HOMD Banner
Taxonomy: V4.3   |  16S rRNA RefSeq: V16.03   |  Genomic RefSeq: V11.03   |  Viruses: V1.2

BAKTAGenome Explorer: Corynebacterium mucifaciens (GCA_946221375.1)

Select a Genome:
BAKTA Annotations for GCA_946221375.1
Genome Selected: Corynebacterium mucifaciens
ContigsBases CDSrRNA tmRNAtRNA
84 2118906 2096 0 1 53
[Table]   [AA Fasta]      [Browser]   [Text]   [Excel]  
Search & Sort all 4316 Records
Search These Records: Clear
Sort Column:   Molecule   PID   NA   AA   Gene  Gene Product  Reverse
Annotation Table [page:6]    |    Number of Records Found: 4316 [9 Pages]    |    Previous Page <==> Next Page    |    Jump to Page: [ 1  2  3  4  5  6  7  8  9  ]
Notes:   1- Column headers only sort the current page. 2- Select [NA] or [AA] links to show sequences.
Region Protein-ID Type Genome
Viewer		 Range
(bp)		 Show Sequences
(length) NA / AA		 BAKTA
Gene		 BAKTA
GeneProduct
2501 CAMIAM010000022.1 GCA946221375_01238 gene open 20643-20936
2502 CAMIAM010000022.1 GCA946221375_01239 gene open 21388-21615 mmeI
2503 CAMIAM010000022.1 GCA946221375_01240 gene open 21932-22786 erm(X)
2504 CAMIAM010000022.1 GCA946221375_01241 gene open 23322-23414
2505 CAMIAM010000022.1 GCA946221375_01242 gene open 23470-24555 ychF
2506 CAMIAM010000022.1 GCA946221375_01243 gene open 24626-26056
2507 CAMIAM010000022.1 GCA946221375_01244 gene open 26088-27137 rmuC
2508 CAMIAM010000022.1 GCA946221375_01245 gene open 27149-27796
2509 CAMIAM010000022.1 GCA946221375_01246 gene open 27797-28774
2510 CAMIAM010000022.1 GCA946221375_01247 gene open 28889-30154 xseA
2511 CAMIAM010000022.1 GCA946221375_01248 gene open 30166-30450
2512 CAMIAM010000022.1 GCA946221375_01249 gene open 30419-30997
2513 CAMIAM010000022.1 GCA946221375_01250 gene open 31118-32128 glpX
2514 CAMIAM010000022.1 GCA946221375_01251 gene open 32125-32799
2515 CAMIAM010000022.1 GCA946221375_01252 gene open 32904-34304
2516 CAMIAM010000022.1 GCA946221375_01253 gene open 34357-34860
2517 CAMIAM010000022.1 GCA946221375_01254 gene open 34888-35496 tetR
2518 CAMIAM010000022.1 GCA946221375_01255 gene open 35490-37061
2519 CAMIAM010000022.1 GCA946221375_01256 gene open 37058-37648
2520 CAMIAM010000022.1 GCA946221375_01257 gene open 37681-38022
2521 CAMIAM010000023.1 GCA946221375_01258 CDS open 788-1300 _na     170_aa dut dUTP diphosphatase
2522 CAMIAM010000023.1 GCA946221375_01259 CDS open 1363-1899 _na     178_aa Membrane protein
2523 CAMIAM010000023.1 GCA946221375_01260 CDS open 1979-2272 _na     97_aa dUTPase
2524 CAMIAM010000023.1 GCA946221375_01261 CDS open 2437-3195 _na     252_aa ppgK polyphosphate--glucose phosphotransferase
2525 CAMIAM010000023.1 GCA946221375_01262 CDS open 3361-4839 _na     492_aa RNA polymerase sigma factor
2526 CAMIAM010000023.1 GCA946221375_01263 CDS open 4914-5579 _na     221_aa DUF4190 domain-containing protein
2527 CAMIAM010000023.1 GCA946221375_01264 CDS open 5628-7388 _na     586_aa Helicase ATP-binding domain-containing protein
2528 CAMIAM010000023.1 GCA946221375_01265 CDS open 7385-7642 _na     85_aa DUF3039 domain-containing protein
2529 CAMIAM010000023.1 GCA946221375_01266 CDS open 7691-8242 _na     183_aa DUF3099 domain-containing protein
2530 CAMIAM010000023.1 GCA946221375_01267 CDS open 8268-9827 _na     519_aa rRNA methyltransferase
2531 CAMIAM010000023.1 GCA946221375_01268 CDS open 9836-10270 _na     144_aa dtd D-aminoacyl-tRNA deacylase
2532 CAMIAM010000023.1 GCA946221375_01269 CDS open 10381-11382 _na     333_aa RNA polymerase sigma factor
2533 CAMIAM010000023.1 GCA946221375_01270 CDS open 11511-12206 _na     231_aa Diphtheria toxin repressor
2534 CAMIAM010000023.1 GCA946221375_01271 CDS open 12203-13192 _na     329_aa galE UDP-glucose 4-epimerase GalE
2535 CAMIAM010000023.1 GCA946221375_01272 CDS open 13196-14347 _na     383_aa DUF4192 domain-containing protein
2536 CAMIAM010000023.1 GCA946221375_01273 CDS open 14561-15652 _na     363_aa Proteasome protein
2537 CAMIAM010000023.1 GCA946221375_01274 CDS open 15687-18227 _na     846_aa DEAD/DEAH box helicase
2538 CAMIAM010000023.1 GCA946221375_01275 CDS open 18324-19571 _na     415_aa D-amino acid dehydrogenase small subunit
2539 CAMIAM010000023.1 GCA946221375_01276 CDS open 19658-20182 _na     174_aa ahpD Alkyl hydroperoxide reductase AhpD
2540 CAMIAM010000023.1 GCA946221375_01277 CDS open 20204-20800 _na     198_aa Alkyl hydroperoxide reductase
2541 CAMIAM010000023.1 GCA946221375_01278 CDS open 20917-21873 _na     318_aa putative hydrogen peroxide-inducible genes activator
2542 CAMIAM010000023.1 GCA946221375_01279 CDS open 21889-25833 _na     1314_aa hrpA ATP-dependent RNA helicase HrpA
2543 CAMIAM010000023.1 GCA946221375_01280 CDS open 25861-26187 _na     108_aa nrdR Transcriptional repressor NrdR
2544 CAMIAM010000023.1 GCA946221375_01281 CDS open 26984-27664 _na     226_aa lexA transcriptional repressor LexA
2545 CAMIAM010000023.1 GCA946221375_01282 CDS open 27743-28528 _na     261_aa D-beta-D-heptose 1-phosphate adenosyltransferase
2546 CAMIAM010000023.1 GCA946221375_01283 CDS open 28698-29042 _na     114_aa hypothetical protein
2547 CAMIAM010000023.1 GCA946221375_01284 CDS open 29101-29370 _na     89_aa HPr family phosphocarrier protein
2548 CAMIAM010000023.1 GCA946221375_01285 CDS open 29442-30533 _na     363_aa uracil-xanthine permease family protein
2549 CAMIAM010000023.1 GCA946221375_01286 CDS open 30597-32066 _na     489_aa recombinase family protein
2550 CAMIAM010000023.1 GCA946221375_01287 CDS open 32394-32657 _na     87_aa hypothetical protein
2551 CAMIAM010000023.1 GCA946221375_01288 CDS open 32818-33141 _na     107_aa hypothetical protein
2552 CAMIAM010000023.1 GCA946221375_01289 CDS open 33146-34894 _na     582_aa DUF3987 domain-containing protein
2553 CAMIAM010000023.1 GCA946221375_01258 gene open 788-1300 dut
2554 CAMIAM010000023.1 GCA946221375_01259 gene open 1363-1899
2555 CAMIAM010000023.1 GCA946221375_01260 gene open 1979-2272
2556 CAMIAM010000023.1 GCA946221375_01261 gene open 2437-3195 ppgK
2557 CAMIAM010000023.1 GCA946221375_01262 gene open 3361-4839
2558 CAMIAM010000023.1 GCA946221375_01263 gene open 4914-5579
2559 CAMIAM010000023.1 GCA946221375_01264 gene open 5628-7388
2560 CAMIAM010000023.1 GCA946221375_01265 gene open 7385-7642
2561 CAMIAM010000023.1 GCA946221375_01266 gene open 7691-8242
2562 CAMIAM010000023.1 GCA946221375_01267 gene open 8268-9827
2563 CAMIAM010000023.1 GCA946221375_01268 gene open 9836-10270 dtd
2564 CAMIAM010000023.1 GCA946221375_01269 gene open 10381-11382
2565 CAMIAM010000023.1 GCA946221375_01270 gene open 11511-12206
2566 CAMIAM010000023.1 GCA946221375_01271 gene open 12203-13192 galE
2567 CAMIAM010000023.1 GCA946221375_01272 gene open 13196-14347
2568 CAMIAM010000023.1 GCA946221375_01273 gene open 14561-15652
2569 CAMIAM010000023.1 GCA946221375_01274 gene open 15687-18227
2570 CAMIAM010000023.1 GCA946221375_01275 gene open 18324-19571
2571 CAMIAM010000023.1 GCA946221375_01276 gene open 19658-20182 ahpD
2572 CAMIAM010000023.1 GCA946221375_01277 gene open 20204-20800
2573 CAMIAM010000023.1 GCA946221375_01278 gene open 20917-21873
2574 CAMIAM010000023.1 GCA946221375_01279 gene open 21889-25833 hrpA
2575 CAMIAM010000023.1 GCA946221375_01280 gene open 25861-26187 nrdR
2576 CAMIAM010000023.1 GCA946221375_01281 gene open 26984-27664 lexA
2577 CAMIAM010000023.1 GCA946221375_01282 gene open 27743-28528
2578 CAMIAM010000023.1 GCA946221375_01283 gene open 28698-29042
2579 CAMIAM010000023.1 GCA946221375_01284 gene open 29101-29370
2580 CAMIAM010000023.1 GCA946221375_01285 gene open 29442-30533
2581 CAMIAM010000023.1 GCA946221375_01286 gene open 30597-32066
2582 CAMIAM010000023.1 GCA946221375_01287 gene open 32394-32657
2583 CAMIAM010000023.1 GCA946221375_01288 gene open 32818-33141
2584 CAMIAM010000023.1 GCA946221375_01289 gene open 33146-34894
2585 CAMIAM010000024.1 GCA946221375_01299 gene open 9535-9630 Bacteria_small_SRP
2586 CAMIAM010000024.1 GCA946221375_01299 ncRNA open 9535-9630 Bacterial small signal recognition particle RNA
2587 CAMIAM010000024.1 GCA946221375_01291 CDS open 361-2766 _na     801_aa Multidrug RND transporter
2588 CAMIAM010000024.1 GCA946221375_01292 CDS open 2763-4016 _na     417_aa tgt tRNA guanosine(34) transglycosylase Tgt
2589 CAMIAM010000024.1 GCA946221375_01293 CDS open 3995-4663 _na     222_aa queuosine precursor transporter
2590 CAMIAM010000024.1 GCA946221375_01294 CDS open 4671-5582 _na     303_aa gluQRS tRNA glutamyl-Q(34) synthetase GluQRS
2591 CAMIAM010000024.1 GCA946221375_01295 CDS open 5666-6937 _na     423_aa Acid phosphatase
2592 CAMIAM010000024.1 GCA946221375_01296 CDS open 6941-8674 _na     577_aa Twin-arginine translocation signal domain-containing protein
2593 CAMIAM010000024.1 GCA946221375_01297 CDS open 8757-9257 _na     166_aa Ferritin
2594 CAMIAM010000024.1 GCA946221375_01300 CDS open 9652-10932 _na     426_aa Aminotransferase
2595 CAMIAM010000024.1 GCA946221375_01301 CDS open 10966-12903 _na     645_aa DNA polymerase III subunit gamma and tau
2596 CAMIAM010000024.1 GCA946221375_01302 CDS open 12953-13306 _na     117_aa YbaB/EbfC family nucleoid-associated protein
2597 CAMIAM010000024.1 GCA946221375_01303 CDS open 13371-13997 _na     208_aa recR recombination mediator RecR
2598 CAMIAM010000024.1 GCA946221375_01304 CDS open 13994-14713 _na     239_aa Cyclase
2599 CAMIAM010000024.1 GCA946221375_01305 CDS open 14738-15454 _na     238_aa gatD Lipid II isoglutaminyl synthase (glutamine-hydrolyzing) subunit GatD
2600 CAMIAM010000024.1 GCA946221375_01306 CDS open 15447-16772 _na     441_aa murT Lipid II isoglutaminyl synthase (glutamine-hydrolyzing) subunit MurT
2601 CAMIAM010000024.1 GCA946221375_01307 CDS open 16744-17718 _na     324_aa exonuclease domain-containing protein
2602 CAMIAM010000024.1 GCA946221375_01308 CDS open 17746-19572 _na     608_aa leuA 2-isopropylmalate synthase
2603 CAMIAM010000024.1 GCA946221375_01309 CDS open 19714-20565 _na     283_aa Membrane protein
2604 CAMIAM010000024.1 GCA946221375_01310 CDS open 20657-21922 _na     421_aa aspartate kinase
2605 CAMIAM010000024.1 GCA946221375_01311 CDS open 21936-22961 _na     341_aa aspartate-semialdehyde dehydrogenase
2606 CAMIAM010000024.1 GCA946221375_01312 CDS open 23088-24548 _na     486_aa ykvI Membrane protein YkvI
2607 CAMIAM010000024.1 GCA946221375_01313 CDS open 24574-25131 _na     185_aa DUF1541 domain-containing protein
2608 CAMIAM010000024.1 GCA946221375_01314 CDS open 25156-25695 _na     179_aa RNA polymerase sigma factor
2609 CAMIAM010000024.1 GCA946221375_01315 CDS open 25708-26043 _na     111_aa Na+/H+ antiporter subunit G
2610 CAMIAM010000024.1 GCA946221375_01316 CDS open 26045-26311 _na     88_aa Cation:proton antiporter
2611 CAMIAM010000024.1 GCA946221375_01317 CDS open 26315-26752 _na     145_aa monovalent cation/H+ antiporter subunit E
2612 CAMIAM010000024.1 GCA946221375_01318 CDS open 26752-28284 _na     510_aa Cation:proton antiporter
2613 CAMIAM010000024.1 GCA946221375_01319 CDS open 28284-28745 _na     153_aa Cation:proton antiporter subunit C
2614 CAMIAM010000024.1 GCA946221375_01320 CDS open 28749-31658 _na     969_aa DUF4040 domain-containing protein
2615 CAMIAM010000024.1 GCA946221375_01321 CDS open 31674-33194 _na     506_aa X-X-X-Leu-X-X-Gly heptad repeat-containing protein
2616 CAMIAM010000024.1 GCA946221375_01322 CDS open 33294-33509 _na     71_aa hypothetical protein
2617 CAMIAM010000024.1 GCA946221375_01323 CDS open 33727-35349 _na     540_aa hypothetical protein
2618 CAMIAM010000024.1 GCA946221375_01291 gene open 361-2766
2619 CAMIAM010000024.1 GCA946221375_01292 gene open 2763-4016 tgt
2620 CAMIAM010000024.1 GCA946221375_01293 gene open 3995-4663
2621 CAMIAM010000024.1 GCA946221375_01294 gene open 4671-5582 gluQRS
2622 CAMIAM010000024.1 GCA946221375_01295 gene open 5666-6937
2623 CAMIAM010000024.1 GCA946221375_01296 gene open 6941-8674
2624 CAMIAM010000024.1 GCA946221375_01297 gene open 8757-9257
2625 CAMIAM010000024.1 GCA946221375_01300 gene open 9652-10932
2626 CAMIAM010000024.1 GCA946221375_01301 gene open 10966-12903
2627 CAMIAM010000024.1 GCA946221375_01302 gene open 12953-13306
2628 CAMIAM010000024.1 GCA946221375_01303 gene open 13371-13997 recR
2629 CAMIAM010000024.1 GCA946221375_01304 gene open 13994-14713
2630 CAMIAM010000024.1 GCA946221375_01305 gene open 14738-15454 gatD
2631 CAMIAM010000024.1 GCA946221375_01306 gene open 15447-16772 murT
2632 CAMIAM010000024.1 GCA946221375_01307 gene open 16744-17718
2633 CAMIAM010000024.1 GCA946221375_01308 gene open 17746-19572 leuA
2634 CAMIAM010000024.1 GCA946221375_01309 gene open 19714-20565
2635 CAMIAM010000024.1 GCA946221375_01310 gene open 20657-21922
2636 CAMIAM010000024.1 GCA946221375_01311 gene open 21936-22961
2637 CAMIAM010000024.1 GCA946221375_01312 gene open 23088-24548 ykvI
2638 CAMIAM010000024.1 GCA946221375_01313 gene open 24574-25131
2639 CAMIAM010000024.1 GCA946221375_01314 gene open 25156-25695
2640 CAMIAM010000024.1 GCA946221375_01315 gene open 25708-26043
2641 CAMIAM010000024.1 GCA946221375_01316 gene open 26045-26311
2642 CAMIAM010000024.1 GCA946221375_01317 gene open 26315-26752
2643 CAMIAM010000024.1 GCA946221375_01318 gene open 26752-28284
2644 CAMIAM010000024.1 GCA946221375_01319 gene open 28284-28745
2645 CAMIAM010000024.1 GCA946221375_01320 gene open 28749-31658
2646 CAMIAM010000024.1 GCA946221375_01321 gene open 31674-33194
2647 CAMIAM010000024.1 GCA946221375_01322 gene open 33294-33509
2648 CAMIAM010000024.1 GCA946221375_01323 gene open 33727-35349
2649 CAMIAM010000024.1 GCA946221375_01290 gene open 207-291 trnS
2650 CAMIAM010000024.1 GCA946221375_01298 gene open 9312-9400 trnS
2651 CAMIAM010000024.1 GCA946221375_01290 tRNA open 207-291 trnS tRNA-Ser(cga)
2652 CAMIAM010000024.1 GCA946221375_01298 tRNA open 9312-9400 trnS tRNA-Ser(gga)
2653 CAMIAM010000025.1 regulatory_region open 2774-2854 L31-Corynebacteriaceae ribosomal protein leader
2654 CAMIAM010000025.1 GCA946221375_01324 CDS open 51-248 _na     65_aa hypothetical protein
2655 CAMIAM010000025.1 GCA946221375_01325 CDS open 265-825 _na     186_aa Molybdenum cofactor biosynthesis protein
2656 CAMIAM010000025.1 GCA946221375_01326 CDS open 876-2129 _na     417_aa PDZ domain-containing protein
2657 CAMIAM010000025.1 GCA946221375_01327 CDS open 2299-2472 _na     57_aa rpmF 50S ribosomal protein L32
2658 CAMIAM010000025.1 GCA946221375_01328 CDS open 2494-2763 _na     89_aa type B 50S ribosomal protein L31
2659 CAMIAM010000025.1 GCA946221375_01329 CDS open 2975-4105 _na     376_aa Citrate transporter-like domain-containing protein
2660 CAMIAM010000025.1 GCA946221375_01330 CDS open 4330-4566 _na     78_aa rpmB 50S ribosomal protein L28
2661 CAMIAM010000025.1 GCA946221375_01331 CDS open 4566-4730 _na     54_aa rpmG 50S ribosomal protein L33
2662 CAMIAM010000025.1 GCA946221375_01332 CDS open 4734-5039 _na     101_aa rpsN 30S ribosomal protein S14
2663 CAMIAM010000025.1 GCA946221375_01333 CDS open 5054-5302 _na     82_aa rpsR 30S ribosomal protein S18
2664 CAMIAM010000025.1 GCA946221375_01334 CDS open 5454-6131 _na     225_aa tetR TetR family transcriptional regulator
2665 CAMIAM010000025.1 GCA946221375_01335 CDS open 6132-6920 _na     262_aa Class A beta-lactamase-related serine hydrolase
2666 CAMIAM010000025.1 GCA946221375_01336 CDS open 7004-7594 _na     196_aa Serine/threonine protein kinase
2667 CAMIAM010000025.1 GCA946221375_01337 CDS open 7661-8521 _na     286_aa Serine hydrolase
2668 CAMIAM010000025.1 GCA946221375_01338 CDS open 8534-10081 _na     515_aa purH bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase
2669 CAMIAM010000025.1 GCA946221375_01339 CDS open 10071-10484 _na     137_aa phosphoribosylglycinamide formyltransferase 1
2670 CAMIAM010000025.1 GCA946221375_01340 CDS open 10669-11904 _na     411_aa DUF6350 domain-containing protein
2671 CAMIAM010000025.1 GCA946221375_01341 CDS open 12144-12884 _na     246_aa Membrane protein
2672 CAMIAM010000025.1 GCA946221375_01342 CDS open 13192-13890 _na     232_aa Peptidase M23
2673 CAMIAM010000025.1 GCA946221375_01343 CDS open 13896-16214 _na     772_aa pcrA DNA helicase PcrA
2674 CAMIAM010000025.1 GCA946221375_01344 CDS open 16282-16575 _na     97_aa chorismate mutase
2675 CAMIAM010000025.1 GCA946221375_01345 CDS open 16572-16892 _na     106_aa hmoA Heme-degrading monooxygenase HmoA
2676 CAMIAM010000025.1 GCA946221375_01346 CDS open 16990-18627 _na     545_aa pgi glucose-6-phosphate isomerase
2677 CAMIAM010000025.1 GCA946221375_01347 CDS open 18627-20114 _na     495_aa Glutamate--cysteine ligase
2678 CAMIAM010000025.1 GCA946221375_01348 CDS open 20130-20774 _na     214_aa VTT domain-containing protein
2679 CAMIAM010000025.1 GCA946221375_01349 CDS open 20713-21546 _na     277_aa DNA-(apurinic or apyrimidinic site) lyase
2680 CAMIAM010000025.1 GCA946221375_01350 CDS open 21557-21790 _na     77_aa Transposase
2681 CAMIAM010000025.1 GCA946221375_01351 CDS open 21874-23418 _na     514_aa DUF222 domain-containing protein
2682 CAMIAM010000025.1 GCA946221375_01352 CDS open 23441-28090 _na     1549_aa ATP-dependent helicase
2683 CAMIAM010000025.1 GCA946221375_01353 CDS open 28139-28912 _na     257_aa 3'(2')%2C5-bisphosphonucleoside 3'(2')-phosphohydrolase
2684 CAMIAM010000025.1 GCA946221375_01354 CDS open 28909-29706 _na     265_aa thymidylate synthase
2685 CAMIAM010000025.1 GCA946221375_01355 CDS open 29703-30194 _na     163_aa dihydrofolate reductase
2686 CAMIAM010000025.1 GCA946221375_01356 CDS open 30196-30480 _na     94_aa Glutaredoxin
2687 CAMIAM010000025.1 GCA946221375_01357 CDS open 30484-31203 _na     239_aa Membrane protein
2688 CAMIAM010000025.1 GCA946221375_01358 CDS open 31277-32671 _na     464_aa Pyridine nucleotide-disulfide oxidoreductase domain-containing protein 2
2689 CAMIAM010000025.1 GCA946221375_01359 CDS open 33451-33885 _na     144_aa hypothetical protein
2690 CAMIAM010000025.1 GCA946221375_01360 CDS open 34060-34305 _na     81_aa hypothetical protein
2691 CAMIAM010000025.1 GCA946221375_01324 gene open 51-248
2692 CAMIAM010000025.1 GCA946221375_01325 gene open 265-825
2693 CAMIAM010000025.1 GCA946221375_01326 gene open 876-2129
2694 CAMIAM010000025.1 GCA946221375_01327 gene open 2299-2472 rpmF
2695 CAMIAM010000025.1 GCA946221375_01328 gene open 2494-2763
2696 CAMIAM010000025.1 GCA946221375_01329 gene open 2975-4105
2697 CAMIAM010000025.1 GCA946221375_01330 gene open 4330-4566 rpmB
2698 CAMIAM010000025.1 GCA946221375_01331 gene open 4566-4730 rpmG
2699 CAMIAM010000025.1 GCA946221375_01332 gene open 4734-5039 rpsN
2700 CAMIAM010000025.1 GCA946221375_01333 gene open 5054-5302 rpsR
2701 CAMIAM010000025.1 GCA946221375_01334 gene open 5454-6131 tetR
2702 CAMIAM010000025.1 GCA946221375_01335 gene open 6132-6920
2703 CAMIAM010000025.1 GCA946221375_01336 gene open 7004-7594
2704 CAMIAM010000025.1 GCA946221375_01337 gene open 7661-8521
2705 CAMIAM010000025.1 GCA946221375_01338 gene open 8534-10081 purH
2706 CAMIAM010000025.1 GCA946221375_01339 gene open 10071-10484
2707 CAMIAM010000025.1 GCA946221375_01340 gene open 10669-11904
2708 CAMIAM010000025.1 GCA946221375_01341 gene open 12144-12884
2709 CAMIAM010000025.1 GCA946221375_01342 gene open 13192-13890
2710 CAMIAM010000025.1 GCA946221375_01343 gene open 13896-16214 pcrA
2711 CAMIAM010000025.1 GCA946221375_01344 gene open 16282-16575
2712 CAMIAM010000025.1 GCA946221375_01345 gene open 16572-16892 hmoA
2713 CAMIAM010000025.1 GCA946221375_01346 gene open 16990-18627 pgi
2714 CAMIAM010000025.1 GCA946221375_01347 gene open 18627-20114
2715 CAMIAM010000025.1 GCA946221375_01348 gene open 20130-20774
2716 CAMIAM010000025.1 GCA946221375_01349 gene open 20713-21546
2717 CAMIAM010000025.1 GCA946221375_01350 gene open 21557-21790
2718 CAMIAM010000025.1 GCA946221375_01351 gene open 21874-23418
2719 CAMIAM010000025.1 GCA946221375_01352 gene open 23441-28090
2720 CAMIAM010000025.1 GCA946221375_01353 gene open 28139-28912
2721 CAMIAM010000025.1 GCA946221375_01354 gene open 28909-29706
2722 CAMIAM010000025.1 GCA946221375_01355 gene open 29703-30194
2723 CAMIAM010000025.1 GCA946221375_01356 gene open 30196-30480
2724 CAMIAM010000025.1 GCA946221375_01357 gene open 30484-31203
2725 CAMIAM010000025.1 GCA946221375_01358 gene open 31277-32671
2726 CAMIAM010000025.1 GCA946221375_01359 gene open 33451-33885
2727 CAMIAM010000025.1 GCA946221375_01360 gene open 34060-34305
2728 CAMIAM010000026.1 repeat_region open 2770-3728 CRISPR array with 16 repeats of length 28%2C consensus sequence GTCTGCCCCGCACCCGCGGGGATGAGCC and spacer length 33
2729 CAMIAM010000026.1 repeat_region open 3977-4868 CRISPR array with 15 repeats of length 28%2C consensus sequence GTCTGCCCCGCACCCGCGGGGATGAGCC and spacer length 33
2730 CAMIAM010000026.1 repeat_region open 5316-5918 CRISPR array with 10 repeats of length 28%2C consensus sequence GTCTGCCCCGCACCCGCGGGGATGAGCC and spacer length 33
2731 CAMIAM010000026.1 GCA946221375_01361 CDS open 6459-7820 _na     453_aa Septum formation initiator
2732 CAMIAM010000026.1 GCA946221375_01362 CDS open 8099-9733 _na     544_aa AAA family ATPase
2733 CAMIAM010000026.1 GCA946221375_01363 CDS open 9885-10076 _na     63_aa hypothetical protein
2734 CAMIAM010000026.1 GCA946221375_01364 CDS open 10224-11528 _na     434_aa Phosphate transporter
2735 CAMIAM010000026.1 GCA946221375_01365 CDS open 11550-11807 _na     85_aa Secreted protein
2736 CAMIAM010000026.1 GCA946221375_01366 CDS open 11965-12081 _na     38_aa hypothetical protein
2737 CAMIAM010000026.1 GCA946221375_01367 CDS open 12158-12376 _na     72_aa hypothetical protein
2738 CAMIAM010000026.1 GCA946221375_01368 CDS open 12809-13225 _na     138_aa DUF488 domain-containing protein
2739 CAMIAM010000026.1 GCA946221375_01369 CDS open 13546-16389 _na     947_aa leuS leucine--tRNA ligase
2740 CAMIAM010000026.1 GCA946221375_01370 CDS open 16485-17468 _na     327_aa Transmembrane protein
2741 CAMIAM010000026.1 GCA946221375_01371 CDS open 17458-18408 _na     316_aa Acryloyl-CoA reductase
2742 CAMIAM010000026.1 GCA946221375_01372 CDS open 18432-18926 _na     164_aa vanZ VanZ family protein
2743 CAMIAM010000026.1 GCA946221375_01373 CDS open 18923-19288 _na     121_aa DUF202 domain-containing protein
2744 CAMIAM010000026.1 GCA946221375_01374 CDS open 19285-19599 _na     104_aa DUF202 domain-containing protein
2745 CAMIAM010000026.1 GCA946221375_01375 CDS open 19793-21079 _na     428_aa Plasmid pRiA4b Orf3-like domain-containing protein
2746 CAMIAM010000026.1 GCA946221375_01376 CDS open 21076-21618 _na     180_aa Pirin C-terminal domain-containing protein
2747 CAMIAM010000026.1 GCA946221375_01377 CDS open 21629-22231 _na     200_aa luxR LuxR family transcriptional regulator
2748 CAMIAM010000026.1 GCA946221375_01378 CDS open 22228-23370 _na     380_aa histidine kinase
2749 CAMIAM010000026.1 GCA946221375_01379 CDS open 23462-24448 _na     328_aa ABC transporter permease
2750 CAMIAM010000026.1 GCA946221375_01380 CDS open 24448-25077 _na     209_aa ABC transporter ATP-binding protein
2751 CAMIAM010000026.1 GCA946221375_01381 CDS open 25088-25675 _na     195_aa lysR LysR substrate-binding domain-containing protein
2752 CAMIAM010000026.1 GCA946221375_01382 CDS open 25516-26628 _na     370_aa Arabinose ABC transporter permease
2753 CAMIAM010000026.1 GCA946221375_01383 CDS open 26991-27944 _na     317_aa Pyridine nucleotide-disulfide oxidoreductase
2754 CAMIAM010000026.1 GCA946221375_01384 CDS open 27937-29478 _na     513_aa Bifunctional NAD(P)H-hydrate repair enzyme
2755 CAMIAM010000026.1 GCA946221375_01385 CDS open 29588-31114 _na     508_aa UPF0371 protein CUREI_11110
2756 CAMIAM010000026.1 GCA946221375_01386 CDS open 31169-31504 _na     111_aa DNA binding domain-containing protein%2C excisionase family
2757 CAMIAM010000026.1 GCA946221375_01387 CDS open 31505-32203 _na     232_aa GlcNAc-PI de-N-acetylase
2758 CAMIAM010000026.1 GCA946221375_01388 CDS open 32242-33117 _na     291_aa rhodanese-related sulfurtransferase
2759 CAMIAM010000026.1 GCA946221375_01389 CDS open 33114-33572 _na     152_aa Integral membrane protein
2760 CAMIAM010000026.1 GCA946221375_01390 CDS open 33584-34486 _na     300_aa Universal stress protein
2761 CAMIAM010000026.1 GCA946221375_01361 gene open 6459-7820
2762 CAMIAM010000026.1 GCA946221375_01362 gene open 8099-9733
2763 CAMIAM010000026.1 GCA946221375_01363 gene open 9885-10076
2764 CAMIAM010000026.1 GCA946221375_01364 gene open 10224-11528
2765 CAMIAM010000026.1 GCA946221375_01365 gene open 11550-11807
2766 CAMIAM010000026.1 GCA946221375_01366 gene open 11965-12081
2767 CAMIAM010000026.1 GCA946221375_01367 gene open 12158-12376
2768 CAMIAM010000026.1 GCA946221375_01368 gene open 12809-13225
2769 CAMIAM010000026.1 GCA946221375_01369 gene open 13546-16389 leuS
2770 CAMIAM010000026.1 GCA946221375_01370 gene open 16485-17468
2771 CAMIAM010000026.1 GCA946221375_01371 gene open 17458-18408
2772 CAMIAM010000026.1 GCA946221375_01372 gene open 18432-18926 vanZ
2773 CAMIAM010000026.1 GCA946221375_01373 gene open 18923-19288
2774 CAMIAM010000026.1 GCA946221375_01374 gene open 19285-19599
2775 CAMIAM010000026.1 GCA946221375_01375 gene open 19793-21079
2776 CAMIAM010000026.1 GCA946221375_01376 gene open 21076-21618
2777 CAMIAM010000026.1 GCA946221375_01377 gene open 21629-22231 luxR
2778 CAMIAM010000026.1 GCA946221375_01378 gene open 22228-23370
2779 CAMIAM010000026.1 GCA946221375_01379 gene open 23462-24448
2780 CAMIAM010000026.1 GCA946221375_01380 gene open 24448-25077
2781 CAMIAM010000026.1 GCA946221375_01381 gene open 25088-25675 lysR
2782 CAMIAM010000026.1 GCA946221375_01382 gene open 25516-26628
2783 CAMIAM010000026.1 GCA946221375_01383 gene open 26991-27944
2784 CAMIAM010000026.1 GCA946221375_01384 gene open 27937-29478
2785 CAMIAM010000026.1 GCA946221375_01385 gene open 29588-31114
2786 CAMIAM010000026.1 GCA946221375_01386 gene open 31169-31504
2787 CAMIAM010000026.1 GCA946221375_01387 gene open 31505-32203
2788 CAMIAM010000026.1 GCA946221375_01388 gene open 32242-33117
2789 CAMIAM010000026.1 GCA946221375_01389 gene open 33114-33572
2790 CAMIAM010000026.1 GCA946221375_01390 gene open 33584-34486
2791 CAMIAM010000027.1 GCA946221375_01391 CDS open 151-369 _na     72_aa whiA Sporulation regulator WhiA C-terminal domain-containing protein
2792 CAMIAM010000027.1 GCA946221375_01392 CDS open 608-1618 _na     336_aa gap type I glyceraldehyde-3-phosphate dehydrogenase
2793 CAMIAM010000027.1 GCA946221375_01393 CDS open 1711-2922 _na     403_aa Phosphoglycerate kinase
2794 CAMIAM010000027.1 GCA946221375_01394 CDS open 2948-3721 _na     257_aa tpiA triose-phosphate isomerase
2795 CAMIAM010000027.1 GCA946221375_01395 CDS open 3804-4040 _na     78_aa secG preprotein translocase subunit SecG
2796 CAMIAM010000027.1 GCA946221375_01396 CDS open 4053-4736 _na     227_aa 6-phosphogluconolactonase
2797 CAMIAM010000027.1 GCA946221375_01397 CDS open 4726-5655 _na     309_aa opcA Oxppcycle protein OpcA
2798 CAMIAM010000027.1 GCA946221375_01398 CDS open 5671-7125 _na     484_aa zwf glucose-6-phosphate dehydrogenase
2799 CAMIAM010000027.1 GCA946221375_01399 CDS open 7211-8302 _na     363_aa tal transaldolase
2800 CAMIAM010000027.1 GCA946221375_01400 CDS open 8346-10517 _na     723_aa tkt transketolase
2801 CAMIAM010000027.1 GCA946221375_01401 CDS open 10689-11603 _na     304_aa heme o synthase
2802 CAMIAM010000027.1 GCA946221375_01402 CDS open 11600-12556 _na     318_aa NADPH--quinone reductase
2803 CAMIAM010000027.1 GCA946221375_01403 CDS open 12558-13508 _na     316_aa Cytochrome B561
2804 CAMIAM010000027.1 GCA946221375_01404 CDS open 13558-14328 _na     256_aa Multidrug ABC transporter permease
2805 CAMIAM010000027.1 GCA946221375_01405 CDS open 14328-15254 _na     308_aa Spermidine/putrescine ABC transporter ATP-binding protein
2806 CAMIAM010000027.1 GCA946221375_01406 CDS open 15247-16881 _na     544_aa mptB polyprenol phosphomannose-dependent alpha 1%2C6 mannosyltransferase MptB
2807 CAMIAM010000027.1 GCA946221375_01407 CDS open 17194-17859 _na     221_aa Transcriptional regulator
2808 CAMIAM010000027.1 GCA946221375_01408 CDS open 17852-19297 _na     481_aa sufB Fe-S cluster assembly protein SufB
2809 CAMIAM010000027.1 GCA946221375_01409 CDS open 19298-20479 _na     393_aa sufD Fe-S cluster assembly protein SufD
2810 CAMIAM010000027.1 GCA946221375_01410 CDS open 20492-21247 _na     251_aa sufC Fe-S cluster assembly ATPase SufC
2811 CAMIAM010000027.1 GCA946221375_01411 CDS open 21247-22479 _na     410_aa cysteine desulfurase
2812 CAMIAM010000027.1 GCA946221375_01412 CDS open 22476-22925 _na     149_aa sufU Fe-S cluster assembly sulfur transfer protein SufU
2813 CAMIAM010000027.1 GCA946221375_01413 CDS open 22928-23320 _na     130_aa Metal-sulfur cluster biosynthetic enzyme
2814 CAMIAM010000027.1 GCA946221375_01414 CDS open 23615-24466 _na     283_aa Cutinase
2815 CAMIAM010000027.1 GCA946221375_01415 CDS open 24628-26256 _na     542_aa ccmA heme ABC exporter ATP-binding protein CcmA
2816 CAMIAM010000027.1 GCA946221375_01416 CDS open 26306-26551 _na     81_aa Cardiolipin synthase N-terminal domain-containing protein
2817 CAMIAM010000027.1 GCA946221375_01417 CDS open 26618-27982 _na     454_aa UPF0210 protein CUREI_06310
2818 CAMIAM010000027.1 GCA946221375_01418 CDS open 27993-28262 _na     89_aa ACT domain-containing protein
2819 CAMIAM010000027.1 GCA946221375_01419 CDS open 28304-28960 _na     218_aa Nucleoside-diphosphate sugar epimerase
2820 CAMIAM010000027.1 GCA946221375_01420 CDS open 28957-29679 _na     240_aa Glutamine amidotransferase
2821 CAMIAM010000027.1 GCA946221375_01421 CDS open 29717-30268 _na     183_aa tetR TetR family transcriptional regulator
2822 CAMIAM010000027.1 GCA946221375_01422 CDS open 30375-33320 _na     981_aa can aconitate hydratase
2823 CAMIAM010000027.1 GCA946221375_01423 CDS open 33361-33831 _na     156_aa 1-deoxy-D-xylulose-5-phosphate synthase
2824 CAMIAM010000027.1 GCA946221375_01391 gene open 151-369 whiA
2825 CAMIAM010000027.1 GCA946221375_01392 gene open 608-1618 gap
2826 CAMIAM010000027.1 GCA946221375_01393 gene open 1711-2922
2827 CAMIAM010000027.1 GCA946221375_01394 gene open 2948-3721 tpiA
2828 CAMIAM010000027.1 GCA946221375_01395 gene open 3804-4040 secG
2829 CAMIAM010000027.1 GCA946221375_01396 gene open 4053-4736
2830 CAMIAM010000027.1 GCA946221375_01397 gene open 4726-5655 opcA
2831 CAMIAM010000027.1 GCA946221375_01398 gene open 5671-7125 zwf
2832 CAMIAM010000027.1 GCA946221375_01399 gene open 7211-8302 tal
2833 CAMIAM010000027.1 GCA946221375_01400 gene open 8346-10517 tkt
2834 CAMIAM010000027.1 GCA946221375_01401 gene open 10689-11603
2835 CAMIAM010000027.1 GCA946221375_01402 gene open 11600-12556
2836 CAMIAM010000027.1 GCA946221375_01403 gene open 12558-13508
2837 CAMIAM010000027.1 GCA946221375_01404 gene open 13558-14328
2838 CAMIAM010000027.1 GCA946221375_01405 gene open 14328-15254
2839 CAMIAM010000027.1 GCA946221375_01406 gene open 15247-16881 mptB
2840 CAMIAM010000027.1 GCA946221375_01407 gene open 17194-17859
2841 CAMIAM010000027.1 GCA946221375_01408 gene open 17852-19297 sufB
2842 CAMIAM010000027.1 GCA946221375_01409 gene open 19298-20479 sufD
2843 CAMIAM010000027.1 GCA946221375_01410 gene open 20492-21247 sufC
2844 CAMIAM010000027.1 GCA946221375_01411 gene open 21247-22479
2845 CAMIAM010000027.1 GCA946221375_01412 gene open 22476-22925 sufU
2846 CAMIAM010000027.1 GCA946221375_01413 gene open 22928-23320
2847 CAMIAM010000027.1 GCA946221375_01414 gene open 23615-24466
2848 CAMIAM010000027.1 GCA946221375_01415 gene open 24628-26256 ccmA
2849 CAMIAM010000027.1 GCA946221375_01416 gene open 26306-26551
2850 CAMIAM010000027.1 GCA946221375_01417 gene open 26618-27982
2851 CAMIAM010000027.1 GCA946221375_01418 gene open 27993-28262
2852 CAMIAM010000027.1 GCA946221375_01419 gene open 28304-28960
2853 CAMIAM010000027.1 GCA946221375_01420 gene open 28957-29679
2854 CAMIAM010000027.1 GCA946221375_01421 gene open 29717-30268 tetR
2855 CAMIAM010000027.1 GCA946221375_01422 gene open 30375-33320 can
2856 CAMIAM010000027.1 GCA946221375_01423 gene open 33361-33831
2857 CAMIAM010000028.1 GCA946221375_01424 CDS open 17-292 _na     91_aa BRCT domain-containing protein
2858 CAMIAM010000028.1 GCA946221375_01425 CDS open 389-1054 _na     221_aa Amino acid-binding ACT domain protein
2859 CAMIAM010000028.1 GCA946221375_01426 CDS open 1156-1455 _na     99_aa gatC Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC
2860 CAMIAM010000028.1 GCA946221375_01427 CDS open 1462-2943 _na     493_aa gatA Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA
2861 CAMIAM010000028.1 GCA946221375_01428 CDS open 3008-4228 _na     406_aa Multidrug MFS transporter
2862 CAMIAM010000028.1 GCA946221375_01429 CDS open 4239-5270 _na     343_aa ATP-dependent 6-phosphofructokinase
2863 CAMIAM010000028.1 GCA946221375_01430 CDS open 5267-5998 _na     243_aa prsW PrsW family intramembrane metalloprotease
2864 CAMIAM010000028.1 GCA946221375_01431 CDS open 6112-6864 _na     250_aa hypothetical protein
2865 CAMIAM010000028.1 GCA946221375_01432 CDS open 6892-7221 _na     109_aa hypothetical protein
2866 CAMIAM010000028.1 GCA946221375_01433 CDS open 7188-8009 _na     273_aa Peptidase
2867 CAMIAM010000028.1 GCA946221375_01434 CDS open 8009-8542 _na     177_aa Secreted protein
2868 CAMIAM010000028.1 GCA946221375_01435 CDS open 8675-9256 _na     193_aa N-acetyltransferase domain-containing protein
2869 CAMIAM010000028.1 GCA946221375_01436 CDS open 9267-10142 _na     291_aa nadC carboxylating nicotinate-nucleotide diphosphorylase
2870 CAMIAM010000028.1 GCA946221375_01437 CDS open 10149-11201 _na     350_aa nadA quinolinate synthase NadA
2871 CAMIAM010000028.1 GCA946221375_01438 CDS open 11255-12241 _na     328_aa Bile acid:sodium symporter
2872 CAMIAM010000028.1 GCA946221375_01439 CDS open 12291-13793 _na     500_aa gatB Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB
2873 CAMIAM010000028.1 GCA946221375_01440 CDS open 14017-15420 _na     467_aa ykvI Membrane protein YkvI
2874 CAMIAM010000028.1 GCA946221375_01441 CDS open 15602-16444 _na     280_aa doxX DoxX family protein
2875 CAMIAM010000028.1 GCA946221375_01442 CDS open 16445-18283 _na     612_aa ilvD dihydroxy-acid dehydratase
2876 CAMIAM010000028.1 GCA946221375_01443 CDS open 18288-18836 _na     182_aa Low molecular weight protein antigen 6 PH domain-containing protein
2877 CAMIAM010000028.1 GCA946221375_01444 CDS open 19114-20940 _na     608_aa acetolactate synthase large subunit
2878 CAMIAM010000028.1 GCA946221375_01445 CDS open 20943-21461 _na     172_aa ilvN acetolactate synthase small subunit
2879 CAMIAM010000028.1 GCA946221375_01446 CDS open 21536-22552 _na     338_aa ilvC ketol-acid reductoisomerase
2880 CAMIAM010000028.1 GCA946221375_01447 CDS open 22688-23188 _na     166_aa lytR LytR family transcriptional regulator
2881 CAMIAM010000028.1 GCA946221375_01448 CDS open 23457-24368 _na     303_aa Cobalt-zinc-cadmium resistance protein
2882 CAMIAM010000028.1 GCA946221375_01449 CDS open 24384-26147 _na     587_aa GmrSD restriction endonucleases N-terminal domain-containing protein
2883 CAMIAM010000028.1 GCA946221375_01450 CDS open 26147-27016 _na     289_aa ABC transporter substrate-binding protein
2884 CAMIAM010000028.1 GCA946221375_01451 CDS open 27068-28018 _na     316_aa Phosphoglycerate dehydrogenase
2885 CAMIAM010000028.1 GCA946221375_01452 CDS open 28064-29080 _na     338_aa 3-isopropylmalate dehydrogenase
2886 CAMIAM010000028.1 GCA946221375_01453 CDS open 29091-30551 _na     486_aa Cell wall-binding repeat 2 family protein
2887 CAMIAM010000028.1 GCA946221375_01454 CDS open 30604-31407 _na     267_aa 2-hydroxyhepta-2%2C4-diene-1%2C7-dioate isomerase
2888 CAMIAM010000028.1 GCA946221375_01455 CDS open 31416-32531 _na     371_aa isochorismate synthase
2889 CAMIAM010000028.1 GCA946221375_01456 CDS open 32827-33723 _na     298_aa Polyhydroxybutyrate depolymerase
2890 CAMIAM010000028.1 GCA946221375_01424 gene open 17-292
2891 CAMIAM010000028.1 GCA946221375_01425 gene open 389-1054
2892 CAMIAM010000028.1 GCA946221375_01426 gene open 1156-1455 gatC
2893 CAMIAM010000028.1 GCA946221375_01427 gene open 1462-2943 gatA
2894 CAMIAM010000028.1 GCA946221375_01428 gene open 3008-4228
2895 CAMIAM010000028.1 GCA946221375_01429 gene open 4239-5270
2896 CAMIAM010000028.1 GCA946221375_01430 gene open 5267-5998 prsW
2897 CAMIAM010000028.1 GCA946221375_01431 gene open 6112-6864
2898 CAMIAM010000028.1 GCA946221375_01432 gene open 6892-7221
2899 CAMIAM010000028.1 GCA946221375_01433 gene open 7188-8009
2900 CAMIAM010000028.1 GCA946221375_01434 gene open 8009-8542
2901 CAMIAM010000028.1 GCA946221375_01435 gene open 8675-9256
2902 CAMIAM010000028.1 GCA946221375_01436 gene open 9267-10142 nadC
2903 CAMIAM010000028.1 GCA946221375_01437 gene open 10149-11201 nadA
2904 CAMIAM010000028.1 GCA946221375_01438 gene open 11255-12241
2905 CAMIAM010000028.1 GCA946221375_01439 gene open 12291-13793 gatB
2906 CAMIAM010000028.1 GCA946221375_01440 gene open 14017-15420 ykvI
2907 CAMIAM010000028.1 GCA946221375_01441 gene open 15602-16444 doxX
2908 CAMIAM010000028.1 GCA946221375_01442 gene open 16445-18283 ilvD
2909 CAMIAM010000028.1 GCA946221375_01443 gene open 18288-18836
2910 CAMIAM010000028.1 GCA946221375_01444 gene open 19114-20940
2911 CAMIAM010000028.1 GCA946221375_01445 gene open 20943-21461 ilvN
2912 CAMIAM010000028.1 GCA946221375_01446 gene open 21536-22552 ilvC
2913 CAMIAM010000028.1 GCA946221375_01447 gene open 22688-23188 lytR
2914 CAMIAM010000028.1 GCA946221375_01448 gene open 23457-24368
2915 CAMIAM010000028.1 GCA946221375_01449 gene open 24384-26147
2916 CAMIAM010000028.1 GCA946221375_01450 gene open 26147-27016
2917 CAMIAM010000028.1 GCA946221375_01451 gene open 27068-28018
2918 CAMIAM010000028.1 GCA946221375_01452 gene open 28064-29080
2919 CAMIAM010000028.1 GCA946221375_01453 gene open 29091-30551
2920 CAMIAM010000028.1 GCA946221375_01454 gene open 30604-31407
2921 CAMIAM010000028.1 GCA946221375_01455 gene open 31416-32531
2922 CAMIAM010000028.1 GCA946221375_01456 gene open 32827-33723
2923 CAMIAM010000029.1 GCA946221375_01457 CDS open 107-889 _na     260_aa hypothetical protein
2924 CAMIAM010000029.1 GCA946221375_01458 CDS open 1016-1219 _na     67_aa hypothetical protein
2925 CAMIAM010000029.1 GCA946221375_01459 CDS open 1286-1624 _na     112_aa hypothetical protein
2926 CAMIAM010000029.1 GCA946221375_01460 CDS open 1661-2083 _na     140_aa hypothetical protein
2927 CAMIAM010000029.1 GCA946221375_01461 CDS open 2241-4658 _na     805_aa Secreted protein
2928 CAMIAM010000029.1 GCA946221375_01462 CDS open 4655-5359 _na     234_aa NUDIX hydrolase
2929 CAMIAM010000029.1 GCA946221375_01463 CDS open 5367-6914 _na     515_aa CCA tRNA nucleotidyltransferase
2930 CAMIAM010000029.1 GCA946221375_01464 CDS open 6907-7515 _na     202_aa YqgE/AlgH family protein
2931 CAMIAM010000029.1 GCA946221375_01465 CDS open 7756-8103 _na     115_aa Branched-chain amino acid ABC transporter permease
2932 CAMIAM010000029.1 GCA946221375_01466 CDS open 8111-9466 _na     451_aa HNH nuclease domain-containing protein
2933 CAMIAM010000029.1 GCA946221375_01467 CDS open 9672-9977 _na     101_aa YCII-related domain-containing protein
2934 CAMIAM010000029.1 GCA946221375_01468 CDS open 9974-10927 _na     317_aa Membrane protein
2935 CAMIAM010000029.1 GCA946221375_01469 CDS open 10928-11275 _na     115_aa Iron-sulfur protein
2936 CAMIAM010000029.1 GCA946221375_01470 CDS open 11290-12105 _na     271_aa trpA tryptophan synthase subunit alpha
2937 CAMIAM010000029.1 GCA946221375_01471 CDS open 12106-13299 _na     397_aa trpB tryptophan synthase subunit beta
2938 CAMIAM010000029.1 GCA946221375_01472 CDS open 13312-14673 _na     453_aa trpF bifunctional indole-3-glycerol-phosphate synthase TrpC/phosphoribosylanthranilate isomerase TrpF
2939 CAMIAM010000029.1 GCA946221375_01473 CDS open 14666-15685 _na     339_aa Anthranilate phosphoribosyltransferase
2940 CAMIAM010000029.1 GCA946221375_01474 CDS open 15678-16289 _na     203_aa anthranilate synthase
2941 CAMIAM010000029.1 GCA946221375_01475 CDS open 16286-17788 _na     500_aa anthranilate synthase component 1
2942 CAMIAM010000029.1 GCA946221375_01476 CDS open 17968-18177 _na     69_aa HTH HARE-type domain-containing protein
2943 CAMIAM010000029.1 GCA946221375_01477 CDS open 18184-18645 _na     153_aa sdpI SdpI family protein
2944 CAMIAM010000029.1 GCA946221375_01478 CDS open 18720-19937 _na     405_aa Sodium:proton antiporter
2945 CAMIAM010000029.1 GCA946221375_01479 CDS open 20021-20728 _na     235_aa ethD EthD domain-containing protein
2946 CAMIAM010000029.1 GCA946221375_01480 CDS open 20744-22186 _na     480_aa DUF5129 domain-containing protein
2947 CAMIAM010000029.1 GCA946221375_01481 CDS open 22497-24344 _na     615_aa ATP-binding protein
2948 CAMIAM010000029.1 GCA946221375_01482 CDS open 24421-26298 _na     625_aa GIY-YIG domain-containing protein
2949 CAMIAM010000029.1 GCA946221375_01483 CDS open 26675-27199 _na     174_aa hypothetical protein
2950 CAMIAM010000029.1 GCA946221375_01484 CDS open 27616-28317 _na     233_aa cas6e type I-E CRISPR-associated protein Cas6/Cse3/CasE
2951 CAMIAM010000029.1 GCA946221375_01485 CDS open 28314-29036 _na     240_aa cas5e type I-E CRISPR-associated protein Cas5/CasD
2952 CAMIAM010000029.1 GCA946221375_01486 CDS open 29036-30166 _na     376_aa cas7e type I-E CRISPR-associated protein Cas7/Cse4/CasC
2953 CAMIAM010000029.1 GCA946221375_01487 CDS open 30190-30834 _na     214_aa casB type I-E CRISPR-associated protein Cse2/CasB
2954 CAMIAM010000029.1 GCA946221375_01488 CDS open 30831-32579 _na     582_aa casA type I-E CRISPR-associated protein Cse1/CasA
2955 CAMIAM010000029.1 GCA946221375_01489 CDS open 32636-32797 _na     53_aa hypothetical protein
2956 CAMIAM010000029.1 GCA946221375_01457 gene open 107-889
2957 CAMIAM010000029.1 GCA946221375_01458 gene open 1016-1219
2958 CAMIAM010000029.1 GCA946221375_01459 gene open 1286-1624
2959 CAMIAM010000029.1 GCA946221375_01460 gene open 1661-2083
2960 CAMIAM010000029.1 GCA946221375_01461 gene open 2241-4658
2961 CAMIAM010000029.1 GCA946221375_01462 gene open 4655-5359
2962 CAMIAM010000029.1 GCA946221375_01463 gene open 5367-6914
2963 CAMIAM010000029.1 GCA946221375_01464 gene open 6907-7515
2964 CAMIAM010000029.1 GCA946221375_01465 gene open 7756-8103
2965 CAMIAM010000029.1 GCA946221375_01466 gene open 8111-9466
2966 CAMIAM010000029.1 GCA946221375_01467 gene open 9672-9977
2967 CAMIAM010000029.1 GCA946221375_01468 gene open 9974-10927
2968 CAMIAM010000029.1 GCA946221375_01469 gene open 10928-11275
2969 CAMIAM010000029.1 GCA946221375_01470 gene open 11290-12105 trpA
2970 CAMIAM010000029.1 GCA946221375_01471 gene open 12106-13299 trpB
2971 CAMIAM010000029.1 GCA946221375_01472 gene open 13312-14673 trpF
2972 CAMIAM010000029.1 GCA946221375_01473 gene open 14666-15685
2973 CAMIAM010000029.1 GCA946221375_01474 gene open 15678-16289
2974 CAMIAM010000029.1 GCA946221375_01475 gene open 16286-17788
2975 CAMIAM010000029.1 GCA946221375_01476 gene open 17968-18177
2976 CAMIAM010000029.1 GCA946221375_01477 gene open 18184-18645 sdpI
2977 CAMIAM010000029.1 GCA946221375_01478 gene open 18720-19937
2978 CAMIAM010000029.1 GCA946221375_01479 gene open 20021-20728 ethD
2979 CAMIAM010000029.1 GCA946221375_01480 gene open 20744-22186
2980 CAMIAM010000029.1 GCA946221375_01481 gene open 22497-24344
2981 CAMIAM010000029.1 GCA946221375_01482 gene open 24421-26298
2982 CAMIAM010000029.1 GCA946221375_01483 gene open 26675-27199
2983 CAMIAM010000029.1 GCA946221375_01484 gene open 27616-28317 cas6e
2984 CAMIAM010000029.1 GCA946221375_01485 gene open 28314-29036 cas5e
2985 CAMIAM010000029.1 GCA946221375_01486 gene open 29036-30166 cas7e
2986 CAMIAM010000029.1 GCA946221375_01487 gene open 30190-30834 casB
2987 CAMIAM010000029.1 GCA946221375_01488 gene open 30831-32579 casA
2988 CAMIAM010000029.1 GCA946221375_01489 gene open 32636-32797
2989 CAMIAM010000030.1 GCA946221375_01490 CDS open 257-2359 _na     700_aa Ribonuclease J
2990 CAMIAM010000030.1 GCA946221375_01491 CDS open 2484-3110 _na     208_aa Mycothiol-dependent maleylpyruvate isomerase metal-binding domain-containing protein
2991 CAMIAM010000030.1 GCA946221375_01492 CDS open 3178-6294 _na     1038_aa ftsK DNA translocase FtsK
2992 CAMIAM010000030.1 GCA946221375_01493 CDS open 6481-7656 _na     391_aa terC Tellurium resistance protein TerC
2993 CAMIAM010000030.1 GCA946221375_01494 CDS open 7666-7950 _na     94_aa YCII-related domain-containing protein
2994 CAMIAM010000030.1 GCA946221375_01495 CDS open 8000-8539 _na     179_aa pgsA CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase
2995 CAMIAM010000030.1 GCA946221375_01496 CDS open 8536-9075 _na     179_aa Competence protein
2996 CAMIAM010000030.1 GCA946221375_01497 CDS open 9099-9470 _na     123_aa Transcriptional regulator
2997 CAMIAM010000030.1 GCA946221375_01498 CDS open 9542-10405 _na     287_aa PspA/IM30 family protein
2998 CAMIAM010000030.1 GCA946221375_01499 CDS open 10475-11080 _na     201_aa Cobalt ABC transporter permease
2999 CAMIAM010000030.1 GCA946221375_01500 CDS open 11077-11766 _na     229_aa Cobalt ABC transporter ATP-binding protein
3000 CAMIAM010000030.1 GCA946221375_01501 CDS open 11770-12336 _na     188_aa Biotin transporter