HOMD Banner
Taxonomy: V4.3   |  16S rRNA RefSeq: V16.03   |  Genomic RefSeq: V11.03   |  Viruses: V1.2

BAKTAGenome Explorer: Dermabacter hominis (GCA_946221715.1)

Select a Genome:
BAKTA Annotations for GCA_946221715.1
Genome Selected: Dermabacter hominis
ContigsBases CDSrRNA tmRNAtRNA
39 2145908 1907 3 1 45
[Table]   [AA Fasta]      [Browser]   [Text]   [Excel]  
Search & Sort all 3922 Records
Search These Records: Clear
Sort Column:   Molecule   PID   NA   AA   Gene  Gene Product  Reverse
Annotation Table [page:6]    |    Number of Records Found: 3922 [8 Pages]    |    Previous Page <==> Next Page    |    Jump to Page: [ 1  2  3  4  5  6  7  8  ]
Notes:   1- Column headers only sort the current page. 2- Select [NA] or [AA] links to show sequences.
Region Protein-ID Type Genome
Viewer		 Range
(bp)		 Show Sequences
(length) NA / AA		 BAKTA
Gene		 BAKTA
GeneProduct
2501 CAMIJK010000013.1 GCA946221715_01245 gene open 54620-54982
2502 CAMIJK010000013.1 GCA946221715_01246 gene open 55057-55677
2503 CAMIJK010000013.1 GCA946221715_01247 gene open 55718-56428 trkA
2504 CAMIJK010000013.1 GCA946221715_01248 gene open 56425-57093 trkA
2505 CAMIJK010000013.1 GCA946221715_01249 gene open 57238-59208
2506 CAMIJK010000013.1 GCA946221715_01250 gene open 59243-60568
2507 CAMIJK010000013.1 GCA946221715_01251 gene open 60608-63268 acnA
2508 CAMIJK010000013.1 GCA946221715_01252 gene open 63397-64077
2509 CAMIJK010000014.1 regulatory_region open 31982-32026 L31-Actinobacteria ribosomal protein leader
2510 CAMIJK010000014.1 GCA946221715_01253 CDS open 423-1508 _na     361_aa mnmA tRNA 2-thiouridine(34) synthase MnmA
2511 CAMIJK010000014.1 GCA946221715_01254 CDS open 1621-2754 _na     377_aa Aminotransferase class V domain-containing protein
2512 CAMIJK010000014.1 GCA946221715_01255 CDS open 2748-3629 _na     293_aa Tetratricopeptide repeat protein
2513 CAMIJK010000014.1 GCA946221715_01256 CDS open 3632-4642 _na     336_aa VWFA domain-containing protein
2514 CAMIJK010000014.1 GCA946221715_01257 CDS open 4639-5661 _na     340_aa VWFA domain-containing protein
2515 CAMIJK010000014.1 GCA946221715_01258 CDS open 5652-6116 _na     154_aa hypothetical protein
2516 CAMIJK010000014.1 GCA946221715_01259 CDS open 6103-6996 _na     297_aa mMP0362 DUF58 domain-containing protein
2517 CAMIJK010000014.1 GCA946221715_01260 CDS open 7005-8072 _na     355_aa mMP0363 AAA+ ATPase domain-containing protein
2518 CAMIJK010000014.1 GCA946221715_01261 CDS open 8246-10408 _na     720_aa glgX glycogen debranching protein GlgX
2519 CAMIJK010000014.1 GCA946221715_01262 CDS open 10446-12464 _na     672_aa amyA Alpha-1%2C4-glucan:maltose-1-phosphate maltosyltransferase
2520 CAMIJK010000014.1 GCA946221715_01263 CDS open 12489-14693 _na     734_aa glgB 1%2C4-alpha-glucan branching protein GlgB
2521 CAMIJK010000014.1 GCA946221715_01264 CDS open 14773-15645 _na     290_aa cnoX Thioredoxin domain-containing protein
2522 CAMIJK010000014.1 GCA946221715_01265 CDS open 15679-16713 _na     344_aa Lipoprotein
2523 CAMIJK010000014.1 GCA946221715_01266 CDS open 16710-17927 _na     405_aa hypothetical protein
2524 CAMIJK010000014.1 GCA946221715_01267 CDS open 18174-18776 _na     200_aa nucS endonuclease NucS
2525 CAMIJK010000014.1 GCA946221715_01268 CDS open 18777-19985 _na     402_aa N-acetylglucosamine-6-phosphate deacetylase
2526 CAMIJK010000014.1 GCA946221715_01269 CDS open 20112-20435 _na     107_aa atpC F0F1 ATP synthase subunit epsilon
2527 CAMIJK010000014.1 GCA946221715_01270 CDS open 20441-21925 _na     494_aa atpD F0F1 ATP synthase subunit beta
2528 CAMIJK010000014.1 GCA946221715_01271 CDS open 21953-22870 _na     305_aa atpG F0F1 ATP synthase subunit gamma
2529 CAMIJK010000014.1 GCA946221715_01272 CDS open 22915-24543 _na     542_aa atpA F0F1 ATP synthase subunit alpha
2530 CAMIJK010000014.1 GCA946221715_01273 CDS open 24615-25427 _na     270_aa atpH F0F1 ATP synthase subunit delta
2531 CAMIJK010000014.1 GCA946221715_01274 CDS open 25442-25984 _na     180_aa atpF F0F1 ATP synthase subunit B
2532 CAMIJK010000014.1 GCA946221715_01275 CDS open 25997-26257 _na     86_aa atpE ATP synthase F0 subunit C
2533 CAMIJK010000014.1 GCA946221715_01276 CDS open 26322-27128 _na     268_aa atpB F0F1 ATP synthase subunit A
2534 CAMIJK010000014.1 GCA946221715_01277 CDS open 27314-27733 _na     139_aa ATP synthase I
2535 CAMIJK010000014.1 GCA946221715_01278 CDS open 27730-28854 _na     374_aa rfe Phospho-N-acetylmuramoyl-pentapeptide-transferase
2536 CAMIJK010000014.1 GCA946221715_01279 CDS open 28851-29594 _na     247_aa L-threonylcarbamoyladenylate synthase
2537 CAMIJK010000014.1 GCA946221715_01280 CDS open 29591-30538 _na     315_aa prmC peptide chain release factor N(5)-glutamine methyltransferase
2538 CAMIJK010000014.1 GCA946221715_01281 CDS open 30545-31708 _na     387_aa prfA peptide chain release factor 1
2539 CAMIJK010000014.1 GCA946221715_01282 CDS open 31747-31959 _na     70_aa rpmE 50S ribosomal protein L31
2540 CAMIJK010000014.1 GCA946221715_01283 CDS open 32108-33961 _na     617_aa rho transcription termination factor Rho
2541 CAMIJK010000014.1 GCA946221715_01284 CDS open 34237-35166 _na     309_aa thrB homoserine kinase
2542 CAMIJK010000014.1 GCA946221715_01285 CDS open 35301-36701 _na     466_aa lysA diaminopimelate decarboxylase
2543 CAMIJK010000014.1 GCA946221715_01286 CDS open 36865-39123 _na     752_aa otsB bifunctional alpha%2Calpha-trehalose-phosphate synthase (UDP-forming)/trehalose-phosphatase
2544 CAMIJK010000014.1 GCA946221715_01287 CDS open 39219-42683 _na     1154_aa type I restriction endonuclease subunit R
2545 CAMIJK010000014.1 GCA946221715_01288 CDS open 42687-43877 _na     396_aa restriction endonuclease subunit S
2546 CAMIJK010000014.1 GCA946221715_01289 CDS open 43870-45051 _na     393_aa class I SAM-dependent DNA methyltransferase
2547 CAMIJK010000014.1 GCA946221715_01290 CDS open 45011-45871 _na     286_aa type I restriction-modification system subunit M N-terminal domain-containing protein
2548 CAMIJK010000014.1 GCA946221715_01291 CDS open 46494-47339 _na     281_aa hypothetical protein
2549 CAMIJK010000014.1 GCA946221715_01292 CDS open 47355-47798 _na     147_aa NTP pyrophosphohydrolase
2550 CAMIJK010000014.1 GCA946221715_01294 CDS open 47989-49248 _na     419_aa tyrosine-type recombinase/integrase
2551 CAMIJK010000014.1 GCA946221715_01295 CDS open 49448-49675 _na     75_aa helix-turn-helix domain-containing protein
2552 CAMIJK010000014.1 GCA946221715_01296 CDS open 49834-50808 _na     324_aa NAD-dependent epimerase
2553 CAMIJK010000014.1 GCA946221715_01297 CDS open 51379-51681 _na     100_aa helix-turn-helix domain-containing protein
2554 CAMIJK010000014.1 GCA946221715_01298 CDS open 51678-54674 _na     998_aa DNA-directed DNA polymerase
2555 CAMIJK010000014.1 GCA946221715_01299 CDS open 54712-55014 _na     100_aa hypothetical protein
2556 CAMIJK010000014.1 GCA946221715_01300 CDS open 55338-56849 _na     503_aa hypothetical protein
2557 CAMIJK010000014.1 GCA946221715_01301 CDS open 56892-57497 _na     201_aa hypothetical protein
2558 CAMIJK010000014.1 GCA946221715_01302 CDS open 57710-58267 _na     185_aa ardA antirestriction protein ArdA
2559 CAMIJK010000014.1 GCA946221715_01304 CDS open 58568-59620 _na     350_aa tsaD tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD
2560 CAMIJK010000014.1 GCA946221715_01305 CDS open 59611-60357 _na     248_aa Peptidase M23 domain-containing protein
2561 CAMIJK010000014.1 GCA946221715_01253 gene open 423-1508 mnmA
2562 CAMIJK010000014.1 GCA946221715_01254 gene open 1621-2754
2563 CAMIJK010000014.1 GCA946221715_01255 gene open 2748-3629
2564 CAMIJK010000014.1 GCA946221715_01256 gene open 3632-4642
2565 CAMIJK010000014.1 GCA946221715_01257 gene open 4639-5661
2566 CAMIJK010000014.1 GCA946221715_01258 gene open 5652-6116
2567 CAMIJK010000014.1 GCA946221715_01259 gene open 6103-6996 mMP0362
2568 CAMIJK010000014.1 GCA946221715_01260 gene open 7005-8072 mMP0363
2569 CAMIJK010000014.1 GCA946221715_01261 gene open 8246-10408 glgX
2570 CAMIJK010000014.1 GCA946221715_01262 gene open 10446-12464 amyA
2571 CAMIJK010000014.1 GCA946221715_01263 gene open 12489-14693 glgB
2572 CAMIJK010000014.1 GCA946221715_01264 gene open 14773-15645 cnoX
2573 CAMIJK010000014.1 GCA946221715_01265 gene open 15679-16713
2574 CAMIJK010000014.1 GCA946221715_01266 gene open 16710-17927
2575 CAMIJK010000014.1 GCA946221715_01267 gene open 18174-18776 nucS
2576 CAMIJK010000014.1 GCA946221715_01268 gene open 18777-19985
2577 CAMIJK010000014.1 GCA946221715_01269 gene open 20112-20435 atpC
2578 CAMIJK010000014.1 GCA946221715_01270 gene open 20441-21925 atpD
2579 CAMIJK010000014.1 GCA946221715_01271 gene open 21953-22870 atpG
2580 CAMIJK010000014.1 GCA946221715_01272 gene open 22915-24543 atpA
2581 CAMIJK010000014.1 GCA946221715_01273 gene open 24615-25427 atpH
2582 CAMIJK010000014.1 GCA946221715_01274 gene open 25442-25984 atpF
2583 CAMIJK010000014.1 GCA946221715_01275 gene open 25997-26257 atpE
2584 CAMIJK010000014.1 GCA946221715_01276 gene open 26322-27128 atpB
2585 CAMIJK010000014.1 GCA946221715_01277 gene open 27314-27733
2586 CAMIJK010000014.1 GCA946221715_01278 gene open 27730-28854 rfe
2587 CAMIJK010000014.1 GCA946221715_01279 gene open 28851-29594
2588 CAMIJK010000014.1 GCA946221715_01280 gene open 29591-30538 prmC
2589 CAMIJK010000014.1 GCA946221715_01281 gene open 30545-31708 prfA
2590 CAMIJK010000014.1 GCA946221715_01282 gene open 31747-31959 rpmE
2591 CAMIJK010000014.1 GCA946221715_01283 gene open 32108-33961 rho
2592 CAMIJK010000014.1 GCA946221715_01284 gene open 34237-35166 thrB
2593 CAMIJK010000014.1 GCA946221715_01285 gene open 35301-36701 lysA
2594 CAMIJK010000014.1 GCA946221715_01286 gene open 36865-39123 otsB
2595 CAMIJK010000014.1 GCA946221715_01287 gene open 39219-42683
2596 CAMIJK010000014.1 GCA946221715_01288 gene open 42687-43877
2597 CAMIJK010000014.1 GCA946221715_01289 gene open 43870-45051
2598 CAMIJK010000014.1 GCA946221715_01290 gene open 45011-45871
2599 CAMIJK010000014.1 GCA946221715_01291 gene open 46494-47339
2600 CAMIJK010000014.1 GCA946221715_01292 gene open 47355-47798
2601 CAMIJK010000014.1 GCA946221715_01294 gene open 47989-49248
2602 CAMIJK010000014.1 GCA946221715_01295 gene open 49448-49675
2603 CAMIJK010000014.1 GCA946221715_01296 gene open 49834-50808
2604 CAMIJK010000014.1 GCA946221715_01297 gene open 51379-51681
2605 CAMIJK010000014.1 GCA946221715_01298 gene open 51678-54674
2606 CAMIJK010000014.1 GCA946221715_01299 gene open 54712-55014
2607 CAMIJK010000014.1 GCA946221715_01300 gene open 55338-56849
2608 CAMIJK010000014.1 GCA946221715_01301 gene open 56892-57497
2609 CAMIJK010000014.1 GCA946221715_01302 gene open 57710-58267 ardA
2610 CAMIJK010000014.1 GCA946221715_01304 gene open 58568-59620 tsaD
2611 CAMIJK010000014.1 GCA946221715_01305 gene open 59611-60357
2612 CAMIJK010000014.1 GCA946221715_01293 gene open 47835-47932
2613 CAMIJK010000014.1 GCA946221715_01303 gene open 58433-58505 trnR
2614 CAMIJK010000014.1 GCA946221715_01293 tRNA open 47835-47932 tRNA-Xxx
2615 CAMIJK010000014.1 GCA946221715_01303 tRNA open 58433-58505 trnR tRNA-Arg(ccg)
2616 CAMIJK010000015.1 GCA946221715_01306 CDS open 126-593 _na     155_aa hypothetical protein
2617 CAMIJK010000015.1 GCA946221715_01308 CDS open 746-1387 _na     213_aa Alpha-ribazole phosphatase
2618 CAMIJK010000015.1 GCA946221715_01309 CDS open 1387-1776 _na     129_aa rsfS ribosome silencing factor
2619 CAMIJK010000015.1 GCA946221715_01310 CDS open 1773-2801 _na     342_aa hypothetical protein
2620 CAMIJK010000015.1 GCA946221715_01311 CDS open 2788-3396 _na     202_aa nadD nicotinate-nucleotide adenylyltransferase
2621 CAMIJK010000015.1 GCA946221715_01312 CDS open 3407-3616 _na     69_aa hypothetical protein
2622 CAMIJK010000015.1 GCA946221715_01313 CDS open 3705-4985 _na     426_aa glutamate-5-semialdehyde dehydrogenase
2623 CAMIJK010000015.1 GCA946221715_01314 CDS open 5023-6195 _na     390_aa Glutamate 5-kinase
2624 CAMIJK010000015.1 GCA946221715_01315 CDS open 6195-7733 _na     512_aa obgE GTPase ObgE
2625 CAMIJK010000015.1 GCA946221715_01316 CDS open 7882-8136 _na     84_aa rpmA 50S ribosomal protein L27
2626 CAMIJK010000015.1 GCA946221715_01317 CDS open 8170-8478 _na     102_aa rplU 50S ribosomal protein L21
2627 CAMIJK010000015.1 GCA946221715_01318 CDS open 8720-11674 _na     984_aa Rne/Rng family ribonuclease
2628 CAMIJK010000015.1 GCA946221715_01319 CDS open 12190-13764 _na     524_aa appC Cytochrome d ubiquinol oxidase subunit 1
2629 CAMIJK010000015.1 GCA946221715_01320 CDS open 13786-14874 _na     362_aa cydB cytochrome d ubiquinol oxidase subunit II
2630 CAMIJK010000015.1 GCA946221715_01321 CDS open 14948-16600 _na     550_aa cydD thiol reductant ABC exporter subunit CydD
2631 CAMIJK010000015.1 GCA946221715_01322 CDS open 16597-18450 _na     617_aa cydC thiol reductant ABC exporter subunit CydC
2632 CAMIJK010000015.1 GCA946221715_01323 CDS open 18425-19606 _na     393_aa sensor histidine kinase
2633 CAMIJK010000015.1 GCA946221715_01324 CDS open 19622-20245 _na     207_aa citB DNA-binding response regulator
2634 CAMIJK010000015.1 GCA946221715_01325 CDS open 20399-21361 _na     320_aa mutM bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase
2635 CAMIJK010000015.1 GCA946221715_01326 CDS open 21370-22119 _na     249_aa rnc ribonuclease III
2636 CAMIJK010000015.1 GCA946221715_01327 CDS open 22116-22736 _na     206_aa Metal-binding protein
2637 CAMIJK010000015.1 GCA946221715_01328 CDS open 22733-23248 _na     171_aa coaD pantetheine-phosphate adenylyltransferase
2638 CAMIJK010000015.1 GCA946221715_01329 CDS open 23258-23839 _na     193_aa rsmD RsmD family RNA methyltransferase
2639 CAMIJK010000015.1 GCA946221715_01330 CDS open 23842-26070 _na     742_aa recG ATP-dependent DNA helicase RecG
2640 CAMIJK010000015.1 GCA946221715_01331 CDS open 26150-26476 _na     108_aa Large ribosomal subunit protein bL28A
2641 CAMIJK010000015.1 GCA946221715_01332 CDS open 26608-27258 _na     216_aa Methyltransferase domain-containing protein
2642 CAMIJK010000015.1 GCA946221715_01333 CDS open 27277-28305 _na     342_aa thiL thiamine-phosphate kinase
2643 CAMIJK010000015.1 GCA946221715_01334 CDS open 28306-29430 _na     374_aa N-acetyltransferase domain-containing protein
2644 CAMIJK010000015.1 GCA946221715_01335 CDS open 29464-29994 _na     176_aa DUF3515 domain-containing protein
2645 CAMIJK010000015.1 GCA946221715_01336 CDS open 29998-31098 _na     366_aa ddlA D-alanine--D-alanine ligase
2646 CAMIJK010000015.1 GCA946221715_01337 CDS open 31109-32020 _na     303_aa Glycerol-3-phosphate dehydrogenase [NAD(P)+]
2647 CAMIJK010000015.1 GCA946221715_01338 CDS open 32112-32705 _na     197_aa DUF2867 domain-containing protein
2648 CAMIJK010000015.1 GCA946221715_01339 CDS open 32739-34055 _na     438_aa murA UDP-N-acetylglucosamine 1-carboxyvinyltransferase
2649 CAMIJK010000015.1 GCA946221715_01340 CDS open 34172-34783 _na     203_aa leuD 3-isopropylmalate dehydratase small subunit
2650 CAMIJK010000015.1 GCA946221715_01341 CDS open 34817-36253 _na     478_aa leuC 3-isopropylmalate dehydratase large subunit
2651 CAMIJK010000015.1 GCA946221715_01342 CDS open 36388-37119 _na     243_aa iclR IclR family transcriptional regulator
2652 CAMIJK010000015.1 GCA946221715_01343 CDS open 37146-37964 _na     272_aa uspA UspA domain-containing protein
2653 CAMIJK010000015.1 GCA946221715_01346 CDS open 38452-39612 _na     386_aa hydroxymethylglutaryl-CoA synthase
2654 CAMIJK010000015.1 GCA946221715_01347 CDS open 39609-40670 _na     353_aa hMG1 Hydroxymethylglutaryl-CoA reductase (NADPH)
2655 CAMIJK010000015.1 GCA946221715_01348 CDS open 40663-41748 _na     361_aa fni type 2 isopentenyl-diphosphate Delta-isomerase
2656 CAMIJK010000015.1 GCA946221715_01349 CDS open 41741-42868 _na     375_aa phosphomevalonate kinase
2657 CAMIJK010000015.1 GCA946221715_01350 CDS open 42865-43857 _na     330_aa mvaD diphosphomevalonate decarboxylase
2658 CAMIJK010000015.1 GCA946221715_01351 CDS open 43854-45026 _na     390_aa mvk mevalonate kinase
2659 CAMIJK010000015.1 GCA946221715_01352 CDS open 45023-46564 _na     513_aa gltX glutamate--tRNA ligase
2660 CAMIJK010000015.1 GCA946221715_01353 CDS open 46616-47407 _na     263_aa ycgM Fumarylacetoacetase-like C-terminal domain-containing protein
2661 CAMIJK010000015.1 GCA946221715_01354 CDS open 47607-48551 _na     314_aa 3-methyladenine DNA glycosylase
2662 CAMIJK010000015.1 GCA946221715_01355 CDS open 48600-49421 _na     273_aa Endonuclease/exonuclease/phosphatase domain-containing protein
2663 CAMIJK010000015.1 GCA946221715_01356 CDS open 49456-52014 _na     852_aa dob10 DEAD/DEAH box helicase
2664 CAMIJK010000015.1 GCA946221715_01357 CDS open 52011-52544 _na     177_aa PTS sugar transporter subunit IIA
2665 CAMIJK010000015.1 GCA946221715_01358 CDS open 52558-53226 _na     222_aa lexA LexA repressor DNA-binding domain-containing protein
2666 CAMIJK010000015.1 GCA946221715_01359 CDS open 53286-53624 _na     112_aa hypothetical protein
2667 CAMIJK010000015.1 GCA946221715_01360 CDS open 53723-53998 _na     91_aa MmeI-like C-terminal domain-containing protein
2668 CAMIJK010000015.1 GCA946221715_01361 CDS open 54013-54933 _na     306_aa hypothetical protein
2669 CAMIJK010000015.1 GCA946221715_01362 CDS open 54996-55547 _na     183_aa hypothetical protein
2670 CAMIJK010000015.1 GCA946221715_01363 CDS open 56739-57080 _na     113_aa hypothetical protein
2671 CAMIJK010000015.1 GCA946221715_01306 gene open 126-593
2672 CAMIJK010000015.1 GCA946221715_01308 gene open 746-1387
2673 CAMIJK010000015.1 GCA946221715_01309 gene open 1387-1776 rsfS
2674 CAMIJK010000015.1 GCA946221715_01310 gene open 1773-2801
2675 CAMIJK010000015.1 GCA946221715_01311 gene open 2788-3396 nadD
2676 CAMIJK010000015.1 GCA946221715_01312 gene open 3407-3616
2677 CAMIJK010000015.1 GCA946221715_01313 gene open 3705-4985
2678 CAMIJK010000015.1 GCA946221715_01314 gene open 5023-6195
2679 CAMIJK010000015.1 GCA946221715_01315 gene open 6195-7733 obgE
2680 CAMIJK010000015.1 GCA946221715_01316 gene open 7882-8136 rpmA
2681 CAMIJK010000015.1 GCA946221715_01317 gene open 8170-8478 rplU
2682 CAMIJK010000015.1 GCA946221715_01318 gene open 8720-11674
2683 CAMIJK010000015.1 GCA946221715_01319 gene open 12190-13764 appC
2684 CAMIJK010000015.1 GCA946221715_01320 gene open 13786-14874 cydB
2685 CAMIJK010000015.1 GCA946221715_01321 gene open 14948-16600 cydD
2686 CAMIJK010000015.1 GCA946221715_01322 gene open 16597-18450 cydC
2687 CAMIJK010000015.1 GCA946221715_01323 gene open 18425-19606
2688 CAMIJK010000015.1 GCA946221715_01324 gene open 19622-20245 citB
2689 CAMIJK010000015.1 GCA946221715_01325 gene open 20399-21361 mutM
2690 CAMIJK010000015.1 GCA946221715_01326 gene open 21370-22119 rnc
2691 CAMIJK010000015.1 GCA946221715_01327 gene open 22116-22736
2692 CAMIJK010000015.1 GCA946221715_01328 gene open 22733-23248 coaD
2693 CAMIJK010000015.1 GCA946221715_01329 gene open 23258-23839 rsmD
2694 CAMIJK010000015.1 GCA946221715_01330 gene open 23842-26070 recG
2695 CAMIJK010000015.1 GCA946221715_01331 gene open 26150-26476
2696 CAMIJK010000015.1 GCA946221715_01332 gene open 26608-27258
2697 CAMIJK010000015.1 GCA946221715_01333 gene open 27277-28305 thiL
2698 CAMIJK010000015.1 GCA946221715_01334 gene open 28306-29430
2699 CAMIJK010000015.1 GCA946221715_01335 gene open 29464-29994
2700 CAMIJK010000015.1 GCA946221715_01336 gene open 29998-31098 ddlA
2701 CAMIJK010000015.1 GCA946221715_01337 gene open 31109-32020
2702 CAMIJK010000015.1 GCA946221715_01338 gene open 32112-32705
2703 CAMIJK010000015.1 GCA946221715_01339 gene open 32739-34055 murA
2704 CAMIJK010000015.1 GCA946221715_01340 gene open 34172-34783 leuD
2705 CAMIJK010000015.1 GCA946221715_01341 gene open 34817-36253 leuC
2706 CAMIJK010000015.1 GCA946221715_01342 gene open 36388-37119 iclR
2707 CAMIJK010000015.1 GCA946221715_01343 gene open 37146-37964 uspA
2708 CAMIJK010000015.1 GCA946221715_01346 gene open 38452-39612
2709 CAMIJK010000015.1 GCA946221715_01347 gene open 39609-40670 hMG1
2710 CAMIJK010000015.1 GCA946221715_01348 gene open 40663-41748 fni
2711 CAMIJK010000015.1 GCA946221715_01349 gene open 41741-42868
2712 CAMIJK010000015.1 GCA946221715_01350 gene open 42865-43857 mvaD
2713 CAMIJK010000015.1 GCA946221715_01351 gene open 43854-45026 mvk
2714 CAMIJK010000015.1 GCA946221715_01352 gene open 45023-46564 gltX
2715 CAMIJK010000015.1 GCA946221715_01353 gene open 46616-47407 ycgM
2716 CAMIJK010000015.1 GCA946221715_01354 gene open 47607-48551
2717 CAMIJK010000015.1 GCA946221715_01355 gene open 48600-49421
2718 CAMIJK010000015.1 GCA946221715_01356 gene open 49456-52014 dob10
2719 CAMIJK010000015.1 GCA946221715_01357 gene open 52011-52544
2720 CAMIJK010000015.1 GCA946221715_01358 gene open 52558-53226 lexA
2721 CAMIJK010000015.1 GCA946221715_01359 gene open 53286-53624
2722 CAMIJK010000015.1 GCA946221715_01360 gene open 53723-53998
2723 CAMIJK010000015.1 GCA946221715_01361 gene open 54013-54933
2724 CAMIJK010000015.1 GCA946221715_01362 gene open 54996-55547
2725 CAMIJK010000015.1 GCA946221715_01363 gene open 56739-57080
2726 CAMIJK010000015.1 GCA946221715_01307 gene open 627-699 trnA
2727 CAMIJK010000015.1 GCA946221715_01344 gene open 38093-38165 trnE
2728 CAMIJK010000015.1 GCA946221715_01345 gene open 38242-38313 trnQ
2729 CAMIJK010000015.1 GCA946221715_01307 tRNA open 627-699 trnA tRNA-Ala(ggc)
2730 CAMIJK010000015.1 GCA946221715_01344 tRNA open 38093-38165 trnE tRNA-Glu(ctc)
2731 CAMIJK010000015.1 GCA946221715_01345 tRNA open 38242-38313 trnQ tRNA-Gln(ctg)
2732 CAMIJK010000016.1 GCA946221715_01364 CDS open 237-431 _na     64_aa Redoxin domain-containing protein
2733 CAMIJK010000016.1 GCA946221715_01365 CDS open 428-580 _na     50_aa hypothetical protein
2734 CAMIJK010000016.1 GCA946221715_01366 CDS open 620-2284 _na     554_aa aspartate:alanine exchanger family transporter
2735 CAMIJK010000016.1 GCA946221715_01367 CDS open 2341-3021 _na     226_aa msrA peptide-methionine (S)-S-oxide reductase MsrA
2736 CAMIJK010000016.1 GCA946221715_01368 CDS open 3018-3476 _na     152_aa TIGR00299 family protein
2737 CAMIJK010000016.1 GCA946221715_01369 CDS open 3469-4422 _na     317_aa TIGR00299 family protein
2738 CAMIJK010000016.1 GCA946221715_01370 CDS open 4449-5783 _na     444_aa larA LarA-like N-terminal domain-containing protein
2739 CAMIJK010000016.1 GCA946221715_01371 CDS open 5780-6640 _na     286_aa larE ATP-dependent sacrificial sulfur transferase LarE
2740 CAMIJK010000016.1 GCA946221715_01372 CDS open 6637-7362 _na     241_aa larB nickel pincer cofactor biosynthesis protein LarB
2741 CAMIJK010000016.1 GCA946221715_01373 CDS open 7370-8671 _na     433_aa dctQ TRAP transporter%2C DctM subunit
2742 CAMIJK010000016.1 GCA946221715_01374 CDS open 8668-9240 _na     190_aa dctM TRAP transporter%2C DctQ-like membrane protein
2743 CAMIJK010000016.1 GCA946221715_01375 CDS open 9246-10271 _na     341_aa dctP DctP family TRAP transporter solute receptor
2744 CAMIJK010000016.1 GCA946221715_01376 CDS open 10305-12818 _na     837_aa yicI Glycoside hydrolase family 31 N-terminal domain-containing protein
2745 CAMIJK010000016.1 GCA946221715_01377 CDS open 12971-14008 _na     345_aa HTH lacI-type domain-containing protein
2746 CAMIJK010000016.1 GCA946221715_01378 CDS open 14011-15447 _na     478_aa uxaC glucuronate isomerase
2747 CAMIJK010000016.1 GCA946221715_01379 CDS open 15447-16847 _na     466_aa Mannitol dehydrogenase C-terminal domain-containing protein
2748 CAMIJK010000016.1 GCA946221715_01380 CDS open 16858-18150 _na     430_aa THUMP-like domain-containing protein
2749 CAMIJK010000016.1 GCA946221715_01381 CDS open 18173-19090 _na     305_aa ugpE ABC transmembrane type-1 domain-containing protein
2750 CAMIJK010000016.1 GCA946221715_01382 CDS open 19087-20073 _na     328_aa ugpA ABC transmembrane type-1 domain-containing protein
2751 CAMIJK010000016.1 GCA946221715_01383 CDS open 20153-21463 _na     436_aa ABC transporter substrate-binding protein
2752 CAMIJK010000016.1 GCA946221715_01384 CDS open 21647-22933 _na     428_aa Molybdopterin molybdenumtransferase
2753 CAMIJK010000016.1 GCA946221715_01385 CDS open 22973-23266 _na     97_aa DUF6457 domain-containing protein
2754 CAMIJK010000016.1 GCA946221715_01386 CDS open 23263-23901 _na     212_aa DUF304 domain-containing protein
2755 CAMIJK010000016.1 GCA946221715_01387 CDS open 24009-25715 _na     568_aa ddpA Tat (Twin-arginine translocation) pathway signal sequence
2756 CAMIJK010000016.1 GCA946221715_01388 CDS open 25908-27641 _na     577_aa ddpA Solute-binding protein family 5 domain-containing protein
2757 CAMIJK010000016.1 GCA946221715_01389 CDS open 27715-29790 _na     691_aa oppF murein tripeptide/oligopeptide ABC transporter ATP binding protein OppF
2758 CAMIJK010000016.1 GCA946221715_01390 CDS open 29783-30781 _na     332_aa dppC ABC transmembrane type-1 domain-containing protein
2759 CAMIJK010000016.1 GCA946221715_01391 CDS open 30786-31781 _na     331_aa dppB ABC transmembrane type-1 domain-containing protein
2760 CAMIJK010000016.1 GCA946221715_01392 CDS open 32154-33320 _na     388_aa Rhodanese domain-containing protein
2761 CAMIJK010000016.1 GCA946221715_01393 CDS open 33621-34592 _na     323_aa DUF559 domain-containing protein
2762 CAMIJK010000016.1 GCA946221715_01394 CDS open 34827-35111 _na     94_aa thiS ThiS family protein
2763 CAMIJK010000016.1 GCA946221715_01395 CDS open 35116-36327 _na     403_aa moaA GTP 3'%2C8-cyclase MoaA
2764 CAMIJK010000016.1 GCA946221715_01396 CDS open 36344-37768 _na     474_aa glp gephyrin-like molybdotransferase Glp
2765 CAMIJK010000016.1 GCA946221715_01397 CDS open 37765-38292 _na     175_aa moaC cyclic pyranopterin monophosphate synthase MoaC
2766 CAMIJK010000016.1 GCA946221715_01398 CDS open 38289-38783 _na     164_aa moaB Molybdenum cofactor synthesis domain-containing protein
2767 CAMIJK010000016.1 GCA946221715_01399 CDS open 38780-39268 _na     162_aa moaE Molybdenum cofactor biosynthesis protein MoaE
2768 CAMIJK010000016.1 GCA946221715_01400 CDS open 39370-39543 _na     57_aa hypothetical protein
2769 CAMIJK010000016.1 GCA946221715_01401 CDS open 39992-40288 _na     98_aa groES co-chaperone GroES
2770 CAMIJK010000016.1 GCA946221715_01402 CDS open 40299-41885 _na     528_aa groL chaperonin GroEL
2771 CAMIJK010000016.1 GCA946221715_01403 CDS open 42039-42782 _na     247_aa hypothetical protein
2772 CAMIJK010000016.1 GCA946221715_01404 CDS open 42812-43789 _na     325_aa Pseudouridine synthase RsuA/RluA-like domain-containing protein
2773 CAMIJK010000016.1 GCA946221715_01405 CDS open 43782-44423 _na     213_aa hypothetical protein
2774 CAMIJK010000016.1 GCA946221715_01406 CDS open 44433-45929 _na     498_aa guaB IMP dehydrogenase
2775 CAMIJK010000016.1 GCA946221715_01407 CDS open 45939-49316 _na     1125_aa lolD ABC transporter domain-containing protein
2776 CAMIJK010000016.1 GCA946221715_01408 CDS open 49407-50111 _na     234_aa dnaQ Exonuclease domain-containing protein
2777 CAMIJK010000016.1 GCA946221715_01409 CDS open 50122-51234 _na     370_aa guaB GuaB3 family IMP dehydrogenase-related protein
2778 CAMIJK010000016.1 GCA946221715_01410 CDS open 51297-52493 _na     398_aa ackA Acetate kinase
2779 CAMIJK010000016.1 GCA946221715_01411 CDS open 52533-54581 _na     682_aa pta phosphate acetyltransferase
2780 CAMIJK010000016.1 GCA946221715_01412 CDS open 54676-55602 _na     308_aa SURF1-like protein
2781 CAMIJK010000016.1 GCA946221715_01413 CDS open 55638-56018 _na     126_aa Integral membrane protein
2782 CAMIJK010000016.1 GCA946221715_01414 CDS open 56044-57648 _na     534_aa guaA glutamine-hydrolyzing GMP synthase
2783 CAMIJK010000016.1 GCA946221715_01364 gene open 237-431
2784 CAMIJK010000016.1 GCA946221715_01365 gene open 428-580
2785 CAMIJK010000016.1 GCA946221715_01366 gene open 620-2284
2786 CAMIJK010000016.1 GCA946221715_01367 gene open 2341-3021 msrA
2787 CAMIJK010000016.1 GCA946221715_01368 gene open 3018-3476
2788 CAMIJK010000016.1 GCA946221715_01369 gene open 3469-4422
2789 CAMIJK010000016.1 GCA946221715_01370 gene open 4449-5783 larA
2790 CAMIJK010000016.1 GCA946221715_01371 gene open 5780-6640 larE
2791 CAMIJK010000016.1 GCA946221715_01372 gene open 6637-7362 larB
2792 CAMIJK010000016.1 GCA946221715_01373 gene open 7370-8671 dctQ
2793 CAMIJK010000016.1 GCA946221715_01374 gene open 8668-9240 dctM
2794 CAMIJK010000016.1 GCA946221715_01375 gene open 9246-10271 dctP
2795 CAMIJK010000016.1 GCA946221715_01376 gene open 10305-12818 yicI
2796 CAMIJK010000016.1 GCA946221715_01377 gene open 12971-14008
2797 CAMIJK010000016.1 GCA946221715_01378 gene open 14011-15447 uxaC
2798 CAMIJK010000016.1 GCA946221715_01379 gene open 15447-16847
2799 CAMIJK010000016.1 GCA946221715_01380 gene open 16858-18150
2800 CAMIJK010000016.1 GCA946221715_01381 gene open 18173-19090 ugpE
2801 CAMIJK010000016.1 GCA946221715_01382 gene open 19087-20073 ugpA
2802 CAMIJK010000016.1 GCA946221715_01383 gene open 20153-21463
2803 CAMIJK010000016.1 GCA946221715_01384 gene open 21647-22933
2804 CAMIJK010000016.1 GCA946221715_01385 gene open 22973-23266
2805 CAMIJK010000016.1 GCA946221715_01386 gene open 23263-23901
2806 CAMIJK010000016.1 GCA946221715_01387 gene open 24009-25715 ddpA
2807 CAMIJK010000016.1 GCA946221715_01388 gene open 25908-27641 ddpA
2808 CAMIJK010000016.1 GCA946221715_01389 gene open 27715-29790 oppF
2809 CAMIJK010000016.1 GCA946221715_01390 gene open 29783-30781 dppC
2810 CAMIJK010000016.1 GCA946221715_01391 gene open 30786-31781 dppB
2811 CAMIJK010000016.1 GCA946221715_01392 gene open 32154-33320
2812 CAMIJK010000016.1 GCA946221715_01393 gene open 33621-34592
2813 CAMIJK010000016.1 GCA946221715_01394 gene open 34827-35111 thiS
2814 CAMIJK010000016.1 GCA946221715_01395 gene open 35116-36327 moaA
2815 CAMIJK010000016.1 GCA946221715_01396 gene open 36344-37768 glp
2816 CAMIJK010000016.1 GCA946221715_01397 gene open 37765-38292 moaC
2817 CAMIJK010000016.1 GCA946221715_01398 gene open 38289-38783 moaB
2818 CAMIJK010000016.1 GCA946221715_01399 gene open 38780-39268 moaE
2819 CAMIJK010000016.1 GCA946221715_01400 gene open 39370-39543
2820 CAMIJK010000016.1 GCA946221715_01401 gene open 39992-40288 groES
2821 CAMIJK010000016.1 GCA946221715_01402 gene open 40299-41885 groL
2822 CAMIJK010000016.1 GCA946221715_01403 gene open 42039-42782
2823 CAMIJK010000016.1 GCA946221715_01404 gene open 42812-43789
2824 CAMIJK010000016.1 GCA946221715_01405 gene open 43782-44423
2825 CAMIJK010000016.1 GCA946221715_01406 gene open 44433-45929 guaB
2826 CAMIJK010000016.1 GCA946221715_01407 gene open 45939-49316 lolD
2827 CAMIJK010000016.1 GCA946221715_01408 gene open 49407-50111 dnaQ
2828 CAMIJK010000016.1 GCA946221715_01409 gene open 50122-51234 guaB
2829 CAMIJK010000016.1 GCA946221715_01410 gene open 51297-52493 ackA
2830 CAMIJK010000016.1 GCA946221715_01411 gene open 52533-54581 pta
2831 CAMIJK010000016.1 GCA946221715_01412 gene open 54676-55602
2832 CAMIJK010000016.1 GCA946221715_01413 gene open 55638-56018
2833 CAMIJK010000016.1 GCA946221715_01414 gene open 56044-57648 guaA
2834 CAMIJK010000017.1 repeat_region open 35286-35779 CRISPR array with 8 repeats of length 36%2C consensus sequence GTTTCAATCTCTCTCCCGAGAACCCCTGTAGACTTT and spacer length 28
2835 CAMIJK010000017.1 GCA946221715_01415 CDS open 613-1818 _na     401_aa hypothetical protein
2836 CAMIJK010000017.1 GCA946221715_01416 CDS open 1924-2274 _na     116_aa HTH arsR-type domain-containing protein
2837 CAMIJK010000017.1 GCA946221715_01417 CDS open 2267-3214 _na     315_aa czcD Cation diffusion facilitator family transporter
2838 CAMIJK010000017.1 GCA946221715_01418 CDS open 3323-4024 _na     233_aa Uracil-DNA glycosylase-like domain-containing protein
2839 CAMIJK010000017.1 GCA946221715_01419 CDS open 4115-5056 _na     313_aa mrr Restriction endonuclease
2840 CAMIJK010000017.1 GCA946221715_01420 CDS open 5107-5934 _na     275_aa TIM-barrel domain-containing protein
2841 CAMIJK010000017.1 GCA946221715_01421 CDS open 5936-7177 _na     413_aa Tm-1-like ATP-binding domain-containing protein
2842 CAMIJK010000017.1 GCA946221715_01422 CDS open 7540-7785 _na     81_aa hypothetical protein
2843 CAMIJK010000017.1 GCA946221715_01423 CDS open 8438-8776 _na     112_aa WXG100 family type VII secretion target
2844 CAMIJK010000017.1 GCA946221715_01424 CDS open 8803-10050 _na     415_aa LXG domain-containing protein
2845 CAMIJK010000017.1 GCA946221715_01425 CDS open 10124-10639 _na     171_aa MmyB-like transcription regulator ligand binding domain-containing protein
2846 CAMIJK010000017.1 GCA946221715_01426 CDS open 10636-11418 _na     260_aa hypothetical protein
2847 CAMIJK010000017.1 GCA946221715_01427 CDS open 11462-11842 _na     126_aa hypothetical protein
2848 CAMIJK010000017.1 GCA946221715_01428 CDS open 11972-14443 _na     823_aa Actinobacterial surface-anchored protein domain
2849 CAMIJK010000017.1 GCA946221715_01429 CDS open 14889-15512 _na     207_aa lolD ABC transporter domain-containing protein
2850 CAMIJK010000017.1 GCA946221715_01430 CDS open 15522-16739 _na     405_aa ABC3 transporter permease C-terminal domain-containing protein
2851 CAMIJK010000017.1 GCA946221715_01431 CDS open 16736-18103 _na     455_aa lolE ABC transporter permease
2852 CAMIJK010000017.1 GCA946221715_01432 CDS open 18383-19681 _na     432_aa ATP-grasp domain-containing protein
2853 CAMIJK010000017.1 GCA946221715_01433 CDS open 19834-20079 _na     81_aa MT0933-like antitoxin protein
2854 CAMIJK010000017.1 GCA946221715_01434 CDS open 20893-22206 _na     437_aa codB cytosine permease
2855 CAMIJK010000017.1 GCA946221715_01435 CDS open 22313-23548 _na     411_aa ssnA Amidohydrolase 3 domain-containing protein
2856 CAMIJK010000017.1 GCA946221715_01436 CDS open 23756-24706 _na     316_aa Phosphotransferase enzyme family
2857 CAMIJK010000017.1 GCA946221715_01437 CDS open 24934-25803 _na     289_aa LPXTG-domain-containing protein cell wall anchor domain
2858 CAMIJK010000017.1 GCA946221715_01438 CDS open 25983-27686 _na     567_aa hIS2 Polymerase/histidinol phosphatase N-terminal domain-containing protein
2859 CAMIJK010000017.1 GCA946221715_01439 CDS open 27798-28730 _na     310_aa Altered inheritance of mitochondria protein 6
2860 CAMIJK010000017.1 GCA946221715_01440 CDS open 28748-31603 _na     951_aa glcD D-lactate dehydrogenase (cytochrome)
2861 CAMIJK010000017.1 GCA946221715_01441 CDS open 31838-33166 _na     442_aa Major facilitator superfamily (MFS) profile domain-containing protein
2862 CAMIJK010000017.1 GCA946221715_01442 CDS open 33187-34680 _na     497_aa putP Solute:sodium symporter (SSS) family transporter
2863 CAMIJK010000017.1 GCA946221715_01443 CDS open 34784-35170 _na     128_aa MmcQ/YjbR family DNA-binding protein
2864 CAMIJK010000017.1 GCA946221715_01444 CDS open 35886-36206 _na     106_aa cas2 CRISPR-associated endonuclease Cas2
2865 CAMIJK010000017.1 GCA946221715_01445 CDS open 36210-37088 _na     292_aa cas1 type II CRISPR-associated endonuclease Cas1
2866 CAMIJK010000017.1 GCA946221715_01446 CDS open 37104-40466 _na     1120_aa cas9 type II CRISPR RNA-guided endonuclease Cas9
2867 CAMIJK010000017.1 GCA946221715_01447 CDS open 40707-41567 _na     286_aa yqjQ SDR family NAD(P)-dependent oxidoreductase
2868 CAMIJK010000017.1 GCA946221715_01448 CDS open 41592-42662 _na     356_aa nagC HTH marR-type domain-containing protein
2869 CAMIJK010000017.1 GCA946221715_01449 CDS open 42857-44107 _na     416_aa ugpB Tat (Twin-arginine translocation) pathway signal sequence
2870 CAMIJK010000017.1 GCA946221715_01450 CDS open 44201-45031 _na     276_aa ugpA ABC transmembrane type-1 domain-containing protein
2871 CAMIJK010000017.1 GCA946221715_01451 CDS open 45033-45962 _na     309_aa ugpE ABC transmembrane type-1 domain-containing protein
2872 CAMIJK010000017.1 GCA946221715_01452 CDS open 46355-48058 _na     567_aa dhaK dihydroxyacetone kinase subunit DhaK
2873 CAMIJK010000017.1 GCA946221715_01453 CDS open 48309-50123 _na     604_aa amyA Glycosyl hydrolase family 13 catalytic domain-containing protein
2874 CAMIJK010000017.1 GCA946221715_01454 CDS open 50259-50708 _na     149_aa hypothetical protein
2875 CAMIJK010000017.1 GCA946221715_01455 CDS open 50705-51100 _na     131_aa hypothetical protein
2876 CAMIJK010000017.1 GCA946221715_01456 CDS open 51147-54680 _na     1177_aa DNA/RNA non-specific endonuclease
2877 CAMIJK010000017.1 GCA946221715_01457 CDS open 54682-54948 _na     88_aa hypothetical protein
2878 CAMIJK010000017.1 GCA946221715_01415 gene open 613-1818
2879 CAMIJK010000017.1 GCA946221715_01416 gene open 1924-2274
2880 CAMIJK010000017.1 GCA946221715_01417 gene open 2267-3214 czcD
2881 CAMIJK010000017.1 GCA946221715_01418 gene open 3323-4024
2882 CAMIJK010000017.1 GCA946221715_01419 gene open 4115-5056 mrr
2883 CAMIJK010000017.1 GCA946221715_01420 gene open 5107-5934
2884 CAMIJK010000017.1 GCA946221715_01421 gene open 5936-7177
2885 CAMIJK010000017.1 GCA946221715_01422 gene open 7540-7785
2886 CAMIJK010000017.1 GCA946221715_01423 gene open 8438-8776
2887 CAMIJK010000017.1 GCA946221715_01424 gene open 8803-10050
2888 CAMIJK010000017.1 GCA946221715_01425 gene open 10124-10639
2889 CAMIJK010000017.1 GCA946221715_01426 gene open 10636-11418
2890 CAMIJK010000017.1 GCA946221715_01427 gene open 11462-11842
2891 CAMIJK010000017.1 GCA946221715_01428 gene open 11972-14443
2892 CAMIJK010000017.1 GCA946221715_01429 gene open 14889-15512 lolD
2893 CAMIJK010000017.1 GCA946221715_01430 gene open 15522-16739
2894 CAMIJK010000017.1 GCA946221715_01431 gene open 16736-18103 lolE
2895 CAMIJK010000017.1 GCA946221715_01432 gene open 18383-19681
2896 CAMIJK010000017.1 GCA946221715_01433 gene open 19834-20079
2897 CAMIJK010000017.1 GCA946221715_01434 gene open 20893-22206 codB
2898 CAMIJK010000017.1 GCA946221715_01435 gene open 22313-23548 ssnA
2899 CAMIJK010000017.1 GCA946221715_01436 gene open 23756-24706
2900 CAMIJK010000017.1 GCA946221715_01437 gene open 24934-25803
2901 CAMIJK010000017.1 GCA946221715_01438 gene open 25983-27686 hIS2
2902 CAMIJK010000017.1 GCA946221715_01439 gene open 27798-28730
2903 CAMIJK010000017.1 GCA946221715_01440 gene open 28748-31603 glcD
2904 CAMIJK010000017.1 GCA946221715_01441 gene open 31838-33166
2905 CAMIJK010000017.1 GCA946221715_01442 gene open 33187-34680 putP
2906 CAMIJK010000017.1 GCA946221715_01443 gene open 34784-35170
2907 CAMIJK010000017.1 GCA946221715_01444 gene open 35886-36206 cas2
2908 CAMIJK010000017.1 GCA946221715_01445 gene open 36210-37088 cas1
2909 CAMIJK010000017.1 GCA946221715_01446 gene open 37104-40466 cas9
2910 CAMIJK010000017.1 GCA946221715_01447 gene open 40707-41567 yqjQ
2911 CAMIJK010000017.1 GCA946221715_01448 gene open 41592-42662 nagC
2912 CAMIJK010000017.1 GCA946221715_01449 gene open 42857-44107 ugpB
2913 CAMIJK010000017.1 GCA946221715_01450 gene open 44201-45031 ugpA
2914 CAMIJK010000017.1 GCA946221715_01451 gene open 45033-45962 ugpE
2915 CAMIJK010000017.1 GCA946221715_01452 gene open 46355-48058 dhaK
2916 CAMIJK010000017.1 GCA946221715_01453 gene open 48309-50123 amyA
2917 CAMIJK010000017.1 GCA946221715_01454 gene open 50259-50708
2918 CAMIJK010000017.1 GCA946221715_01455 gene open 50705-51100
2919 CAMIJK010000017.1 GCA946221715_01456 gene open 51147-54680
2920 CAMIJK010000017.1 GCA946221715_01457 gene open 54682-54948
2921 CAMIJK010000018.1 GCA946221715_01459 CDS open 328-2022 _na     564_aa NlpC/P60 domain-containing protein
2922 CAMIJK010000018.1 GCA946221715_01460 CDS open 2249-3739 _na     496_aa beta-N-acetylhexosaminidase
2923 CAMIJK010000018.1 GCA946221715_01461 CDS open 3746-5728 _na     660_aa Ig-like domain-containing protein
2924 CAMIJK010000018.1 GCA946221715_01462 CDS open 5822-7225 _na     467_aa Maltokinase
2925 CAMIJK010000018.1 GCA946221715_01463 CDS open 7209-10607 _na     1132_aa ATP-binding protein
2926 CAMIJK010000018.1 GCA946221715_01464 CDS open 10604-11389 _na     261_aa DUF4194 domain-containing protein
2927 CAMIJK010000018.1 GCA946221715_01465 CDS open 11531-12136 _na     201_aa hypothetical protein
2928 CAMIJK010000018.1 GCA946221715_01466 CDS open 12476-12727 _na     83_aa hypothetical protein
2929 CAMIJK010000018.1 GCA946221715_01467 CDS open 12825-13355 _na     176_aa hypothetical protein
2930 CAMIJK010000018.1 GCA946221715_01468 CDS open 13406-13930 _na     174_aa Major facilitator superfamily (MFS) profile domain-containing protein
2931 CAMIJK010000018.1 GCA946221715_01469 CDS open 14194-14727 _na     177_aa Glycerophosphoryl diester phosphodiesterase membrane domain-containing protein
2932 CAMIJK010000018.1 GCA946221715_01470 CDS open 14724-15323 _na     199_aa DUF4386 domain-containing protein
2933 CAMIJK010000018.1 GCA946221715_01471 CDS open 15301-16794 _na     497_aa DUF3375 domain-containing protein
2934 CAMIJK010000018.1 GCA946221715_01472 CDS open 16830-18089 _na     419_aa tgt tRNA guanosine(34) transglycosylase Tgt
2935 CAMIJK010000018.1 GCA946221715_01473 CDS open 18203-20593 _na     796_aa Acyltransferase 3 domain-containing protein
2936 CAMIJK010000018.1 GCA946221715_01474 CDS open 20713-22767 _na     684_aa DUF6541 domain-containing protein
2937 CAMIJK010000018.1 GCA946221715_01475 CDS open 22852-24165 _na     437_aa M18 family aminopeptidase
2938 CAMIJK010000018.1 GCA946221715_01476 CDS open 24205-26307 _na     700_aa acyltransferase family protein
2939 CAMIJK010000018.1 GCA946221715_01477 CDS open 26346-26666 _na     106_aa hypothetical protein
2940 CAMIJK010000018.1 GCA946221715_01478 CDS open 26659-28092 _na     477_aa glutamyl-tRNA reductase
2941 CAMIJK010000018.1 GCA946221715_01479 CDS open 28196-29251 _na     351_aa hemE uroporphyrinogen decarboxylase
2942 CAMIJK010000018.1 GCA946221715_01480 CDS open 29263-30699 _na     478_aa hemG protoporphyrinogen oxidase
2943 CAMIJK010000018.1 GCA946221715_01481 CDS open 30732-31427 _na     231_aa hemQ hydrogen peroxide-dependent heme synthase
2944 CAMIJK010000018.1 GCA946221715_01482 CDS open 31424-32554 _na     376_aa hemH ferrochelatase
2945 CAMIJK010000018.1 GCA946221715_01483 CDS open 32551-33495 _na     314_aa hemC hydroxymethylbilane synthase
2946 CAMIJK010000018.1 GCA946221715_01484 CDS open 33492-34247 _na     251_aa hemD Uroporphyrinogen-III synthase
2947 CAMIJK010000018.1 GCA946221715_01485 CDS open 34247-35257 _na     336_aa hemB porphobilinogen synthase
2948 CAMIJK010000018.1 GCA946221715_01486 CDS open 35283-36569 _na     428_aa hemL glutamate-1-semialdehyde 2%2C1-aminomutase
2949 CAMIJK010000018.1 GCA946221715_01487 CDS open 36574-37095 _na     173_aa Transmembrane protein
2950 CAMIJK010000018.1 GCA946221715_01488 CDS open 37107-38267 _na     386_aa D-inositol 3-phosphate glycosyltransferase
2951 CAMIJK010000018.1 GCA946221715_01489 CDS open 38291-39475 _na     394_aa wcaG NAD-dependent epimerase/dehydratase domain-containing protein
2952 CAMIJK010000018.1 GCA946221715_01490 CDS open 39538-40413 _na     291_aa ampC Beta-lactamase-related domain-containing protein
2953 CAMIJK010000018.1 GCA946221715_01491 CDS open 40512-41210 _na     232_aa fHA FHA domain-containing protein
2954 CAMIJK010000018.1 GCA946221715_01492 CDS open 41218-41733 _na     171_aa fHA FHA domain-containing protein
2955 CAMIJK010000018.1 GCA946221715_01493 CDS open 41730-43016 _na     428_aa pTC1 PPM-type phosphatase domain-containing protein
2956 CAMIJK010000018.1 GCA946221715_01494 CDS open 43016-44425 _na     469_aa ftsW Cell division protein FtsW
2957 CAMIJK010000018.1 GCA946221715_01495 CDS open 44422-45867 _na     481_aa penicillin-binding protein 2
2958 CAMIJK010000018.1 GCA946221715_01496 CDS open 45869-47191 _na     440_aa sPS1 non-specific serine/threonine protein kinase
2959 CAMIJK010000018.1 GCA946221715_01497 CDS open 47137-49356 _na     739_aa pknB Stk1 family PASTA domain-containing Ser/Thr kinase
2960 CAMIJK010000018.1 GCA946221715_01498 CDS open 49515-49844 _na     109_aa aminodeoxychorismate/anthranilate synthase component II
2961 CAMIJK010000018.1 GCA946221715_01499 CDS open 49907-50086 _na     59_aa DUF4175 domain-containing protein
2962 CAMIJK010000018.1 GCA946221715_01500 CDS open 50086-50781 _na     231_aa srtA Sortase
2963 CAMIJK010000018.1 GCA946221715_01501 CDS open 50981-51292 _na     103_aa crgA Cell division protein CrgA
2964 CAMIJK010000018.1 GCA946221715_01502 CDS open 51294-52124 _na     276_aa tesA SGNH hydrolase-type esterase domain-containing protein
2965 CAMIJK010000018.1 GCA946221715_01503 CDS open 52184-53077 _na     297_aa Lipoprotein
2966 CAMIJK010000018.1 GCA946221715_01504 CDS open 53087-54037 _na     316_aa DUF3153 domain-containing protein
2967 CAMIJK010000018.1 GCA946221715_01459 gene open 328-2022
2968 CAMIJK010000018.1 GCA946221715_01460 gene open 2249-3739
2969 CAMIJK010000018.1 GCA946221715_01461 gene open 3746-5728
2970 CAMIJK010000018.1 GCA946221715_01462 gene open 5822-7225
2971 CAMIJK010000018.1 GCA946221715_01463 gene open 7209-10607
2972 CAMIJK010000018.1 GCA946221715_01464 gene open 10604-11389
2973 CAMIJK010000018.1 GCA946221715_01465 gene open 11531-12136
2974 CAMIJK010000018.1 GCA946221715_01466 gene open 12476-12727
2975 CAMIJK010000018.1 GCA946221715_01467 gene open 12825-13355
2976 CAMIJK010000018.1 GCA946221715_01468 gene open 13406-13930
2977 CAMIJK010000018.1 GCA946221715_01469 gene open 14194-14727
2978 CAMIJK010000018.1 GCA946221715_01470 gene open 14724-15323
2979 CAMIJK010000018.1 GCA946221715_01471 gene open 15301-16794
2980 CAMIJK010000018.1 GCA946221715_01472 gene open 16830-18089 tgt
2981 CAMIJK010000018.1 GCA946221715_01473 gene open 18203-20593
2982 CAMIJK010000018.1 GCA946221715_01474 gene open 20713-22767
2983 CAMIJK010000018.1 GCA946221715_01475 gene open 22852-24165
2984 CAMIJK010000018.1 GCA946221715_01476 gene open 24205-26307
2985 CAMIJK010000018.1 GCA946221715_01477 gene open 26346-26666
2986 CAMIJK010000018.1 GCA946221715_01478 gene open 26659-28092
2987 CAMIJK010000018.1 GCA946221715_01479 gene open 28196-29251 hemE
2988 CAMIJK010000018.1 GCA946221715_01480 gene open 29263-30699 hemG
2989 CAMIJK010000018.1 GCA946221715_01481 gene open 30732-31427 hemQ
2990 CAMIJK010000018.1 GCA946221715_01482 gene open 31424-32554 hemH
2991 CAMIJK010000018.1 GCA946221715_01483 gene open 32551-33495 hemC
2992 CAMIJK010000018.1 GCA946221715_01484 gene open 33492-34247 hemD
2993 CAMIJK010000018.1 GCA946221715_01485 gene open 34247-35257 hemB
2994 CAMIJK010000018.1 GCA946221715_01486 gene open 35283-36569 hemL
2995 CAMIJK010000018.1 GCA946221715_01487 gene open 36574-37095
2996 CAMIJK010000018.1 GCA946221715_01488 gene open 37107-38267
2997 CAMIJK010000018.1 GCA946221715_01489 gene open 38291-39475 wcaG
2998 CAMIJK010000018.1 GCA946221715_01490 gene open 39538-40413 ampC
2999 CAMIJK010000018.1 GCA946221715_01491 gene open 40512-41210 fHA
3000 CAMIJK010000018.1 GCA946221715_01492 gene open 41218-41733 fHA