HOMD Banner
Taxonomy: V4.3   |  16S rRNA RefSeq: V16.03   |  Genomic RefSeq: V11.03   |  Viruses: V1.2

BAKTAGenome Explorer: Veillonella parvula (GCA_946223045.1)

Select a Genome:
BAKTA Annotations for GCA_946223045.1
Genome Selected: Veillonella parvula
ContigsBases CDSrRNA tmRNAtRNA
108 1,961,210 1781 1 1 39
[Table]   [AA Fasta]      [Browser]   [Text]   [Excel]  
Search & Sort all 3675 Records
Search These Records: Clear
Sort Column:   Molecule   PID   NA   AA   Gene  Gene Product  Reverse
Annotation Table [page:8]    |    Number of Records Found: 3675 [8 Pages]    |    Previous Page <==> Next Page    |    Jump to Page: [ 1  2  3  4  5  6  7  8  ]
Notes:   1- Column headers only sort the current page. 2- Select [NA] or [AA] links to show sequences.
Region Protein-ID Type Genome
Viewer		 Range
(bp)		 Show Sequences
(length) NA / AA		 BAKTA
Gene		 BAKTA
GeneProduct
3501 CAMIHS010000087.1 GCA946223045_01743 CDS open 2518-3666 _na     382_aa bglX beta-N-acetylhexosaminidase
3502 CAMIHS010000087.1 GCA946223045_01744 CDS open 3943-4176 _na     77_aa nirB BFD-like [2Fe-2S]-binding domain-containing protein
3503 CAMIHS010000087.1 GCA946223045_01745 CDS open 4519-5145 _na     208_aa spoIVFB Peptidase M50
3504 CAMIHS010000087.1 GCA946223045_01746 CDS open 5155-5925 _na     256_aa yurZ Carboxymuconolactone decarboxylase family protein
3505 CAMIHS010000087.1 GCA946223045_01742 gene open 963-2114 fucO
3506 CAMIHS010000087.1 GCA946223045_01743 gene open 2518-3666 bglX
3507 CAMIHS010000087.1 GCA946223045_01744 gene open 3943-4176 nirB
3508 CAMIHS010000087.1 GCA946223045_01745 gene open 4519-5145 spoIVFB
3509 CAMIHS010000087.1 GCA946223045_01746 gene open 5155-5925 yurZ
3510 CAMIHS010000088.1 GCA946223045_01747 CDS open 123-1523 _na     466_aa citT Inner membrane protein ybhI
3511 CAMIHS010000088.1 GCA946223045_01748 CDS open 1759-2592 _na     277_aa mrp Iron-sulfur cluster carrier protein
3512 CAMIHS010000088.1 GCA946223045_01749 CDS open 2713-3906 _na     397_aa aRO8 2-aminoadipate transaminase
3513 CAMIHS010000088.1 GCA946223045_01750 CDS open 4058-4795 _na     245_aa tVP38 TVP38/TMEM64 family membrane protein
3514 CAMIHS010000088.1 GCA946223045_01751 CDS open 5036-5428 _na     130_aa Fluoroacetyl-CoA thioesterase
3515 CAMIHS010000088.1 GCA946223045_01752 CDS open 5573-5977 _na     134_aa hypothetical protein
3516 CAMIHS010000088.1 GCA946223045_01747 gene open 123-1523 citT
3517 CAMIHS010000088.1 GCA946223045_01748 gene open 1759-2592 mrp
3518 CAMIHS010000088.1 GCA946223045_01749 gene open 2713-3906 aRO8
3519 CAMIHS010000088.1 GCA946223045_01750 gene open 4058-4795 tVP38
3520 CAMIHS010000088.1 GCA946223045_01751 gene open 5036-5428
3521 CAMIHS010000088.1 GCA946223045_01752 gene open 5573-5977
3522 CAMIHS010000089.1 GCA946223045_01753 CDS open 394-2085 _na     563_aa preA Putative selenate reductase%2C YgfK subunit
3523 CAMIHS010000089.1 GCA946223045_01754 CDS open 2114-3442 _na     442_aa ssnA putative aminohydrolase SsnA
3524 CAMIHS010000089.1 GCA946223045_01755 CDS open 3497-4432 _na     311_aa arcC carbamate kinase
3525 CAMIHS010000089.1 GCA946223045_01756 CDS open 4501-5694 _na     397_aa ygeW knotted carbamoyltransferase YgeW
3526 CAMIHS010000089.1 GCA946223045_01753 gene open 394-2085 preA
3527 CAMIHS010000089.1 GCA946223045_01754 gene open 2114-3442 ssnA
3528 CAMIHS010000089.1 GCA946223045_01755 gene open 3497-4432 arcC
3529 CAMIHS010000089.1 GCA946223045_01756 gene open 4501-5694 ygeW
3530 CAMIHS010000090.1 GCA946223045_01757 CDS open 348-1121 _na     257_aa hypothetical protein
3531 CAMIHS010000090.1 GCA946223045_01758 CDS open 1230-2552 _na     440_aa uhpC Glycerol-3-phosphate transporter
3532 CAMIHS010000090.1 GCA946223045_01759 CDS open 3068-3202 _na     44_aa hypothetical protein
3533 CAMIHS010000090.1 GCA946223045_01760 CDS open 3521-4111 _na     196_aa nfnB Coenzyme F420:L-glutamate ligase
3534 CAMIHS010000090.1 GCA946223045_01761 CDS open 4493-5011 _na     172_aa marR MarR family transcriptional regulator
3535 CAMIHS010000090.1 GCA946223045_01762 CDS open 5166-5564 _na     132_aa DUF4822 domain-containing protein
3536 CAMIHS010000090.1 GCA946223045_01757 gene open 348-1121
3537 CAMIHS010000090.1 GCA946223045_01758 gene open 1230-2552 uhpC
3538 CAMIHS010000090.1 GCA946223045_01759 gene open 3068-3202
3539 CAMIHS010000090.1 GCA946223045_01760 gene open 3521-4111 nfnB
3540 CAMIHS010000090.1 GCA946223045_01761 gene open 4493-5011 marR
3541 CAMIHS010000090.1 GCA946223045_01762 gene open 5166-5564
3542 CAMIHS010000091.1 GCA946223045_01763 CDS open 113-640 _na     175_aa eCF-S ECF transporter S component
3543 CAMIHS010000091.1 GCA946223045_01764 CDS open 814-2988 _na     724_aa zntA P-type Cu(+) transporter
3544 CAMIHS010000091.1 GCA946223045_01765 CDS open 3401-4054 _na     217_aa yIH1 YigZ family protein
3545 CAMIHS010000091.1 GCA946223045_01766 CDS open 4078-4263 _na     61_aa hypothetical protein
3546 CAMIHS010000091.1 GCA946223045_01767 CDS open 4459-5349 _na     296_aa lysR HTH lysR-type domain-containing protein
3547 CAMIHS010000091.1 GCA946223045_01763 gene open 113-640 eCF-S
3548 CAMIHS010000091.1 GCA946223045_01764 gene open 814-2988 zntA
3549 CAMIHS010000091.1 GCA946223045_01765 gene open 3401-4054 yIH1
3550 CAMIHS010000091.1 GCA946223045_01766 gene open 4078-4263
3551 CAMIHS010000091.1 GCA946223045_01767 gene open 4459-5349 lysR
3552 CAMIHS010000092.1 GCA946223045_01768 CDS open 56-547 _na     163_aa 3-isopropylmalate dehydratase%2C small subunit
3553 CAMIHS010000092.1 GCA946223045_01769 CDS open 834-1904 _na     356_aa leuB 3-isopropylmalate dehydrogenase
3554 CAMIHS010000092.1 GCA946223045_01770 CDS open 2136-2675 _na     179_aa niaX Niacin transporter NiaX
3555 CAMIHS010000092.1 GCA946223045_01771 CDS open 2985-4172 _na     395_aa norV Flavodoxin-like domain-containing protein
3556 CAMIHS010000092.1 GCA946223045_01768 gene open 56-547
3557 CAMIHS010000092.1 GCA946223045_01769 gene open 834-1904 leuB
3558 CAMIHS010000092.1 GCA946223045_01770 gene open 2136-2675 niaX
3559 CAMIHS010000092.1 GCA946223045_01771 gene open 2985-4172 norV
3560 CAMIHS010000093.1 regulatory_region open 2369-2484 FMN riboswitch aptamer (RFN element)
3561 CAMIHS010000093.1 GCA946223045_01772 CDS open 333-2075 _na     580_aa poxB ubiquinone-dependent pyruvate dehydrogenase
3562 CAMIHS010000093.1 GCA946223045_01773 CDS open 2551-3765 _na     404_aa ribD bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD
3563 CAMIHS010000093.1 GCA946223045_01774 CDS open 3746-4402 _na     218_aa ribE riboflavin synthase
3564 CAMIHS010000093.1 GCA946223045_01772 gene open 333-2075 poxB
3565 CAMIHS010000093.1 GCA946223045_01773 gene open 2551-3765 ribD
3566 CAMIHS010000093.1 GCA946223045_01774 gene open 3746-4402 ribE
3567 CAMIHS010000094.1 GCA946223045_01775 CDS open 189-923 _na     244_aa Carboxymuconolactone decarboxylase family protein
3568 CAMIHS010000094.1 GCA946223045_01776 CDS open 1125-1784 _na     219_aa trmB tRNA (guanosine(46)-N7)-methyltransferase TrmB
3569 CAMIHS010000094.1 GCA946223045_01777 CDS open 1786-3111 _na     441_aa ftsW putative peptidoglycan glycosyltransferase FtsW
3570 CAMIHS010000094.1 GCA946223045_01778 CDS open 3240-4523 _na     427_aa uraA uracil permease
3571 CAMIHS010000094.1 GCA946223045_01775 gene open 189-923
3572 CAMIHS010000094.1 GCA946223045_01776 gene open 1125-1784 trmB
3573 CAMIHS010000094.1 GCA946223045_01777 gene open 1786-3111 ftsW
3574 CAMIHS010000094.1 GCA946223045_01778 gene open 3240-4523 uraA
3575 CAMIHS010000095.1 GCA946223045_01779 CDS open 67-1404 _na     445_aa narK Major facilitator superfamily (MFS) profile domain-containing protein
3576 CAMIHS010000095.1 GCA946223045_01780 CDS open 2070-2801 _na     243_aa hemQ hydrogen peroxide-dependent heme synthase
3577 CAMIHS010000095.1 GCA946223045_01781 CDS open 3032-4648 _na     538_aa Coproporphyrinogen III oxidase
3578 CAMIHS010000095.1 GCA946223045_01779 gene open 67-1404 narK
3579 CAMIHS010000095.1 GCA946223045_01780 gene open 2070-2801 hemQ
3580 CAMIHS010000095.1 GCA946223045_01781 gene open 3032-4648
3581 CAMIHS010000096.1 GCA946223045_01782 CDS open 10-231 _na     73_aa hypothetical protein
3582 CAMIHS010000096.1 GCA946223045_01783 CDS open 234-4025 _na     1263_aa polC PolC-type DNA polymerase III
3583 CAMIHS010000096.1 GCA946223045_01784 CDS open 4084-4362 _na     92_aa hypothetical protein
3584 CAMIHS010000096.1 GCA946223045_01785 CDS open 4464-4580 _na     38_aa hypothetical protein
3585 CAMIHS010000096.1 GCA946223045_01782 gene open 10-231
3586 CAMIHS010000096.1 GCA946223045_01783 gene open 234-4025 polC
3587 CAMIHS010000096.1 GCA946223045_01784 gene open 4084-4362
3588 CAMIHS010000096.1 GCA946223045_01785 gene open 4464-4580
3589 CAMIHS010000097.1 GCA946223045_01786 CDS open 4-612 _na     202_aa hypothetical protein
3590 CAMIHS010000097.1 GCA946223045_01787 CDS open 746-2611 _na     621_aa fhaC Hemolysin transporter protein ShlB
3591 CAMIHS010000097.1 GCA946223045_01788 CDS open 3047-3436 _na     129_aa hypothetical protein
3592 CAMIHS010000097.1 GCA946223045_01789 CDS open 4052-4201 _na     49_aa hypothetical protein
3593 CAMIHS010000097.1 GCA946223045_01786 gene open 4-612
3594 CAMIHS010000097.1 GCA946223045_01787 gene open 746-2611 fhaC
3595 CAMIHS010000097.1 GCA946223045_01788 gene open 3047-3436
3596 CAMIHS010000097.1 GCA946223045_01789 gene open 4052-4201
3597 CAMIHS010000098.1 GCA946223045_01790 CDS open 150-962 _na     270_aa Class I SAM-dependent methyltransferase
3598 CAMIHS010000098.1 GCA946223045_01791 CDS open 964-3003 _na     679_aa mutL DNA mismatch repair endonuclease MutL
3599 CAMIHS010000098.1 GCA946223045_01792 CDS open 3003-4283 _na     426_aa mutS DNA mismatch repair protein MutS
3600 CAMIHS010000098.1 GCA946223045_01790 gene open 150-962
3601 CAMIHS010000098.1 GCA946223045_01791 gene open 964-3003 mutL
3602 CAMIHS010000098.1 GCA946223045_01792 gene open 3003-4283 mutS
3603 CAMIHS010000099.1 repeat_region open 1568-1977 CRISPR array with 6 repeats of length 36%2C consensus sequence AGTTGCAACAGTGCTTACCGTTTACGGTATTGAAAC and spacer length 37
3604 CAMIHS010000099.1 GCA946223045_01793 CDS open 474-1286 _na     270_aa CRISPR-associated protein Cas6
3605 CAMIHS010000099.1 GCA946223045_01794 CDS open 2984-4273 _na     429_aa hypothetical protein
3606 CAMIHS010000099.1 GCA946223045_01793 gene open 474-1286
3607 CAMIHS010000099.1 GCA946223045_01794 gene open 2984-4273
3608 CAMIHS010000100.1 GCA946223045_01795 CDS open 43-573 _na     176_aa hypothetical protein
3609 CAMIHS010000100.1 GCA946223045_01796 CDS open 883-1677 _na     264_aa aroD 3-dehydroquinate dehydratase
3610 CAMIHS010000100.1 GCA946223045_01797 CDS open 1702-2004 _na     100_aa Type II toxin-antitoxin system RelE/ParE family toxin
3611 CAMIHS010000100.1 GCA946223045_01798 CDS open 2020-2625 _na     201_aa relB Type II toxin-antitoxin system RelB/DinJ family antitoxin
3612 CAMIHS010000100.1 GCA946223045_01799 CDS open 2960-3961 _na     333_aa shikimate kinase
3613 CAMIHS010000100.1 GCA946223045_01795 gene open 43-573
3614 CAMIHS010000100.1 GCA946223045_01796 gene open 883-1677 aroD
3615 CAMIHS010000100.1 GCA946223045_01797 gene open 1702-2004
3616 CAMIHS010000100.1 GCA946223045_01798 gene open 2020-2625 relB
3617 CAMIHS010000100.1 GCA946223045_01799 gene open 2960-3961
3618 CAMIHS010000101.1 GCA946223045_01800 CDS open 247-681 _na     144_aa CHAP domain-containing protein
3619 CAMIHS010000101.1 GCA946223045_01801 CDS open 763-2040 _na     425_aa hydroxymethylglutaryl-CoA reductase%2C degradative
3620 CAMIHS010000101.1 GCA946223045_01802 CDS open 2284-3450 _na     388_aa hydroxymethylglutaryl-CoA synthase
3621 CAMIHS010000101.1 GCA946223045_01803 CDS open 3505-3882 _na     125_aa methylated-DNA--[protein]-cysteine S-methyltransferase
3622 CAMIHS010000101.1 GCA946223045_01800 gene open 247-681
3623 CAMIHS010000101.1 GCA946223045_01801 gene open 763-2040
3624 CAMIHS010000101.1 GCA946223045_01802 gene open 2284-3450
3625 CAMIHS010000101.1 GCA946223045_01803 gene open 3505-3882
3626 CAMIHS010000102.1 GCA946223045_01805 CDS open 379-1209 _na     276_aa DUF6630 domain-containing protein
3627 CAMIHS010000102.1 GCA946223045_01806 CDS open 1323-2138 _na     271_aa DUF2262 domain-containing protein
3628 CAMIHS010000102.1 GCA946223045_01807 CDS open 2159-2590 _na     143_aa DUF2262 domain-containing protein
3629 CAMIHS010000102.1 GCA946223045_01808 CDS open 2662-3168 _na     168_aa Glutathione reductase
3630 CAMIHS010000102.1 GCA946223045_01809 CDS open 3206-3748 _na     180_aa ardA Antirestriction protein ArdA
3631 CAMIHS010000102.1 GCA946223045_01805 gene open 379-1209
3632 CAMIHS010000102.1 GCA946223045_01806 gene open 1323-2138
3633 CAMIHS010000102.1 GCA946223045_01807 gene open 2159-2590
3634 CAMIHS010000102.1 GCA946223045_01808 gene open 2662-3168
3635 CAMIHS010000102.1 GCA946223045_01809 gene open 3206-3748 ardA
3636 CAMIHS010000102.1 GCA946223045_01804 gene open 12-88 trnR
3637 CAMIHS010000102.1 GCA946223045_01804 tRNA open 12-88 trnR tRNA-Arg(cct)
3638 CAMIHS010000103.1 GCA946223045_01810 CDS open 476-745 _na     89_aa hypothetical protein
3639 CAMIHS010000103.1 GCA946223045_01811 CDS open 871-1512 _na     213_aa pdaC Deacetylase PdaC domain-containing protein
3640 CAMIHS010000103.1 GCA946223045_01812 CDS open 1780-2334 _na     184_aa hypothetical protein
3641 CAMIHS010000103.1 GCA946223045_01813 CDS open 2482-2832 _na     116_aa rplT 50S ribosomal protein L20
3642 CAMIHS010000103.1 GCA946223045_01814 CDS open 2881-3078 _na     65_aa rpmI 50S ribosomal protein L35
3643 CAMIHS010000103.1 GCA946223045_01815 CDS open 3099-3617 _na     172_aa infC translation initiation factor IF-3
3644 CAMIHS010000103.1 GCA946223045_01810 gene open 476-745
3645 CAMIHS010000103.1 GCA946223045_01811 gene open 871-1512 pdaC
3646 CAMIHS010000103.1 GCA946223045_01812 gene open 1780-2334
3647 CAMIHS010000103.1 GCA946223045_01813 gene open 2482-2832 rplT
3648 CAMIHS010000103.1 GCA946223045_01814 gene open 2881-3078 rpmI
3649 CAMIHS010000103.1 GCA946223045_01815 gene open 3099-3617 infC
3650 CAMIHS010000104.1 GCA946223045_01816 CDS open 9-554 _na     181_aa Thiamine-phosphate synthase
3651 CAMIHS010000104.1 GCA946223045_01817 CDS open 710-1255 _na     181_aa rbr rubrerythrin
3652 CAMIHS010000104.1 GCA946223045_01818 CDS open 2006-2209 _na     67_aa DUF951 domain-containing protein
3653 CAMIHS010000104.1 GCA946223045_01819 CDS open 2219-3250 _na     343_aa selD selenide%2C water dikinase SelD
3654 CAMIHS010000104.1 GCA946223045_01816 gene open 9-554
3655 CAMIHS010000104.1 GCA946223045_01817 gene open 710-1255 rbr
3656 CAMIHS010000104.1 GCA946223045_01818 gene open 2006-2209
3657 CAMIHS010000104.1 GCA946223045_01819 gene open 2219-3250 selD
3658 CAMIHS010000105.1 GCA946223045_01820 CDS open 878-1072 _na     64_aa hypothetical protein
3659 CAMIHS010000105.1 GCA946223045_01821 CDS open 1300-2766 _na     488_aa citT Citrate carrier
3660 CAMIHS010000105.1 GCA946223045_01822 CDS open 2733-2897 _na     54_aa hypothetical protein
3661 CAMIHS010000105.1 GCA946223045_01820 gene open 878-1072
3662 CAMIHS010000105.1 GCA946223045_01821 gene open 1300-2766 citT
3663 CAMIHS010000105.1 GCA946223045_01822 gene open 2733-2897
3664 CAMIHS010000106.1 GCA946223045_01823 CDS open 967-3024 _na     685_aa Autotransporter outer membrane beta-barrel domain-containing protein
3665 CAMIHS010000106.1 GCA946223045_01823 gene open 967-3024
3666 CAMIHS010000107.1 GCA946223045_01824 CDS open 52-423 _na     123_aa Membrane protein
3667 CAMIHS010000107.1 GCA946223045_01825 CDS open 482-1726 _na     414_aa fabF beta-ketoacyl-ACP synthase II
3668 CAMIHS010000107.1 GCA946223045_01826 CDS open 1738-2679 _na     313_aa fabH Beta-ketoacyl-[acyl-carrier-protein] synthase III
3669 CAMIHS010000107.1 GCA946223045_01824 gene open 52-423
3670 CAMIHS010000107.1 GCA946223045_01825 gene open 482-1726 fabF
3671 CAMIHS010000107.1 GCA946223045_01826 gene open 1738-2679 fabH
3672 CAMIHS010000108.1 GCA946223045_01827 CDS open 1192-1371 _na     59_aa hypothetical protein
3673 CAMIHS010000108.1 GCA946223045_01828 CDS open 1589-1924 _na     111_aa ylxM YlxM family DNA-binding protein
3674 CAMIHS010000108.1 GCA946223045_01827 gene open 1192-1371
3675 CAMIHS010000108.1 GCA946223045_01828 gene open 1589-1924 ylxM