BAKTAGenome Explorer: Actinomyces oris clade-893 (GCA_946221355.1)
Select a Genome:
|
BAKTA Annotations for GCA_946221355.1
|
Search & Sort all 5252 Records
| ||||||||||||||||||
Notes: 1- Column headers only sort the current page. 2- Select [NA] or [AA] links to show sequences.
| Region | Protein-ID | Type | Genome Viewer |
Range (bp) |
Show Sequences (length) NA / AA |
BAKTA Gene |
BAKTA GeneProduct |
|
|---|---|---|---|---|---|---|---|---|
| 3501 | CAMIKZ010000088.1 | GCA946221355_01747 | gene | open | 7888-9429 | |||
| 3502 | CAMIKZ010000088.1 | GCA946221355_01748 | gene | open | 9665-11659 | oPT | ||
| 3503 | CAMIKZ010000088.1 | GCA946221355_01749 | gene | open | 11774-12547 | ppgK | ||
| 3504 | CAMIKZ010000088.1 | GCA946221355_01745 | gene | open | 6204-6279 | trnA | ||
| 3505 | CAMIKZ010000088.1 | GCA946221355_01745 | tRNA | open | 6204-6279 | trnA | tRNA-Ala(cgc) | |
| 3506 | CAMIKZ010000089.1 | GCA946221355_01750 | CDS | open | 609-1364 | _na 251_aa | Cytokinin riboside 5'-monophosphate phosphoribohydrolase | |
| 3507 | CAMIKZ010000089.1 | GCA946221355_01751 | CDS | open | 1470-1637 | _na 55_aa | DUF3117 domain-containing protein | |
| 3508 | CAMIKZ010000089.1 | GCA946221355_01752 | CDS | open | 1786-2421 | _na 211_aa | trmR | Methyltransferase domain-containing protein |
| 3509 | CAMIKZ010000089.1 | GCA946221355_01753 | CDS | open | 2557-3480 | _na 307_aa | tatB | Sec-independent protein translocase protein TatB |
| 3510 | CAMIKZ010000089.1 | GCA946221355_01754 | CDS | open | 3574-4716 | _na 380_aa | paaD | Iron-sulfur cluster carrier protein |
| 3511 | CAMIKZ010000089.1 | GCA946221355_01755 | CDS | open | 4786-5358 | _na 190_aa | DUF1003 domain-containing protein | |
| 3512 | CAMIKZ010000089.1 | GCA946221355_01756 | CDS | open | 5351-6604 | _na 417_aa | mgtE | CBS domain-containing protein |
| 3513 | CAMIKZ010000089.1 | GCA946221355_01757 | CDS | open | 6682-7530 | _na 282_aa | General stress protein 17M-like domain-containing protein | |
| 3514 | CAMIKZ010000089.1 | GCA946221355_01758 | CDS | open | 7560-8408 | _na 282_aa | ycjR | Xylose isomerase-like TIM barrel domain-containing protein |
| 3515 | CAMIKZ010000089.1 | GCA946221355_01759 | CDS | open | 8415-9389 | _na 324_aa | cation diffusion facilitator family transporter | |
| 3516 | CAMIKZ010000089.1 | GCA946221355_01760 | CDS | open | 9386-9757 | _na 123_aa | arsR | HTH arsR-type domain-containing protein |
| 3517 | CAMIKZ010000089.1 | GCA946221355_01761 | CDS | open | 9822-11447 | _na 541_aa | pepP | Xaa-Pro aminopeptidase |
| 3518 | CAMIKZ010000089.1 | GCA946221355_01762 | CDS | open | 11515-12597 | _na 360_aa | Gfo/Idh/MocA family oxidoreductase | |
| 3519 | CAMIKZ010000089.1 | GCA946221355_01750 | gene | open | 609-1364 | |||
| 3520 | CAMIKZ010000089.1 | GCA946221355_01751 | gene | open | 1470-1637 | |||
| 3521 | CAMIKZ010000089.1 | GCA946221355_01752 | gene | open | 1786-2421 | trmR | ||
| 3522 | CAMIKZ010000089.1 | GCA946221355_01753 | gene | open | 2557-3480 | tatB | ||
| 3523 | CAMIKZ010000089.1 | GCA946221355_01754 | gene | open | 3574-4716 | paaD | ||
| 3524 | CAMIKZ010000089.1 | GCA946221355_01755 | gene | open | 4786-5358 | |||
| 3525 | CAMIKZ010000089.1 | GCA946221355_01756 | gene | open | 5351-6604 | mgtE | ||
| 3526 | CAMIKZ010000089.1 | GCA946221355_01757 | gene | open | 6682-7530 | |||
| 3527 | CAMIKZ010000089.1 | GCA946221355_01758 | gene | open | 7560-8408 | ycjR | ||
| 3528 | CAMIKZ010000089.1 | GCA946221355_01759 | gene | open | 8415-9389 | |||
| 3529 | CAMIKZ010000089.1 | GCA946221355_01760 | gene | open | 9386-9757 | arsR | ||
| 3530 | CAMIKZ010000089.1 | GCA946221355_01761 | gene | open | 9822-11447 | pepP | ||
| 3531 | CAMIKZ010000089.1 | GCA946221355_01762 | gene | open | 11515-12597 | |||
| 3532 | CAMIKZ010000090.1 | GCA946221355_01763 | CDS | open | 707-1444 | _na 245_aa | glycosyltransferase | |
| 3533 | CAMIKZ010000090.1 | GCA946221355_01764 | CDS | open | 1571-2215 | _na 214_aa | hypothetical protein | |
| 3534 | CAMIKZ010000090.1 | GCA946221355_01765 | CDS | open | 3318-4313 | _na 331_aa | Enoyl reductase (ER) domain-containing protein | |
| 3535 | CAMIKZ010000090.1 | GCA946221355_01766 | CDS | open | 4349-4813 | _na 154_aa | HTH marR-type domain-containing protein | |
| 3536 | CAMIKZ010000090.1 | GCA946221355_01767 | CDS | open | 4906-5211 | _na 101_aa | mJ0435 | Polymerase nucleotidyl transferase domain-containing protein |
| 3537 | CAMIKZ010000090.1 | GCA946221355_01768 | CDS | open | 5316-6212 | _na 298_aa | prmC | peptide chain release factor N(5)-glutamine methyltransferase |
| 3538 | CAMIKZ010000090.1 | GCA946221355_01769 | CDS | open | 6202-7296 | _na 364_aa | prfA | peptide chain release factor 1 |
| 3539 | CAMIKZ010000090.1 | GCA946221355_01770 | CDS | open | 7416-7628 | _na 70_aa | rpmE | 50S ribosomal protein L31 |
| 3540 | CAMIKZ010000090.1 | GCA946221355_01771 | CDS | open | 7769-9889 | _na 706_aa | rho | transcription termination factor Rho |
| 3541 | CAMIKZ010000090.1 | GCA946221355_01772 | CDS | open | 10267-11052 | _na 261_aa | ssuE | LLM-partnered FMN reductase%2C CE1759 family |
| 3542 | CAMIKZ010000090.1 | GCA946221355_01773 | CDS | open | 11054-12202 | _na 382_aa | ssuD | F420-dependent glucose-6-phosphate dehydrogenase |
| 3543 | CAMIKZ010000090.1 | GCA946221355_01774 | CDS | open | 12237-12413 | _na 58_aa | hypothetical protein | |
| 3544 | CAMIKZ010000090.1 | GCA946221355_01775 | CDS | open | 12432-12839 | _na 135_aa | hypothetical protein | |
| 3545 | CAMIKZ010000090.1 | GCA946221355_01763 | gene | open | 707-1444 | |||
| 3546 | CAMIKZ010000090.1 | GCA946221355_01764 | gene | open | 1571-2215 | |||
| 3547 | CAMIKZ010000090.1 | GCA946221355_01765 | gene | open | 3318-4313 | |||
| 3548 | CAMIKZ010000090.1 | GCA946221355_01766 | gene | open | 4349-4813 | |||
| 3549 | CAMIKZ010000090.1 | GCA946221355_01767 | gene | open | 4906-5211 | mJ0435 | ||
| 3550 | CAMIKZ010000090.1 | GCA946221355_01768 | gene | open | 5316-6212 | prmC | ||
| 3551 | CAMIKZ010000090.1 | GCA946221355_01769 | gene | open | 6202-7296 | prfA | ||
| 3552 | CAMIKZ010000090.1 | GCA946221355_01770 | gene | open | 7416-7628 | rpmE | ||
| 3553 | CAMIKZ010000090.1 | GCA946221355_01771 | gene | open | 7769-9889 | rho | ||
| 3554 | CAMIKZ010000090.1 | GCA946221355_01772 | gene | open | 10267-11052 | ssuE | ||
| 3555 | CAMIKZ010000090.1 | GCA946221355_01773 | gene | open | 11054-12202 | ssuD | ||
| 3556 | CAMIKZ010000090.1 | GCA946221355_01774 | gene | open | 12237-12413 | |||
| 3557 | CAMIKZ010000090.1 | GCA946221355_01775 | gene | open | 12432-12839 | |||
| 3558 | CAMIKZ010000091.1 | GCA946221355_01776 | CDS | open | 591-1907 | _na 438_aa | MFS transporter | |
| 3559 | CAMIKZ010000091.1 | GCA946221355_01777 | CDS | open | 2107-3159 | _na 350_aa | Glycosyltransferase 2-like domain-containing protein | |
| 3560 | CAMIKZ010000091.1 | GCA946221355_01778 | CDS | open | 3156-4241 | _na 361_aa | Glycosyltransferase | |
| 3561 | CAMIKZ010000091.1 | GCA946221355_01779 | CDS | open | 4384-5463 | _na 359_aa | Glycosyltransferase family 2 protein | |
| 3562 | CAMIKZ010000091.1 | GCA946221355_01780 | CDS | open | 5536-6507 | _na 323_aa | diaminopimelate dehydrogenase | |
| 3563 | CAMIKZ010000091.1 | GCA946221355_01781 | CDS | open | 6894-7136 | _na 80_aa | Addiction module antidote protein%2C CC2985 family | |
| 3564 | CAMIKZ010000091.1 | GCA946221355_01782 | CDS | open | 7280-10360 | _na 1026_aa | Laminin G domain-containing protein | |
| 3565 | CAMIKZ010000091.1 | GCA946221355_01783 | CDS | open | 10814-11482 | _na 222_aa | DUF4352 domain-containing protein | |
| 3566 | CAMIKZ010000091.1 | GCA946221355_01784 | CDS | open | 11644-12720 | _na 358_aa | hypothetical protein | |
| 3567 | CAMIKZ010000091.1 | GCA946221355_01776 | gene | open | 591-1907 | |||
| 3568 | CAMIKZ010000091.1 | GCA946221355_01777 | gene | open | 2107-3159 | |||
| 3569 | CAMIKZ010000091.1 | GCA946221355_01778 | gene | open | 3156-4241 | |||
| 3570 | CAMIKZ010000091.1 | GCA946221355_01779 | gene | open | 4384-5463 | |||
| 3571 | CAMIKZ010000091.1 | GCA946221355_01780 | gene | open | 5536-6507 | |||
| 3572 | CAMIKZ010000091.1 | GCA946221355_01781 | gene | open | 6894-7136 | |||
| 3573 | CAMIKZ010000091.1 | GCA946221355_01782 | gene | open | 7280-10360 | |||
| 3574 | CAMIKZ010000091.1 | GCA946221355_01783 | gene | open | 10814-11482 | |||
| 3575 | CAMIKZ010000091.1 | GCA946221355_01784 | gene | open | 11644-12720 | |||
| 3576 | CAMIKZ010000092.1 | GCA946221355_01785 | CDS | open | 22-729 | _na 235_aa | hypothetical protein | |
| 3577 | CAMIKZ010000092.1 | GCA946221355_01786 | CDS | open | 903-1865 | _na 320_aa | mvk | mevalonate kinase |
| 3578 | CAMIKZ010000092.1 | GCA946221355_01787 | CDS | open | 1862-2893 | _na 343_aa | mvaD | diphosphomevalonate decarboxylase |
| 3579 | CAMIKZ010000092.1 | GCA946221355_01788 | CDS | open | 2884-4071 | _na 395_aa | eRG12 | phosphomevalonate kinase |
| 3580 | CAMIKZ010000092.1 | GCA946221355_01789 | CDS | open | 4068-5156 | _na 362_aa | fni | type 2 isopentenyl-diphosphate Delta-isomerase |
| 3581 | CAMIKZ010000092.1 | GCA946221355_01790 | CDS | open | 5326-6702 | _na 458_aa | DUF112 domain-containing protein | |
| 3582 | CAMIKZ010000092.1 | GCA946221355_01791 | CDS | open | 7100-7999 | _na 299_aa | N-acetyltransferase domain-containing protein | |
| 3583 | CAMIKZ010000092.1 | GCA946221355_01792 | CDS | open | 8139-9287 | _na 382_aa | ispG | flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase |
| 3584 | CAMIKZ010000092.1 | GCA946221355_01793 | CDS | open | 9423-10757 | _na 444_aa | Peptidase%2C M50 family | |
| 3585 | CAMIKZ010000092.1 | GCA946221355_01794 | CDS | open | 10754-12046 | _na 430_aa | dxr | 1-deoxy-D-xylulose-5-phosphate reductoisomerase |
| 3586 | CAMIKZ010000092.1 | GCA946221355_01795 | CDS | open | 12088-12519 | _na 143_aa | DivIVA domain repeat protein | |
| 3587 | CAMIKZ010000092.1 | GCA946221355_01785 | gene | open | 22-729 | |||
| 3588 | CAMIKZ010000092.1 | GCA946221355_01786 | gene | open | 903-1865 | mvk | ||
| 3589 | CAMIKZ010000092.1 | GCA946221355_01787 | gene | open | 1862-2893 | mvaD | ||
| 3590 | CAMIKZ010000092.1 | GCA946221355_01788 | gene | open | 2884-4071 | eRG12 | ||
| 3591 | CAMIKZ010000092.1 | GCA946221355_01789 | gene | open | 4068-5156 | fni | ||
| 3592 | CAMIKZ010000092.1 | GCA946221355_01790 | gene | open | 5326-6702 | |||
| 3593 | CAMIKZ010000092.1 | GCA946221355_01791 | gene | open | 7100-7999 | |||
| 3594 | CAMIKZ010000092.1 | GCA946221355_01792 | gene | open | 8139-9287 | ispG | ||
| 3595 | CAMIKZ010000092.1 | GCA946221355_01793 | gene | open | 9423-10757 | |||
| 3596 | CAMIKZ010000092.1 | GCA946221355_01794 | gene | open | 10754-12046 | dxr | ||
| 3597 | CAMIKZ010000092.1 | GCA946221355_01795 | gene | open | 12088-12519 | |||
| 3598 | CAMIKZ010000093.1 | GCA946221355_01796 | CDS | open | 66-1223 | _na 385_aa | hypothetical protein | |
| 3599 | CAMIKZ010000093.1 | GCA946221355_01797 | CDS | open | 1248-2498 | _na 416_aa | gdhA | Glutamate dehydrogenase |
| 3600 | CAMIKZ010000093.1 | GCA946221355_01798 | CDS | open | 2579-3901 | _na 440_aa | gabT | 4-aminobutyrate--2-oxoglutarate transaminase |
| 3601 | CAMIKZ010000093.1 | GCA946221355_01799 | CDS | open | 4094-5674 | _na 526_aa | pucR | PucR family transcriptional regulator |
| 3602 | CAMIKZ010000093.1 | GCA946221355_01800 | CDS | open | 5975-7402 | _na 475_aa | adhE | Aminobutyraldehyde dehydrogenase |
| 3603 | CAMIKZ010000093.1 | GCA946221355_01801 | CDS | open | 7433-8293 | _na 286_aa | Universal stress family protein | |
| 3604 | CAMIKZ010000093.1 | GCA946221355_01802 | CDS | open | 8290-9870 | _na 526_aa | potE | Amino acid permease |
| 3605 | CAMIKZ010000093.1 | GCA946221355_01803 | CDS | open | 10047-11417 | _na 456_aa | hemL | Putative glutamate-1-semialdehyde-2%2C1-aminomutase |
| 3606 | CAMIKZ010000093.1 | GCA946221355_01804 | CDS | open | 11507-12013 | _na 168_aa | dfsB | PF08020 family protein |
| 3607 | CAMIKZ010000093.1 | GCA946221355_01805 | CDS | open | 12149-12445 | _na 98_aa | hypothetical protein | |
| 3608 | CAMIKZ010000093.1 | GCA946221355_01796 | gene | open | 66-1223 | |||
| 3609 | CAMIKZ010000093.1 | GCA946221355_01797 | gene | open | 1248-2498 | gdhA | ||
| 3610 | CAMIKZ010000093.1 | GCA946221355_01798 | gene | open | 2579-3901 | gabT | ||
| 3611 | CAMIKZ010000093.1 | GCA946221355_01799 | gene | open | 4094-5674 | pucR | ||
| 3612 | CAMIKZ010000093.1 | GCA946221355_01800 | gene | open | 5975-7402 | adhE | ||
| 3613 | CAMIKZ010000093.1 | GCA946221355_01801 | gene | open | 7433-8293 | |||
| 3614 | CAMIKZ010000093.1 | GCA946221355_01802 | gene | open | 8290-9870 | potE | ||
| 3615 | CAMIKZ010000093.1 | GCA946221355_01803 | gene | open | 10047-11417 | hemL | ||
| 3616 | CAMIKZ010000093.1 | GCA946221355_01804 | gene | open | 11507-12013 | dfsB | ||
| 3617 | CAMIKZ010000093.1 | GCA946221355_01805 | gene | open | 12149-12445 | |||
| 3618 | CAMIKZ010000094.1 | GCA946221355_01806 | CDS | open | 247-1032 | _na 261_aa | glnQ | ABC transporter domain-containing protein |
| 3619 | CAMIKZ010000094.1 | GCA946221355_01807 | CDS | open | 1296-1946 | _na 216_aa | TetR/AcrR family transcriptional regulator | |
| 3620 | CAMIKZ010000094.1 | GCA946221355_01808 | CDS | open | 1799-2128 | _na 109_aa | hypothetical protein | |
| 3621 | CAMIKZ010000094.1 | GCA946221355_01809 | CDS | open | 2164-3444 | _na 426_aa | Erythromycin biosynthesis protein CIII-like C-terminal domain-containing protein | |
| 3622 | CAMIKZ010000094.1 | GCA946221355_01810 | CDS | open | 3446-4378 | _na 310_aa | trmH | RNA methyltransferase%2C TrmH family |
| 3623 | CAMIKZ010000094.1 | GCA946221355_01811 | CDS | open | 4574-4843 | _na 89_aa | Transposase | |
| 3624 | CAMIKZ010000094.1 | GCA946221355_01812 | CDS | open | 5039-5269 | _na 76_aa | DDE-type integrase/transposase/recombinase | |
| 3625 | CAMIKZ010000094.1 | GCA946221355_01813 | CDS | open | 5312-5572 | _na 86_aa | DDE-type integrase/transposase/recombinase | |
| 3626 | CAMIKZ010000094.1 | GCA946221355_01814 | CDS | open | 5799-6086 | _na 95_aa | hypothetical protein | |
| 3627 | CAMIKZ010000094.1 | GCA946221355_01815 | CDS | open | 6344-7519 | _na 391_aa | DUF6829 domain-containing protein | |
| 3628 | CAMIKZ010000094.1 | GCA946221355_01816 | CDS | open | 7521-8441 | _na 306_aa | TIR domain-containing protein | |
| 3629 | CAMIKZ010000094.1 | GCA946221355_01817 | CDS | open | 8428-10605 | _na 725_aa | TIR domain-containing protein | |
| 3630 | CAMIKZ010000094.1 | GCA946221355_01818 | CDS | open | 10932-11225 | _na 97_aa | transposase | |
| 3631 | CAMIKZ010000094.1 | GCA946221355_01819 | CDS | open | 11240-11398 | _na 52_aa | hypothetical protein | |
| 3632 | CAMIKZ010000094.1 | GCA946221355_01820 | CDS | open | 11683-11892 | _na 69_aa | Mutator family transposase | |
| 3633 | CAMIKZ010000094.1 | GCA946221355_01821 | CDS | open | 11956-12348 | _na 130_aa | hypothetical protein | |
| 3634 | CAMIKZ010000094.1 | GCA946221355_01806 | gene | open | 247-1032 | glnQ | ||
| 3635 | CAMIKZ010000094.1 | GCA946221355_01807 | gene | open | 1296-1946 | |||
| 3636 | CAMIKZ010000094.1 | GCA946221355_01808 | gene | open | 1799-2128 | |||
| 3637 | CAMIKZ010000094.1 | GCA946221355_01809 | gene | open | 2164-3444 | |||
| 3638 | CAMIKZ010000094.1 | GCA946221355_01810 | gene | open | 3446-4378 | trmH | ||
| 3639 | CAMIKZ010000094.1 | GCA946221355_01811 | gene | open | 4574-4843 | |||
| 3640 | CAMIKZ010000094.1 | GCA946221355_01812 | gene | open | 5039-5269 | |||
| 3641 | CAMIKZ010000094.1 | GCA946221355_01813 | gene | open | 5312-5572 | |||
| 3642 | CAMIKZ010000094.1 | GCA946221355_01814 | gene | open | 5799-6086 | |||
| 3643 | CAMIKZ010000094.1 | GCA946221355_01815 | gene | open | 6344-7519 | |||
| 3644 | CAMIKZ010000094.1 | GCA946221355_01816 | gene | open | 7521-8441 | |||
| 3645 | CAMIKZ010000094.1 | GCA946221355_01817 | gene | open | 8428-10605 | |||
| 3646 | CAMIKZ010000094.1 | GCA946221355_01818 | gene | open | 10932-11225 | |||
| 3647 | CAMIKZ010000094.1 | GCA946221355_01819 | gene | open | 11240-11398 | |||
| 3648 | CAMIKZ010000094.1 | GCA946221355_01820 | gene | open | 11683-11892 | |||
| 3649 | CAMIKZ010000094.1 | GCA946221355_01821 | gene | open | 11956-12348 | |||
| 3650 | CAMIKZ010000095.1 | GCA946221355_01822 | CDS | open | 91-855 | _na 254_aa | hypothetical protein | |
| 3651 | CAMIKZ010000095.1 | GCA946221355_01823 | CDS | open | 877-1716 | _na 279_aa | udg4 | Type-5 uracil-DNA glycosylase |
| 3652 | CAMIKZ010000095.1 | GCA946221355_01824 | CDS | open | 1784-6778 | _na 1664_aa | DEAD/DEAH box helicase | |
| 3653 | CAMIKZ010000095.1 | GCA946221355_01825 | CDS | open | 7037-8365 | _na 442_aa | nCS2 | Permease |
| 3654 | CAMIKZ010000095.1 | GCA946221355_01826 | CDS | open | 8703-9068 | _na 121_aa | hypothetical protein | |
| 3655 | CAMIKZ010000095.1 | GCA946221355_01827 | CDS | open | 9813-10370 | _na 185_aa | Conserved domain protein | |
| 3656 | CAMIKZ010000095.1 | GCA946221355_01828 | CDS | open | 10390-10911 | _na 173_aa | DUF6301 domain-containing protein | |
| 3657 | CAMIKZ010000095.1 | GCA946221355_01829 | CDS | open | 11035-11598 | _na 187_aa | DUF6301 domain-containing protein | |
| 3658 | CAMIKZ010000095.1 | GCA946221355_01830 | CDS | open | 11638-12174 | _na 178_aa | DUF6301 domain-containing protein | |
| 3659 | CAMIKZ010000095.1 | GCA946221355_01822 | gene | open | 91-855 | |||
| 3660 | CAMIKZ010000095.1 | GCA946221355_01823 | gene | open | 877-1716 | udg4 | ||
| 3661 | CAMIKZ010000095.1 | GCA946221355_01824 | gene | open | 1784-6778 | |||
| 3662 | CAMIKZ010000095.1 | GCA946221355_01825 | gene | open | 7037-8365 | nCS2 | ||
| 3663 | CAMIKZ010000095.1 | GCA946221355_01826 | gene | open | 8703-9068 | |||
| 3664 | CAMIKZ010000095.1 | GCA946221355_01827 | gene | open | 9813-10370 | |||
| 3665 | CAMIKZ010000095.1 | GCA946221355_01828 | gene | open | 10390-10911 | |||
| 3666 | CAMIKZ010000095.1 | GCA946221355_01829 | gene | open | 11035-11598 | |||
| 3667 | CAMIKZ010000095.1 | GCA946221355_01830 | gene | open | 11638-12174 | |||
| 3668 | CAMIKZ010000096.1 | GCA946221355_01831 | CDS | open | 63-1097 | _na 344_aa | hypothetical protein | |
| 3669 | CAMIKZ010000096.1 | GCA946221355_01832 | CDS | open | 935-1324 | _na 129_aa | ruvX | Holliday junction resolvase RuvX |
| 3670 | CAMIKZ010000096.1 | GCA946221355_01833 | CDS | open | 1491-4202 | _na 903_aa | alaS | alanine--tRNA ligase |
| 3671 | CAMIKZ010000096.1 | GCA946221355_01834 | CDS | open | 4440-5063 | _na 207_aa | rpsD | 30S ribosomal protein S4 |
| 3672 | CAMIKZ010000096.1 | GCA946221355_01835 | CDS | open | 5320-6723 | _na 467_aa | rarA | ATPase%2C AAA family |
| 3673 | CAMIKZ010000096.1 | GCA946221355_01836 | CDS | open | 6853-7470 | _na 205_aa | L-threonylcarbamoyladenylate synthase | |
| 3674 | CAMIKZ010000096.1 | GCA946221355_01837 | CDS | open | 7528-8250 | _na 240_aa | Glycerophosphodiester phosphodiesterase family protein | |
| 3675 | CAMIKZ010000096.1 | GCA946221355_01838 | CDS | open | 8437-8715 | _na 92_aa | arsR | HTH arsR-type domain-containing protein |
| 3676 | CAMIKZ010000096.1 | GCA946221355_01839 | CDS | open | 8699-9022 | _na 107_aa | TNFR-Cys domain-containing protein | |
| 3677 | CAMIKZ010000096.1 | GCA946221355_01840 | CDS | open | 9217-10800 | _na 527_aa | non-specific serine/threonine protein kinase | |
| 3678 | CAMIKZ010000096.1 | GCA946221355_01841 | CDS | open | 10878-11645 | _na 255_aa | AB hydrolase-1 domain-containing protein | |
| 3679 | CAMIKZ010000096.1 | GCA946221355_01842 | CDS | open | 11891-12172 | _na 93_aa | hypothetical protein | |
| 3680 | CAMIKZ010000096.1 | GCA946221355_01831 | gene | open | 63-1097 | |||
| 3681 | CAMIKZ010000096.1 | GCA946221355_01832 | gene | open | 935-1324 | ruvX | ||
| 3682 | CAMIKZ010000096.1 | GCA946221355_01833 | gene | open | 1491-4202 | alaS | ||
| 3683 | CAMIKZ010000096.1 | GCA946221355_01834 | gene | open | 4440-5063 | rpsD | ||
| 3684 | CAMIKZ010000096.1 | GCA946221355_01835 | gene | open | 5320-6723 | rarA | ||
| 3685 | CAMIKZ010000096.1 | GCA946221355_01836 | gene | open | 6853-7470 | |||
| 3686 | CAMIKZ010000096.1 | GCA946221355_01837 | gene | open | 7528-8250 | |||
| 3687 | CAMIKZ010000096.1 | GCA946221355_01838 | gene | open | 8437-8715 | arsR | ||
| 3688 | CAMIKZ010000096.1 | GCA946221355_01839 | gene | open | 8699-9022 | |||
| 3689 | CAMIKZ010000096.1 | GCA946221355_01840 | gene | open | 9217-10800 | |||
| 3690 | CAMIKZ010000096.1 | GCA946221355_01841 | gene | open | 10878-11645 | |||
| 3691 | CAMIKZ010000096.1 | GCA946221355_01842 | gene | open | 11891-12172 | |||
| 3692 | CAMIKZ010000097.1 | GCA946221355_01843 | CDS | open | 307-1764 | _na 485_aa | Nitrate reductase | |
| 3693 | CAMIKZ010000097.1 | GCA946221355_01844 | CDS | open | 2006-2389 | _na 127_aa | DUF4190 domain-containing protein | |
| 3694 | CAMIKZ010000097.1 | GCA946221355_01845 | CDS | open | 2465-3187 | _na 240_aa | guaA1 | Glutamine amidotransferase domain-containing protein |
| 3695 | CAMIKZ010000097.1 | GCA946221355_01846 | CDS | open | 3278-4717 | _na 479_aa | Annexin A7 | |
| 3696 | CAMIKZ010000097.1 | GCA946221355_01847 | CDS | open | 4886-6202 | _na 438_aa | Putative membrane protein | |
| 3697 | CAMIKZ010000097.1 | GCA946221355_01848 | CDS | open | 6373-6675 | _na 100_aa | Pentapeptide MXKDX repeat protein | |
| 3698 | CAMIKZ010000097.1 | GCA946221355_01849 | CDS | open | 6885-7619 | _na 244_aa | guaA1 | glutamine amidotransferase |
| 3699 | CAMIKZ010000097.1 | GCA946221355_01850 | CDS | open | 7687-8508 | _na 273_aa | Purine-nucleoside phosphorylase | |
| 3700 | CAMIKZ010000097.1 | GCA946221355_01851 | CDS | open | 8752-9258 | _na 168_aa | DUF2178 domain-containing protein | |
| 3701 | CAMIKZ010000097.1 | GCA946221355_01852 | CDS | open | 9251-9439 | _na 62_aa | xRE | HTH cro/C1-type domain-containing protein |
| 3702 | CAMIKZ010000097.1 | GCA946221355_01853 | CDS | open | 9476-9880 | _na 134_aa | PTS sugar transporter | |
| 3703 | CAMIKZ010000097.1 | GCA946221355_01854 | CDS | open | 10196-10564 | _na 122_aa | SRPBCC family protein | |
| 3704 | CAMIKZ010000097.1 | GCA946221355_01843 | gene | open | 307-1764 | |||
| 3705 | CAMIKZ010000097.1 | GCA946221355_01844 | gene | open | 2006-2389 | |||
| 3706 | CAMIKZ010000097.1 | GCA946221355_01845 | gene | open | 2465-3187 | guaA1 | ||
| 3707 | CAMIKZ010000097.1 | GCA946221355_01846 | gene | open | 3278-4717 | |||
| 3708 | CAMIKZ010000097.1 | GCA946221355_01847 | gene | open | 4886-6202 | |||
| 3709 | CAMIKZ010000097.1 | GCA946221355_01848 | gene | open | 6373-6675 | |||
| 3710 | CAMIKZ010000097.1 | GCA946221355_01849 | gene | open | 6885-7619 | guaA1 | ||
| 3711 | CAMIKZ010000097.1 | GCA946221355_01850 | gene | open | 7687-8508 | |||
| 3712 | CAMIKZ010000097.1 | GCA946221355_01851 | gene | open | 8752-9258 | |||
| 3713 | CAMIKZ010000097.1 | GCA946221355_01852 | gene | open | 9251-9439 | xRE | ||
| 3714 | CAMIKZ010000097.1 | GCA946221355_01853 | gene | open | 9476-9880 | |||
| 3715 | CAMIKZ010000097.1 | GCA946221355_01854 | gene | open | 10196-10564 | |||
| 3716 | CAMIKZ010000098.1 | GCA946221355_01855 | CDS | open | 204-2504 | _na 766_aa | CRISPR-associated RAMP family protein | |
| 3717 | CAMIKZ010000098.1 | GCA946221355_01856 | CDS | open | 2506-3054 | _na 182_aa | hypothetical protein | |
| 3718 | CAMIKZ010000098.1 | GCA946221355_01857 | CDS | open | 3047-4792 | _na 581_aa | CRISPR-associated RAMP protein | |
| 3719 | CAMIKZ010000098.1 | GCA946221355_01858 | CDS | open | 4789-6711 | _na 640_aa | CRISPR-associated RAMP protein | |
| 3720 | CAMIKZ010000098.1 | GCA946221355_01859 | CDS | open | 6708-8699 | _na 663_aa | Cas10/Cmr2 second palm domain-containing protein | |
| 3721 | CAMIKZ010000098.1 | GCA946221355_01860 | CDS | open | 9045-11495 | _na 816_aa | hypothetical protein | |
| 3722 | CAMIKZ010000098.1 | GCA946221355_01855 | gene | open | 204-2504 | |||
| 3723 | CAMIKZ010000098.1 | GCA946221355_01856 | gene | open | 2506-3054 | |||
| 3724 | CAMIKZ010000098.1 | GCA946221355_01857 | gene | open | 3047-4792 | |||
| 3725 | CAMIKZ010000098.1 | GCA946221355_01858 | gene | open | 4789-6711 | |||
| 3726 | CAMIKZ010000098.1 | GCA946221355_01859 | gene | open | 6708-8699 | |||
| 3727 | CAMIKZ010000098.1 | GCA946221355_01860 | gene | open | 9045-11495 | |||
| 3728 | CAMIKZ010000099.1 | GCA946221355_01871 | gene | open | 10216-10326 | Actinomyces-1 | ||
| 3729 | CAMIKZ010000099.1 | GCA946221355_01871 | ncRNA | open | 10216-10326 | Actinomyces-1 RNA | ||
| 3730 | CAMIKZ010000099.1 | GCA946221355_01861 | CDS | open | 24-449 | _na 141_aa | NUDIX domain-containing protein | |
| 3731 | CAMIKZ010000099.1 | GCA946221355_01862 | CDS | open | 452-1387 | _na 311_aa | Patatin family protein | |
| 3732 | CAMIKZ010000099.1 | GCA946221355_01863 | CDS | open | 1477-2583 | _na 368_aa | fadH | NADH:flavin oxidoreductase/NADH oxidase N-terminal domain-containing protein |
| 3733 | CAMIKZ010000099.1 | GCA946221355_01864 | CDS | open | 2623-3078 | _na 151_aa | ychJ | UPF0225 protein FBF36_10920 |
| 3734 | CAMIKZ010000099.1 | GCA946221355_01865 | CDS | open | 3081-4415 | _na 444_aa | lAP4 | M18 family aminopeptidase |
| 3735 | CAMIKZ010000099.1 | GCA946221355_01866 | CDS | open | 4498-5151 | _na 217_aa | yigB | Hydrolase |
| 3736 | CAMIKZ010000099.1 | GCA946221355_01867 | CDS | open | 5248-5811 | _na 187_aa | GtrA/DPMS transmembrane domain-containing protein | |
| 3737 | CAMIKZ010000099.1 | GCA946221355_01868 | CDS | open | 6070-6882 | _na 270_aa | Peptidyl-tRNA hydrolase PTH2 | |
| 3738 | CAMIKZ010000099.1 | GCA946221355_01869 | CDS | open | 7082-8449 | _na 455_aa | Peptidase M48 domain-containing protein | |
| 3739 | CAMIKZ010000099.1 | GCA946221355_01870 | CDS | open | 8544-9902 | _na 452_aa | Histidine kinase | |
| 3740 | CAMIKZ010000099.1 | GCA946221355_01872 | CDS | open | 10487-11467 | _na 326_aa | Arsenic resistance protein | |
| 3741 | CAMIKZ010000099.1 | GCA946221355_01861 | gene | open | 24-449 | |||
| 3742 | CAMIKZ010000099.1 | GCA946221355_01862 | gene | open | 452-1387 | |||
| 3743 | CAMIKZ010000099.1 | GCA946221355_01863 | gene | open | 1477-2583 | fadH | ||
| 3744 | CAMIKZ010000099.1 | GCA946221355_01864 | gene | open | 2623-3078 | ychJ | ||
| 3745 | CAMIKZ010000099.1 | GCA946221355_01865 | gene | open | 3081-4415 | lAP4 | ||
| 3746 | CAMIKZ010000099.1 | GCA946221355_01866 | gene | open | 4498-5151 | yigB | ||
| 3747 | CAMIKZ010000099.1 | GCA946221355_01867 | gene | open | 5248-5811 | |||
| 3748 | CAMIKZ010000099.1 | GCA946221355_01868 | gene | open | 6070-6882 | |||
| 3749 | CAMIKZ010000099.1 | GCA946221355_01869 | gene | open | 7082-8449 | |||
| 3750 | CAMIKZ010000099.1 | GCA946221355_01870 | gene | open | 8544-9902 | |||
| 3751 | CAMIKZ010000099.1 | GCA946221355_01872 | gene | open | 10487-11467 | |||
| 3752 | CAMIKZ010000100.1 | GCA946221355_01873 | CDS | open | 55-777 | _na 240_aa | deoD | purine-nucleoside phosphorylase |
| 3753 | CAMIKZ010000100.1 | GCA946221355_01874 | CDS | open | 1151-1429 | _na 92_aa | DUF1540 domain-containing protein | |
| 3754 | CAMIKZ010000100.1 | GCA946221355_01875 | CDS | open | 1547-2434 | _na 295_aa | DUF2470 domain-containing protein | |
| 3755 | CAMIKZ010000100.1 | GCA946221355_01876 | CDS | open | 2561-3268 | _na 235_aa | marC | UPF0056 membrane protein |
| 3756 | CAMIKZ010000100.1 | GCA946221355_01879 | CDS | open | 3575-4216 | _na 213_aa | Alpha-ribazole phosphatase | |
| 3757 | CAMIKZ010000100.1 | GCA946221355_01880 | CDS | open | 4213-4632 | _na 139_aa | rsfS | ribosome silencing factor |
| 3758 | CAMIKZ010000100.1 | GCA946221355_01881 | CDS | open | 4699-6387 | _na 562_aa | hypothetical protein | |
| 3759 | CAMIKZ010000100.1 | GCA946221355_01882 | CDS | open | 6377-7060 | _na 227_aa | nadD | nicotinate-nucleotide adenylyltransferase |
| 3760 | CAMIKZ010000100.1 | GCA946221355_01883 | CDS | open | 7239-8324 | _na 361_aa | ROK family protein | |
| 3761 | CAMIKZ010000100.1 | GCA946221355_01884 | CDS | open | 8608-9384 | _na 258_aa | HTH deoR-type domain-containing protein | |
| 3762 | CAMIKZ010000100.1 | GCA946221355_01885 | CDS | open | 9497-10789 | _na 430_aa | Glycosyl transferase family 28 C-terminal domain-containing protein | |
| 3763 | CAMIKZ010000100.1 | GCA946221355_01873 | gene | open | 55-777 | deoD | ||
| 3764 | CAMIKZ010000100.1 | GCA946221355_01874 | gene | open | 1151-1429 | |||
| 3765 | CAMIKZ010000100.1 | GCA946221355_01875 | gene | open | 1547-2434 | |||
| 3766 | CAMIKZ010000100.1 | GCA946221355_01876 | gene | open | 2561-3268 | marC | ||
| 3767 | CAMIKZ010000100.1 | GCA946221355_01879 | gene | open | 3575-4216 | |||
| 3768 | CAMIKZ010000100.1 | GCA946221355_01880 | gene | open | 4213-4632 | rsfS | ||
| 3769 | CAMIKZ010000100.1 | GCA946221355_01881 | gene | open | 4699-6387 | |||
| 3770 | CAMIKZ010000100.1 | GCA946221355_01882 | gene | open | 6377-7060 | nadD | ||
| 3771 | CAMIKZ010000100.1 | GCA946221355_01883 | gene | open | 7239-8324 | |||
| 3772 | CAMIKZ010000100.1 | GCA946221355_01884 | gene | open | 8608-9384 | |||
| 3773 | CAMIKZ010000100.1 | GCA946221355_01885 | gene | open | 9497-10789 | |||
| 3774 | CAMIKZ010000100.1 | GCA946221355_01877 | gene | open | 3293-3368 | trnA | ||
| 3775 | CAMIKZ010000100.1 | GCA946221355_01878 | gene | open | 3409-3481 | trnA | ||
| 3776 | CAMIKZ010000100.1 | GCA946221355_01877 | tRNA | open | 3293-3368 | trnA | tRNA-Ala(ggc) | |
| 3777 | CAMIKZ010000100.1 | GCA946221355_01878 | tRNA | open | 3409-3481 | trnA | tRNA-Ala(ggc) | |
| 3778 | CAMIKZ010000101.1 | GCA946221355_01886 | CDS | open | 180-593 | _na 137_aa | hypothetical protein | |
| 3779 | CAMIKZ010000101.1 | GCA946221355_01887 | CDS | open | 614-1018 | _na 134_aa | Ferredoxin | |
| 3780 | CAMIKZ010000101.1 | GCA946221355_01888 | CDS | open | 979-1221 | _na 80_aa | hypothetical protein | |
| 3781 | CAMIKZ010000101.1 | GCA946221355_01889 | CDS | open | 1218-1625 | _na 135_aa | hypothetical protein | |
| 3782 | CAMIKZ010000101.1 | GCA946221355_01890 | CDS | open | 1622-1912 | _na 96_aa | hypothetical protein | |
| 3783 | CAMIKZ010000101.1 | GCA946221355_01891 | CDS | open | 1909-2544 | _na 211_aa | Thioredoxin | |
| 3784 | CAMIKZ010000101.1 | GCA946221355_01892 | CDS | open | 2541-3473 | _na 310_aa | hypothetical protein | |
| 3785 | CAMIKZ010000101.1 | GCA946221355_01893 | CDS | open | 3470-5311 | _na 613_aa | ParB/Sulfiredoxin domain-containing protein | |
| 3786 | CAMIKZ010000101.1 | GCA946221355_01894 | CDS | open | 5308-5634 | _na 108_aa | hypothetical protein | |
| 3787 | CAMIKZ010000101.1 | GCA946221355_01895 | CDS | open | 5631-6035 | _na 134_aa | hypothetical protein | |
| 3788 | CAMIKZ010000101.1 | GCA946221355_01896 | CDS | open | 6107-6529 | _na 140_aa | Tat pathway signal sequence domain protein | |
| 3789 | CAMIKZ010000101.1 | GCA946221355_01897 | CDS | open | 6646-6849 | _na 67_aa | helix-turn-helix domain-containing protein | |
| 3790 | CAMIKZ010000101.1 | GCA946221355_01898 | CDS | open | 6996-7634 | _na 212_aa | hypothetical protein | |
| 3791 | CAMIKZ010000101.1 | GCA946221355_01899 | CDS | open | 7892-8221 | _na 109_aa | HTH cro/C1-type domain-containing protein | |
| 3792 | CAMIKZ010000101.1 | GCA946221355_01900 | CDS | open | 8940-9374 | _na 144_aa | irrE | IrrE N-terminal-like domain-containing protein |
| 3793 | CAMIKZ010000101.1 | GCA946221355_01901 | CDS | open | 9444-10685 | _na 413_aa | Site-specific recombinase%2C phage integrase family | |
| 3794 | CAMIKZ010000101.1 | GCA946221355_01886 | gene | open | 180-593 | |||
| 3795 | CAMIKZ010000101.1 | GCA946221355_01887 | gene | open | 614-1018 | |||
| 3796 | CAMIKZ010000101.1 | GCA946221355_01888 | gene | open | 979-1221 | |||
| 3797 | CAMIKZ010000101.1 | GCA946221355_01889 | gene | open | 1218-1625 | |||
| 3798 | CAMIKZ010000101.1 | GCA946221355_01890 | gene | open | 1622-1912 | |||
| 3799 | CAMIKZ010000101.1 | GCA946221355_01891 | gene | open | 1909-2544 | |||
| 3800 | CAMIKZ010000101.1 | GCA946221355_01892 | gene | open | 2541-3473 | |||
| 3801 | CAMIKZ010000101.1 | GCA946221355_01893 | gene | open | 3470-5311 | |||
| 3802 | CAMIKZ010000101.1 | GCA946221355_01894 | gene | open | 5308-5634 | |||
| 3803 | CAMIKZ010000101.1 | GCA946221355_01895 | gene | open | 5631-6035 | |||
| 3804 | CAMIKZ010000101.1 | GCA946221355_01896 | gene | open | 6107-6529 | |||
| 3805 | CAMIKZ010000101.1 | GCA946221355_01897 | gene | open | 6646-6849 | |||
| 3806 | CAMIKZ010000101.1 | GCA946221355_01898 | gene | open | 6996-7634 | |||
| 3807 | CAMIKZ010000101.1 | GCA946221355_01899 | gene | open | 7892-8221 | |||
| 3808 | CAMIKZ010000101.1 | GCA946221355_01900 | gene | open | 8940-9374 | irrE | ||
| 3809 | CAMIKZ010000101.1 | GCA946221355_01901 | gene | open | 9444-10685 | |||
| 3810 | CAMIKZ010000102.1 | GCA946221355_01902 | CDS | open | 90-1016 | _na 308_aa | ycfH | putative deoxyribonuclease YcfH |
| 3811 | CAMIKZ010000102.1 | GCA946221355_01903 | CDS | open | 1023-2870 | _na 615_aa | Methionine--tRNA ligase | |
| 3812 | CAMIKZ010000102.1 | GCA946221355_01904 | CDS | open | 3130-4197 | _na 355_aa | Serine/threonine protein kinase | |
| 3813 | CAMIKZ010000102.1 | GCA946221355_01905 | CDS | open | 4319-4921 | _na 200_aa | nicotinamidase | |
| 3814 | CAMIKZ010000102.1 | GCA946221355_01906 | CDS | open | 4966-5895 | _na 309_aa | rsmI | 16S rRNA (cytidine(1402)-2'-O)-methyltransferase |
| 3815 | CAMIKZ010000102.1 | GCA946221355_01907 | CDS | open | 5949-8315 | _na 788_aa | Dolichyl-phosphate-mannose--protein mannosyltransferase | |
| 3816 | CAMIKZ010000102.1 | GCA946221355_01908 | CDS | open | 8268-8960 | _na 230_aa | NAD(P)-binding domain-containing protein | |
| 3817 | CAMIKZ010000102.1 | GCA946221355_01909 | CDS | open | 8957-9919 | _na 320_aa | eamA | EamA domain-containing protein |
| 3818 | CAMIKZ010000102.1 | GCA946221355_01910 | CDS | open | 9998-10903 | _na 301_aa | HTH lysR-type domain-containing protein | |
| 3819 | CAMIKZ010000102.1 | GCA946221355_01902 | gene | open | 90-1016 | ycfH | ||
| 3820 | CAMIKZ010000102.1 | GCA946221355_01903 | gene | open | 1023-2870 | |||
| 3821 | CAMIKZ010000102.1 | GCA946221355_01904 | gene | open | 3130-4197 | |||
| 3822 | CAMIKZ010000102.1 | GCA946221355_01905 | gene | open | 4319-4921 | |||
| 3823 | CAMIKZ010000102.1 | GCA946221355_01906 | gene | open | 4966-5895 | rsmI | ||
| 3824 | CAMIKZ010000102.1 | GCA946221355_01907 | gene | open | 5949-8315 | |||
| 3825 | CAMIKZ010000102.1 | GCA946221355_01908 | gene | open | 8268-8960 | |||
| 3826 | CAMIKZ010000102.1 | GCA946221355_01909 | gene | open | 8957-9919 | eamA | ||
| 3827 | CAMIKZ010000102.1 | GCA946221355_01910 | gene | open | 9998-10903 | |||
| 3828 | CAMIKZ010000103.1 | GCA946221355_01911 | CDS | open | 839-2422 | _na 527_aa | ybjL | RCK C-terminal domain-containing protein |
| 3829 | CAMIKZ010000103.1 | GCA946221355_01912 | CDS | open | 2666-3094 | _na 142_aa | yurZ | 4-carboxymuconolactone decarboxylase |
| 3830 | CAMIKZ010000103.1 | GCA946221355_01913 | CDS | open | 3091-3636 | _na 181_aa | HTH merR-type domain-containing protein | |
| 3831 | CAMIKZ010000103.1 | GCA946221355_01914 | CDS | open | 3726-4034 | _na 102_aa | yqgV | Thiamine-binding protein domain-containing protein |
| 3832 | CAMIKZ010000103.1 | GCA946221355_01915 | CDS | open | 4145-4846 | _na 233_aa | mtnN | 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase |
| 3833 | CAMIKZ010000103.1 | GCA946221355_01916 | CDS | open | 4860-5696 | _na 278_aa | hypothetical protein | |
| 3834 | CAMIKZ010000103.1 | GCA946221355_01917 | CDS | open | 6524-7147 | _na 207_aa | HTH tetR-type domain-containing protein | |
| 3835 | CAMIKZ010000103.1 | GCA946221355_01918 | CDS | open | 7277-9625 | _na 782_aa | SSD domain-containing protein | |
| 3836 | CAMIKZ010000103.1 | GCA946221355_01919 | CDS | open | 9954-11066 | _na 370_aa | AAA family ATPase | |
| 3837 | CAMIKZ010000103.1 | GCA946221355_01911 | gene | open | 839-2422 | ybjL | ||
| 3838 | CAMIKZ010000103.1 | GCA946221355_01912 | gene | open | 2666-3094 | yurZ | ||
| 3839 | CAMIKZ010000103.1 | GCA946221355_01913 | gene | open | 3091-3636 | |||
| 3840 | CAMIKZ010000103.1 | GCA946221355_01914 | gene | open | 3726-4034 | yqgV | ||
| 3841 | CAMIKZ010000103.1 | GCA946221355_01915 | gene | open | 4145-4846 | mtnN | ||
| 3842 | CAMIKZ010000103.1 | GCA946221355_01916 | gene | open | 4860-5696 | |||
| 3843 | CAMIKZ010000103.1 | GCA946221355_01917 | gene | open | 6524-7147 | |||
| 3844 | CAMIKZ010000103.1 | GCA946221355_01918 | gene | open | 7277-9625 | |||
| 3845 | CAMIKZ010000103.1 | GCA946221355_01919 | gene | open | 9954-11066 | |||
| 3846 | CAMIKZ010000104.1 | GCA946221355_01920 | CDS | open | 897-4676 | _na 1259_aa | smc | chromosome segregation protein SMC |
| 3847 | CAMIKZ010000104.1 | GCA946221355_01921 | CDS | open | 4838-5212 | _na 124_aa | Cell division protein DivIVA | |
| 3848 | CAMIKZ010000104.1 | GCA946221355_01922 | CDS | open | 5552-6733 | _na 393_aa | ftsY | signal recognition particle-docking protein FtsY |
| 3849 | CAMIKZ010000104.1 | GCA946221355_01923 | CDS | open | 6756-7367 | _na 203_aa | citB | Two component system response regulator |
| 3850 | CAMIKZ010000104.1 | GCA946221355_01924 | CDS | open | 7446-8603 | _na 385_aa | Signal transduction histidine kinase subgroup 3 dimerisation and phosphoacceptor domain-containing protein | |
| 3851 | CAMIKZ010000104.1 | GCA946221355_01925 | CDS | open | 8626-9513 | _na 295_aa | ABC-2 type transporter transmembrane domain-containing protein | |
| 3852 | CAMIKZ010000104.1 | GCA946221355_01926 | CDS | open | 9510-10436 | _na 308_aa | ABC transporter domain-containing protein | |
| 3853 | CAMIKZ010000104.1 | GCA946221355_01920 | gene | open | 897-4676 | smc | ||
| 3854 | CAMIKZ010000104.1 | GCA946221355_01921 | gene | open | 4838-5212 | |||
| 3855 | CAMIKZ010000104.1 | GCA946221355_01922 | gene | open | 5552-6733 | ftsY | ||
| 3856 | CAMIKZ010000104.1 | GCA946221355_01923 | gene | open | 6756-7367 | citB | ||
| 3857 | CAMIKZ010000104.1 | GCA946221355_01924 | gene | open | 7446-8603 | |||
| 3858 | CAMIKZ010000104.1 | GCA946221355_01925 | gene | open | 8626-9513 | |||
| 3859 | CAMIKZ010000104.1 | GCA946221355_01926 | gene | open | 9510-10436 | |||
| 3860 | CAMIKZ010000105.1 | GCA946221355_01927 | CDS | open | 300-1043 | _na 247_aa | Lipoprotein | |
| 3861 | CAMIKZ010000105.1 | GCA946221355_01928 | CDS | open | 1186-2670 | _na 494_aa | gltX | glutamate--tRNA ligase |
| 3862 | CAMIKZ010000105.1 | GCA946221355_01929 | CDS | open | 3253-4077 | _na 274_aa | Lipoprotein | |
| 3863 | CAMIKZ010000105.1 | GCA946221355_01930 | CDS | open | 4228-5052 | _na 274_aa | ycgM | Fumarylacetoacetase-like C-terminal domain-containing protein |
| 3864 | CAMIKZ010000105.1 | GCA946221355_01931 | CDS | open | 5078-6673 | _na 531_aa | Amino acid carrier protein | |
| 3865 | CAMIKZ010000105.1 | GCA946221355_01932 | CDS | open | 6907-8382 | _na 491_aa | Sodium:alanine symporter family protein | |
| 3866 | CAMIKZ010000105.1 | GCA946221355_01933 | CDS | open | 8388-9842 | _na 484_aa | alsT | Amino acid carrier protein |
| 3867 | CAMIKZ010000105.1 | GCA946221355_01934 | CDS | open | 9839-10900 | _na 353_aa | sodium:alanine symporter family protein | |
| 3868 | CAMIKZ010000105.1 | GCA946221355_01927 | gene | open | 300-1043 | |||
| 3869 | CAMIKZ010000105.1 | GCA946221355_01928 | gene | open | 1186-2670 | gltX | ||
| 3870 | CAMIKZ010000105.1 | GCA946221355_01929 | gene | open | 3253-4077 | |||
| 3871 | CAMIKZ010000105.1 | GCA946221355_01930 | gene | open | 4228-5052 | ycgM | ||
| 3872 | CAMIKZ010000105.1 | GCA946221355_01931 | gene | open | 5078-6673 | |||
| 3873 | CAMIKZ010000105.1 | GCA946221355_01932 | gene | open | 6907-8382 | |||
| 3874 | CAMIKZ010000105.1 | GCA946221355_01933 | gene | open | 8388-9842 | alsT | ||
| 3875 | CAMIKZ010000105.1 | GCA946221355_01934 | gene | open | 9839-10900 | |||
| 3876 | CAMIKZ010000106.1 | GCA946221355_01935 | CDS | open | 213-848 | _na 211_aa | DJ-1/PfpI family protein | |
| 3877 | CAMIKZ010000106.1 | GCA946221355_01936 | CDS | open | 908-3889 | _na 993_aa | uvrD | DNA 3'-5' helicase |
| 3878 | CAMIKZ010000106.1 | GCA946221355_01937 | CDS | open | 4005-5000 | _na 331_aa | CPBP family intramembrane glutamic endopeptidase | |
| 3879 | CAMIKZ010000106.1 | GCA946221355_01938 | CDS | open | 5148-5867 | _na 239_aa | Nitroreductase domain-containing protein | |
| 3880 | CAMIKZ010000106.1 | GCA946221355_01939 | CDS | open | 5864-6529 | _na 221_aa | wbbJ | Maltose/galactoside acetyltransferase domain-containing protein |
| 3881 | CAMIKZ010000106.1 | GCA946221355_01940 | CDS | open | 6609-9011 | _na 800_aa | DUF5110 domain-containing protein | |
| 3882 | CAMIKZ010000106.1 | GCA946221355_01941 | CDS | open | 9937-10905 | _na 322_aa | hypothetical protein | |
| 3883 | CAMIKZ010000106.1 | GCA946221355_01935 | gene | open | 213-848 | |||
| 3884 | CAMIKZ010000106.1 | GCA946221355_01936 | gene | open | 908-3889 | uvrD | ||
| 3885 | CAMIKZ010000106.1 | GCA946221355_01937 | gene | open | 4005-5000 | |||
| 3886 | CAMIKZ010000106.1 | GCA946221355_01938 | gene | open | 5148-5867 | |||
| 3887 | CAMIKZ010000106.1 | GCA946221355_01939 | gene | open | 5864-6529 | wbbJ | ||
| 3888 | CAMIKZ010000106.1 | GCA946221355_01940 | gene | open | 6609-9011 | |||
| 3889 | CAMIKZ010000106.1 | GCA946221355_01941 | gene | open | 9937-10905 | |||
| 3890 | CAMIKZ010000107.1 | GCA946221355_01942 | CDS | open | 132-2105 | _na 657_aa | Rne/Rng family ribonuclease | |
| 3891 | CAMIKZ010000107.1 | GCA946221355_01943 | CDS | open | 2282-2602 | _na 106_aa | rplU | 50S ribosomal protein L21 |
| 3892 | CAMIKZ010000107.1 | GCA946221355_01944 | CDS | open | 2672-2929 | _na 85_aa | rpmA | 50S ribosomal protein L27 |
| 3893 | CAMIKZ010000107.1 | GCA946221355_01945 | CDS | open | 3016-4623 | _na 535_aa | obgE | GTPase ObgE |
| 3894 | CAMIKZ010000107.1 | GCA946221355_01946 | CDS | open | 4635-5804 | _na 389_aa | proB | Glutamate 5-kinase |
| 3895 | CAMIKZ010000107.1 | GCA946221355_01947 | CDS | open | 5839-7134 | _na 431_aa | proA | glutamate-5-semialdehyde dehydrogenase |
| 3896 | CAMIKZ010000107.1 | GCA946221355_01948 | CDS | open | 7317-7814 | _na 165_aa | Ubiquitin carboxyl-hydrolase | |
| 3897 | CAMIKZ010000107.1 | GCA946221355_01949 | CDS | open | 7848-8507 | _na 219_aa | ompR | Transcriptional activator protein CopR |
| 3898 | CAMIKZ010000107.1 | GCA946221355_01950 | CDS | open | 8504-10135 | _na 543_aa | histidine kinase | |
| 3899 | CAMIKZ010000107.1 | GCA946221355_01951 | CDS | open | 10108-10746 | _na 212_aa | UDP-glucose 6-dehydrogenase | |
| 3900 | CAMIKZ010000107.1 | GCA946221355_01942 | gene | open | 132-2105 | |||
| 3901 | CAMIKZ010000107.1 | GCA946221355_01943 | gene | open | 2282-2602 | rplU | ||
| 3902 | CAMIKZ010000107.1 | GCA946221355_01944 | gene | open | 2672-2929 | rpmA | ||
| 3903 | CAMIKZ010000107.1 | GCA946221355_01945 | gene | open | 3016-4623 | obgE | ||
| 3904 | CAMIKZ010000107.1 | GCA946221355_01946 | gene | open | 4635-5804 | proB | ||
| 3905 | CAMIKZ010000107.1 | GCA946221355_01947 | gene | open | 5839-7134 | proA | ||
| 3906 | CAMIKZ010000107.1 | GCA946221355_01948 | gene | open | 7317-7814 | |||
| 3907 | CAMIKZ010000107.1 | GCA946221355_01949 | gene | open | 7848-8507 | ompR | ||
| 3908 | CAMIKZ010000107.1 | GCA946221355_01950 | gene | open | 8504-10135 | |||
| 3909 | CAMIKZ010000107.1 | GCA946221355_01951 | gene | open | 10108-10746 | |||
| 3910 | CAMIKZ010000108.1 | repeat_region | open | 8634-8970 | CRISPR array with 5 repeats of length 37%2C consensus sequence GTCTTAATGCACCTTCTGGTGCTGGGTGCTTTCTGAC and spacer length 35 | |||
| 3911 | CAMIKZ010000108.1 | repeat_region | open | 9438-10647 | CRISPR array with 17 repeats of length 37%2C consensus sequence GTCTTAATGCACCTTCTGGTGCTGGGTGCTTTCTGAC and spacer length 35 | |||
| 3912 | CAMIKZ010000108.1 | GCA946221355_01952 | CDS | open | 1075-2469 | _na 464_aa | NlpC/P60 domain-containing protein | |
| 3913 | CAMIKZ010000108.1 | GCA946221355_01953 | CDS | open | 2531-3031 | _na 166_aa | ppa | Inorganic pyrophosphatase |
| 3914 | CAMIKZ010000108.1 | GCA946221355_01954 | CDS | open | 3267-4664 | _na 465_aa | dacB | D-alanyl-D-alanine carboxypeptidase/D-alanyl-D-alanine-endopeptidase |
| 3915 | CAMIKZ010000108.1 | GCA946221355_01955 | CDS | open | 4746-5984 | _na 412_aa | Zinc-dependent metalloprotease | |
| 3916 | CAMIKZ010000108.1 | GCA946221355_01956 | CDS | open | 6098-6652 | _na 184_aa | hpt | hypoxanthine phosphoribosyltransferase |
| 3917 | CAMIKZ010000108.1 | GCA946221355_01957 | CDS | open | 6853-8196 | _na 447_aa | NlpC/P60 domain-containing protein | |
| 3918 | CAMIKZ010000108.1 | GCA946221355_01952 | gene | open | 1075-2469 | |||
| 3919 | CAMIKZ010000108.1 | GCA946221355_01953 | gene | open | 2531-3031 | ppa | ||
| 3920 | CAMIKZ010000108.1 | GCA946221355_01954 | gene | open | 3267-4664 | dacB | ||
| 3921 | CAMIKZ010000108.1 | GCA946221355_01955 | gene | open | 4746-5984 | |||
| 3922 | CAMIKZ010000108.1 | GCA946221355_01956 | gene | open | 6098-6652 | hpt | ||
| 3923 | CAMIKZ010000108.1 | GCA946221355_01957 | gene | open | 6853-8196 | |||
| 3924 | CAMIKZ010000109.1 | GCA946221355_01958 | CDS | open | 10-750 | _na 246_aa | terC | Tellurite resistance protein TerC |
| 3925 | CAMIKZ010000109.1 | GCA946221355_01959 | CDS | open | 807-3296 | _na 829_aa | mgtA | putative cation-transporting ATPase F |
| 3926 | CAMIKZ010000109.1 | GCA946221355_01960 | CDS | open | 3322-3861 | _na 179_aa | Class I SAM-dependent methyltransferase | |
| 3927 | CAMIKZ010000109.1 | GCA946221355_01961 | CDS | open | 3939-4280 | _na 113_aa | YCII-related domain-containing protein | |
| 3928 | CAMIKZ010000109.1 | GCA946221355_01962 | CDS | open | 4333-7209 | _na 958_aa | uvrA | excinuclease ABC subunit UvrA |
| 3929 | CAMIKZ010000109.1 | GCA946221355_01963 | CDS | open | 7267-9891 | _na 874_aa | DUF2339 domain-containing protein | |
| 3930 | CAMIKZ010000109.1 | GCA946221355_01958 | gene | open | 10-750 | terC | ||
| 3931 | CAMIKZ010000109.1 | GCA946221355_01959 | gene | open | 807-3296 | mgtA | ||
| 3932 | CAMIKZ010000109.1 | GCA946221355_01960 | gene | open | 3322-3861 | |||
| 3933 | CAMIKZ010000109.1 | GCA946221355_01961 | gene | open | 3939-4280 | |||
| 3934 | CAMIKZ010000109.1 | GCA946221355_01962 | gene | open | 4333-7209 | uvrA | ||
| 3935 | CAMIKZ010000109.1 | GCA946221355_01963 | gene | open | 7267-9891 | |||
| 3936 | CAMIKZ010000110.1 | GCA946221355_01964 | CDS | open | 39-455 | _na 138_aa | hypothetical protein | |
| 3937 | CAMIKZ010000110.1 | GCA946221355_01965 | CDS | open | 452-3043 | _na 863_aa | pelF | GT4 family glycosyltransferase PelF |
| 3938 | CAMIKZ010000110.1 | GCA946221355_01966 | CDS | open | 3040-4149 | _na 369_aa | Glycoside-hydrolase family GH114 TIM-barrel domain-containing protein | |
| 3939 | CAMIKZ010000110.1 | GCA946221355_01967 | CDS | open | 4352-5764 | _na 470_aa | melB | Major facilitator superfamily (MFS) profile domain-containing protein |
| 3940 | CAMIKZ010000110.1 | GCA946221355_01968 | CDS | open | 5793-6239 | _na 148_aa | uspA | UspA domain-containing protein |
| 3941 | CAMIKZ010000110.1 | GCA946221355_01969 | CDS | open | 7345-7491 | _na 48_aa | hypothetical protein | |
| 3942 | CAMIKZ010000110.1 | GCA946221355_01970 | CDS | open | 7631-10336 | _na 901_aa | ppdK | pyruvate%2C phosphate dikinase |
| 3943 | CAMIKZ010000110.1 | GCA946221355_01971 | CDS | open | 10395-10640 | _na 81_aa | hypothetical protein | |
| 3944 | CAMIKZ010000110.1 | GCA946221355_01964 | gene | open | 39-455 | |||
| 3945 | CAMIKZ010000110.1 | GCA946221355_01965 | gene | open | 452-3043 | pelF | ||
| 3946 | CAMIKZ010000110.1 | GCA946221355_01966 | gene | open | 3040-4149 | |||
| 3947 | CAMIKZ010000110.1 | GCA946221355_01967 | gene | open | 4352-5764 | melB | ||
| 3948 | CAMIKZ010000110.1 | GCA946221355_01968 | gene | open | 5793-6239 | uspA | ||
| 3949 | CAMIKZ010000110.1 | GCA946221355_01969 | gene | open | 7345-7491 | |||
| 3950 | CAMIKZ010000110.1 | GCA946221355_01970 | gene | open | 7631-10336 | ppdK | ||
| 3951 | CAMIKZ010000110.1 | GCA946221355_01971 | gene | open | 10395-10640 | |||
| 3952 | CAMIKZ010000111.1 | GCA946221355_01972 | CDS | open | 88-369 | _na 93_aa | hypothetical protein | |
| 3953 | CAMIKZ010000111.1 | GCA946221355_01973 | CDS | open | 660-1910 | _na 416_aa | tadA | Bacterial type II secretion system protein E domain-containing protein |
| 3954 | CAMIKZ010000111.1 | GCA946221355_01974 | CDS | open | 1910-2761 | _na 283_aa | tadB | Type II secretion system protein GspF domain-containing protein |
| 3955 | CAMIKZ010000111.1 | GCA946221355_01975 | CDS | open | 2758-3711 | _na 317_aa | gspF | Type II secretion system protein GspF domain-containing protein |
| 3956 | CAMIKZ010000111.1 | GCA946221355_01976 | CDS | open | 3799-4029 | _na 76_aa | DUF4244 domain-containing protein | |
| 3957 | CAMIKZ010000111.1 | GCA946221355_01977 | CDS | open | 4019-4492 | _na 157_aa | tadE | Pilus assembly protein TadE |
| 3958 | CAMIKZ010000111.1 | GCA946221355_01978 | CDS | open | 4649-5062 | _na 137_aa | Pilus assembly protein | |
| 3959 | CAMIKZ010000111.1 | GCA946221355_01979 | CDS | open | 5059-5565 | _na 168_aa | Flp pilus-assembly TadG-like N-terminal domain-containing protein | |
| 3960 | CAMIKZ010000111.1 | GCA946221355_01980 | CDS | open | 5634-6032 | _na 132_aa | Cyclic nucleotide-binding protein | |
| 3961 | CAMIKZ010000111.1 | GCA946221355_01981 | CDS | open | 6063-6974 | _na 303_aa | lysR | HTH lysR-type domain-containing protein |
| 3962 | CAMIKZ010000111.1 | GCA946221355_01982 | CDS | open | 7075-8196 | _na 373_aa | prfB | peptide chain release factor 2 |
| 3963 | CAMIKZ010000111.1 | GCA946221355_01983 | CDS | open | 8329-9258 | _na 309_aa | CAAX amino terminal protease family protein | |
| 3964 | CAMIKZ010000111.1 | GCA946221355_01984 | CDS | open | 9206-9748 | _na 180_aa | Methylated-DNA--[protein]-cysteine S-methyltransferase | |
| 3965 | CAMIKZ010000111.1 | GCA946221355_01972 | gene | open | 88-369 | |||
| 3966 | CAMIKZ010000111.1 | GCA946221355_01973 | gene | open | 660-1910 | tadA | ||
| 3967 | CAMIKZ010000111.1 | GCA946221355_01974 | gene | open | 1910-2761 | tadB | ||
| 3968 | CAMIKZ010000111.1 | GCA946221355_01975 | gene | open | 2758-3711 | gspF | ||
| 3969 | CAMIKZ010000111.1 | GCA946221355_01976 | gene | open | 3799-4029 | |||
| 3970 | CAMIKZ010000111.1 | GCA946221355_01977 | gene | open | 4019-4492 | tadE | ||
| 3971 | CAMIKZ010000111.1 | GCA946221355_01978 | gene | open | 4649-5062 | |||
| 3972 | CAMIKZ010000111.1 | GCA946221355_01979 | gene | open | 5059-5565 | |||
| 3973 | CAMIKZ010000111.1 | GCA946221355_01980 | gene | open | 5634-6032 | |||
| 3974 | CAMIKZ010000111.1 | GCA946221355_01981 | gene | open | 6063-6974 | lysR | ||
| 3975 | CAMIKZ010000111.1 | GCA946221355_01982 | gene | open | 7075-8196 | prfB | ||
| 3976 | CAMIKZ010000111.1 | GCA946221355_01983 | gene | open | 8329-9258 | |||
| 3977 | CAMIKZ010000111.1 | GCA946221355_01984 | gene | open | 9206-9748 | |||
| 3978 | CAMIKZ010000112.1 | GCA946221355_01985 | CDS | open | 1151-3709 | _na 852_aa | Phosphatidylglycerol lysyltransferase C-terminal domain-containing protein | |
| 3979 | CAMIKZ010000112.1 | GCA946221355_01986 | CDS | open | 4121-6142 | _na 673_aa | RAMA domain-containing protein | |
| 3980 | CAMIKZ010000112.1 | GCA946221355_01987 | CDS | open | 6175-7218 | _na 347_aa | pldB | Serine aminopeptidase S33 domain-containing protein |
| 3981 | CAMIKZ010000112.1 | GCA946221355_01988 | CDS | open | 7404-8363 | _na 319_aa | Alpha/beta hydrolase | |
| 3982 | CAMIKZ010000112.1 | GCA946221355_01989 | CDS | open | 8549-8671 | _na 40_aa | Membrane transporter protein | |
| 3983 | CAMIKZ010000112.1 | GCA946221355_01990 | CDS | open | 8928-10346 | _na 472_aa | Dihydrolipoyl dehydrogenase | |
| 3984 | CAMIKZ010000112.1 | GCA946221355_01985 | gene | open | 1151-3709 | |||
| 3985 | CAMIKZ010000112.1 | GCA946221355_01986 | gene | open | 4121-6142 | |||
| 3986 | CAMIKZ010000112.1 | GCA946221355_01987 | gene | open | 6175-7218 | pldB | ||
| 3987 | CAMIKZ010000112.1 | GCA946221355_01988 | gene | open | 7404-8363 | |||
| 3988 | CAMIKZ010000112.1 | GCA946221355_01989 | gene | open | 8549-8671 | |||
| 3989 | CAMIKZ010000112.1 | GCA946221355_01990 | gene | open | 8928-10346 | |||
| 3990 | CAMIKZ010000113.1 | GCA946221355_01991 | CDS | open | 26-1714 | _na 562_aa | pgm | phosphoglucomutase (alpha-D-glucose-1%2C6-bisphosphate-dependent) |
| 3991 | CAMIKZ010000113.1 | GCA946221355_01992 | CDS | open | 2008-2994 | _na 328_aa | hypothetical protein | |
| 3992 | CAMIKZ010000113.1 | GCA946221355_01993 | CDS | open | 3191-3589 | _na 132_aa | ridA | Enamine/imine deaminase |
| 3993 | CAMIKZ010000113.1 | GCA946221355_01994 | CDS | open | 3913-4941 | _na 342_aa | Conserved domain protein | |
| 3994 | CAMIKZ010000113.1 | GCA946221355_01995 | CDS | open | 4991-6634 | _na 547_aa | DUF5129 domain-containing protein | |
| 3995 | CAMIKZ010000113.1 | GCA946221355_01996 | CDS | open | 6782-7672 | _na 296_aa | DUF5926 domain-containing protein | |
| 3996 | CAMIKZ010000113.1 | GCA946221355_01997 | CDS | open | 8118-8975 | _na 285_aa | yoaT | DUF817 domain-containing protein |
| 3997 | CAMIKZ010000113.1 | GCA946221355_01998 | CDS | open | 9238-9984 | _na 248_aa | DNA alkylation repair enzyme domain protein | |
| 3998 | CAMIKZ010000113.1 | GCA946221355_01999 | CDS | open | 9988-10188 | _na 66_aa | hypothetical protein | |
| 3999 | CAMIKZ010000113.1 | GCA946221355_01991 | gene | open | 26-1714 | pgm | ||
| 4000 | CAMIKZ010000113.1 | GCA946221355_01992 | gene | open | 2008-2994 |

