BAKTAGenome Explorer: Corynebacterium tuscaniense (GCA_946222205.1)
Select a Genome:
|
BAKTA Annotations for GCA_946222205.1
|
Search & Sort all 3767 Records
| ||||||||||||||||||
Notes: 1- Column headers only sort the current page. 2- Select [NA] or [AA] links to show sequences.
| Region | Protein-ID | Type | Genome Viewer |
Range (bp) |
Show Sequences (length) NA / AA |
BAKTA Gene |
BAKTA GeneProduct |
|
|---|---|---|---|---|---|---|---|---|
| 1 | CAMIBB010000001.1 | GCA946222205_00001 | CDS | open | 105-1319 | _na 404_aa | hypothetical protein | |
| 2 | CAMIBB010000001.1 | GCA946222205_00002 | CDS | open | 1361-2461 | _na 366_aa | Peptidase M24 family protein | |
| 3 | CAMIBB010000001.1 | GCA946222205_00003 | CDS | open | 2480-3229 | _na 249_aa | SDR family oxidoreductase | |
| 4 | CAMIBB010000001.1 | GCA946222205_00004 | CDS | open | 3253-4560 | _na 435_aa | Lipase | |
| 5 | CAMIBB010000001.1 | GCA946222205_00005 | CDS | open | 4581-5063 | _na 160_aa | fxsA | FxsA |
| 6 | CAMIBB010000001.1 | GCA946222205_00006 | CDS | open | 5063-6658 | _na 531_aa | lnt | apolipoprotein N-acyltransferase |
| 7 | CAMIBB010000001.1 | GCA946222205_00007 | CDS | open | 6668-7573 | _na 301_aa | Polyprenol monophosphomannose synthase | |
| 8 | CAMIBB010000001.1 | GCA946222205_00008 | CDS | open | 7675-8043 | _na 122_aa | rbpA | RNA polymerase-binding protein RbpA |
| 9 | CAMIBB010000001.1 | GCA946222205_00009 | CDS | open | 8197-8547 | _na 116_aa | FCS-type domain-containing protein | |
| 10 | CAMIBB010000001.1 | GCA946222205_00010 | CDS | open | 8561-9298 | _na 245_aa | Lipid/polyisoprenoid-binding YceI-like domain-containing protein | |
| 11 | CAMIBB010000001.1 | GCA946222205_00011 | CDS | open | 9394-10791 | _na 465_aa | SAM-dependent methyltransferase | |
| 12 | CAMIBB010000001.1 | GCA946222205_00012 | CDS | open | 10881-12281 | _na 466_aa | NADH:ubiquinone reductase (non-electrogenic) | |
| 13 | CAMIBB010000001.1 | GCA946222205_00013 | CDS | open | 12435-13505 | _na 356_aa | Magnesium transporter | |
| 14 | CAMIBB010000001.1 | GCA946222205_00014 | CDS | open | 13502-13969 | _na 155_aa | Thioesterase | |
| 15 | CAMIBB010000001.1 | GCA946222205_00015 | CDS | open | 13975-15513 | _na 512_aa | gndA | NADP-dependent phosphogluconate dehydrogenase |
| 16 | CAMIBB010000001.1 | GCA946222205_00016 | CDS | open | 15488-16903 | _na 471_aa | ATP-dependent RNA helicase | |
| 17 | CAMIBB010000001.1 | GCA946222205_00017 | CDS | open | 16915-18297 | _na 460_aa | HlyC/CorC family transporter | |
| 18 | CAMIBB010000001.1 | GCA946222205_00018 | CDS | open | 18294-19355 | _na 353_aa | HlyC/CorC family transporter | |
| 19 | CAMIBB010000001.1 | GCA946222205_00019 | CDS | open | 19355-20230 | _na 291_aa | 3-methyladenine DNA glycosylase | |
| 20 | CAMIBB010000001.1 | GCA946222205_00020 | CDS | open | 20264-21700 | _na 478_aa | VWFA domain-containing protein | |
| 21 | CAMIBB010000001.1 | GCA946222205_00021 | CDS | open | 21861-22445 | _na 194_aa | merR | MerR family transcriptional regulator |
| 22 | CAMIBB010000001.1 | GCA946222205_00022 | CDS | open | 22678-23244 | _na 188_aa | BFN domain-containing protein | |
| 23 | CAMIBB010000001.1 | GCA946222205_00023 | CDS | open | 23252-23938 | _na 228_aa | merR | MerR family transcriptional regulator |
| 24 | CAMIBB010000001.1 | GCA946222205_00024 | CDS | open | 24067-24495 | _na 142_aa | odhI | oxoglutarate dehydrogenase inhibitor Odhl |
| 25 | CAMIBB010000001.1 | GCA946222205_00025 | CDS | open | 24677-26944 | _na 755_aa | secA2 | accessory Sec system translocase SecA2 |
| 26 | CAMIBB010000001.1 | GCA946222205_00027 | CDS | open | 27252-28622 | _na 456_aa | MFS transporter | |
| 27 | CAMIBB010000001.1 | GCA946222205_00028 | CDS | open | 28730-30373 | _na 547_aa | Potassium transporter Kef | |
| 28 | CAMIBB010000001.1 | GCA946222205_00029 | CDS | open | 30553-32748 | _na 731_aa | hypothetical protein | |
| 29 | CAMIBB010000001.1 | GCA946222205_00030 | CDS | open | 32773-33735 | _na 320_aa | Esterase | |
| 30 | CAMIBB010000001.1 | GCA946222205_00031 | CDS | open | 33803-34594 | _na 263_aa | SAM-dependent methyltransferase | |
| 31 | CAMIBB010000001.1 | GCA946222205_00032 | CDS | open | 34591-35322 | _na 243_aa | PHB depolymerase family esterase | |
| 32 | CAMIBB010000001.1 | GCA946222205_00033 | CDS | open | 35335-36936 | _na 533_aa | der | ribosome biogenesis GTPase Der |
| 33 | CAMIBB010000001.1 | GCA946222205_00034 | CDS | open | 36936-37640 | _na 234_aa | cmk | (d)CMP kinase |
| 34 | CAMIBB010000001.1 | GCA946222205_00035 | CDS | open | 37641-38681 | _na 346_aa | pseudouridine synthase | |
| 35 | CAMIBB010000001.1 | GCA946222205_00036 | CDS | open | 38693-39256 | _na 187_aa | scpB | SMC-Scp complex subunit ScpB |
| 36 | CAMIBB010000001.1 | GCA946222205_00037 | CDS | open | 39262-40101 | _na 279_aa | Segregation and condensation protein A | |
| 37 | CAMIBB010000001.1 | GCA946222205_00038 | CDS | open | 40123-41046 | _na 307_aa | parA | ParA family protein |
| 38 | CAMIBB010000001.1 | GCA946222205_00039 | CDS | open | 41104-42009 | _na 301_aa | xerD | site-specific tyrosine recombinase XerD |
| 39 | CAMIBB010000001.1 | GCA946222205_00040 | CDS | open | 42009-42683 | _na 224_aa | NUDIX hydrolase | |
| 40 | CAMIBB010000001.1 | GCA946222205_00041 | CDS | open | 42736-43734 | _na 332_aa | Copper transporter | |
| 41 | CAMIBB010000001.1 | GCA946222205_00042 | CDS | open | 43750-44973 | _na 407_aa | steA | putative cytokinetic ring protein SteA |
| 42 | CAMIBB010000001.1 | GCA946222205_00043 | CDS | open | 45040-46770 | _na 576_aa | recN | DNA repair protein RecN |
| 43 | CAMIBB010000001.1 | GCA946222205_00044 | CDS | open | 46775-47731 | _na 318_aa | NAD kinase | |
| 44 | CAMIBB010000001.1 | GCA946222205_00045 | CDS | open | 47731-48558 | _na 275_aa | tlyA | TlyA family rRNA (Cytidine-2'-O)-methyltransferase |
| 45 | CAMIBB010000001.1 | GCA946222205_00046 | CDS | open | 48570-48755 | _na 61_aa | hypothetical protein | |
| 46 | CAMIBB010000001.1 | GCA946222205_00047 | CDS | open | 48761-49783 | _na 340_aa | HAD family hydrolase | |
| 47 | CAMIBB010000001.1 | GCA946222205_00048 | CDS | open | 49793-50626 | _na 277_aa | Tetratricopeptide repeat-containing protein | |
| 48 | CAMIBB010000001.1 | GCA946222205_00049 | CDS | open | 50635-51909 | _na 424_aa | tyrS | tyrosine--tRNA ligase |
| 49 | CAMIBB010000001.1 | GCA946222205_00050 | CDS | open | 51985-52176 | _na 63_aa | UPF0434 protein CJ203_01990 | |
| 50 | CAMIBB010000001.1 | GCA946222205_00051 | CDS | open | 52197-52826 | _na 209_aa | Secreted protein | |
| 51 | CAMIBB010000001.1 | GCA946222205_00052 | CDS | open | 52813-54387 | _na 524_aa | VWA domain-containing protein | |
| 52 | CAMIBB010000001.1 | GCA946222205_00053 | CDS | open | 54402-55646 | _na 414_aa | Secreted protein | |
| 53 | CAMIBB010000001.1 | GCA946222205_00054 | CDS | open | 55705-57141 | _na 478_aa | argH | argininosuccinate lyase |
| 54 | CAMIBB010000001.1 | GCA946222205_00055 | CDS | open | 57193-58152 | _na 319_aa | Argininosuccinate synthase | |
| 55 | CAMIBB010000001.1 | GCA946222205_00001 | gene | open | 105-1319 | |||
| 56 | CAMIBB010000001.1 | GCA946222205_00002 | gene | open | 1361-2461 | |||
| 57 | CAMIBB010000001.1 | GCA946222205_00003 | gene | open | 2480-3229 | |||
| 58 | CAMIBB010000001.1 | GCA946222205_00004 | gene | open | 3253-4560 | |||
| 59 | CAMIBB010000001.1 | GCA946222205_00005 | gene | open | 4581-5063 | fxsA | ||
| 60 | CAMIBB010000001.1 | GCA946222205_00006 | gene | open | 5063-6658 | lnt | ||
| 61 | CAMIBB010000001.1 | GCA946222205_00007 | gene | open | 6668-7573 | |||
| 62 | CAMIBB010000001.1 | GCA946222205_00008 | gene | open | 7675-8043 | rbpA | ||
| 63 | CAMIBB010000001.1 | GCA946222205_00009 | gene | open | 8197-8547 | |||
| 64 | CAMIBB010000001.1 | GCA946222205_00010 | gene | open | 8561-9298 | |||
| 65 | CAMIBB010000001.1 | GCA946222205_00011 | gene | open | 9394-10791 | |||
| 66 | CAMIBB010000001.1 | GCA946222205_00012 | gene | open | 10881-12281 | |||
| 67 | CAMIBB010000001.1 | GCA946222205_00013 | gene | open | 12435-13505 | |||
| 68 | CAMIBB010000001.1 | GCA946222205_00014 | gene | open | 13502-13969 | |||
| 69 | CAMIBB010000001.1 | GCA946222205_00015 | gene | open | 13975-15513 | gndA | ||
| 70 | CAMIBB010000001.1 | GCA946222205_00016 | gene | open | 15488-16903 | |||
| 71 | CAMIBB010000001.1 | GCA946222205_00017 | gene | open | 16915-18297 | |||
| 72 | CAMIBB010000001.1 | GCA946222205_00018 | gene | open | 18294-19355 | |||
| 73 | CAMIBB010000001.1 | GCA946222205_00019 | gene | open | 19355-20230 | |||
| 74 | CAMIBB010000001.1 | GCA946222205_00020 | gene | open | 20264-21700 | |||
| 75 | CAMIBB010000001.1 | GCA946222205_00021 | gene | open | 21861-22445 | merR | ||
| 76 | CAMIBB010000001.1 | GCA946222205_00022 | gene | open | 22678-23244 | |||
| 77 | CAMIBB010000001.1 | GCA946222205_00023 | gene | open | 23252-23938 | merR | ||
| 78 | CAMIBB010000001.1 | GCA946222205_00024 | gene | open | 24067-24495 | odhI | ||
| 79 | CAMIBB010000001.1 | GCA946222205_00025 | gene | open | 24677-26944 | secA2 | ||
| 80 | CAMIBB010000001.1 | GCA946222205_00027 | gene | open | 27252-28622 | |||
| 81 | CAMIBB010000001.1 | GCA946222205_00028 | gene | open | 28730-30373 | |||
| 82 | CAMIBB010000001.1 | GCA946222205_00029 | gene | open | 30553-32748 | |||
| 83 | CAMIBB010000001.1 | GCA946222205_00030 | gene | open | 32773-33735 | |||
| 84 | CAMIBB010000001.1 | GCA946222205_00031 | gene | open | 33803-34594 | |||
| 85 | CAMIBB010000001.1 | GCA946222205_00032 | gene | open | 34591-35322 | |||
| 86 | CAMIBB010000001.1 | GCA946222205_00033 | gene | open | 35335-36936 | der | ||
| 87 | CAMIBB010000001.1 | GCA946222205_00034 | gene | open | 36936-37640 | cmk | ||
| 88 | CAMIBB010000001.1 | GCA946222205_00035 | gene | open | 37641-38681 | |||
| 89 | CAMIBB010000001.1 | GCA946222205_00036 | gene | open | 38693-39256 | scpB | ||
| 90 | CAMIBB010000001.1 | GCA946222205_00037 | gene | open | 39262-40101 | |||
| 91 | CAMIBB010000001.1 | GCA946222205_00038 | gene | open | 40123-41046 | parA | ||
| 92 | CAMIBB010000001.1 | GCA946222205_00039 | gene | open | 41104-42009 | xerD | ||
| 93 | CAMIBB010000001.1 | GCA946222205_00040 | gene | open | 42009-42683 | |||
| 94 | CAMIBB010000001.1 | GCA946222205_00041 | gene | open | 42736-43734 | |||
| 95 | CAMIBB010000001.1 | GCA946222205_00042 | gene | open | 43750-44973 | steA | ||
| 96 | CAMIBB010000001.1 | GCA946222205_00043 | gene | open | 45040-46770 | recN | ||
| 97 | CAMIBB010000001.1 | GCA946222205_00044 | gene | open | 46775-47731 | |||
| 98 | CAMIBB010000001.1 | GCA946222205_00045 | gene | open | 47731-48558 | tlyA | ||
| 99 | CAMIBB010000001.1 | GCA946222205_00046 | gene | open | 48570-48755 | |||
| 100 | CAMIBB010000001.1 | GCA946222205_00047 | gene | open | 48761-49783 | |||
| 101 | CAMIBB010000001.1 | GCA946222205_00048 | gene | open | 49793-50626 | |||
| 102 | CAMIBB010000001.1 | GCA946222205_00049 | gene | open | 50635-51909 | tyrS | ||
| 103 | CAMIBB010000001.1 | GCA946222205_00050 | gene | open | 51985-52176 | |||
| 104 | CAMIBB010000001.1 | GCA946222205_00051 | gene | open | 52197-52826 | |||
| 105 | CAMIBB010000001.1 | GCA946222205_00052 | gene | open | 52813-54387 | |||
| 106 | CAMIBB010000001.1 | GCA946222205_00053 | gene | open | 54402-55646 | |||
| 107 | CAMIBB010000001.1 | GCA946222205_00054 | gene | open | 55705-57141 | argH | ||
| 108 | CAMIBB010000001.1 | GCA946222205_00055 | gene | open | 57193-58152 | |||
| 109 | CAMIBB010000001.1 | GCA946222205_00026 | gene | open | 27082-27155 | trnP | ||
| 110 | CAMIBB010000001.1 | GCA946222205_00026 | tRNA | open | 27082-27155 | trnP | tRNA-Pro(ggg) | |
| 111 | CAMIBB010000002.1 | GCA946222205_00056 | CDS | open | 47-1282 | _na 411_aa | Ammonium transporter | |
| 112 | CAMIBB010000002.1 | GCA946222205_00057 | CDS | open | 1601-2974 | _na 457_aa | ftsY | signal recognition particle-docking protein FtsY |
| 113 | CAMIBB010000002.1 | GCA946222205_00058 | CDS | open | 3056-3592 | _na 178_aa | DUF306 domain-containing protein | |
| 114 | CAMIBB010000002.1 | GCA946222205_00059 | CDS | open | 3589-7044 | _na 1151_aa | Chromosome partition protein Smc | |
| 115 | CAMIBB010000002.1 | GCA946222205_00060 | CDS | open | 7067-7351 | _na 94_aa | acylphosphatase | |
| 116 | CAMIBB010000002.1 | GCA946222205_00061 | CDS | open | 7348-8829 | _na 493_aa | Sodium:alanine symporter family protein | |
| 117 | CAMIBB010000002.1 | GCA946222205_00062 | CDS | open | 8840-9685 | _na 281_aa | mutM | bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase |
| 118 | CAMIBB010000002.1 | GCA946222205_00063 | CDS | open | 9695-10459 | _na 254_aa | rnc | ribonuclease III |
| 119 | CAMIBB010000002.1 | GCA946222205_00064 | CDS | open | 10459-11037 | _na 192_aa | DNA-binding protein | |
| 120 | CAMIBB010000002.1 | GCA946222205_00065 | CDS | open | 11067-11786 | _na 239_aa | DivIVA domain-containing protein | |
| 121 | CAMIBB010000002.1 | GCA946222205_00066 | CDS | open | 11866-13212 | _na 448_aa | gdhA | NADP-specific glutamate dehydrogenase |
| 122 | CAMIBB010000002.1 | GCA946222205_00067 | CDS | open | 13372-14562 | _na 396_aa | Glycerate kinase | |
| 123 | CAMIBB010000002.1 | GCA946222205_00068 | CDS | open | 14532-14927 | _na 131_aa | hypothetical protein | |
| 124 | CAMIBB010000002.1 | GCA946222205_00069 | CDS | open | 14959-16296 | _na 445_aa | DUF4921 domain-containing protein | |
| 125 | CAMIBB010000002.1 | GCA946222205_00070 | CDS | open | 16350-17636 | _na 428_aa | Amidohydrolase | |
| 126 | CAMIBB010000002.1 | GCA946222205_00071 | CDS | open | 17697-20084 | _na 795_aa | Alpha-1%2C4 glucan phosphorylase | |
| 127 | CAMIBB010000002.1 | GCA946222205_00072 | CDS | open | 20113-21969 | _na 618_aa | chorismate-binding protein | |
| 128 | CAMIBB010000002.1 | GCA946222205_00073 | CDS | open | 21994-22275 | _na 93_aa | hypothetical protein | |
| 129 | CAMIBB010000002.1 | GCA946222205_00074 | CDS | open | 22454-23176 | _na 240_aa | aminotransferase class IV | |
| 130 | CAMIBB010000002.1 | GCA946222205_00075 | CDS | open | 23193-24632 | _na 479_aa | pyk | pyruvate kinase |
| 131 | CAMIBB010000002.1 | GCA946222205_00076 | CDS | open | 24702-25622 | _na 306_aa | lgt | prolipoprotein diacylglyceryl transferase |
| 132 | CAMIBB010000002.1 | GCA946222205_00077 | CDS | open | 25641-26498 | _na 285_aa | indole-3-glycerol-phosphate synthase | |
| 133 | CAMIBB010000002.1 | GCA946222205_00078 | CDS | open | 26538-27158 | _na 206_aa | TIGR02234 family membrane protein | |
| 134 | CAMIBB010000002.1 | GCA946222205_00079 | CDS | open | 27158-27511 | _na 117_aa | hisI | phosphoribosyl-AMP cyclohydrolase |
| 135 | CAMIBB010000002.1 | GCA946222205_00080 | CDS | open | 27508-28263 | _na 251_aa | hisF | Imidazole glycerol phosphate synthase subunit HisF |
| 136 | CAMIBB010000002.1 | GCA946222205_00081 | CDS | open | 28282-29073 | _na 263_aa | Inositol monophosphatase | |
| 137 | CAMIBB010000002.1 | GCA946222205_00082 | CDS | open | 29081-29830 | _na 249_aa | priA | bifunctional 1-(5-phosphoribosyl)-5-((5-phosphoribosylamino)methylideneamino)imidazole-4-carboxamide isomerase/phosphoribosylanthranilate isomerase PriA |
| 138 | CAMIBB010000002.1 | GCA946222205_00083 | CDS | open | 29854-30480 | _na 208_aa | hisH | imidazole glycerol phosphate synthase subunit HisH |
| 139 | CAMIBB010000002.1 | GCA946222205_00084 | CDS | open | 30503-31687 | _na 394_aa | MFS transporter | |
| 140 | CAMIBB010000002.1 | GCA946222205_00085 | CDS | open | 31688-31864 | _na 58_aa | hypothetical protein | |
| 141 | CAMIBB010000002.1 | GCA946222205_00086 | CDS | open | 31864-32466 | _na 200_aa | hisB | imidazoleglycerol-phosphate dehydratase HisB |
| 142 | CAMIBB010000002.1 | GCA946222205_00087 | CDS | open | 32459-32881 | _na 140_aa | hypothetical protein | |
| 143 | CAMIBB010000002.1 | GCA946222205_00056 | gene | open | 47-1282 | |||
| 144 | CAMIBB010000002.1 | GCA946222205_00057 | gene | open | 1601-2974 | ftsY | ||
| 145 | CAMIBB010000002.1 | GCA946222205_00058 | gene | open | 3056-3592 | |||
| 146 | CAMIBB010000002.1 | GCA946222205_00059 | gene | open | 3589-7044 | |||
| 147 | CAMIBB010000002.1 | GCA946222205_00060 | gene | open | 7067-7351 | |||
| 148 | CAMIBB010000002.1 | GCA946222205_00061 | gene | open | 7348-8829 | |||
| 149 | CAMIBB010000002.1 | GCA946222205_00062 | gene | open | 8840-9685 | mutM | ||
| 150 | CAMIBB010000002.1 | GCA946222205_00063 | gene | open | 9695-10459 | rnc | ||
| 151 | CAMIBB010000002.1 | GCA946222205_00064 | gene | open | 10459-11037 | |||
| 152 | CAMIBB010000002.1 | GCA946222205_00065 | gene | open | 11067-11786 | |||
| 153 | CAMIBB010000002.1 | GCA946222205_00066 | gene | open | 11866-13212 | gdhA | ||
| 154 | CAMIBB010000002.1 | GCA946222205_00067 | gene | open | 13372-14562 | |||
| 155 | CAMIBB010000002.1 | GCA946222205_00068 | gene | open | 14532-14927 | |||
| 156 | CAMIBB010000002.1 | GCA946222205_00069 | gene | open | 14959-16296 | |||
| 157 | CAMIBB010000002.1 | GCA946222205_00070 | gene | open | 16350-17636 | |||
| 158 | CAMIBB010000002.1 | GCA946222205_00071 | gene | open | 17697-20084 | |||
| 159 | CAMIBB010000002.1 | GCA946222205_00072 | gene | open | 20113-21969 | |||
| 160 | CAMIBB010000002.1 | GCA946222205_00073 | gene | open | 21994-22275 | |||
| 161 | CAMIBB010000002.1 | GCA946222205_00074 | gene | open | 22454-23176 | |||
| 162 | CAMIBB010000002.1 | GCA946222205_00075 | gene | open | 23193-24632 | pyk | ||
| 163 | CAMIBB010000002.1 | GCA946222205_00076 | gene | open | 24702-25622 | lgt | ||
| 164 | CAMIBB010000002.1 | GCA946222205_00077 | gene | open | 25641-26498 | |||
| 165 | CAMIBB010000002.1 | GCA946222205_00078 | gene | open | 26538-27158 | |||
| 166 | CAMIBB010000002.1 | GCA946222205_00079 | gene | open | 27158-27511 | hisI | ||
| 167 | CAMIBB010000002.1 | GCA946222205_00080 | gene | open | 27508-28263 | hisF | ||
| 168 | CAMIBB010000002.1 | GCA946222205_00081 | gene | open | 28282-29073 | |||
| 169 | CAMIBB010000002.1 | GCA946222205_00082 | gene | open | 29081-29830 | priA | ||
| 170 | CAMIBB010000002.1 | GCA946222205_00083 | gene | open | 29854-30480 | hisH | ||
| 171 | CAMIBB010000002.1 | GCA946222205_00084 | gene | open | 30503-31687 | |||
| 172 | CAMIBB010000002.1 | GCA946222205_00085 | gene | open | 31688-31864 | |||
| 173 | CAMIBB010000002.1 | GCA946222205_00086 | gene | open | 31864-32466 | hisB | ||
| 174 | CAMIBB010000002.1 | GCA946222205_00087 | gene | open | 32459-32881 | |||
| 175 | CAMIBB010000003.1 | GCA946222205_00088 | CDS | open | 301-627 | _na 108_aa | hypothetical protein | |
| 176 | CAMIBB010000003.1 | GCA946222205_00089 | CDS | open | 749-2437 | _na 562_aa | Phosphoenolpyruvate-protein phosphotransferase | |
| 177 | CAMIBB010000003.1 | GCA946222205_00090 | CDS | open | 2473-3090 | _na 205_aa | Secreted protein | |
| 178 | CAMIBB010000003.1 | GCA946222205_00091 | CDS | open | 3095-4645 | _na 516_aa | lysS | lysine--tRNA ligase |
| 179 | CAMIBB010000003.1 | GCA946222205_00092 | CDS | open | 4671-5204 | _na 177_aa | DUF4232 domain-containing protein | |
| 180 | CAMIBB010000003.1 | GCA946222205_00093 | CDS | open | 5251-6603 | _na 450_aa | Serine/threonine protein kinase | |
| 181 | CAMIBB010000003.1 | GCA946222205_00094 | CDS | open | 6649-7635 | _na 328_aa | J domain-containing protein | |
| 182 | CAMIBB010000003.1 | GCA946222205_00095 | CDS | open | 8049-8852 | _na 267_aa | pantoate--beta-alanine ligase (AMP-forming) | |
| 183 | CAMIBB010000003.1 | GCA946222205_00096 | CDS | open | 8871-9563 | _na 230_aa | Oxidoreductase/dehydrogenase Rossmann-like domain-containing protein | |
| 184 | CAMIBB010000003.1 | GCA946222205_00097 | CDS | open | 9573-10700 | _na 375_aa | DUF6779 domain-containing protein | |
| 185 | CAMIBB010000003.1 | GCA946222205_00098 | CDS | open | 10711-11178 | _na 155_aa | DUF3180 domain-containing protein | |
| 186 | CAMIBB010000003.1 | GCA946222205_00099 | CDS | open | 11175-11657 | _na 160_aa | folK | 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase |
| 187 | CAMIBB010000003.1 | GCA946222205_00100 | CDS | open | 11662-12054 | _na 130_aa | folB | dihydroneopterin aldolase |
| 188 | CAMIBB010000003.1 | GCA946222205_00101 | CDS | open | 12047-12907 | _na 286_aa | folP | dihydropteroate synthase |
| 189 | CAMIBB010000003.1 | GCA946222205_00102 | CDS | open | 12910-13506 | _na 198_aa | folE | GTP cyclohydrolase I FolE |
| 190 | CAMIBB010000003.1 | GCA946222205_00103 | CDS | open | 13499-15895 | _na 798_aa | ftsH | ATP-dependent zinc metalloprotease FtsH |
| 191 | CAMIBB010000003.1 | GCA946222205_00104 | CDS | open | 16083-16733 | _na 216_aa | hpt | hypoxanthine phosphoribosyltransferase |
| 192 | CAMIBB010000003.1 | GCA946222205_00105 | CDS | open | 17047-18264 | _na 405_aa | hypothetical protein | |
| 193 | CAMIBB010000003.1 | GCA946222205_00106 | CDS | open | 18458-19528 | _na 356_aa | hypothetical protein | |
| 194 | CAMIBB010000003.1 | GCA946222205_00107 | CDS | open | 19697-20188 | _na 163_aa | doxX | DoxX family protein |
| 195 | CAMIBB010000003.1 | GCA946222205_00108 | CDS | open | 20241-21176 | _na 311_aa | tRNA(Ile)-lysidine synthase | |
| 196 | CAMIBB010000003.1 | GCA946222205_00109 | CDS | open | 21179-22450 | _na 423_aa | dacB | D-alanyl-D-alanine carboxypeptidase/D-alanyl-D-alanine-endopeptidase |
| 197 | CAMIBB010000003.1 | GCA946222205_00110 | CDS | open | 22551-25964 | _na 1137_aa | VWFA domain-containing protein | |
| 198 | CAMIBB010000003.1 | GCA946222205_00111 | CDS | open | 25964-26821 | _na 285_aa | Gram-positive pilin subunit D1 N-terminal domain-containing protein | |
| 199 | CAMIBB010000003.1 | GCA946222205_00112 | CDS | open | 26769-27770 | _na 333_aa | Class C sortase | |
| 200 | CAMIBB010000003.1 | GCA946222205_00113 | CDS | open | 27974-29608 | _na 544_aa | SpaH/EbpB family LPXTG-anchored major pilin | |
| 201 | CAMIBB010000003.1 | GCA946222205_00114 | CDS | open | 30136-30612 | _na 158_aa | Inorganic pyrophosphatase | |
| 202 | CAMIBB010000003.1 | GCA946222205_00115 | CDS | open | 30717-31328 | _na 203_aa | hypothetical protein | |
| 203 | CAMIBB010000003.1 | GCA946222205_00116 | CDS | open | 31568-31873 | _na 101_aa | Rhodanese-like domain-containing protein | |
| 204 | CAMIBB010000003.1 | GCA946222205_00088 | gene | open | 301-627 | |||
| 205 | CAMIBB010000003.1 | GCA946222205_00089 | gene | open | 749-2437 | |||
| 206 | CAMIBB010000003.1 | GCA946222205_00090 | gene | open | 2473-3090 | |||
| 207 | CAMIBB010000003.1 | GCA946222205_00091 | gene | open | 3095-4645 | lysS | ||
| 208 | CAMIBB010000003.1 | GCA946222205_00092 | gene | open | 4671-5204 | |||
| 209 | CAMIBB010000003.1 | GCA946222205_00093 | gene | open | 5251-6603 | |||
| 210 | CAMIBB010000003.1 | GCA946222205_00094 | gene | open | 6649-7635 | |||
| 211 | CAMIBB010000003.1 | GCA946222205_00095 | gene | open | 8049-8852 | |||
| 212 | CAMIBB010000003.1 | GCA946222205_00096 | gene | open | 8871-9563 | |||
| 213 | CAMIBB010000003.1 | GCA946222205_00097 | gene | open | 9573-10700 | |||
| 214 | CAMIBB010000003.1 | GCA946222205_00098 | gene | open | 10711-11178 | |||
| 215 | CAMIBB010000003.1 | GCA946222205_00099 | gene | open | 11175-11657 | folK | ||
| 216 | CAMIBB010000003.1 | GCA946222205_00100 | gene | open | 11662-12054 | folB | ||
| 217 | CAMIBB010000003.1 | GCA946222205_00101 | gene | open | 12047-12907 | folP | ||
| 218 | CAMIBB010000003.1 | GCA946222205_00102 | gene | open | 12910-13506 | folE | ||
| 219 | CAMIBB010000003.1 | GCA946222205_00103 | gene | open | 13499-15895 | ftsH | ||
| 220 | CAMIBB010000003.1 | GCA946222205_00104 | gene | open | 16083-16733 | hpt | ||
| 221 | CAMIBB010000003.1 | GCA946222205_00105 | gene | open | 17047-18264 | |||
| 222 | CAMIBB010000003.1 | GCA946222205_00106 | gene | open | 18458-19528 | |||
| 223 | CAMIBB010000003.1 | GCA946222205_00107 | gene | open | 19697-20188 | doxX | ||
| 224 | CAMIBB010000003.1 | GCA946222205_00108 | gene | open | 20241-21176 | |||
| 225 | CAMIBB010000003.1 | GCA946222205_00109 | gene | open | 21179-22450 | dacB | ||
| 226 | CAMIBB010000003.1 | GCA946222205_00110 | gene | open | 22551-25964 | |||
| 227 | CAMIBB010000003.1 | GCA946222205_00111 | gene | open | 25964-26821 | |||
| 228 | CAMIBB010000003.1 | GCA946222205_00112 | gene | open | 26769-27770 | |||
| 229 | CAMIBB010000003.1 | GCA946222205_00113 | gene | open | 27974-29608 | |||
| 230 | CAMIBB010000003.1 | GCA946222205_00114 | gene | open | 30136-30612 | |||
| 231 | CAMIBB010000003.1 | GCA946222205_00115 | gene | open | 30717-31328 | |||
| 232 | CAMIBB010000003.1 | GCA946222205_00116 | gene | open | 31568-31873 | |||
| 233 | CAMIBB010000004.1 | GCA946222205_00117 | CDS | open | 48-782 | _na 244_aa | hypothetical protein | |
| 234 | CAMIBB010000004.1 | GCA946222205_00118 | CDS | open | 793-1422 | _na 209_aa | Tryptophan-associated transmembrane protein (Trp_oprn_chp) | |
| 235 | CAMIBB010000004.1 | GCA946222205_00119 | CDS | open | 1568-2617 | _na 349_aa | GNAT family N-acetyltransferase | |
| 236 | CAMIBB010000004.1 | GCA946222205_00120 | CDS | open | 2620-3987 | _na 455_aa | DUF349 domain-containing protein | |
| 237 | CAMIBB010000004.1 | GCA946222205_00121 | CDS | open | 4106-4720 | _na 204_aa | hypothetical protein | |
| 238 | CAMIBB010000004.1 | GCA946222205_00122 | CDS | open | 4713-5633 | _na 306_aa | miaA | tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA |
| 239 | CAMIBB010000004.1 | GCA946222205_00123 | CDS | open | 5630-6511 | _na 293_aa | dapF | diaminopimelate epimerase |
| 240 | CAMIBB010000004.1 | GCA946222205_00124 | CDS | open | 6461-6970 | _na 169_aa | Tat pathway signal sequence domain protein | |
| 241 | CAMIBB010000004.1 | GCA946222205_00125 | CDS | open | 6989-7756 | _na 255_aa | DUF2993 domain-containing protein | |
| 242 | CAMIBB010000004.1 | GCA946222205_00126 | CDS | open | 7893-9530 | _na 545_aa | hflX | GTPase HflX |
| 243 | CAMIBB010000004.1 | GCA946222205_00127 | CDS | open | 9555-10859 | _na 434_aa | Nitrate reductase | |
| 244 | CAMIBB010000004.1 | GCA946222205_00128 | CDS | open | 10856-11125 | _na 89_aa | HPr family phosphocarrier protein | |
| 245 | CAMIBB010000004.1 | GCA946222205_00129 | CDS | open | 11157-13169 | _na 670_aa | PTS lactose transporter subunit IIC | |
| 246 | CAMIBB010000004.1 | GCA946222205_00130 | CDS | open | 13176-14165 | _na 329_aa | 1-phosphofructokinase | |
| 247 | CAMIBB010000004.1 | GCA946222205_00131 | CDS | open | 14304-15083 | _na 259_aa | D-beta-D-heptose 1-phosphate adenosyltransferase | |
| 248 | CAMIBB010000004.1 | GCA946222205_00132 | CDS | open | 15196-15870 | _na 224_aa | lexA | transcriptional repressor LexA |
| 249 | CAMIBB010000004.1 | GCA946222205_00133 | CDS | open | 16116-16487 | _na 123_aa | Cell wall hydrolase | |
| 250 | CAMIBB010000004.1 | GCA946222205_00134 | CDS | open | 16548-17012 | _na 154_aa | nrdR | transcriptional regulator NrdR |
| 251 | CAMIBB010000004.1 | GCA946222205_00135 | CDS | open | 17009-20935 | _na 1308_aa | hrpA | ATP-dependent RNA helicase HrpA |
| 252 | CAMIBB010000004.1 | GCA946222205_00136 | CDS | open | 20969-21955 | _na 328_aa | putative hydrogen peroxide-inducible genes activator | |
| 253 | CAMIBB010000004.1 | GCA946222205_00137 | CDS | open | 22022-24595 | _na 857_aa | DEAD/DEAH box helicase | |
| 254 | CAMIBB010000004.1 | GCA946222205_00138 | CDS | open | 24604-25668 | _na 354_aa | PAC2 family protein | |
| 255 | CAMIBB010000004.1 | GCA946222205_00139 | CDS | open | 25882-27108 | _na 408_aa | DUF4192 domain-containing protein | |
| 256 | CAMIBB010000004.1 | GCA946222205_00140 | CDS | open | 27105-28067 | _na 320_aa | galE | UDP-glucose 4-epimerase GalE |
| 257 | CAMIBB010000004.1 | GCA946222205_00141 | CDS | open | 28071-28763 | _na 230_aa | Diphtheria toxin repressor | |
| 258 | CAMIBB010000004.1 | GCA946222205_00117 | gene | open | 48-782 | |||
| 259 | CAMIBB010000004.1 | GCA946222205_00118 | gene | open | 793-1422 | |||
| 260 | CAMIBB010000004.1 | GCA946222205_00119 | gene | open | 1568-2617 | |||
| 261 | CAMIBB010000004.1 | GCA946222205_00120 | gene | open | 2620-3987 | |||
| 262 | CAMIBB010000004.1 | GCA946222205_00121 | gene | open | 4106-4720 | |||
| 263 | CAMIBB010000004.1 | GCA946222205_00122 | gene | open | 4713-5633 | miaA | ||
| 264 | CAMIBB010000004.1 | GCA946222205_00123 | gene | open | 5630-6511 | dapF | ||
| 265 | CAMIBB010000004.1 | GCA946222205_00124 | gene | open | 6461-6970 | |||
| 266 | CAMIBB010000004.1 | GCA946222205_00125 | gene | open | 6989-7756 | |||
| 267 | CAMIBB010000004.1 | GCA946222205_00126 | gene | open | 7893-9530 | hflX | ||
| 268 | CAMIBB010000004.1 | GCA946222205_00127 | gene | open | 9555-10859 | |||
| 269 | CAMIBB010000004.1 | GCA946222205_00128 | gene | open | 10856-11125 | |||
| 270 | CAMIBB010000004.1 | GCA946222205_00129 | gene | open | 11157-13169 | |||
| 271 | CAMIBB010000004.1 | GCA946222205_00130 | gene | open | 13176-14165 | |||
| 272 | CAMIBB010000004.1 | GCA946222205_00131 | gene | open | 14304-15083 | |||
| 273 | CAMIBB010000004.1 | GCA946222205_00132 | gene | open | 15196-15870 | lexA | ||
| 274 | CAMIBB010000004.1 | GCA946222205_00133 | gene | open | 16116-16487 | |||
| 275 | CAMIBB010000004.1 | GCA946222205_00134 | gene | open | 16548-17012 | nrdR | ||
| 276 | CAMIBB010000004.1 | GCA946222205_00135 | gene | open | 17009-20935 | hrpA | ||
| 277 | CAMIBB010000004.1 | GCA946222205_00136 | gene | open | 20969-21955 | |||
| 278 | CAMIBB010000004.1 | GCA946222205_00137 | gene | open | 22022-24595 | |||
| 279 | CAMIBB010000004.1 | GCA946222205_00138 | gene | open | 24604-25668 | |||
| 280 | CAMIBB010000004.1 | GCA946222205_00139 | gene | open | 25882-27108 | |||
| 281 | CAMIBB010000004.1 | GCA946222205_00140 | gene | open | 27105-28067 | galE | ||
| 282 | CAMIBB010000004.1 | GCA946222205_00141 | gene | open | 28071-28763 | |||
| 283 | CAMIBB010000005.1 | GCA946222205_00142 | CDS | open | 531-1397 | _na 288_aa | Patatin family protein | |
| 284 | CAMIBB010000005.1 | GCA946222205_00143 | CDS | open | 1404-2588 | _na 394_aa | brkB | YihY/virulence factor BrkB family protein |
| 285 | CAMIBB010000005.1 | GCA946222205_00144 | CDS | open | 2620-3099 | _na 159_aa | Secreted protein | |
| 286 | CAMIBB010000005.1 | GCA946222205_00145 | CDS | open | 3102-4328 | _na 408_aa | MFS transporter | |
| 287 | CAMIBB010000005.1 | GCA946222205_00146 | CDS | open | 4450-5730 | _na 426_aa | D-serine ammonia-lyase | |
| 288 | CAMIBB010000005.1 | GCA946222205_00147 | CDS | open | 5727-7391 | _na 554_aa | FAD-binding dehydrogenase | |
| 289 | CAMIBB010000005.1 | GCA946222205_00148 | CDS | open | 7560-8753 | _na 397_aa | UDP-sulfoquinovose synthase | |
| 290 | CAMIBB010000005.1 | GCA946222205_00149 | CDS | open | 8778-9926 | _na 382_aa | Glycosyl transferase | |
| 291 | CAMIBB010000005.1 | GCA946222205_00150 | CDS | open | 9923-11110 | _na 395_aa | manA | mannose-6-phosphate isomerase%2C class I |
| 292 | CAMIBB010000005.1 | GCA946222205_00151 | CDS | open | 11229-12713 | _na 494_aa | glyceraldehyde-3-phosphate dehydrogenase | |
| 293 | CAMIBB010000005.1 | GCA946222205_00152 | CDS | open | 12760-13761 | _na 333_aa | 3-hydroxyisobutyryl-CoA hydrolase | |
| 294 | CAMIBB010000005.1 | GCA946222205_00153 | CDS | open | 13981-14652 | _na 223_aa | Biliverdin-producing heme oxygenase | |
| 295 | CAMIBB010000005.1 | GCA946222205_00154 | CDS | open | 14656-15123 | _na 155_aa | DUF202 domain-containing protein | |
| 296 | CAMIBB010000005.1 | GCA946222205_00155 | CDS | open | 15220-17259 | _na 679_aa | Htaa domain-containing protein | |
| 297 | CAMIBB010000005.1 | GCA946222205_00156 | CDS | open | 17312-18376 | _na 354_aa | ABC transporter substrate-binding protein | |
| 298 | CAMIBB010000005.1 | GCA946222205_00157 | CDS | open | 18376-19440 | _na 354_aa | Iron ABC transporter permease | |
| 299 | CAMIBB010000005.1 | GCA946222205_00158 | CDS | open | 19437-20237 | _na 266_aa | heme ABC transporter ATP-binding protein | |
| 300 | CAMIBB010000005.1 | GCA946222205_00159 | CDS | open | 20322-21191 | _na 289_aa | Htaa domain-containing protein | |
| 301 | CAMIBB010000005.1 | GCA946222205_00160 | CDS | open | 21240-21572 | _na 110_aa | Secreted protein | |
| 302 | CAMIBB010000005.1 | GCA946222205_00161 | CDS | open | 21582-22151 | _na 189_aa | DNA-3-methyladenine glycosylase | |
| 303 | CAMIBB010000005.1 | GCA946222205_00162 | CDS | open | 22148-23023 | _na 291_aa | ppk2 | polyphosphate kinase 2 |
| 304 | CAMIBB010000005.1 | GCA946222205_00163 | CDS | open | 23072-25105 | _na 677_aa | Neutral ceramidase | |
| 305 | CAMIBB010000005.1 | GCA946222205_00164 | CDS | open | 25169-26995 | _na 608_aa | abc-f | ribosomal protection-like ABC-F family protein |
| 306 | CAMIBB010000005.1 | GCA946222205_00142 | gene | open | 531-1397 | |||
| 307 | CAMIBB010000005.1 | GCA946222205_00143 | gene | open | 1404-2588 | brkB | ||
| 308 | CAMIBB010000005.1 | GCA946222205_00144 | gene | open | 2620-3099 | |||
| 309 | CAMIBB010000005.1 | GCA946222205_00145 | gene | open | 3102-4328 | |||
| 310 | CAMIBB010000005.1 | GCA946222205_00146 | gene | open | 4450-5730 | |||
| 311 | CAMIBB010000005.1 | GCA946222205_00147 | gene | open | 5727-7391 | |||
| 312 | CAMIBB010000005.1 | GCA946222205_00148 | gene | open | 7560-8753 | |||
| 313 | CAMIBB010000005.1 | GCA946222205_00149 | gene | open | 8778-9926 | |||
| 314 | CAMIBB010000005.1 | GCA946222205_00150 | gene | open | 9923-11110 | manA | ||
| 315 | CAMIBB010000005.1 | GCA946222205_00151 | gene | open | 11229-12713 | |||
| 316 | CAMIBB010000005.1 | GCA946222205_00152 | gene | open | 12760-13761 | |||
| 317 | CAMIBB010000005.1 | GCA946222205_00153 | gene | open | 13981-14652 | |||
| 318 | CAMIBB010000005.1 | GCA946222205_00154 | gene | open | 14656-15123 | |||
| 319 | CAMIBB010000005.1 | GCA946222205_00155 | gene | open | 15220-17259 | |||
| 320 | CAMIBB010000005.1 | GCA946222205_00156 | gene | open | 17312-18376 | |||
| 321 | CAMIBB010000005.1 | GCA946222205_00157 | gene | open | 18376-19440 | |||
| 322 | CAMIBB010000005.1 | GCA946222205_00158 | gene | open | 19437-20237 | |||
| 323 | CAMIBB010000005.1 | GCA946222205_00159 | gene | open | 20322-21191 | |||
| 324 | CAMIBB010000005.1 | GCA946222205_00160 | gene | open | 21240-21572 | |||
| 325 | CAMIBB010000005.1 | GCA946222205_00161 | gene | open | 21582-22151 | |||
| 326 | CAMIBB010000005.1 | GCA946222205_00162 | gene | open | 22148-23023 | ppk2 | ||
| 327 | CAMIBB010000005.1 | GCA946222205_00163 | gene | open | 23072-25105 | |||
| 328 | CAMIBB010000005.1 | GCA946222205_00164 | gene | open | 25169-26995 | abc-f | ||
| 329 | CAMIBB010000006.1 | repeat_region | open | 23409-25695 | CRISPR array with 38 repeats of length 28%2C consensus sequence GTGCTCCCCGCGCGAGCGGGGATGAGCC and spacer length 33 | |||
| 330 | CAMIBB010000006.1 | GCA946222205_00165 | CDS | open | 285-1394 | _na 369_aa | MFS transporter permease | |
| 331 | CAMIBB010000006.1 | GCA946222205_00166 | CDS | open | 1579-2895 | _na 438_aa | Serine--pyruvate aminotransferase | |
| 332 | CAMIBB010000006.1 | GCA946222205_00167 | CDS | open | 2928-3902 | _na 324_aa | GIY-YIG nuclease family protein | |
| 333 | CAMIBB010000006.1 | GCA946222205_00168 | CDS | open | 4157-6562 | _na 801_aa | DUF262 domain-containing protein | |
| 334 | CAMIBB010000006.1 | GCA946222205_00169 | CDS | open | 6736-7554 | _na 272_aa | Abi-like protein | |
| 335 | CAMIBB010000006.1 | GCA946222205_00170 | CDS | open | 7678-8355 | _na 225_aa | DUF4352 domain-containing protein | |
| 336 | CAMIBB010000006.1 | GCA946222205_00171 | CDS | open | 8430-10451 | _na 673_aa | L-dehydroascorbate transporter large permease subunit | |
| 337 | CAMIBB010000006.1 | GCA946222205_00172 | CDS | open | 10483-10962 | _na 159_aa | putative conserved protein | |
| 338 | CAMIBB010000006.1 | GCA946222205_00173 | CDS | open | 10967-11965 | _na 332_aa | ABC-type taurine transport system%2C periplasmic component | |
| 339 | CAMIBB010000006.1 | GCA946222205_00174 | CDS | open | 12290-12709 | _na 139_aa | luxR | LuxR family transcriptional regulator |
| 340 | CAMIBB010000006.1 | GCA946222205_00175 | CDS | open | 12738-13169 | _na 143_aa | DUF488 domain-containing protein | |
| 341 | CAMIBB010000006.1 | GCA946222205_00176 | CDS | open | 13177-13965 | _na 262_aa | Oxygen-insensitive NADPH nitroreductase | |
| 342 | CAMIBB010000006.1 | GCA946222205_00177 | CDS | open | 13995-14351 | _na 118_aa | cas2e | type I-E CRISPR-associated endoribonuclease Cas2e |
| 343 | CAMIBB010000006.1 | GCA946222205_00178 | CDS | open | 14348-15286 | _na 312_aa | cas1e | type I-E CRISPR-associated endonuclease Cas1e |
| 344 | CAMIBB010000006.1 | GCA946222205_00179 | CDS | open | 15290-15988 | _na 232_aa | cas6e | type I-E CRISPR-associated protein Cas6/Cse3/CasE |
| 345 | CAMIBB010000006.1 | GCA946222205_00180 | CDS | open | 15985-16704 | _na 239_aa | cas5e | type I-E CRISPR-associated protein Cas5/CasD |
| 346 | CAMIBB010000006.1 | GCA946222205_00181 | CDS | open | 16704-17840 | _na 378_aa | cas7e | type I-E CRISPR-associated protein Cas7/Cse4/CasC |
| 347 | CAMIBB010000006.1 | GCA946222205_00182 | CDS | open | 17870-18514 | _na 214_aa | casB | type I-E CRISPR-associated protein Cse2/CasB |
| 348 | CAMIBB010000006.1 | GCA946222205_00183 | CDS | open | 18507-20210 | _na 567_aa | casA | type I-E CRISPR-associated protein Cse1/CasA |
| 349 | CAMIBB010000006.1 | GCA946222205_00184 | CDS | open | 20279-23104 | _na 941_aa | CRISPR-associated helicase/endonuclease Cas3 | |
| 350 | CAMIBB010000006.1 | GCA946222205_00165 | gene | open | 285-1394 | |||
| 351 | CAMIBB010000006.1 | GCA946222205_00166 | gene | open | 1579-2895 | |||
| 352 | CAMIBB010000006.1 | GCA946222205_00167 | gene | open | 2928-3902 | |||
| 353 | CAMIBB010000006.1 | GCA946222205_00168 | gene | open | 4157-6562 | |||
| 354 | CAMIBB010000006.1 | GCA946222205_00169 | gene | open | 6736-7554 | |||
| 355 | CAMIBB010000006.1 | GCA946222205_00170 | gene | open | 7678-8355 | |||
| 356 | CAMIBB010000006.1 | GCA946222205_00171 | gene | open | 8430-10451 | |||
| 357 | CAMIBB010000006.1 | GCA946222205_00172 | gene | open | 10483-10962 | |||
| 358 | CAMIBB010000006.1 | GCA946222205_00173 | gene | open | 10967-11965 | |||
| 359 | CAMIBB010000006.1 | GCA946222205_00174 | gene | open | 12290-12709 | luxR | ||
| 360 | CAMIBB010000006.1 | GCA946222205_00175 | gene | open | 12738-13169 | |||
| 361 | CAMIBB010000006.1 | GCA946222205_00176 | gene | open | 13177-13965 | |||
| 362 | CAMIBB010000006.1 | GCA946222205_00177 | gene | open | 13995-14351 | cas2e | ||
| 363 | CAMIBB010000006.1 | GCA946222205_00178 | gene | open | 14348-15286 | cas1e | ||
| 364 | CAMIBB010000006.1 | GCA946222205_00179 | gene | open | 15290-15988 | cas6e | ||
| 365 | CAMIBB010000006.1 | GCA946222205_00180 | gene | open | 15985-16704 | cas5e | ||
| 366 | CAMIBB010000006.1 | GCA946222205_00181 | gene | open | 16704-17840 | cas7e | ||
| 367 | CAMIBB010000006.1 | GCA946222205_00182 | gene | open | 17870-18514 | casB | ||
| 368 | CAMIBB010000006.1 | GCA946222205_00183 | gene | open | 18507-20210 | casA | ||
| 369 | CAMIBB010000006.1 | GCA946222205_00184 | gene | open | 20279-23104 | |||
| 370 | CAMIBB010000007.1 | GCA946222205_00185 | CDS | open | 102-1100 | _na 332_aa | rsmH | 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH |
| 371 | CAMIBB010000007.1 | GCA946222205_00186 | CDS | open | 1143-1775 | _na 210_aa | ftsL | Cell division protein FtsL |
| 372 | CAMIBB010000007.1 | GCA946222205_00187 | CDS | open | 1871-3835 | _na 654_aa | ftsI | Cell division protein FtsI |
| 373 | CAMIBB010000007.1 | GCA946222205_00188 | CDS | open | 3849-5333 | _na 494_aa | UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2%2C6-diaminopimelate ligase | |
| 374 | CAMIBB010000007.1 | GCA946222205_00189 | CDS | open | 5336-6841 | _na 501_aa | UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase | |
| 375 | CAMIBB010000007.1 | GCA946222205_00190 | CDS | open | 6857-7966 | _na 369_aa | mraY | phospho-N-acetylmuramoyl-pentapeptide-transferase |
| 376 | CAMIBB010000007.1 | GCA946222205_00191 | CDS | open | 7963-9315 | _na 450_aa | murD | UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase |
| 377 | CAMIBB010000007.1 | GCA946222205_00192 | CDS | open | 9332-10735 | _na 467_aa | ftsW | putative peptidoglycan glycosyltransferase FtsW |
| 378 | CAMIBB010000007.1 | GCA946222205_00193 | CDS | open | 10753-11811 | _na 352_aa | UDP-N-acetylglucosamine--N-acetylmuramyl-(pentapeptide) pyrophosphoryl-undecaprenol N-acetylglucosamine transferase | |
| 379 | CAMIBB010000007.1 | GCA946222205_00194 | CDS | open | 11811-13217 | _na 468_aa | murC | UDP-N-acetylmuramate--L-alanine ligase |
| 380 | CAMIBB010000007.1 | GCA946222205_00195 | CDS | open | 13214-13867 | _na 217_aa | Cell division protein | |
| 381 | CAMIBB010000007.1 | GCA946222205_00196 | CDS | open | 13854-14006 | _na 50_aa | hypothetical protein | |
| 382 | CAMIBB010000007.1 | GCA946222205_00197 | CDS | open | 14009-15250 | _na 413_aa | ftsZ | cell division protein FtsZ |
| 383 | CAMIBB010000007.1 | GCA946222205_00198 | CDS | open | 15250-15957 | _na 235_aa | pgeF | peptidoglycan editing factor PgeF |
| 384 | CAMIBB010000007.1 | GCA946222205_00199 | CDS | open | 15957-16649 | _na 230_aa | Pyridoxal phosphate homeostasis protein | |
| 385 | CAMIBB010000007.1 | GCA946222205_00200 | CDS | open | 16690-17097 | _na 135_aa | sepF | Cell division protein SepF |
| 386 | CAMIBB010000007.1 | GCA946222205_00201 | CDS | open | 17109-17402 | _na 97_aa | yggT | YggT family protein |
| 387 | CAMIBB010000007.1 | GCA946222205_00202 | CDS | open | 17532-18350 | _na 272_aa | Cell wall synthesis protein Wag31 | |
| 388 | CAMIBB010000007.1 | GCA946222205_00203 | CDS | open | 18579-21749 | _na 1056_aa | ileS | isoleucine--tRNA ligase |
| 389 | CAMIBB010000007.1 | GCA946222205_00204 | CDS | open | 21754-23118 | _na 454_aa | DNA polymerase IV | |
| 390 | CAMIBB010000007.1 | GCA946222205_00205 | CDS | open | 23066-24088 | _na 340_aa | histidine kinase | |
| 391 | CAMIBB010000007.1 | GCA946222205_00206 | CDS | open | 24085-24753 | _na 222_aa | DNA-binding response regulator | |
| 392 | CAMIBB010000007.1 | GCA946222205_00185 | gene | open | 102-1100 | rsmH | ||
| 393 | CAMIBB010000007.1 | GCA946222205_00186 | gene | open | 1143-1775 | ftsL | ||
| 394 | CAMIBB010000007.1 | GCA946222205_00187 | gene | open | 1871-3835 | ftsI | ||
| 395 | CAMIBB010000007.1 | GCA946222205_00188 | gene | open | 3849-5333 | |||
| 396 | CAMIBB010000007.1 | GCA946222205_00189 | gene | open | 5336-6841 | |||
| 397 | CAMIBB010000007.1 | GCA946222205_00190 | gene | open | 6857-7966 | mraY | ||
| 398 | CAMIBB010000007.1 | GCA946222205_00191 | gene | open | 7963-9315 | murD | ||
| 399 | CAMIBB010000007.1 | GCA946222205_00192 | gene | open | 9332-10735 | ftsW | ||
| 400 | CAMIBB010000007.1 | GCA946222205_00193 | gene | open | 10753-11811 | |||
| 401 | CAMIBB010000007.1 | GCA946222205_00194 | gene | open | 11811-13217 | murC | ||
| 402 | CAMIBB010000007.1 | GCA946222205_00195 | gene | open | 13214-13867 | |||
| 403 | CAMIBB010000007.1 | GCA946222205_00196 | gene | open | 13854-14006 | |||
| 404 | CAMIBB010000007.1 | GCA946222205_00197 | gene | open | 14009-15250 | ftsZ | ||
| 405 | CAMIBB010000007.1 | GCA946222205_00198 | gene | open | 15250-15957 | pgeF | ||
| 406 | CAMIBB010000007.1 | GCA946222205_00199 | gene | open | 15957-16649 | |||
| 407 | CAMIBB010000007.1 | GCA946222205_00200 | gene | open | 16690-17097 | sepF | ||
| 408 | CAMIBB010000007.1 | GCA946222205_00201 | gene | open | 17109-17402 | yggT | ||
| 409 | CAMIBB010000007.1 | GCA946222205_00202 | gene | open | 17532-18350 | |||
| 410 | CAMIBB010000007.1 | GCA946222205_00203 | gene | open | 18579-21749 | ileS | ||
| 411 | CAMIBB010000007.1 | GCA946222205_00204 | gene | open | 21754-23118 | |||
| 412 | CAMIBB010000007.1 | GCA946222205_00205 | gene | open | 23066-24088 | |||
| 413 | CAMIBB010000007.1 | GCA946222205_00206 | gene | open | 24085-24753 | |||
| 414 | CAMIBB010000008.1 | GCA946222205_00208 | CDS | open | 335-721 | _na 128_aa | Secreted protein | |
| 415 | CAMIBB010000008.1 | GCA946222205_00209 | CDS | open | 718-1164 | _na 148_aa | hypothetical protein | |
| 416 | CAMIBB010000008.1 | GCA946222205_00210 | CDS | open | 1145-1426 | _na 93_aa | Holin | |
| 417 | CAMIBB010000008.1 | GCA946222205_00211 | CDS | open | 1419-2189 | _na 256_aa | N-acetylmuramoyl-L-alanine amidase | |
| 418 | CAMIBB010000008.1 | GCA946222205_00212 | CDS | open | 2232-2630 | _na 132_aa | hypothetical protein | |
| 419 | CAMIBB010000008.1 | GCA946222205_00213 | CDS | open | 2756-5113 | _na 785_aa | hypothetical protein | |
| 420 | CAMIBB010000008.1 | GCA946222205_00214 | CDS | open | 5114-5989 | _na 291_aa | hypothetical protein | |
| 421 | CAMIBB010000008.1 | GCA946222205_00215 | CDS | open | 5980-6762 | _na 260_aa | hypothetical protein | |
| 422 | CAMIBB010000008.1 | GCA946222205_00216 | CDS | open | 6787-12012 | _na 1741_aa | tape measure protein | |
| 423 | CAMIBB010000008.1 | GCA946222205_00217 | CDS | open | 12032-12424 | _na 130_aa | hypothetical protein | |
| 424 | CAMIBB010000008.1 | GCA946222205_00218 | CDS | open | 12472-12732 | _na 86_aa | Tail assembly chaperone | |
| 425 | CAMIBB010000008.1 | GCA946222205_00219 | CDS | open | 12837-13439 | _na 200_aa | Phage tail protein | |
| 426 | CAMIBB010000008.1 | GCA946222205_00220 | CDS | open | 13483-13854 | _na 123_aa | Tail terminator | |
| 427 | CAMIBB010000008.1 | GCA946222205_00221 | CDS | open | 13855-14127 | _na 90_aa | hypothetical protein | |
| 428 | CAMIBB010000008.1 | GCA946222205_00222 | CDS | open | 14124-14459 | _na 111_aa | Head-to-tail stopper | |
| 429 | CAMIBB010000008.1 | GCA946222205_00223 | CDS | open | 14462-14926 | _na 154_aa | Phage protein | |
| 430 | CAMIBB010000008.1 | GCA946222205_00224 | CDS | open | 14947-15888 | _na 313_aa | phage major capsid protein | |
| 431 | CAMIBB010000008.1 | GCA946222205_00225 | CDS | open | 15921-16415 | _na 164_aa | Scaffolding protein | |
| 432 | CAMIBB010000008.1 | GCA946222205_00226 | CDS | open | 16568-16753 | _na 61_aa | hypothetical protein | |
| 433 | CAMIBB010000008.1 | GCA946222205_00227 | CDS | open | 16734-16934 | _na 66_aa | hypothetical protein | |
| 434 | CAMIBB010000008.1 | GCA946222205_00228 | CDS | open | 17011-17301 | _na 96_aa | hypothetical protein | |
| 435 | CAMIBB010000008.1 | GCA946222205_00229 | CDS | open | 17298-18560 | _na 420_aa | EndoU domain-containing protein | |
| 436 | CAMIBB010000008.1 | GCA946222205_00230 | CDS | open | 18535-19944 | _na 469_aa | phage portal protein | |
| 437 | CAMIBB010000008.1 | GCA946222205_00231 | CDS | open | 19938-21392 | _na 484_aa | terL | terminase TerL endonuclease subunit |
| 438 | CAMIBB010000008.1 | GCA946222205_00232 | CDS | open | 21396-21794 | _na 132_aa | hypothetical protein | |
| 439 | CAMIBB010000008.1 | GCA946222205_00233 | CDS | open | 21921-22193 | _na 90_aa | HNH endonuclease | |
| 440 | CAMIBB010000008.1 | GCA946222205_00234 | CDS | open | 22477-23115 | _na 212_aa | hypothetical protein | |
| 441 | CAMIBB010000008.1 | GCA946222205_00235 | CDS | open | 23112-24482 | _na 456_aa | DEAD/DEAH box helicase | |
| 442 | CAMIBB010000008.1 | GCA946222205_00208 | gene | open | 335-721 | |||
| 443 | CAMIBB010000008.1 | GCA946222205_00209 | gene | open | 718-1164 | |||
| 444 | CAMIBB010000008.1 | GCA946222205_00210 | gene | open | 1145-1426 | |||
| 445 | CAMIBB010000008.1 | GCA946222205_00211 | gene | open | 1419-2189 | |||
| 446 | CAMIBB010000008.1 | GCA946222205_00212 | gene | open | 2232-2630 | |||
| 447 | CAMIBB010000008.1 | GCA946222205_00213 | gene | open | 2756-5113 | |||
| 448 | CAMIBB010000008.1 | GCA946222205_00214 | gene | open | 5114-5989 | |||
| 449 | CAMIBB010000008.1 | GCA946222205_00215 | gene | open | 5980-6762 | |||
| 450 | CAMIBB010000008.1 | GCA946222205_00216 | gene | open | 6787-12012 | |||
| 451 | CAMIBB010000008.1 | GCA946222205_00217 | gene | open | 12032-12424 | |||
| 452 | CAMIBB010000008.1 | GCA946222205_00218 | gene | open | 12472-12732 | |||
| 453 | CAMIBB010000008.1 | GCA946222205_00219 | gene | open | 12837-13439 | |||
| 454 | CAMIBB010000008.1 | GCA946222205_00220 | gene | open | 13483-13854 | |||
| 455 | CAMIBB010000008.1 | GCA946222205_00221 | gene | open | 13855-14127 | |||
| 456 | CAMIBB010000008.1 | GCA946222205_00222 | gene | open | 14124-14459 | |||
| 457 | CAMIBB010000008.1 | GCA946222205_00223 | gene | open | 14462-14926 | |||
| 458 | CAMIBB010000008.1 | GCA946222205_00224 | gene | open | 14947-15888 | |||
| 459 | CAMIBB010000008.1 | GCA946222205_00225 | gene | open | 15921-16415 | |||
| 460 | CAMIBB010000008.1 | GCA946222205_00226 | gene | open | 16568-16753 | |||
| 461 | CAMIBB010000008.1 | GCA946222205_00227 | gene | open | 16734-16934 | |||
| 462 | CAMIBB010000008.1 | GCA946222205_00228 | gene | open | 17011-17301 | |||
| 463 | CAMIBB010000008.1 | GCA946222205_00229 | gene | open | 17298-18560 | |||
| 464 | CAMIBB010000008.1 | GCA946222205_00230 | gene | open | 18535-19944 | |||
| 465 | CAMIBB010000008.1 | GCA946222205_00231 | gene | open | 19938-21392 | terL | ||
| 466 | CAMIBB010000008.1 | GCA946222205_00232 | gene | open | 21396-21794 | |||
| 467 | CAMIBB010000008.1 | GCA946222205_00233 | gene | open | 21921-22193 | |||
| 468 | CAMIBB010000008.1 | GCA946222205_00234 | gene | open | 22477-23115 | |||
| 469 | CAMIBB010000008.1 | GCA946222205_00235 | gene | open | 23112-24482 | |||
| 470 | CAMIBB010000008.1 | GCA946222205_00207 | gene | open | 75-142 | trnV | ||
| 471 | CAMIBB010000008.1 | GCA946222205_00207 | tRNA | open | 75-142 | trnV | tRNA-Val(tac) | |
| 472 | CAMIBB010000009.1 | GCA946222205_00236 | CDS | open | 647-1942 | _na 431_aa | hypothetical protein | |
| 473 | CAMIBB010000009.1 | GCA946222205_00237 | CDS | open | 1943-2836 | _na 297_aa | hypothetical protein | |
| 474 | CAMIBB010000009.1 | GCA946222205_00238 | CDS | open | 2833-3621 | _na 262_aa | Phage tail protein | |
| 475 | CAMIBB010000009.1 | GCA946222205_00239 | CDS | open | 3636-9797 | _na 2053_aa | tape measure protein | |
| 476 | CAMIBB010000009.1 | GCA946222205_00240 | CDS | open | 9816-10226 | _na 136_aa | hypothetical protein | |
| 477 | CAMIBB010000009.1 | GCA946222205_00241 | CDS | open | 10241-10657 | _na 138_aa | Tail assembly chaperone | |
| 478 | CAMIBB010000009.1 | GCA946222205_00242 | CDS | open | 10840-11466 | _na 208_aa | Major tail protein | |
| 479 | CAMIBB010000009.1 | GCA946222205_00243 | CDS | open | 11520-11879 | _na 119_aa | Tail terminator | |
| 480 | CAMIBB010000009.1 | GCA946222205_00244 | CDS | open | 11876-12115 | _na 79_aa | hypothetical protein | |
| 481 | CAMIBB010000009.1 | GCA946222205_00245 | CDS | open | 12099-12275 | _na 58_aa | hypothetical protein | |
| 482 | CAMIBB010000009.1 | GCA946222205_00246 | CDS | open | 12272-12664 | _na 130_aa | Head-to-tail stopper | |
| 483 | CAMIBB010000009.1 | GCA946222205_00247 | CDS | open | 12671-13066 | _na 131_aa | Head-to-tail adaptor | |
| 484 | CAMIBB010000009.1 | GCA946222205_00248 | CDS | open | 13023-13217 | _na 64_aa | Head-to-tail stopper | |
| 485 | CAMIBB010000009.1 | GCA946222205_00249 | CDS | open | 13231-14241 | _na 336_aa | major capsid protein | |
| 486 | CAMIBB010000009.1 | GCA946222205_00250 | CDS | open | 14247-14618 | _na 123_aa | Head decoration protein | |
| 487 | CAMIBB010000009.1 | GCA946222205_00251 | CDS | open | 14642-15217 | _na 191_aa | DUF4355 domain-containing protein | |
| 488 | CAMIBB010000009.1 | GCA946222205_00252 | CDS | open | 15343-16101 | _na 252_aa | Capsid maturation protease | |
| 489 | CAMIBB010000009.1 | GCA946222205_00253 | CDS | open | 16117-17757 | _na 546_aa | phage portal protein | |
| 490 | CAMIBB010000009.1 | GCA946222205_00254 | CDS | open | 17754-19376 | _na 540_aa | Terminase | |
| 491 | CAMIBB010000009.1 | GCA946222205_00255 | CDS | open | 19389-19838 | _na 149_aa | Terminase small subunit | |
| 492 | CAMIBB010000009.1 | GCA946222205_00256 | CDS | open | 20007-20294 | _na 95_aa | HNH endonuclease | |
| 493 | CAMIBB010000009.1 | GCA946222205_00257 | CDS | open | 20493-21164 | _na 223_aa | HD domain-containing protein | |
| 494 | CAMIBB010000009.1 | GCA946222205_00258 | CDS | open | 21161-21328 | _na 55_aa | hypothetical protein | |
| 495 | CAMIBB010000009.1 | GCA946222205_00259 | CDS | open | 21338-21592 | _na 84_aa | hypothetical protein | |
| 496 | CAMIBB010000009.1 | GCA946222205_00260 | CDS | open | 21589-22956 | _na 455_aa | DEAD/DEAH box helicase | |
| 497 | CAMIBB010000009.1 | GCA946222205_00261 | CDS | open | 22953-23276 | _na 107_aa | Nuclease | |
| 498 | CAMIBB010000009.1 | GCA946222205_00262 | CDS | open | 23568-24278 | _na 236_aa | hypothetical protein | |
| 499 | CAMIBB010000009.1 | GCA946222205_00236 | gene | open | 647-1942 | |||
| 500 | CAMIBB010000009.1 | GCA946222205_00237 | gene | open | 1943-2836 |

