723 | arc | ||
| 2129 | CAMIKZ010000038.1 | GCA946221355_01056 | gene | open | 5716-6807 | |||
| 2130 | CAMIKZ010000038.1 | GCA946221355_01057 | gene | open | 6837-7631 | cFP29 | ||
| 2131 | CAMIKZ010000038.1 | GCA946221355_01058 | gene | open | 7628-8812 | efeB | ||
| 2132 | CAMIKZ010000038.1 | GCA946221355_01059 | gene | open | 8927-10048 | |||
| 2133 | CAMIKZ010000038.1 | GCA946221355_01060 | gene | open | 10348-11133 | recB | ||
| 2134 | CAMIKZ010000038.1 | GCA946221355_01061 | gene | open | 11520-12605 | |||
| 2135 | CAMIKZ010000038.1 | GCA946221355_01062 | gene | open | 12685-12906 | tusA | ||
| 2136 | CAMIKZ010000038.1 | GCA946221355_01063 | gene | open | 12930-13910 | pdxI | ||
| 2137 | CAMIKZ010000038.1 | GCA946221355_01064 | gene | open | 13950-14708 | |||
| 2138 | CAMIKZ010000038.1 | GCA946221355_01065 | gene | open | 14705-15688 | |||
| 2139 | CAMIKZ010000038.1 | GCA946221355_01066 | gene | open | 15681-16703 | |||
| 2140 | CAMIKZ010000038.1 | GCA946221355_01067 | gene | open | 16700-17791 | |||
| 2141 | CAMIKZ010000038.1 | GCA946221355_01068 | gene | open | 17980-18306 | |||
| 2142 | CAMIKZ010000038.1 | GCA946221355_01069 | gene | open | 18378-19478 | ndh | ||
| 2143 | CAMIKZ010000038.1 | GCA946221355_01070 | gene | open | 19527-20885 | |||
| 2144 | CAMIKZ010000039.1 | GCA946221355_01071 | CDS | open | 478-2574 | _na 698_aa | uvrB | excinuclease ABC subunit UvrB |
| 2145 | CAMIKZ010000039.1 | GCA946221355_01072 | CDS | open | 2824-2913 | _na 29_aa | hypothetical protein | |
| 2146 | CAMIKZ010000039.1 | GCA946221355_01073 | CDS | open | 2929-3618 | _na 229_aa | Transcriptional initiation protein Tat | |
| 2147 | CAMIKZ010000039.1 | GCA946221355_01074 | CDS | open | 3737-4330 | _na 197_aa | coaE | dephospho-CoA kinase |
| 2148 | CAMIKZ010000039.1 | GCA946221355_01075 | CDS | open | 4487-6232 | _na 581_aa | Tetratricopeptide repeat protein | |
| 2149 | CAMIKZ010000039.1 | GCA946221355_01076 | CDS | open | 6434-7888 | _na 484_aa | rpsA | 30S ribosomal protein S1 |
| 2150 | CAMIKZ010000039.1 | GCA946221355_01077 | CDS | open | 8200-10944 | _na 914_aa | polA | DNA polymerase I |
| 2151 | CAMIKZ010000039.1 | GCA946221355_01078 | CDS | open | 11058-11696 | _na 212_aa | Thioesterase domain-containing protein | |
| 2152 | CAMIKZ010000039.1 | GCA946221355_01079 | CDS | open | 11730-12338 | _na 202_aa | amiR | Response regulator |
| 2153 | CAMIKZ010000039.1 | GCA946221355_01081 | CDS | open | 12511-12921 | _na 136_aa | cdd | CMP/dCMP-type deaminase domain-containing protein |
| 2154 | CAMIKZ010000039.1 | GCA946221355_01082 | CDS | open | 13069-14499 | _na 476_aa | pyk | pyruvate kinase |
| 2155 | CAMIKZ010000039.1 | GCA946221355_01083 | CDS | open | 14622-15629 | _na 335_aa | lgt | prolipoprotein diacylglyceryl transferase |
| 2156 | CAMIKZ010000039.1 | GCA946221355_01084 | CDS | open | 15666-16490 | _na 274_aa | trpC | indole-3-glycerol-phosphate synthase |
| 2157 | CAMIKZ010000039.1 | GCA946221355_01085 | CDS | open | 16606-16872 | _na 88_aa | phosphoribosyl-AMP cyclohydrolase | |
| 2158 | CAMIKZ010000039.1 | GCA946221355_01086 | CDS | open | 16996-17232 | _na 78_aa | hypothetical protein | |
| 2159 | CAMIKZ010000039.1 | GCA946221355_01087 | CDS | open | 17484-17885 | _na 133_aa | DUF4190 domain-containing protein | |
| 2160 | CAMIKZ010000039.1 | GCA946221355_01088 | CDS | open | 18263-18598 | _na 111_aa | DUF4190 domain-containing protein | |
| 2161 | CAMIKZ010000039.1 | GCA946221355_01089 | CDS | open | 19137-19907 | _na 256_aa | hisF | Imidazole glycerol phosphate synthase subunit HisF |
| 2162 | CAMIKZ010000039.1 | GCA946221355_01090 | CDS | open | 19904-20800 | _na 298_aa | hypothetical protein | |
| 2163 | CAMIKZ010000039.1 | GCA946221355_01071 | gene | open | 478-2574 | uvrB | ||
| 2164 | CAMIKZ010000039.1 | GCA946221355_01072 | gene | open | 2824-2913 | |||
| 2165 | CAMIKZ010000039.1 | GCA946221355_01073 | gene | open | 2929-3618 | |||
| 2166 | CAMIKZ010000039.1 | GCA946221355_01074 | gene | open | 3737-4330 | coaE | ||
| 2167 | CAMIKZ010000039.1 | GCA946221355_01075 | gene | open | 4487-6232 | |||
| 2168 | CAMIKZ010000039.1 | GCA946221355_01076 | gene | open | 6434-7888 | rpsA | ||
| 2169 | CAMIKZ010000039.1 | GCA946221355_01077 | gene | open | 8200-10944 | polA | ||
| 2170 | CAMIKZ010000039.1 | GCA946221355_01078 | gene | open | 11058-11696 | |||
| 2171 | CAMIKZ010000039.1 | GCA946221355_01079 | gene | open | 11730-12338 | amiR | ||
| 2172 | CAMIKZ010000039.1 | GCA946221355_01081 | gene | open | 12511-12921 | cdd | ||
| 2173 | CAMIKZ010000039.1 | GCA946221355_01082 | gene | open | 13069-14499 | pyk | ||
| 2174 | CAMIKZ010000039.1 | GCA946221355_01083 | gene | open | 14622-15629 | lgt | ||
| 2175 | CAMIKZ010000039.1 | GCA946221355_01084 | gene | open | 15666-16490 | trpC | ||
| 2176 | CAMIKZ010000039.1 | GCA946221355_01085 | gene | open | 16606-16872 | |||
| 2177 | CAMIKZ010000039.1 | GCA946221355_01086 | gene | open | 16996-17232 | |||
| 2178 | CAMIKZ010000039.1 | GCA946221355_01087 | gene | open | 17484-17885 | |||
| 2179 | CAMIKZ010000039.1 | GCA946221355_01088 | gene | open | 18263-18598 | |||
| 2180 | CAMIKZ010000039.1 | GCA946221355_01089 | gene | open | 19137-19907 | hisF | ||
| 2181 | CAMIKZ010000039.1 | GCA946221355_01090 | gene | open | 19904-20800 | |||
| 2182 | CAMIKZ010000039.1 | GCA946221355_01080 | gene | open | 12393-12469 | trnL | ||
| 2183 | CAMIKZ010000039.1 | GCA946221355_01080 | tRNA | open | 12393-12469 | trnL | tRNA-Leu(caa) | |
| 2184 | CAMIKZ010000040.1 | repeat_region | open | 10152-10709 | CRISPR array with 9 repeats of length 36%2C consensus sequence GCTGGGATTCAGTCACCAGACCCCTTGATAGACTTC and spacer length 28 | |||
| 2185 | CAMIKZ010000040.1 | GCA946221355_01091 | CDS | open | 7-417 | _na 136_aa | hypothetical protein | |
| 2186 | CAMIKZ010000040.1 | GCA946221355_01092 | CDS | open | 553-1116 | _na 187_aa | hypothetical protein | |
| 2187 | CAMIKZ010000040.1 | GCA946221355_01093 | CDS | open | 1149-2021 | _na 290_aa | Tat pathway signal sequence | |
| 2188 | CAMIKZ010000040.1 | GCA946221355_01094 | CDS | open | 2096-3040 | _na 314_aa | Putative lipoprotein | |
| 2189 | CAMIKZ010000040.1 | GCA946221355_01095 | CDS | open | 3162-3764 | _na 200_aa | DUF1269 domain-containing protein | |
| 2190 | CAMIKZ010000040.1 | GCA946221355_01096 | CDS | open | 3939-4913 | _na 324_aa | nrdF | class 1b ribonucleoside-diphosphate reductase subunit beta |
| 2191 | CAMIKZ010000040.1 | GCA946221355_01097 | CDS | open | 4964-5491 | _na 175_aa | hypothetical protein | |
| 2192 | CAMIKZ010000040.1 | GCA946221355_01098 | CDS | open | 5505-5933 | _na 142_aa | helix-turn-helix domain-containing protein | |
| 2193 | CAMIKZ010000040.1 | GCA946221355_01099 | CDS | open | 5930-6379 | _na 149_aa | secB | Preprotein translocase subunit SecB |
| 2194 | CAMIKZ010000040.1 | GCA946221355_01100 | CDS | open | 6611-7330 | _na 239_aa | Conserved domain protein | |
| 2195 | CAMIKZ010000040.1 | GCA946221355_01101 | CDS | open | 7499-8914 | _na 471_aa | LssY-like C-terminal domain-containing protein | |
| 2196 | CAMIKZ010000040.1 | GCA946221355_01102 | CDS | open | 8911-9768 | _na 285_aa | Suppressor of fused protein (SUFU) | |
| 2197 | CAMIKZ010000040.1 | GCA946221355_01103 | CDS | open | 10749-11069 | _na 106_aa | cas2 | CRISPR-associated endonuclease Cas2 |
| 2198 | CAMIKZ010000040.1 | GCA946221355_01104 | CDS | open | 11069-11977 | _na 302_aa | cas1 | type II CRISPR-associated endonuclease Cas1 |
| 2199 | CAMIKZ010000040.1 | GCA946221355_01105 | CDS | open | 11987-15274 | _na 1095_aa | cas9 | type II CRISPR RNA-guided endonuclease Cas9 |
| 2200 | CAMIKZ010000040.1 | GCA946221355_01106 | CDS | open | 15725-16657 | _na 310_aa | efeU | iron uptake transporter permease EfeU |
| 2201 | CAMIKZ010000040.1 | GCA946221355_01107 | CDS | open | 16714-18042 | _na 442_aa | efeO | iron uptake system protein EfeO |
| 2202 | CAMIKZ010000040.1 | GCA946221355_01108 | CDS | open | 18088-19635 | _na 515_aa | efeB | iron uptake transporter deferrochelatase/peroxidase subunit |
| 2203 | CAMIKZ010000040.1 | GCA946221355_01109 | CDS | open | 19827-20645 | _na 272_aa | MFS transporter | |
| 2204 | CAMIKZ010000040.1 | GCA946221355_01091 | gene | open | 7-417 | |||
| 2205 | CAMIKZ010000040.1 | GCA946221355_01092 | gene | open | 553-1116 | |||
| 2206 | CAMIKZ010000040.1 | GCA946221355_01093 | gene | open | 1149-2021 | |||
| 2207 | CAMIKZ010000040.1 | GCA946221355_01094 | gene | open | 2096-3040 | |||
| 2208 | CAMIKZ010000040.1 | GCA946221355_01095 | gene | open | 3162-3764 | |||
| 2209 | CAMIKZ010000040.1 | GCA946221355_01096 | gene | open | 3939-4913 | nrdF | ||
| 2210 | CAMIKZ010000040.1 | GCA946221355_01097 | gene | open | 4964-5491 | |||
| 2211 | CAMIKZ010000040.1 | GCA946221355_01098 | gene | open | 5505-5933 | |||
| 2212 | CAMIKZ010000040.1 | GCA946221355_01099 | gene | open | 5930-6379 | secB | ||
| 2213 | CAMIKZ010000040.1 | GCA946221355_01100 | gene | open | 6611-7330 | |||
| 2214 | CAMIKZ010000040.1 | GCA946221355_01101 | gene | open | 7499-8914 | |||
| 2215 | CAMIKZ010000040.1 | GCA946221355_01102 | gene | open | 8911-9768 | |||
| 2216 | CAMIKZ010000040.1 | GCA946221355_01103 | gene | open | 10749-11069 | cas2 | ||
| 2217 | CAMIKZ010000040.1 | GCA946221355_01104 | gene | open | 11069-11977 | cas1 | ||
| 2218 | CAMIKZ010000040.1 | GCA946221355_01105 | gene | open | 11987-15274 | cas9 | ||
| 2219 | CAMIKZ010000040.1 | GCA946221355_01106 | gene | open | 15725-16657 | efeU | ||
| 2220 | CAMIKZ010000040.1 | GCA946221355_01107 | gene | open | 16714-18042 | efeO | ||
| 2221 | CAMIKZ010000040.1 | GCA946221355_01108 | gene | open | 18088-19635 | efeB | ||
| 2222 | CAMIKZ010000040.1 | GCA946221355_01109 | gene | open | 19827-20645 | |||
| 2223 | CAMIKZ010000041.1 | GCA946221355_01110 | CDS | open | 78-1133 | _na 351_aa | Iron ABC transporter permease | |
| 2224 | CAMIKZ010000041.1 | GCA946221355_01111 | CDS | open | 1130-2380 | _na 416_aa | ABC transporter domain-containing protein | |
| 2225 | CAMIKZ010000041.1 | GCA946221355_01112 | CDS | open | 2593-3648 | _na 351_aa | ABC transmembrane type-1 domain-containing protein | |
| 2226 | CAMIKZ010000041.1 | GCA946221355_01113 | CDS | open | 3645-4631 | _na 328_aa | dppB | Dipeptide transport system permease protein dppB |
| 2227 | CAMIKZ010000041.1 | GCA946221355_01114 | CDS | open | 4737-6413 | _na 558_aa | Solute-binding protein family 5 domain-containing protein | |
| 2228 | CAMIKZ010000041.1 | GCA946221355_01115 | CDS | open | 6410-8395 | _na 661_aa | nikD | nickel import ATP-binding protein NikD |
| 2229 | CAMIKZ010000041.1 | GCA946221355_01116 | CDS | open | 8700-12371 | _na 1223_aa | DUF4011 domain-containing protein | |
| 2230 | CAMIKZ010000041.1 | GCA946221355_01117 | CDS | open | 12897-13952 | _na 351_aa | Zinc ribbon domain-containing protein | |
| 2231 | CAMIKZ010000041.1 | GCA946221355_01118 | CDS | open | 14114-14605 | _na 163_aa | Chemotaxis protein | |
| 2232 | CAMIKZ010000041.1 | GCA946221355_01119 | CDS | open | 14729-15169 | _na 146_aa | ybjN | YbjN domain-containing protein |
| 2233 | CAMIKZ010000041.1 | GCA946221355_01120 | CDS | open | 15169-16008 | _na 279_aa | Bacterial sensory transduction regulator | |
| 2234 | CAMIKZ010000041.1 | GCA946221355_01121 | CDS | open | 16399-19434 | _na 1011_aa | MalT-like TPR region domain-containing protein | |
| 2235 | CAMIKZ010000041.1 | GCA946221355_01122 | CDS | open | 20159-20308 | _na 49_aa | hypothetical protein | |
| 2236 | CAMIKZ010000041.1 | GCA946221355_01110 | gene | open | 78-1133 | |||
| 2237 | CAMIKZ010000041.1 | GCA946221355_01111 | gene | open | 1130-2380 | |||
| 2238 | CAMIKZ010000041.1 | GCA946221355_01112 | gene | open | 2593-3648 | |||
| 2239 | CAMIKZ010000041.1 | GCA946221355_01113 | gene | open | 3645-4631 | dppB | ||
| 2240 | CAMIKZ010000041.1 | GCA946221355_01114 | gene | open | 4737-6413 | |||
| 2241 | CAMIKZ010000041.1 | GCA946221355_01115 | gene | open | 6410-8395 | nikD | ||
| 2242 | CAMIKZ010000041.1 | GCA946221355_01116 | gene | open | 8700-12371 | |||
| 2243 | CAMIKZ010000041.1 | GCA946221355_01117 | gene | open | 12897-13952 | |||
| 2244 | CAMIKZ010000041.1 | GCA946221355_01118 | gene | open | 14114-14605 | |||
| 2245 | CAMIKZ010000041.1 | GCA946221355_01119 | gene | open | 14729-15169 | ybjN | ||
| 2246 | CAMIKZ010000041.1 | GCA946221355_01120 | gene | open | 15169-16008 | |||
| 2247 | CAMIKZ010000041.1 | GCA946221355_01121 | gene | open | 16399-19434 | |||
| 2248 | CAMIKZ010000041.1 | GCA946221355_01122 | gene | open | 20159-20308 | |||
| 2249 | CAMIKZ010000042.1 | GCA946221355_01123 | CDS | open | 33-284 | _na 83_aa | hypothetical protein | |
| 2250 | CAMIKZ010000042.1 | GCA946221355_01124 | CDS | open | 308-1909 | _na 533_aa | hscA | Chaperone HscA |
| 2251 | CAMIKZ010000042.1 | GCA946221355_01125 | CDS | open | 2218-3456 | _na 412_aa | pitA | Phosphate transporter |
| 2252 | CAMIKZ010000042.1 | GCA946221355_01126 | CDS | open | 3453-3698 | _na 81_aa | DUF4190 domain-containing protein | |
| 2253 | CAMIKZ010000042.1 | GCA946221355_01127 | CDS | open | 3742-5274 | _na 510_aa | beta-fructofuranosidase | |
| 2254 | CAMIKZ010000042.1 | GCA946221355_01128 | CDS | open | 5507-7558 | _na 683_aa | nagE | protein-N(pi)-phosphohistidine--sucrose phosphotransferase |
| 2255 | CAMIKZ010000042.1 | GCA946221355_01129 | CDS | open | 7642-8673 | _na 343_aa | purR | HTH lacI-type domain-containing protein |
| 2256 | CAMIKZ010000042.1 | GCA946221355_01130 | CDS | open | 8785-9297 | _na 170_aa | GDSL family lipase | |
| 2257 | CAMIKZ010000042.1 | GCA946221355_01131 | CDS | open | 9453-10202 | _na 249_aa | hrtA | Putative hemin import ATP-binding protein HrtA |
| 2258 | CAMIKZ010000042.1 | GCA946221355_01132 | CDS | open | 10199-11311 | _na 370_aa | ABC3 transporter permease C-terminal domain-containing protein | |
| 2259 | CAMIKZ010000042.1 | GCA946221355_01133 | CDS | open | 11529-14021 | _na 830_aa | UvrABC system protein A | |
| 2260 | CAMIKZ010000042.1 | GCA946221355_01134 | CDS | open | 14008-15291 | _na 427_aa | GNAT family N-acetyltransferase | |
| 2261 | CAMIKZ010000042.1 | GCA946221355_01135 | CDS | open | 15314-16435 | _na 373_aa | pfkA | ATP-dependent 6-phosphofructokinase |
| 2262 | CAMIKZ010000042.1 | GCA946221355_01136 | CDS | open | 16659-17018 | _na 119_aa | rbpA | RNA polymerase-binding protein RbpA |
| 2263 | CAMIKZ010000042.1 | GCA946221355_01137 | CDS | open | 17025-17864 | _na 279_aa | wcaA | Glycosyltransferase 2-like domain-containing protein |
| 2264 | CAMIKZ010000042.1 | GCA946221355_01138 | CDS | open | 17931-19520 | _na 529_aa | lnt | apolipoprotein N-acyltransferase |
| 2265 | CAMIKZ010000042.1 | GCA946221355_01139 | CDS | open | 19627-20097 | _na 156_aa | mutK | ABC transporter |
| 2266 | CAMIKZ010000042.1 | GCA946221355_01123 | gene | open | 33-284 | |||
| 2267 | CAMIKZ010000042.1 | GCA946221355_01124 | gene | open | 308-1909 | hscA | ||
| 2268 | CAMIKZ010000042.1 | GCA946221355_01125 | gene | open | 2218-3456 | pitA | ||
| 2269 | CAMIKZ010000042.1 | GCA946221355_01126 | gene | open | 3453-3698 | |||
| 2270 | CAMIKZ010000042.1 | GCA946221355_01127 | gene | open | 3742-5274 | |||
| 2271 | CAMIKZ010000042.1 | GCA946221355_01128 | gene | open | 5507-7558 | nagE | ||
| 2272 | CAMIKZ010000042.1 | GCA946221355_01129 | gene | open | 7642-8673 | purR | ||
| 2273 | CAMIKZ010000042.1 | GCA946221355_01130 | gene | open | 8785-9297 | |||
| 2274 | CAMIKZ010000042.1 | GCA946221355_01131 | gene | open | 9453-10202 | hrtA | ||
| 2275 | CAMIKZ010000042.1 | GCA946221355_01132 | gene | open | 10199-11311 | |||
| 2276 | CAMIKZ010000042.1 | GCA946221355_01133 | gene | open | 11529-14021 | |||
| 2277 | CAMIKZ010000042.1 | GCA946221355_01134 | gene | open | 14008-15291 | |||
| 2278 | CAMIKZ010000042.1 | GCA946221355_01135 | gene | open | 15314-16435 | pfkA | ||
| 2279 | CAMIKZ010000042.1 | GCA946221355_01136 | gene | open | 16659-17018 | rbpA | ||
| 2280 | CAMIKZ010000042.1 | GCA946221355_01137 | gene | open | 17025-17864 | wcaA | ||
| 2281 | CAMIKZ010000042.1 | GCA946221355_01138 | gene | open | 17931-19520 | lnt | ||
| 2282 | CAMIKZ010000042.1 | GCA946221355_01139 | gene | open | 19627-20097 | mutK | ||
| 2283 | CAMIKZ010000043.1 | GCA946221355_01140 | CDS | open | 4-918 | _na 304_aa | ABC-2 type transporter transmembrane domain-containing protein | |
| 2284 | CAMIKZ010000043.1 | GCA946221355_01141 | CDS | open | 905-1942 | _na 345_aa | ABC transporter domain-containing protein | |
| 2285 | CAMIKZ010000043.1 | GCA946221355_01142 | CDS | open | 1945-2721 | _na 258_aa | SGNH/GDSL hydrolase family protein | |
| 2286 | CAMIKZ010000043.1 | GCA946221355_01143 | CDS | open | 2773-4017 | _na 414_aa | Glycosyltransferase%2C group 2 family protein | |
| 2287 | CAMIKZ010000043.1 | GCA946221355_01144 | CDS | open | 4017-6422 | _na 801_aa | Glycosyl transferase | |
| 2288 | CAMIKZ010000043.1 | GCA946221355_01145 | CDS | open | 6419-8356 | _na 645_aa | Glycosyltransferase | |
| 2289 | CAMIKZ010000043.1 | GCA946221355_01146 | CDS | open | 8341-10185 | _na 614_aa | Glycosyltransferase 61 catalytic domain-containing protein | |
| 2290 | CAMIKZ010000043.1 | GCA946221355_01147 | CDS | open | 10182-14171 | _na 1329_aa | Glycosyl transferase family 1 domain-containing protein | |
| 2291 | CAMIKZ010000043.1 | GCA946221355_01148 | CDS | open | 14312-14704 | _na 130_aa | tagD | glycerol-3-phosphate cytidylyltransferase |
| 2292 | CAMIKZ010000043.1 | GCA946221355_01149 | CDS | open | 14969-18139 | _na 1056_aa | CDP-glycerol glycerophosphotransferase family protein | |
| 2293 | CAMIKZ010000043.1 | GCA946221355_01150 | CDS | open | 18121-19428 | _na 435_aa | wecC | UDP-N-acetyl-D-mannosamine dehydrogenase |
| 2294 | CAMIKZ010000043.1 | GCA946221355_01151 | CDS | open | 19504-20007 | _na 167_aa | LCP family protein | |
| 2295 | CAMIKZ010000043.1 | GCA946221355_01140 | gene | open | 4-918 | |||
| 2296 | CAMIKZ010000043.1 | GCA946221355_01141 | gene | open | 905-1942 | |||
| 2297 | CAMIKZ010000043.1 | GCA946221355_01142 | gene | open | 1945-2721 | |||
| 2298 | CAMIKZ010000043.1 | GCA946221355_01143 | gene | open | 2773-4017 | |||
| 2299 | CAMIKZ010000043.1 | GCA946221355_01144 | gene | open | 4017-6422 | |||
| 2300 | CAMIKZ010000043.1 | GCA946221355_01145 | gene | open | 6419-8356 | |||
| 2301 | CAMIKZ010000043.1 | GCA946221355_01146 | gene | open | 8341-10185 | |||
| 2302 | CAMIKZ010000043.1 | GCA946221355_01147 | gene | open | 10182-14171 | |||
| 2303 | CAMIKZ010000043.1 | GCA946221355_01148 | gene | open | 14312-14704 | tagD | ||
| 2304 | CAMIKZ010000043.1 | GCA946221355_01149 | gene | open | 14969-18139 | |||
| 2305 | CAMIKZ010000043.1 | GCA946221355_01150 | gene | open | 18121-19428 | wecC | ||
| 2306 | CAMIKZ010000043.1 | GCA946221355_01151 | gene | open | 19504-20007 | |||
| 2307 | CAMIKZ010000044.1 | regulatory_region | open | 53-138 | ZMP/ZTP riboswitch aptamer (pfl RNA motif) | |||
| 2308 | CAMIKZ010000044.1 | GCA946221355_01152 | CDS | open | 204-1514 | _na 436_aa | glyA | Serine hydroxymethyltransferase |
| 2309 | CAMIKZ010000044.1 | GCA946221355_01153 | CDS | open | 1511-2407 | _na 298_aa | folD | bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase |
| 2310 | CAMIKZ010000044.1 | GCA946221355_01154 | CDS | open | 2450-4192 | _na 580_aa | Fructan beta-fructosidase | |
| 2311 | CAMIKZ010000044.1 | GCA946221355_01155 | CDS | open | 4295-6205 | _na 636_aa | Levansucrase | |
| 2312 | CAMIKZ010000044.1 | GCA946221355_01156 | CDS | open | 6539-7732 | _na 397_aa | choice-of-anchor L domain-containing protein | |
| 2313 | CAMIKZ010000044.1 | GCA946221355_01157 | CDS | open | 7827-8051 | _na 74_aa | DUF2933 domain-containing protein | |
| 2314 | CAMIKZ010000044.1 | GCA946221355_01158 | CDS | open | 8064-8339 | _na 91_aa | acylphosphatase | |
| 2315 | CAMIKZ010000044.1 | GCA946221355_01159 | CDS | open | 8416-9249 | _na 277_aa | xthA | exodeoxyribonuclease III |
| 2316 | CAMIKZ010000044.1 | GCA946221355_01160 | CDS | open | 9319-10755 | _na 478_aa | ABC3 transporter permease protein domain-containing protein | |
| 2317 | CAMIKZ010000044.1 | GCA946221355_01161 | CDS | open | 10752-11543 | _na 263_aa | lolD | ABC transporter domain-containing protein |
| 2318 | CAMIKZ010000044.1 | GCA946221355_01162 | CDS | open | 11540-12595 | _na 351_aa | Biotin-requiring enzyme | |
| 2319 | CAMIKZ010000044.1 | GCA946221355_01163 | CDS | open | 12789-14066 | _na 425_aa | galK | galactokinase |
| 2320 | CAMIKZ010000044.1 | GCA946221355_01164 | CDS | open | 14140-14988 | _na 282_aa | Cytochrome C | |
| 2321 | CAMIKZ010000044.1 | GCA946221355_01165 | CDS | open | 15251-15913 | _na 220_aa | 2'-5' RNA ligase | |
| 2322 | CAMIKZ010000044.1 | GCA946221355_01166 | CDS | open | 15910-16932 | _na 340_aa | brkB | YihY/virulence factor BrkB family protein |
| 2323 | CAMIKZ010000044.1 | GCA946221355_01167 | CDS | open | 16999-18240 | _na 413_aa | Mannose-1-phosphate guanylyltransferase | |
| 2324 | CAMIKZ010000044.1 | GCA946221355_01168 | CDS | open | 18479-19579 | _na 366_aa | med | ABC transporter substrate-binding protein PnrA-like domain-containing protein |
| 2325 | CAMIKZ010000044.1 | GCA946221355_01152 | gene | open | 204-1514 | glyA | ||
| 2326 | CAMIKZ010000044.1 | GCA946221355_01153 | gene | open | 1511-2407 | folD | ||
| 2327 | CAMIKZ010000044.1 | GCA946221355_01154 | gene | open | 2450-4192 | |||
| 2328 | CAMIKZ010000044.1 | GCA946221355_01155 | gene | open | 4295-6205 | |||
| 2329 | CAMIKZ010000044.1 | GCA946221355_01156 | gene | open | 6539-7732 | |||
| 2330 | CAMIKZ010000044.1 | GCA946221355_01157 | gene | open | 7827-8051 | |||
| 2331 | CAMIKZ010000044.1 | GCA946221355_01158 | gene | open | 8064-8339 | |||
| 2332 | CAMIKZ010000044.1 | GCA946221355_01159 | gene | open | 8416-9249 | xthA | ||
| 2333 | CAMIKZ010000044.1 | GCA946221355_01160 | gene | open | 9319-10755 | |||
| 2334 | CAMIKZ010000044.1 | GCA946221355_01161 | gene | open | 10752-11543 | lolD | ||
| 2335 | CAMIKZ010000044.1 | GCA946221355_01162 | gene | open | 11540-12595 | |||
| 2336 | CAMIKZ010000044.1 | GCA946221355_01163 | gene | open | 12789-14066 | galK | ||
| 2337 | CAMIKZ010000044.1 | GCA946221355_01164 | gene | open | 14140-14988 | |||
| 2338 | CAMIKZ010000044.1 | GCA946221355_01165 | gene | open | 15251-15913 | |||
| 2339 | CAMIKZ010000044.1 | GCA946221355_01166 | gene | open | 15910-16932 | brkB | ||
| 2340 | CAMIKZ010000044.1 | GCA946221355_01167 | gene | open | 16999-18240 | |||
| 2341 | CAMIKZ010000044.1 | GCA946221355_01168 | gene | open | 18479-19579 | med | ||
| 2342 | CAMIKZ010000045.1 | GCA946221355_01169 | CDS | open | 208-435 | _na 75_aa | hypothetical protein | |
| 2343 | CAMIKZ010000045.1 | GCA946221355_01170 | CDS | open | 1134-2630 | _na 498_aa | gatB | Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB |
| 2344 | CAMIKZ010000045.1 | GCA946221355_01171 | CDS | open | 2627-4168 | _na 513_aa | gatA | Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA |
| 2345 | CAMIKZ010000045.1 | GCA946221355_01172 | CDS | open | 4165-4470 | _na 101_aa | Aspartyl/glutamyl-tRNA(Asn/Gln) amidotransferase subunit C | |
| 2346 | CAMIKZ010000045.1 | GCA946221355_01173 | CDS | open | 4876-6705 | _na 609_aa | L%2CD-TPase catalytic domain-containing protein | |
| 2347 | CAMIKZ010000045.1 | GCA946221355_01174 | CDS | open | 6792-9248 | _na 818_aa | ligA | NAD-dependent DNA ligase LigA |
| 2348 | CAMIKZ010000045.1 | GCA946221355_01175 | CDS | open | 9390-13004 | _na 1204_aa | ftsK | FtsK domain-containing protein |
| 2349 | CAMIKZ010000045.1 | GCA946221355_01176 | CDS | open | 13211-13459 | _na 82_aa | whiB | Transcriptional regulator WhiB |
| 2350 | CAMIKZ010000045.1 | GCA946221355_01177 | CDS | open | 13558-15033 | _na 491_aa | histidine kinase | |
| 2351 | CAMIKZ010000045.1 | GCA946221355_01178 | CDS | open | 15210-15704 | _na 164_aa | DUF2505 domain-containing protein | |
| 2352 | CAMIKZ010000045.1 | GCA946221355_01179 | CDS | open | 15880-16320 | _na 146_aa | yhfA | OsmC-like protein |
| 2353 | CAMIKZ010000045.1 | GCA946221355_01180 | CDS | open | 16396-17094 | _na 232_aa | ecsC | EcsC family protein |
| 2354 | CAMIKZ010000045.1 | GCA946221355_01181 | CDS | open | 17091-17984 | _na 297_aa | thymidylate synthase | |
| 2355 | CAMIKZ010000045.1 | GCA946221355_01182 | CDS | open | 17981-18571 | _na 196_aa | folA | dihydrofolate reductase |
| 2356 | CAMIKZ010000045.1 | GCA946221355_01183 | CDS | open | 18612-19019 | _na 135_aa | hxlR | HTH hxlR-type domain-containing protein |
| 2357 | CAMIKZ010000045.1 | GCA946221355_01184 | CDS | open | 19156-19779 | _na 207_aa | Pyrroline-5-carboxylate reductase catalytic N-terminal domain-containing protein | |
| 2358 | CAMIKZ010000045.1 | GCA946221355_01169 | gene | open | 208-435 | |||
| 2359 | CAMIKZ010000045.1 | GCA946221355_01170 | gene | open | 1134-2630 | gatB | ||
| 2360 | CAMIKZ010000045.1 | GCA946221355_01171 | gene | open | 2627-4168 | gatA | ||
| 2361 | CAMIKZ010000045.1 | GCA946221355_01172 | gene | open | 4165-4470 | |||
| 2362 | CAMIKZ010000045.1 | GCA946221355_01173 | gene | open | 4876-6705 | |||
| 2363 | CAMIKZ010000045.1 | GCA946221355_01174 | gene | open | 6792-9248 | ligA | ||
| 2364 | CAMIKZ010000045.1 | GCA946221355_01175 | gene | open | 9390-13004 | ftsK | ||
| 2365 | CAMIKZ010000045.1 | GCA946221355_01176 | gene | open | 13211-13459 | whiB | ||
| 2366 | CAMIKZ010000045.1 | GCA946221355_01177 | gene | open | 13558-15033 | |||
| 2367 | CAMIKZ010000045.1 | GCA946221355_01178 | gene | open | 15210-15704 | |||
| 2368 | CAMIKZ010000045.1 | GCA946221355_01179 | gene | open | 15880-16320 | yhfA | ||
| 2369 | CAMIKZ010000045.1 | GCA946221355_01180 | gene | open | 16396-17094 | ecsC | ||
| 2370 | CAMIKZ010000045.1 | GCA946221355_01181 | gene | open | 17091-17984 | |||
| 2371 | CAMIKZ010000045.1 | GCA946221355_01182 | gene | open | 17981-18571 | folA | ||
| 2372 | CAMIKZ010000045.1 | GCA946221355_01183 | gene | open | 18612-19019 | hxlR | ||
| 2373 | CAMIKZ010000045.1 | GCA946221355_01184 | gene | open | 19156-19779 | |||
| 2374 | CAMIKZ010000046.1 | GCA946221355_01185 | CDS | open | 249-419 | _na 56_aa | hypothetical protein | |
| 2375 | CAMIKZ010000046.1 | GCA946221355_01186 | CDS | open | 416-721 | _na 101_aa | putative protein conserved in bacteria | |
| 2376 | CAMIKZ010000046.1 | GCA946221355_01187 | CDS | open | 874-1527 | _na 217_aa | SMI1/KNR4 family protein | |
| 2377 | CAMIKZ010000046.1 | GCA946221355_01188 | CDS | open | 1536-2876 | _na 446_aa | galT | DUF4921 domain-containing protein |
| 2378 | CAMIKZ010000046.1 | GCA946221355_01189 | CDS | open | 3061-4671 | _na 536_aa | kefB | Cation/H+ exchanger transmembrane domain-containing protein |
| 2379 | CAMIKZ010000046.1 | GCA946221355_01190 | CDS | open | 5081-5773 | _na 230_aa | GPP34 family phosphoprotein | |
| 2380 | CAMIKZ010000046.1 | GCA946221355_01191 | CDS | open | 5997-9665 | _na 1222_aa | Helicase | |
| 2381 | CAMIKZ010000046.1 | GCA946221355_01192 | CDS | open | 10314-10565 | _na 83_aa | DUF4244 domain-containing protein | |
| 2382 | CAMIKZ010000046.1 | GCA946221355_01193 | CDS | open | 10766-11080 | _na 104_aa | TadE-like protein | |
| 2383 | CAMIKZ010000046.1 | GCA946221355_01194 | CDS | open | 11077-11451 | _na 124_aa | Putative Flp pilus-assembly TadG-like N-terminal domain-containing protein | |
| 2384 | CAMIKZ010000046.1 | GCA946221355_01195 | CDS | open | 11499-13709 | _na 736_aa | Multidrug ABC transporter ATP-binding protein | |
| 2385 | CAMIKZ010000046.1 | GCA946221355_01196 | CDS | open | 13706-15439 | _na 577_aa | mdlB | ABC transporter transmembrane region |
| 2386 | CAMIKZ010000046.1 | GCA946221355_01197 | CDS | open | 15651-18563 | _na 970_aa | yprA | DEAD/DEAH box helicase |
| 2387 | CAMIKZ010000046.1 | GCA946221355_01198 | CDS | open | 19064-19234 | _na 56_aa | hypothetical protein | |
| 2388 | CAMIKZ010000046.1 | GCA946221355_01185 | gene | open | 249-419 | |||
| 2389 | CAMIKZ010000046.1 | GCA946221355_01186 | gene | open | 416-721 | |||
| 2390 | CAMIKZ010000046.1 | GCA946221355_01187 | gene | open | 874-1527 | |||
| 2391 | CAMIKZ010000046.1 | GCA946221355_01188 | gene | open | 1536-2876 | galT | ||
| 2392 | CAMIKZ010000046.1 | GCA946221355_01189 | gene | open | 3061-4671 | kefB | ||
| 2393 | CAMIKZ010000046.1 | GCA946221355_01190 | gene | open | 5081-5773 | |||
| 2394 | CAMIKZ010000046.1 | GCA946221355_01191 | gene | open | 5997-9665 | |||
| 2395 | CAMIKZ010000046.1 | GCA946221355_01192 | gene | open | 10314-10565 | |||
| 2396 | CAMIKZ010000046.1 | GCA946221355_01193 | gene | open | 10766-11080 | |||
| 2397 | CAMIKZ010000046.1 | GCA946221355_01194 | gene | open | 11077-11451 | |||
| 2398 | CAMIKZ010000046.1 | GCA946221355_01195 | gene | open | 11499-13709 | |||
| 2399 | CAMIKZ010000046.1 | GCA946221355_01196 | gene | open | 13706-15439 | mdlB | ||
| 2400 | CAMIKZ010000046.1 | GCA946221355_01197 | gene | open | 15651-18563 | yprA | ||
| 2401 | CAMIKZ010000046.1 | GCA946221355_01198 | gene | open | 19064-19234 | |||
| 2402 | CAMIKZ010000047.1 | GCA946221355_01199 | CDS | open | 504-1514 | _na 336_aa | ssuD | Luciferase-like domain-containing protein |
| 2403 | CAMIKZ010000047.1 | GCA946221355_01200 | CDS | open | 1590-3254 | _na 554_aa | Transferase | |
| 2404 | CAMIKZ010000047.1 | GCA946221355_01201 | CDS | open | 3673-7821 | _na 1382_aa | LPXTG-motif protein cell wall anchor domain protein | |
| 2405 | CAMIKZ010000047.1 | GCA946221355_01202 | CDS | open | 7911-9512 | _na 533_aa | Fimbrial subunit type 1 | |
| 2406 | CAMIKZ010000047.1 | GCA946221355_01203 | CDS | open | 9718-11073 | _na 451_aa | Sortase | |
| 2407 | CAMIKZ010000047.1 | GCA946221355_01204 | CDS | open | 11070-12125 | _na 351_aa | Phosphatidic acid phosphatase type 2/haloperoxidase domain-containing protein | |
| 2408 | CAMIKZ010000047.1 | GCA946221355_01205 | CDS | open | 12758-14440 | _na 560_aa | histidine kinase | |
| 2409 | CAMIKZ010000047.1 | GCA946221355_01206 | CDS | open | 14451-15197 | _na 248_aa | tcrX | putative transcriptional regulatory protein TcrX |
| 2410 | CAMIKZ010000047.1 | GCA946221355_01207 | CDS | open | 15500-16852 | _na 450_aa | PAS domain-containing protein | |
| 2411 | CAMIKZ010000047.1 | GCA946221355_01208 | CDS | open | 17022-18356 | _na 444_aa | PAS domain-containing protein | |
| 2412 | CAMIKZ010000047.1 | GCA946221355_01199 | gene | open | 504-1514 | ssuD | ||
| 2413 | CAMIKZ010000047.1 | GCA946221355_01200 | gene | open | 1590-3254 | |||
| 2414 | CAMIKZ010000047.1 | GCA946221355_01201 | gene | open | 3673-7821 | |||
| 2415 | CAMIKZ010000047.1 | GCA946221355_01202 | gene | open | 7911-9512 | |||
| 2416 | CAMIKZ010000047.1 | GCA946221355_01203 | gene | open | 9718-11073 | |||
| 2417 | CAMIKZ010000047.1 | GCA946221355_01204 | gene | open | 11070-12125 | |||
| 2418 | CAMIKZ010000047.1 | GCA946221355_01205 | gene | open | 12758-14440 | |||
| 2419 | CAMIKZ010000047.1 | GCA946221355_01206 | gene | open | 14451-15197 | tcrX | ||
| 2420 | CAMIKZ010000047.1 | GCA946221355_01207 | gene | open | 15500-16852 | |||
| 2421 | CAMIKZ010000047.1 | GCA946221355_01208 | gene | open | 17022-18356 | |||
| 2422 | CAMIKZ010000048.1 | GCA946221355_01209 | CDS | open | 77-868 | _na 263_aa | ydfG | Oxidoreductase |
| 2423 | CAMIKZ010000048.1 | GCA946221355_01210 | CDS | open | 986-1888 | _na 300_aa | Transcriptional regulator | |
| 2424 | CAMIKZ010000048.1 | GCA946221355_01211 | CDS | open | 2047-2994 | _na 315_aa | NADP-dependent oxidoreductase domain-containing protein | |
| 2425 | CAMIKZ010000048.1 | GCA946221355_01212 | CDS | open | 3547-6906 | _na 1119_aa | ileS | isoleucine--tRNA ligase |
| 2426 | CAMIKZ010000048.1 | GCA946221355_01213 | CDS | open | 7319-8260 | _na 313_aa | Glycosyl transferase | |
| 2427 | CAMIKZ010000048.1 | GCA946221355_01214 | CDS | open | 8517-9860 | _na 447_aa | Polysaccharide biosynthesis tyrosine autokinase | |
| 2428 | CAMIKZ010000048.1 | GCA946221355_01215 | CDS | open | 10623-12479 | _na 618_aa | Polysaccharide biosynthesis protein CapD-like domain-containing protein | |
| 2429 | CAMIKZ010000048.1 | GCA946221355_01216 | CDS | open | 12479-13690 | _na 403_aa | Capsular biosynthesis protein | |
| 2430 | CAMIKZ010000048.1 | GCA946221355_01217 | CDS | open | 13687-14373 | _na 228_aa | Bacterial sugar transferase domain-containing protein | |
| 2431 | CAMIKZ010000048.1 | GCA946221355_01218 | CDS | open | 14405-15187 | _na 260_aa | wcaA | Glycosyltransferase 2-like domain-containing protein |
| 2432 | CAMIKZ010000048.1 | GCA946221355_01219 | CDS | open | 15253-16404 | _na 383_aa | Glycosyltransferase%2C group 1 family protein | |
| 2433 | CAMIKZ010000048.1 | GCA946221355_01220 | CDS | open | 16414-17520 | _na 368_aa | Polysaccharide polymerase | |
| 2434 | CAMIKZ010000048.1 | GCA946221355_01221 | CDS | open | 18270-18545 | _na 91_aa | hypothetical protein | |
| 2435 | CAMIKZ010000048.1 | GCA946221355_01209 | gene | open | 77-868 | ydfG | ||
| 2436 | CAMIKZ010000048.1 | GCA946221355_01210 | gene | open | 986-1888 | |||
| 2437 | CAMIKZ010000048.1 | GCA946221355_01211 | gene | open | 2047-2994 | |||
| 2438 | CAMIKZ010000048.1 | GCA946221355_01212 | gene | open | 3547-6906 | ileS | ||
| 2439 | CAMIKZ010000048.1 | GCA946221355_01213 | gene | open | 7319-8260 | |||
| 2440 | CAMIKZ010000048.1 | GCA946221355_01214 | gene | open | 8517-9860 | |||
| 2441 | CAMIKZ010000048.1 | GCA946221355_01215 | gene | open | 10623-12479 | |||
| 2442 | CAMIKZ010000048.1 | GCA946221355_01216 | gene | open | 12479-13690 | |||
| 2443 | CAMIKZ010000048.1 | GCA946221355_01217 | gene | open | 13687-14373 | |||
| 2444 | CAMIKZ010000048.1 | GCA946221355_01218 | gene | open | 14405-15187 | wcaA | ||
| 2445 | CAMIKZ010000048.1 | GCA946221355_01219 | gene | open | 15253-16404 | |||
| 2446 | CAMIKZ010000048.1 | GCA946221355_01220 | gene | open | 16414-17520 | |||
| 2447 | CAMIKZ010000048.1 | GCA946221355_01221 | gene | open | 18270-18545 | |||
| 2448 | CAMIKZ010000049.1 | GCA946221355_01222 | CDS | open | 89-1450 | _na 453_aa | succinate dehydrogenase (quinone) flavoprotein subunit | |
| 2449 | CAMIKZ010000049.1 | GCA946221355_01223 | CDS | open | 1447-2202 | _na 251_aa | sdhB | 4Fe-4S ferredoxin-type domain-containing protein |
| 2450 | CAMIKZ010000049.1 | GCA946221355_01224 | CDS | open | 2329-3192 | _na 287_aa | ubiE | Class I SAM-dependent methyltransferase |
| 2451 | CAMIKZ010000049.1 | GCA946221355_01225 | CDS | open | 3362-3676 | _na 104_aa | soxR | Transcriptional regulator%2C MerR family |
| 2452 | CAMIKZ010000049.1 | GCA946221355_01226 | CDS | open | 3826-4980 | _na 384_aa | araJ | Major facilitator superfamily (MFS) profile domain-containing protein |
| 2453 | CAMIKZ010000049.1 | GCA946221355_01227 | CDS | open | 5382-6230 | _na 282_aa | PhnB-like domain-containing protein | |
| 2454 | CAMIKZ010000049.1 | GCA946221355_01228 | CDS | open | 6296-6544 | _na 82_aa | copG | Ribbon-helix-helix protein CopG domain-containing protein |
| 2455 | CAMIKZ010000049.1 | GCA946221355_01229 | CDS | open | 6950-8371 | _na 473_aa | gltA | citrate synthase |
| 2456 | CAMIKZ010000049.1 | GCA946221355_01230 | CDS | open | 8490-8600 | _na 36_aa | hypothetical protein | |
| 2457 | CAMIKZ010000049.1 | GCA946221355_01231 | CDS | open | 8644-9834 | _na 396_aa | Orc1-like AAA ATPase domain-containing protein | |
| 2458 | CAMIKZ010000049.1 | GCA946221355_01232 | CDS | open | 9851-11098 | _na 415_aa | dapC | succinyldiaminopimelate transaminase |
| 2459 | CAMIKZ010000049.1 | GCA946221355_01233 | CDS | open | 11119-11469 | _na 116_aa | fdxA | ferredoxin |
| 2460 | CAMIKZ010000049.1 | GCA946221355_01234 | CDS | open | 11892-13208 | _na 438_aa | Putative membrane protein | |
| 2461 | CAMIKZ010000049.1 | GCA946221355_01235 | CDS | open | 13372-15456 | _na 694_aa | Tat pathway signal sequence | |
| 2462 | CAMIKZ010000049.1 | GCA946221355_01236 | CDS | open | 16371-18293 | _na 640_aa | typA | translational GTPase TypA |
| 2463 | CAMIKZ010000049.1 | GCA946221355_01222 | gene | open | 89-1450 | |||
| 2464 | CAMIKZ010000049.1 | GCA946221355_01223 | gene | open | 1447-2202 | sdhB | ||
| 2465 | CAMIKZ010000049.1 | GCA946221355_01224 | gene | open | 2329-3192 | ubiE | ||
| 2466 | CAMIKZ010000049.1 | GCA946221355_01225 | gene | open | 3362-3676 | soxR | ||
| 2467 | CAMIKZ010000049.1 | GCA946221355_01226 | gene | open | 3826-4980 | araJ | ||
| 2468 | CAMIKZ010000049.1 | GCA946221355_01227 | gene | open | 5382-6230 | |||
| 2469 | CAMIKZ010000049.1 | GCA946221355_01228 | gene | open | 6296-6544 | copG | ||
| 2470 | CAMIKZ010000049.1 | GCA946221355_01229 | gene | open | 6950-8371 | gltA | ||
| 2471 | CAMIKZ010000049.1 | GCA946221355_01230 | gene | open | 8490-8600 | |||
| 2472 | CAMIKZ010000049.1 | GCA946221355_01231 | gene | open | 8644-9834 | |||
| 2473 | CAMIKZ010000049.1 | GCA946221355_01232 | gene | open | 9851-11098 | dapC | ||
| 2474 | CAMIKZ010000049.1 | GCA946221355_01233 | gene | open | 11119-11469 | fdxA | ||
| 2475 | CAMIKZ010000049.1 | GCA946221355_01234 | gene | open | 11892-13208 | |||
| 2476 | CAMIKZ010000049.1 | GCA946221355_01235 | gene | open | 13372-15456 | |||
| 2477 | CAMIKZ010000049.1 | GCA946221355_01236 | gene | open | 16371-18293 | typA | ||
| 2478 | CAMIKZ010000050.1 | regulatory_region | open | 14304-14392 | TPP riboswitch aptamer (THI element) | |||
| 2479 | CAMIKZ010000050.1 | GCA946221355_01237 | CDS | open | 573-3116 | _na 847_aa | gyrA | DNA topoisomerase (ATP-hydrolyzing) |
| 2480 | CAMIKZ010000050.1 | GCA946221355_01238 | CDS | open | 3184-4827 | _na 547_aa | Amidohydrolase 3 domain-containing protein | |
| 2481 | CAMIKZ010000050.1 | GCA946221355_01239 | CDS | open | 4853-5905 | _na 350_aa | rimI | N-acetyltransferase domain-containing protein |
| 2482 | CAMIKZ010000050.1 | GCA946221355_01240 | CDS | open | 6035-8287 | _na 750_aa | gyrB | DNA topoisomerase (ATP-hydrolyzing) |
| 2483 | CAMIKZ010000050.1 | GCA946221355_01241 | CDS | open | 8389-9162 | _na 257_aa | hypothetical protein | |
| 2484 | CAMIKZ010000050.1 | GCA946221355_01242 | CDS | open | 9347-9619 | _na 90_aa | ClpX-type ZB domain-containing protein | |
| 2485 | CAMIKZ010000050.1 | GCA946221355_01243 | CDS | open | 9866-10273 | _na 135_aa | Rhodanese-like protein | |
| 2486 | CAMIKZ010000050.1 | GCA946221355_01244 | CDS | open | 10321-11223 | _na 300_aa | speB | Arginase |
| 2487 | CAMIKZ010000050.1 | GCA946221355_01245 | CDS | open | 11470-11811 | _na 113_aa | DUF4190 domain-containing protein | |
| 2488 | CAMIKZ010000050.1 | GCA946221355_01246 | CDS | open | 11989-12816 | _na 275_aa | thiD | Bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase |
| 2489 | CAMIKZ010000050.1 | GCA946221355_01247 | CDS | open | 12813-13475 | _na 220_aa | thiE | Thiamine-phosphate synthase |
| 2490 | CAMIKZ010000050.1 | GCA946221355_01248 | CDS | open | 13472-14314 | _na 280_aa | thiM | hydroxyethylthiazole kinase |
| 2491 | CAMIKZ010000050.1 | GCA946221355_01249 | CDS | open | 14500-16146 | _na 548_aa | rpoD | RNA polymerase sigma factor |
| 2492 | CAMIKZ010000050.1 | GCA946221355_01250 | CDS | open | 16372-17532 | _na 386_aa | Geranylgeranyl pyrophosphate synthase | |
| 2493 | CAMIKZ010000050.1 | GCA946221355_01237 | gene | open | 573-3116 | gyrA | ||
| 2494 | CAMIKZ010000050.1 | GCA946221355_01238 | gene | open | 3184-4827 | |||
| 2495 | CAMIKZ010000050.1 | GCA946221355_01239 | gene | open | 4853-5905 | rimI | ||
| 2496 | CAMIKZ010000050.1 | GCA946221355_01240 | gene | open | 6035-8287 | gyrB | ||
| 2497 | CAMIKZ010000050.1 | GCA946221355_01241 | gene | open | 8389-9162 | |||
| 2498 | CAMIKZ010000050.1 | GCA946221355_01242 | gene | open | 9347-9619 | |||
| 2499 | CAMIKZ010000050.1 | GCA946221355_01243 | gene | open | 9866-10273 | |||
| 2500 | CAMIKZ010000050.1 | GCA946221355_01244 | gene | open | 10321-11223 | speB |

