HOMD Banner
Taxonomy: V4.3   |  16S rRNA RefSeq: V16.03   |  Genomic RefSeq: V11.03   |  Viruses: V1.2

BAKTAGenome Explorer: Veillonella parvula (GCA_946223045.1)

Select a Genome:
BAKTA Annotations for GCA_946223045.1
Genome Selected: Veillonella parvula
ContigsBases CDSrRNA tmRNAtRNA
108 1,961,210 1781 1 1 39
[Table]   [AA Fasta]      [Browser]   [Text]   [Excel]  
Search & Sort all 3675 Records
Search These Records: Clear
Sort Column:   Molecule   PID   NA   AA   Gene  Gene Product  Reverse
Annotation Table [page:5]    |    Number of Records Found: 3675 [8 Pages]    |    Previous Page <==> Next Page    |    Jump to Page: [ 1  2  3  4  5  6  7  8  ]
Notes:   1- Column headers only sort the current page. 2- Select [NA] or [AA] links to show sequences.
Region Protein-ID Type Genome
Viewer		 Range
(bp)		 Show Sequences
(length) NA / AA		 BAKTA
Gene		 BAKTA
GeneProduct
2001 CAMIHS010000026.1 repeat_region open 3637-4256 CRISPR array with 9 repeats of length 35%2C consensus sequence GTTGCAACAGTGCTTACCGTTTACGGTATTGAAAC and spacer length 36
2002 CAMIHS010000026.1 repeat_region open 20961-21731 CRISPR array with 11 repeats of length 35%2C consensus sequence GTTGCAACAGTGCTTACCGTTTACGGTATTGAAAC and spacer length 37
2003 CAMIHS010000026.1 GCA946223045_00994 CDS open 86-1114 _na     342_aa hypothetical protein
2004 CAMIHS010000026.1 GCA946223045_00995 CDS open 1044-1238 _na     64_aa hypothetical protein
2005 CAMIHS010000026.1 GCA946223045_00996 CDS open 2786-2893 _na     35_aa hypothetical protein
2006 CAMIHS010000026.1 GCA946223045_00997 CDS open 3069-3200 _na     43_aa hypothetical protein
2007 CAMIHS010000026.1 GCA946223045_00998 CDS open 4694-5092 _na     132_aa DUF805 domain-containing protein
2008 CAMIHS010000026.1 GCA946223045_00999 CDS open 5207-5482 _na     91_aa cas2 CRISPR-associated endonuclease Cas2
2009 CAMIHS010000026.1 GCA946223045_01000 CDS open 5500-6495 _na     331_aa cas1 CRISPR-associated endonuclease Cas1
2010 CAMIHS010000026.1 GCA946223045_01001 CDS open 6688-7053 _na     121_aa CRISPR-associated protein
2011 CAMIHS010000026.1 GCA946223045_01002 CDS open 7084-8688 _na     534_aa cas10 Cas10/Cmr2 second palm domain-containing protein
2012 CAMIHS010000026.1 GCA946223045_01003 CDS open 8691-9338 _na     215_aa RAMP superfamily CRISPR-associated protein
2013 CAMIHS010000026.1 GCA946223045_01004 CDS open 9326-10906 _na     526_aa csx10gr5 CRISPR-Cas system type II-D effector complex subunit Csx10%2C RAMP superfamily Cas5 group
2014 CAMIHS010000026.1 GCA946223045_01005 CDS open 10920-12254 _na     444_aa csm3 CRISPR-associated RAMP protein
2015 CAMIHS010000026.1 GCA946223045_01006 CDS open 12247-12810 _na     187_aa csx19 CRISPR-associated protein Csx19
2016 CAMIHS010000026.1 GCA946223045_01007 CDS open 12812-14827 _na     671_aa TIGR03986 family CRISPR-associated RAMP protein
2017 CAMIHS010000026.1 GCA946223045_01008 CDS open 14827-15630 _na     267_aa cas6a CRISPR system precrRNA processing endoribonuclease RAMP protein Cas6
2018 CAMIHS010000026.1 GCA946223045_01009 CDS open 15978-16640 _na     220_aa Phosphoribosyltransferase
2019 CAMIHS010000026.1 GCA946223045_01010 CDS open 16642-17589 _na     315_aa smf Transporter
2020 CAMIHS010000026.1 GCA946223045_01011 CDS open 17616-18152 _na     178_aa Hydrolase
2021 CAMIHS010000026.1 GCA946223045_01012 CDS open 18269-20524 _na     751_aa hypothetical protein
2022 CAMIHS010000026.1 GCA946223045_01013 CDS open 23149-24492 _na     447_aa purB adenylosuccinate lyase
2023 CAMIHS010000026.1 GCA946223045_00994 gene open 86-1114
2024 CAMIHS010000026.1 GCA946223045_00995 gene open 1044-1238
2025 CAMIHS010000026.1 GCA946223045_00996 gene open 2786-2893
2026 CAMIHS010000026.1 GCA946223045_00997 gene open 3069-3200
2027 CAMIHS010000026.1 GCA946223045_00998 gene open 4694-5092
2028 CAMIHS010000026.1 GCA946223045_00999 gene open 5207-5482 cas2
2029 CAMIHS010000026.1 GCA946223045_01000 gene open 5500-6495 cas1
2030 CAMIHS010000026.1 GCA946223045_01001 gene open 6688-7053
2031 CAMIHS010000026.1 GCA946223045_01002 gene open 7084-8688 cas10
2032 CAMIHS010000026.1 GCA946223045_01003 gene open 8691-9338
2033 CAMIHS010000026.1 GCA946223045_01004 gene open 9326-10906 csx10gr5
2034 CAMIHS010000026.1 GCA946223045_01005 gene open 10920-12254 csm3
2035 CAMIHS010000026.1 GCA946223045_01006 gene open 12247-12810 csx19
2036 CAMIHS010000026.1 GCA946223045_01007 gene open 12812-14827
2037 CAMIHS010000026.1 GCA946223045_01008 gene open 14827-15630 cas6a
2038 CAMIHS010000026.1 GCA946223045_01009 gene open 15978-16640
2039 CAMIHS010000026.1 GCA946223045_01010 gene open 16642-17589 smf
2040 CAMIHS010000026.1 GCA946223045_01011 gene open 17616-18152
2041 CAMIHS010000026.1 GCA946223045_01012 gene open 18269-20524
2042 CAMIHS010000026.1 GCA946223045_01013 gene open 23149-24492 purB
2043 CAMIHS010000027.1 regulatory_region open 19669-19756 ZMP/ZTP riboswitch aptamer (pfl RNA motif)
2044 CAMIHS010000027.1 GCA946223045_01014 CDS open 190-855 _na     221_aa cobH Cobalamin biosynthesis precorrin-8X methylmutase CobH/CbiC domain-containing protein
2045 CAMIHS010000027.1 GCA946223045_01015 CDS open 842-1630 _na     262_aa cobK precorrin-6A reductase
2046 CAMIHS010000027.1 GCA946223045_01016 CDS open 1627-2316 _na     229_aa cobJ Tetrapyrrole methylase domain-containing protein
2047 CAMIHS010000027.1 GCA946223045_01017 CDS open 2346-3491 _na     381_aa cbiG Cobalt-precorrin 5A hydrolase
2048 CAMIHS010000027.1 GCA946223045_01018 CDS open 3496-4257 _na     253_aa cobM precorrin-4 C(11)-methyltransferase
2049 CAMIHS010000027.1 GCA946223045_01019 CDS open 4259-4846 _na     195_aa cbiT Precorrin-6Y C5%2C15-methyltransferase (Decarboxylating)%2C CbiT subunit
2050 CAMIHS010000027.1 GCA946223045_01020 CDS open 4843-5469 _na     208_aa cbiE Precorrin-6y C5%2C15-methyltransferase (Decarboxylating)%2C CbiE subunit
2051 CAMIHS010000027.1 GCA946223045_01021 CDS open 5445-6563 _na     372_aa cbiD cobalt-precorrin-5B (C(1))-methyltransferase CbiD
2052 CAMIHS010000027.1 GCA946223045_01022 CDS open 6634-7128 _na     164_aa yajQ YajQ family cyclic di-GMP-binding protein
2053 CAMIHS010000027.1 GCA946223045_01023 CDS open 7536-9131 _na     531_aa WG repeat-containing protein
2054 CAMIHS010000027.1 GCA946223045_01024 CDS open 9358-10323 _na     321_aa Ribosomal large subunit pseudouridine synthase D
2055 CAMIHS010000027.1 GCA946223045_01025 CDS open 10572-11501 _na     309_aa fba class II fructose-1%2C6-bisphosphate aldolase
2056 CAMIHS010000027.1 GCA946223045_01026 CDS open 11505-13061 _na     518_aa spoVB putative cell division protein ytgP
2057 CAMIHS010000027.1 GCA946223045_01027 CDS open 13158-14201 _na     347_aa yfdV Auxin efflux carrier
2058 CAMIHS010000027.1 GCA946223045_01028 CDS open 14423-15163 _na     246_aa puuD Putative glutamine amidotransferase Rv2859c
2059 CAMIHS010000027.1 GCA946223045_01029 CDS open 15179-16486 _na     435_aa Amino acid permease/ SLC12A domain-containing protein
2060 CAMIHS010000027.1 GCA946223045_01030 CDS open 16657-17496 _na     279_aa SnoaL-like domain-containing protein
2061 CAMIHS010000027.1 GCA946223045_01031 CDS open 17636-18295 _na     219_aa gph Phosphoglycolate phosphatase
2062 CAMIHS010000027.1 GCA946223045_01032 CDS open 18496-19092 _na     198_aa hypothetical protein
2063 CAMIHS010000027.1 GCA946223045_01033 CDS open 19272-19391 _na     39_aa hypothetical protein
2064 CAMIHS010000027.1 GCA946223045_01035 CDS open 19846-21057 _na     403_aa yhjX Inner membrane protein yhjX
2065 CAMIHS010000027.1 GCA946223045_01036 CDS open 21330-24668 _na     1112_aa ATP-binding protein
2066 CAMIHS010000027.1 GCA946223045_01014 gene open 190-855 cobH
2067 CAMIHS010000027.1 GCA946223045_01015 gene open 842-1630 cobK
2068 CAMIHS010000027.1 GCA946223045_01016 gene open 1627-2316 cobJ
2069 CAMIHS010000027.1 GCA946223045_01017 gene open 2346-3491 cbiG
2070 CAMIHS010000027.1 GCA946223045_01018 gene open 3496-4257 cobM
2071 CAMIHS010000027.1 GCA946223045_01019 gene open 4259-4846 cbiT
2072 CAMIHS010000027.1 GCA946223045_01020 gene open 4843-5469 cbiE
2073 CAMIHS010000027.1 GCA946223045_01021 gene open 5445-6563 cbiD
2074 CAMIHS010000027.1 GCA946223045_01022 gene open 6634-7128 yajQ
2075 CAMIHS010000027.1 GCA946223045_01023 gene open 7536-9131
2076 CAMIHS010000027.1 GCA946223045_01024 gene open 9358-10323
2077 CAMIHS010000027.1 GCA946223045_01025 gene open 10572-11501 fba
2078 CAMIHS010000027.1 GCA946223045_01026 gene open 11505-13061 spoVB
2079 CAMIHS010000027.1 GCA946223045_01027 gene open 13158-14201 yfdV
2080 CAMIHS010000027.1 GCA946223045_01028 gene open 14423-15163 puuD
2081 CAMIHS010000027.1 GCA946223045_01029 gene open 15179-16486
2082 CAMIHS010000027.1 GCA946223045_01030 gene open 16657-17496
2083 CAMIHS010000027.1 GCA946223045_01031 gene open 17636-18295 gph
2084 CAMIHS010000027.1 GCA946223045_01032 gene open 18496-19092
2085 CAMIHS010000027.1 GCA946223045_01033 gene open 19272-19391
2086 CAMIHS010000027.1 GCA946223045_01035 gene open 19846-21057 yhjX
2087 CAMIHS010000027.1 GCA946223045_01036 gene open 21330-24668
2088 CAMIHS010000028.1 GCA946223045_01037 CDS open 830-1717 _na     295_aa Prephenate dehydrogenase
2089 CAMIHS010000028.1 GCA946223045_01038 CDS open 1825-3171 _na     448_aa norM Putative transporter YisQ
2090 CAMIHS010000028.1 GCA946223045_01039 CDS open 3359-4231 _na     290_aa porB 2-oxoacid:ferredoxin oxidoreductase subunit beta
2091 CAMIHS010000028.1 GCA946223045_01040 CDS open 4233-5984 _na     583_aa porG 2-oxoglutarate oxidoreductase subunit KorA
2092 CAMIHS010000028.1 GCA946223045_01041 CDS open 6282-7082 _na     266_aa truA tRNA pseudouridine(38-40) synthase TruA
2093 CAMIHS010000028.1 GCA946223045_01042 CDS open 7064-7867 _na     267_aa ecfT Energy-coupling factor transporter transmembrane protein EcfT
2094 CAMIHS010000028.1 GCA946223045_01043 CDS open 7857-8717 _na     286_aa ecfA2 energy-coupling factor transporter ATPase
2095 CAMIHS010000028.1 GCA946223045_01044 CDS open 8717-9625 _na     302_aa ecfA2 energy-coupling factor transporter ATPase
2096 CAMIHS010000028.1 GCA946223045_01045 CDS open 9662-9925 _na     87_aa hypothetical protein
2097 CAMIHS010000028.1 GCA946223045_01046 CDS open 9909-10244 _na     111_aa rplQ 50S ribosomal protein L17
2098 CAMIHS010000028.1 GCA946223045_01047 CDS open 10257-11261 _na     334_aa rpoA DNA-directed RNA polymerase subunit alpha
2099 CAMIHS010000028.1 GCA946223045_01048 CDS open 11332-11721 _na     129_aa rpsK 30S ribosomal protein S11
2100 CAMIHS010000028.1 GCA946223045_01049 CDS open 11741-12109 _na     122_aa rpsM 30S ribosomal protein S13
2101 CAMIHS010000028.1 GCA946223045_01050 CDS open 12133-12246 _na     37_aa rpmJ 50S ribosomal protein L36
2102 CAMIHS010000028.1 GCA946223045_01051 CDS open 12273-12491 _na     72_aa infA translation initiation factor IF-1
2103 CAMIHS010000028.1 GCA946223045_01052 CDS open 12514-13284 _na     256_aa map type I methionyl aminopeptidase
2104 CAMIHS010000028.1 GCA946223045_01053 CDS open 13288-13851 _na     187_aa adk adenylate kinase
2105 CAMIHS010000028.1 GCA946223045_01054 CDS open 13864-15126 _na     420_aa secY preprotein translocase subunit SecY
2106 CAMIHS010000028.1 GCA946223045_01055 CDS open 15128-15574 _na     148_aa rplO 50S ribosomal protein L15
2107 CAMIHS010000028.1 GCA946223045_01056 CDS open 15597-15776 _na     59_aa rpmD 50S ribosomal protein L30
2108 CAMIHS010000028.1 GCA946223045_01057 CDS open 15791-16294 _na     167_aa rpsE 30S ribosomal protein S5
2109 CAMIHS010000028.1 GCA946223045_01058 CDS open 16313-16693 _na     126_aa rplR 50S ribosomal protein L18
2110 CAMIHS010000028.1 GCA946223045_01059 CDS open 16711-17256 _na     181_aa rplF 50S ribosomal protein L6
2111 CAMIHS010000028.1 GCA946223045_01060 CDS open 17281-17667 _na     128_aa rpsH 30S ribosomal protein S8
2112 CAMIHS010000028.1 GCA946223045_01061 CDS open 17695-17964 _na     89_aa rpsN 30S ribosomal protein S14
2113 CAMIHS010000028.1 GCA946223045_01062 CDS open 17981-18520 _na     179_aa rplE 50S ribosomal protein L5
2114 CAMIHS010000028.1 GCA946223045_01063 CDS open 18544-18864 _na     106_aa rplX 50S ribosomal protein L24
2115 CAMIHS010000028.1 GCA946223045_01064 CDS open 18883-19251 _na     122_aa rplN 50S ribosomal protein L14
2116 CAMIHS010000028.1 GCA946223045_01065 CDS open 19276-19536 _na     86_aa rpsQ 30S ribosomal protein S17
2117 CAMIHS010000028.1 GCA946223045_01066 CDS open 19576-19779 _na     67_aa rpmC 50S ribosomal protein L29
2118 CAMIHS010000028.1 GCA946223045_01067 CDS open 19769-20206 _na     145_aa rplP 50S ribosomal protein L16
2119 CAMIHS010000028.1 GCA946223045_01068 CDS open 20206-20874 _na     222_aa rpsC 30S ribosomal protein S3
2120 CAMIHS010000028.1 GCA946223045_01069 CDS open 20891-21226 _na     111_aa rplV 50S ribosomal protein L22
2121 CAMIHS010000028.1 GCA946223045_01070 CDS open 21240-21521 _na     93_aa rpsS 30S ribosomal protein S19
2122 CAMIHS010000028.1 GCA946223045_01071 CDS open 21545-22375 _na     276_aa rplB 50S ribosomal protein L2
2123 CAMIHS010000028.1 GCA946223045_01072 CDS open 22402-22686 _na     94_aa rplW 50S ribosomal protein L23
2124 CAMIHS010000028.1 GCA946223045_01073 CDS open 22686-23309 _na     207_aa rplD 50S ribosomal protein L4
2125 CAMIHS010000028.1 GCA946223045_01074 CDS open 23336-23977 _na     213_aa rplC 50S ribosomal protein L3
2126 CAMIHS010000028.1 GCA946223045_01075 CDS open 23990-24301 _na     103_aa rpsJ 30S ribosomal protein S10
2127 CAMIHS010000028.1 GCA946223045_01037 gene open 830-1717
2128 CAMIHS010000028.1 GCA946223045_01038 gene open 1825-3171 norM
2129 CAMIHS010000028.1 GCA946223045_01039 gene open 3359-4231 porB
2130 CAMIHS010000028.1 GCA946223045_01040 gene open 4233-5984 porG
2131 CAMIHS010000028.1 GCA946223045_01041 gene open 6282-7082 truA
2132 CAMIHS010000028.1 GCA946223045_01042 gene open 7064-7867 ecfT
2133 CAMIHS010000028.1 GCA946223045_01043 gene open 7857-8717 ecfA2
2134 CAMIHS010000028.1 GCA946223045_01044 gene open 8717-9625 ecfA2
2135 CAMIHS010000028.1 GCA946223045_01045 gene open 9662-9925
2136 CAMIHS010000028.1 GCA946223045_01046 gene open 9909-10244 rplQ
2137 CAMIHS010000028.1 GCA946223045_01047 gene open 10257-11261 rpoA
2138 CAMIHS010000028.1 GCA946223045_01048 gene open 11332-11721 rpsK
2139 CAMIHS010000028.1 GCA946223045_01049 gene open 11741-12109 rpsM
2140 CAMIHS010000028.1 GCA946223045_01050 gene open 12133-12246 rpmJ
2141 CAMIHS010000028.1 GCA946223045_01051 gene open 12273-12491 infA
2142 CAMIHS010000028.1 GCA946223045_01052 gene open 12514-13284 map
2143 CAMIHS010000028.1 GCA946223045_01053 gene open 13288-13851 adk
2144 CAMIHS010000028.1 GCA946223045_01054 gene open 13864-15126 secY
2145 CAMIHS010000028.1 GCA946223045_01055 gene open 15128-15574 rplO
2146 CAMIHS010000028.1 GCA946223045_01056 gene open 15597-15776 rpmD
2147 CAMIHS010000028.1 GCA946223045_01057 gene open 15791-16294 rpsE
2148 CAMIHS010000028.1 GCA946223045_01058 gene open 16313-16693 rplR
2149 CAMIHS010000028.1 GCA946223045_01059 gene open 16711-17256 rplF
2150 CAMIHS010000028.1 GCA946223045_01060 gene open 17281-17667 rpsH
2151 CAMIHS010000028.1 GCA946223045_01061 gene open 17695-17964 rpsN
2152 CAMIHS010000028.1 GCA946223045_01062 gene open 17981-18520 rplE
2153 CAMIHS010000028.1 GCA946223045_01063 gene open 18544-18864 rplX
2154 CAMIHS010000028.1 GCA946223045_01064 gene open 18883-19251 rplN
2155 CAMIHS010000028.1 GCA946223045_01065 gene open 19276-19536 rpsQ
2156 CAMIHS010000028.1 GCA946223045_01066 gene open 19576-19779 rpmC
2157 CAMIHS010000028.1 GCA946223045_01067 gene open 19769-20206 rplP
2158 CAMIHS010000028.1 GCA946223045_01068 gene open 20206-20874 rpsC
2159 CAMIHS010000028.1 GCA946223045_01069 gene open 20891-21226 rplV
2160 CAMIHS010000028.1 GCA946223045_01070 gene open 21240-21521 rpsS
2161 CAMIHS010000028.1 GCA946223045_01071 gene open 21545-22375 rplB
2162 CAMIHS010000028.1 GCA946223045_01072 gene open 22402-22686 rplW
2163 CAMIHS010000028.1 GCA946223045_01073 gene open 22686-23309 rplD
2164 CAMIHS010000028.1 GCA946223045_01074 gene open 23336-23977 rplC
2165 CAMIHS010000028.1 GCA946223045_01075 gene open 23990-24301 rpsJ
2166 CAMIHS010000029.1 GCA946223045_01076 CDS open 266-2488 _na     740_aa comEC ComEC family competence protein
2167 CAMIHS010000029.1 GCA946223045_01077 CDS open 2445-3014 _na     189_aa comEA ComEA protein
2168 CAMIHS010000029.1 GCA946223045_01078 CDS open 3126-4355 _na     409_aa ampS Aminomethyltransferase
2169 CAMIHS010000029.1 GCA946223045_01079 CDS open 4434-4913 _na     159_aa comEB CMP/dCMP-type deaminase domain-containing protein
2170 CAMIHS010000029.1 GCA946223045_01080 CDS open 4997-7465 _na     822_aa leuS leucine--tRNA ligase
2171 CAMIHS010000029.1 GCA946223045_01081 CDS open 7556-9232 _na     558_aa sleL Sporulation-specific glycosylase YdhD
2172 CAMIHS010000029.1 GCA946223045_01082 CDS open 9390-10214 _na     274_aa lgt prolipoprotein diacylglyceryl transferase
2173 CAMIHS010000029.1 GCA946223045_01083 CDS open 10352-11668 _na     438_aa trmFO methylenetetrahydrofolate--tRNA-(uracil(54)-C(5))-methyltransferase (FADH(2)-oxidizing) TrmFO
2174 CAMIHS010000029.1 GCA946223045_01084 CDS open 11658-14033 _na     791_aa topA type I DNA topoisomerase
2175 CAMIHS010000029.1 GCA946223045_01085 CDS open 14023-15249 _na     408_aa dprA DNA-processing protein DprA
2176 CAMIHS010000029.1 GCA946223045_01086 CDS open 15258-16949 _na     563_aa Magnesium chelatase
2177 CAMIHS010000029.1 GCA946223045_01087 CDS open 16961-17359 _na     132_aa yraN YraN family protein
2178 CAMIHS010000029.1 GCA946223045_01088 CDS open 17584-18381 _na     265_aa rnhB ribonuclease HII
2179 CAMIHS010000029.1 GCA946223045_01089 CDS open 18374-19279 _na     301_aa ylqF ribosome biogenesis GTPase YlqF
2180 CAMIHS010000029.1 GCA946223045_01090 CDS open 19511-19852 _na     113_aa rplS 50S ribosomal protein L19
2181 CAMIHS010000029.1 GCA946223045_01091 CDS open 19994-20380 _na     128_aa marR Transcriptional regulator SlyA
2182 CAMIHS010000029.1 GCA946223045_01092 CDS open 20547-22598 _na     683_aa glyS Glycine--tRNA ligase beta subunit
2183 CAMIHS010000029.1 GCA946223045_01093 CDS open 22600-23475 _na     291_aa glyQ glycine--tRNA ligase subunit alpha
2184 CAMIHS010000029.1 GCA946223045_01094 CDS open 23835-24284 _na     149_aa hypothetical protein
2185 CAMIHS010000029.1 GCA946223045_01076 gene open 266-2488 comEC
2186 CAMIHS010000029.1 GCA946223045_01077 gene open 2445-3014 comEA
2187 CAMIHS010000029.1 GCA946223045_01078 gene open 3126-4355 ampS
2188 CAMIHS010000029.1 GCA946223045_01079 gene open 4434-4913 comEB
2189 CAMIHS010000029.1 GCA946223045_01080 gene open 4997-7465 leuS
2190 CAMIHS010000029.1 GCA946223045_01081 gene open 7556-9232 sleL
2191 CAMIHS010000029.1 GCA946223045_01082 gene open 9390-10214 lgt
2192 CAMIHS010000029.1 GCA946223045_01083 gene open 10352-11668 trmFO
2193 CAMIHS010000029.1 GCA946223045_01084 gene open 11658-14033 topA
2194 CAMIHS010000029.1 GCA946223045_01085 gene open 14023-15249 dprA
2195 CAMIHS010000029.1 GCA946223045_01086 gene open 15258-16949
2196 CAMIHS010000029.1 GCA946223045_01087 gene open 16961-17359 yraN
2197 CAMIHS010000029.1 GCA946223045_01088 gene open 17584-18381 rnhB
2198 CAMIHS010000029.1 GCA946223045_01089 gene open 18374-19279 ylqF
2199 CAMIHS010000029.1 GCA946223045_01090 gene open 19511-19852 rplS
2200 CAMIHS010000029.1 GCA946223045_01091 gene open 19994-20380 marR
2201 CAMIHS010000029.1 GCA946223045_01092 gene open 20547-22598 glyS
2202 CAMIHS010000029.1 GCA946223045_01093 gene open 22600-23475 glyQ
2203 CAMIHS010000029.1 GCA946223045_01094 gene open 23835-24284
2204 CAMIHS010000030.1 GCA946223045_01095 CDS open 1089-1907 _na     272_aa nlpA Lipoprotein
2205 CAMIHS010000030.1 GCA946223045_01096 CDS open 1980-2795 _na     271_aa nuoI 4Fe-4S ferredoxin-type domain-containing protein
2206 CAMIHS010000030.1 GCA946223045_01097 CDS open 3542-5095 _na     517_aa cysI Sulfite reductase [ferredoxin]
2207 CAMIHS010000030.1 GCA946223045_01098 CDS open 5345-6736 _na     463_aa tcyP L-cystine uptake protein TcyP
2208 CAMIHS010000030.1 GCA946223045_01099 CDS open 6912-7640 _na     242_aa lutC LUD domain-containing protein
2209 CAMIHS010000030.1 GCA946223045_01100 CDS open 7640-9085 _na     481_aa lutB LutB/LldF family L-lactate oxidation iron-sulfur protein
2210 CAMIHS010000030.1 GCA946223045_01101 CDS open 9098-9835 _na     245_aa glpC Cysteine-rich domain-containing protein
2211 CAMIHS010000030.1 GCA946223045_01102 CDS open 10359-12107 _na     582_aa S-layer-like y domain-containing protein
2212 CAMIHS010000030.1 GCA946223045_01103 CDS open 12291-13661 _na     456_aa S-layer protein
2213 CAMIHS010000030.1 GCA946223045_01104 CDS open 13754-14599 _na     281_aa DUF4163 domain-containing protein
2214 CAMIHS010000030.1 GCA946223045_01105 CDS open 14611-16689 _na     692_aa oPT OPT family oligopeptide transporter
2215 CAMIHS010000030.1 GCA946223045_01106 CDS open 16882-17139 _na     85_aa hypothetical protein
2216 CAMIHS010000030.1 GCA946223045_01107 CDS open 17188-18543 _na     451_aa fumC Fumarate hydratase class II
2217 CAMIHS010000030.1 GCA946223045_01108 CDS open 18696-19259 _na     187_aa hypothetical protein
2218 CAMIHS010000030.1 GCA946223045_01109 CDS open 19308-19604 _na     98_aa hypothetical protein
2219 CAMIHS010000030.1 GCA946223045_01110 CDS open 19638-20819 _na     393_aa yaeI Putative metallophosphoesterase
2220 CAMIHS010000030.1 GCA946223045_01111 CDS open 20836-21933 _na     365_aa mutY A/G-specific adenine glycosylase
2221 CAMIHS010000030.1 GCA946223045_01095 gene open 1089-1907 nlpA
2222 CAMIHS010000030.1 GCA946223045_01096 gene open 1980-2795 nuoI
2223 CAMIHS010000030.1 GCA946223045_01097 gene open 3542-5095 cysI
2224 CAMIHS010000030.1 GCA946223045_01098 gene open 5345-6736 tcyP
2225 CAMIHS010000030.1 GCA946223045_01099 gene open 6912-7640 lutC
2226 CAMIHS010000030.1 GCA946223045_01100 gene open 7640-9085 lutB
2227 CAMIHS010000030.1 GCA946223045_01101 gene open 9098-9835 glpC
2228 CAMIHS010000030.1 GCA946223045_01102 gene open 10359-12107
2229 CAMIHS010000030.1 GCA946223045_01103 gene open 12291-13661
2230 CAMIHS010000030.1 GCA946223045_01104 gene open 13754-14599
2231 CAMIHS010000030.1 GCA946223045_01105 gene open 14611-16689 oPT
2232 CAMIHS010000030.1 GCA946223045_01106 gene open 16882-17139
2233 CAMIHS010000030.1 GCA946223045_01107 gene open 17188-18543 fumC
2234 CAMIHS010000030.1 GCA946223045_01108 gene open 18696-19259
2235 CAMIHS010000030.1 GCA946223045_01109 gene open 19308-19604
2236 CAMIHS010000030.1 GCA946223045_01110 gene open 19638-20819 yaeI
2237 CAMIHS010000030.1 GCA946223045_01111 gene open 20836-21933 mutY
2238 CAMIHS010000031.1 GCA946223045_01112 CDS open 27-764 _na     245_aa znuB High-affinity zinc uptake system membrane protein ZnuB
2239 CAMIHS010000031.1 GCA946223045_01113 CDS open 996-1403 _na     135_aa fur Fur family transcriptional regulator%2C ferric uptake regulator
2240 CAMIHS010000031.1 GCA946223045_01114 CDS open 1509-2849 _na     446_aa dcuA C4-dicarboxylate transporter DcuA
2241 CAMIHS010000031.1 GCA946223045_01115 CDS open 3037-4425 _na     462_aa bioA adenosylmethionine--8-amino-7-oxononanoate transaminase
2242 CAMIHS010000031.1 GCA946223045_01116 CDS open 4610-5362 _na     250_aa bioD dethiobiotin synthase
2243 CAMIHS010000031.1 GCA946223045_01117 CDS open 5915-6460 _na     181_aa cynT Carbonate dehydratase
2244 CAMIHS010000031.1 GCA946223045_01118 CDS open 6808-7848 _na     346_aa yeiH Sulfate exporter family transporter
2245 CAMIHS010000031.1 GCA946223045_01119 CDS open 7984-8598 _na     204_aa lysE LysE family transporter
2246 CAMIHS010000031.1 GCA946223045_01120 CDS open 8739-9623 _na     294_aa lysR HTH-type transcriptional regulator BenM
2247 CAMIHS010000031.1 GCA946223045_01121 CDS open 9628-9789 _na     53_aa hypothetical protein
2248 CAMIHS010000031.1 GCA946223045_01122 CDS open 9828-11024 _na     398_aa araJ Transporter%2C major facilitator family protein
2249 CAMIHS010000031.1 GCA946223045_01123 CDS open 11112-11408 _na     98_aa hypothetical protein
2250 CAMIHS010000031.1 GCA946223045_01124 CDS open 11316-11921 _na     201_aa Ferric oxidoreductase domain-containing protein
2251 CAMIHS010000031.1 GCA946223045_01125 CDS open 12060-13331 _na     423_aa SLH domain-containing protein
2252 CAMIHS010000031.1 GCA946223045_01126 CDS open 13609-14211 _na     200_aa Ferric oxidoreductase domain-containing protein
2253 CAMIHS010000031.1 GCA946223045_01127 CDS open 14536-15207 _na     223_aa narI respiratory nitrate reductase subunit gamma
2254 CAMIHS010000031.1 GCA946223045_01128 CDS open 15204-15728 _na     174_aa narJ nitrate reductase molybdenum cofactor assembly chaperone
2255 CAMIHS010000031.1 GCA946223045_01129 CDS open 15721-17154 _na     477_aa narH nitrate reductase subunit beta
2256 CAMIHS010000031.1 GCA946223045_01130 CDS open 17144-20821 _na     1225_aa narG nitrate reductase subunit alpha
2257 CAMIHS010000031.1 GCA946223045_01131 CDS open 20893-21618 _na     241_aa crp Crp/Fnr family transcriptional regulator
2258 CAMIHS010000031.1 GCA946223045_01112 gene open 27-764 znuB
2259 CAMIHS010000031.1 GCA946223045_01113 gene open 996-1403 fur
2260 CAMIHS010000031.1 GCA946223045_01114 gene open 1509-2849 dcuA
2261 CAMIHS010000031.1 GCA946223045_01115 gene open 3037-4425 bioA
2262 CAMIHS010000031.1 GCA946223045_01116 gene open 4610-5362 bioD
2263 CAMIHS010000031.1 GCA946223045_01117 gene open 5915-6460 cynT
2264 CAMIHS010000031.1 GCA946223045_01118 gene open 6808-7848 yeiH
2265 CAMIHS010000031.1 GCA946223045_01119 gene open 7984-8598 lysE
2266 CAMIHS010000031.1 GCA946223045_01120 gene open 8739-9623 lysR
2267 CAMIHS010000031.1 GCA946223045_01121 gene open 9628-9789
2268 CAMIHS010000031.1 GCA946223045_01122 gene open 9828-11024 araJ
2269 CAMIHS010000031.1 GCA946223045_01123 gene open 11112-11408
2270 CAMIHS010000031.1 GCA946223045_01124 gene open 11316-11921
2271 CAMIHS010000031.1 GCA946223045_01125 gene open 12060-13331
2272 CAMIHS010000031.1 GCA946223045_01126 gene open 13609-14211
2273 CAMIHS010000031.1 GCA946223045_01127 gene open 14536-15207 narI
2274 CAMIHS010000031.1 GCA946223045_01128 gene open 15204-15728 narJ
2275 CAMIHS010000031.1 GCA946223045_01129 gene open 15721-17154 narH
2276 CAMIHS010000031.1 GCA946223045_01130 gene open 17144-20821 narG
2277 CAMIHS010000031.1 GCA946223045_01131 gene open 20893-21618 crp
2278 CAMIHS010000032.1 GCA946223045_01132 CDS open 286-1587 _na     433_aa deoA thymidine phosphorylase
2279 CAMIHS010000032.1 GCA946223045_01133 CDS open 1641-2303 _na     220_aa deoC deoxyribose-phosphate aldolase
2280 CAMIHS010000032.1 GCA946223045_01134 CDS open 2318-2947 _na     209_aa dnaQ DNA polymerase III polC-type
2281 CAMIHS010000032.1 GCA946223045_01135 CDS open 3136-3855 _na     239_aa pyrF orotidine-5'-phosphate decarboxylase
2282 CAMIHS010000032.1 GCA946223045_01136 CDS open 3852-4439 _na     195_aa pyrE orotate phosphoribosyltransferase
2283 CAMIHS010000032.1 GCA946223045_01137 CDS open 4624-5034 _na     136_aa ATP-dependent RNA helicase DHH1
2284 CAMIHS010000032.1 GCA946223045_01138 CDS open 5044-5619 _na     191_aa DUF1700 domain-containing protein
2285 CAMIHS010000032.1 GCA946223045_01139 CDS open 5606-5935 _na     109_aa padR Transcription regulator PadR N-terminal domain-containing protein
2286 CAMIHS010000032.1 GCA946223045_01140 CDS open 6295-7392 _na     365_aa degQ Serine protease Do-like HtrB
2287 CAMIHS010000032.1 GCA946223045_01141 CDS open 8061-8750 _na     229_aa ompR Sensory transduction protein regX3
2288 CAMIHS010000032.1 GCA946223045_01142 CDS open 8747-10087 _na     446_aa baeS histidine kinase
2289 CAMIHS010000032.1 GCA946223045_01143 CDS open 10535-11887 _na     450_aa oadA1 Pyruvate carboxyltransferase domain-containing protein
2290 CAMIHS010000032.1 GCA946223045_01144 CDS open 12432-12758 _na     108_aa hypothetical protein
2291 CAMIHS010000032.1 GCA946223045_01145 CDS open 12745-13920 _na     391_aa rfaF Lipopolysaccharide heptosyltransferase 1
2292 CAMIHS010000032.1 GCA946223045_01146 CDS open 13993-14940 _na     315_aa Dipeptidylpeptidase IV N-terminal domain-containing protein
2293 CAMIHS010000032.1 GCA946223045_01147 CDS open 14949-15854 _na     301_aa nAGPA Phosphodiester glycosidase domain-containing protein
2294 CAMIHS010000032.1 GCA946223045_01148 CDS open 15899-16702 _na     267_aa pgaB Poly-beta-1%2C6-N-acetyl-D-glucosamine N-deacetylase
2295 CAMIHS010000032.1 GCA946223045_01149 CDS open 16771-17334 _na     187_aa Nitroreductase family protein
2296 CAMIHS010000032.1 GCA946223045_01150 CDS open 17540-18331 _na     263_aa nit1 CN hydrolase domain-containing protein
2297 CAMIHS010000032.1 GCA946223045_01151 CDS open 18438-18650 _na     70_aa hypothetical protein
2298 CAMIHS010000032.1 GCA946223045_01152 CDS open 18863-20236 _na     457_aa pgtP phosphoglycerate transporter PgtP
2299 CAMIHS010000032.1 GCA946223045_01153 CDS open 20346-20777 _na     143_aa hypothetical protein
2300 CAMIHS010000032.1 GCA946223045_01132 gene open 286-1587 deoA
2301 CAMIHS010000032.1 GCA946223045_01133 gene open 1641-2303 deoC
2302 CAMIHS010000032.1 GCA946223045_01134 gene open 2318-2947 dnaQ
2303 CAMIHS010000032.1 GCA946223045_01135 gene open 3136-3855 pyrF
2304 CAMIHS010000032.1 GCA946223045_01136 gene open 3852-4439 pyrE
2305 CAMIHS010000032.1 GCA946223045_01137 gene open 4624-5034
2306 CAMIHS010000032.1 GCA946223045_01138 gene open 5044-5619
2307 CAMIHS010000032.1 GCA946223045_01139 gene open 5606-5935 padR
2308 CAMIHS010000032.1 GCA946223045_01140 gene open 6295-7392 degQ
2309 CAMIHS010000032.1 GCA946223045_01141 gene open 8061-8750 ompR
2310 CAMIHS010000032.1 GCA946223045_01142 gene open 8747-10087 baeS
2311 CAMIHS010000032.1 GCA946223045_01143 gene open 10535-11887 oadA1
2312 CAMIHS010000032.1 GCA946223045_01144 gene open 12432-12758
2313 CAMIHS010000032.1 GCA946223045_01145 gene open 12745-13920 rfaF
2314 CAMIHS010000032.1 GCA946223045_01146 gene open 13993-14940
2315 CAMIHS010000032.1 GCA946223045_01147 gene open 14949-15854 nAGPA
2316 CAMIHS010000032.1 GCA946223045_01148 gene open 15899-16702 pgaB
2317 CAMIHS010000032.1 GCA946223045_01149 gene open 16771-17334
2318 CAMIHS010000032.1 GCA946223045_01150 gene open 17540-18331 nit1
2319 CAMIHS010000032.1 GCA946223045_01151 gene open 18438-18650
2320 CAMIHS010000032.1 GCA946223045_01152 gene open 18863-20236 pgtP
2321 CAMIHS010000032.1 GCA946223045_01153 gene open 20346-20777
2322 CAMIHS010000033.1 GCA946223045_01154 CDS open 454-1629 _na     391_aa araJ Major facilitator superfamily MFS_1
2323 CAMIHS010000033.1 GCA946223045_01155 CDS open 1858-2751 _na     297_aa secF Protein-export membrane protein SecF
2324 CAMIHS010000033.1 GCA946223045_01156 CDS open 2748-4022 _na     424_aa secD Protein translocase subunit SecD
2325 CAMIHS010000033.1 GCA946223045_01157 CDS open 4041-4607 _na     188_aa fAU1 5-formyltetrahydrofolate cyclo-ligase
2326 CAMIHS010000033.1 GCA946223045_01158 CDS open 4607-4897 _na     96_aa yajC preprotein translocase subunit YajC
2327 CAMIHS010000033.1 GCA946223045_01159 CDS open 4975-6090 _na     371_aa tgt tRNA guanosine(34) transglycosylase Tgt
2328 CAMIHS010000033.1 GCA946223045_01160 CDS open 6099-7124 _na     341_aa queA tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA
2329 CAMIHS010000033.1 GCA946223045_01161 CDS open 7136-8926 _na     596_aa spoIID SpoIID/LytB protein
2330 CAMIHS010000033.1 GCA946223045_01162 CDS open 8929-9933 _na     334_aa ruvB Holliday junction branch migration DNA helicase RuvB
2331 CAMIHS010000033.1 GCA946223045_01163 CDS open 9936-10544 _na     202_aa ruvA Holliday junction branch migration protein RuvA
2332 CAMIHS010000033.1 GCA946223045_01164 CDS open 10544-11038 _na     164_aa ruvC crossover junction endodeoxyribonuclease RuvC
2333 CAMIHS010000033.1 GCA946223045_01165 CDS open 11244-11978 _na     244_aa tACO1 YebC/PmpR family DNA-binding transcriptional regulator
2334 CAMIHS010000033.1 GCA946223045_01166 CDS open 11988-12560 _na     190_aa tRNA (guanine-N(1)-)-methyltransferase C-terminal domain-containing protein
2335 CAMIHS010000033.1 GCA946223045_01167 CDS open 12619-13179 _na     186_aa Gram-positive signal peptide protein%2C YSIRK family
2336 CAMIHS010000033.1 GCA946223045_01168 CDS open 13191-13622 _na     143_aa DUF350 domain-containing protein
2337 CAMIHS010000033.1 GCA946223045_01169 CDS open 13633-14703 _na     356_aa DUF4178 domain-containing protein
2338 CAMIHS010000033.1 GCA946223045_01170 CDS open 14806-16113 _na     435_aa ygiC Acid--amine ligase YgiC
2339 CAMIHS010000033.1 GCA946223045_01171 CDS open 16128-16700 _na     190_aa Gram-positive signal peptide protein%2C YSIRK family
2340 CAMIHS010000033.1 GCA946223045_01172 CDS open 16745-17791 _na     348_aa DUF4178 domain-containing protein
2341 CAMIHS010000033.1 GCA946223045_01173 CDS open 17788-18603 _na     271_aa trmD tRNA (guanosine(37)-N1)-methyltransferase TrmD
2342 CAMIHS010000033.1 GCA946223045_01174 CDS open 18724-19221 _na     165_aa rimM ribosome maturation factor RimM
2343 CAMIHS010000033.1 GCA946223045_01175 CDS open 19221-19628 _na     135_aa rimM 16S rRNA processing protein RimM
2344 CAMIHS010000033.1 GCA946223045_01176 CDS open 19643-19870 _na     75_aa ylqC KH domain-containing protein
2345 CAMIHS010000033.1 GCA946223045_01177 CDS open 19892-20155 _na     87_aa rpsP 30S ribosomal protein S16
2346 CAMIHS010000033.1 GCA946223045_01178 CDS open 20216-20731 _na     171_aa hypothetical protein
2347 CAMIHS010000033.1 GCA946223045_01154 gene open 454-1629 araJ
2348 CAMIHS010000033.1 GCA946223045_01155 gene open 1858-2751 secF
2349 CAMIHS010000033.1 GCA946223045_01156 gene open 2748-4022 secD
2350 CAMIHS010000033.1 GCA946223045_01157 gene open 4041-4607 fAU1
2351 CAMIHS010000033.1 GCA946223045_01158 gene open 4607-4897 yajC
2352 CAMIHS010000033.1 GCA946223045_01159 gene open 4975-6090 tgt
2353 CAMIHS010000033.1 GCA946223045_01160 gene open 6099-7124 queA
2354 CAMIHS010000033.1 GCA946223045_01161 gene open 7136-8926 spoIID
2355 CAMIHS010000033.1 GCA946223045_01162 gene open 8929-9933 ruvB
2356 CAMIHS010000033.1 GCA946223045_01163 gene open 9936-10544 ruvA
2357 CAMIHS010000033.1 GCA946223045_01164 gene open 10544-11038 ruvC
2358 CAMIHS010000033.1 GCA946223045_01165 gene open 11244-11978 tACO1
2359 CAMIHS010000033.1 GCA946223045_01166 gene open 11988-12560
2360 CAMIHS010000033.1 GCA946223045_01167 gene open 12619-13179
2361 CAMIHS010000033.1 GCA946223045_01168 gene open 13191-13622
2362 CAMIHS010000033.1 GCA946223045_01169 gene open 13633-14703
2363 CAMIHS010000033.1 GCA946223045_01170 gene open 14806-16113 ygiC
2364 CAMIHS010000033.1 GCA946223045_01171 gene open 16128-16700
2365 CAMIHS010000033.1 GCA946223045_01172 gene open 16745-17791
2366 CAMIHS010000033.1 GCA946223045_01173 gene open 17788-18603 trmD
2367 CAMIHS010000033.1 GCA946223045_01174 gene open 18724-19221 rimM
2368 CAMIHS010000033.1 GCA946223045_01175 gene open 19221-19628 rimM
2369 CAMIHS010000033.1 GCA946223045_01176 gene open 19643-19870 ylqC
2370 CAMIHS010000033.1 GCA946223045_01177 gene open 19892-20155 rpsP
2371 CAMIHS010000033.1 GCA946223045_01178 gene open 20216-20731
2372 CAMIHS010000034.1 GCA946223045_01179 CDS open 10-1158 _na     382_aa uhpC D-galactonate transporter
2373 CAMIHS010000034.1 GCA946223045_01180 CDS open 1312-1860 _na     182_aa tesA SGNH hydrolase-type esterase domain-containing protein
2374 CAMIHS010000034.1 GCA946223045_01181 CDS open 2023-3015 _na     330_aa hypothetical protein
2375 CAMIHS010000034.1 GCA946223045_01182 CDS open 3367-6933 _na     1188_aa addB ATP-dependent helicase/deoxyribonuclease subunit B
2376 CAMIHS010000034.1 GCA946223045_01183 CDS open 6923-10678 _na     1251_aa addA helicase-exonuclease AddAB subunit AddA
2377 CAMIHS010000034.1 GCA946223045_01184 CDS open 10759-11700 _na     313_aa lCB5 Lipid kinase%2C YegS/Rv2252/BmrU family
2378 CAMIHS010000034.1 GCA946223045_01185 CDS open 11909-12616 _na     235_aa gntR FCD domain protein
2379 CAMIHS010000034.1 GCA946223045_01186 CDS open 12797-13180 _na     127_aa hipB Helix-turn-helix transcriptional regulator
2380 CAMIHS010000034.1 GCA946223045_01187 CDS open 13370-13750 _na     126_aa crcB fluoride efflux transporter CrcB
2381 CAMIHS010000034.1 GCA946223045_01188 CDS open 13835-14815 _na     326_aa moeA Molybdopterin molybdenumtransferase
2382 CAMIHS010000034.1 GCA946223045_01189 CDS open 15234-17732 _na     832_aa dR0291 S-layer-like y domain-containing protein
2383 CAMIHS010000034.1 GCA946223045_01190 CDS open 17864-18094 _na     76_aa hypothetical protein
2384 CAMIHS010000034.1 GCA946223045_01191 CDS open 18104-18871 _na     255_aa dR1119 Metallophosphoesterase
2385 CAMIHS010000034.1 GCA946223045_01192 CDS open 18949-19722 _na     257_aa galT UTP--hexose-1-phosphate uridylyltransferase
2386 CAMIHS010000034.1 GCA946223045_01193 CDS open 19840-20361 _na     173_aa Oxidized purine nucleoside triphosphate hydrolase
2387 CAMIHS010000034.1 GCA946223045_01179 gene open 10-1158 uhpC
2388 CAMIHS010000034.1 GCA946223045_01180 gene open 1312-1860 tesA
2389 CAMIHS010000034.1 GCA946223045_01181 gene open 2023-3015
2390 CAMIHS010000034.1 GCA946223045_01182 gene open 3367-6933 addB
2391 CAMIHS010000034.1 GCA946223045_01183 gene open 6923-10678 addA
2392 CAMIHS010000034.1 GCA946223045_01184 gene open 10759-11700 lCB5
2393 CAMIHS010000034.1 GCA946223045_01185 gene open 11909-12616 gntR
2394 CAMIHS010000034.1 GCA946223045_01186 gene open 12797-13180 hipB
2395 CAMIHS010000034.1 GCA946223045_01187 gene open 13370-13750 crcB
2396 CAMIHS010000034.1 GCA946223045_01188 gene open 13835-14815 moeA
2397 CAMIHS010000034.1 GCA946223045_01189 gene open 15234-17732 dR0291
2398 CAMIHS010000034.1 GCA946223045_01190 gene open 17864-18094
2399 CAMIHS010000034.1 GCA946223045_01191 gene open 18104-18871 dR1119
2400 CAMIHS010000034.1 GCA946223045_01192 gene open 18949-19722 galT
2401 CAMIHS010000034.1 GCA946223045_01193 gene open 19840-20361
2402 CAMIHS010000035.1 GCA946223045_01194 CDS open 559-705 _na     48_aa hypothetical protein
2403 CAMIHS010000035.1 GCA946223045_01195 CDS open 632-1201 _na     189_aa yqeK bis(5'-nucleosyl)-tetraphosphatase (symmetrical) YqeK
2404 CAMIHS010000035.1 GCA946223045_01196 CDS open 1205-1819 _na     204_aa nadD nicotinate-nucleotide adenylyltransferase
2405 CAMIHS010000035.1 GCA946223045_01197 CDS open 1959-3218 _na     419_aa proA glutamate-5-semialdehyde dehydrogenase
2406 CAMIHS010000035.1 GCA946223045_01198 CDS open 3228-4349 _na     373_aa proB Glutamate 5-kinase
2407 CAMIHS010000035.1 GCA946223045_01199 CDS open 4421-4705 _na     94_aa yhbY ribosome assembly RNA-binding protein YhbY
2408 CAMIHS010000035.1 GCA946223045_01200 CDS open 4714-5985 _na     423_aa obgE GTPase ObgE
2409 CAMIHS010000035.1 GCA946223045_01201 CDS open 6003-7142 _na     379_aa ctpA Peptidase%2C S41 family
2410 CAMIHS010000035.1 GCA946223045_01202 CDS open 7144-8325 _na     393_aa envC Peptidase%2C M23 family
2411 CAMIHS010000035.1 GCA946223045_01203 CDS open 8331-9218 _na     295_aa ftsX permease-like cell division protein FtsX
2412 CAMIHS010000035.1 GCA946223045_01204 CDS open 9208-9894 _na     228_aa ftsE cell division ATP-binding protein FtsE
2413 CAMIHS010000035.1 GCA946223045_01205 CDS open 9909-10841 _na     310_aa tktA2 1-deoxy-D-xylulose-5-phosphate synthase
2414 CAMIHS010000035.1 GCA946223045_01206 CDS open 10841-11677 _na     278_aa tktA1 Transketolase N-terminal domain-containing protein
2415 CAMIHS010000035.1 GCA946223045_01207 CDS open 11711-12811 _na     366_aa csaB polysaccharide pyruvyl transferase CsaB
2416 CAMIHS010000035.1 GCA946223045_01208 CDS open 12804-14846 _na     680_aa ATP synthase F0%2C A subunit
2417 CAMIHS010000035.1 GCA946223045_01209 CDS open 14859-15554 _na     231_aa DUF2993 domain-containing protein
2418 CAMIHS010000035.1 GCA946223045_01210 CDS open 15563-16555 _na     330_aa prfB peptide chain release factor 2
2419 CAMIHS010000035.1 GCA946223045_01211 CDS open 16791-19250 _na     819_aa secA preprotein translocase subunit SecA
2420 CAMIHS010000035.1 GCA946223045_01212 CDS open 19445-19972 _na     175_aa hpf ribosome hibernation-promoting factor%2C HPF/YfiA family
2421 CAMIHS010000035.1 GCA946223045_01194 gene open 559-705
2422 CAMIHS010000035.1 GCA946223045_01195 gene open 632-1201 yqeK
2423 CAMIHS010000035.1 GCA946223045_01196 gene open 1205-1819 nadD
2424 CAMIHS010000035.1 GCA946223045_01197 gene open 1959-3218 proA
2425 CAMIHS010000035.1 GCA946223045_01198 gene open 3228-4349 proB
2426 CAMIHS010000035.1 GCA946223045_01199 gene open 4421-4705 yhbY
2427 CAMIHS010000035.1 GCA946223045_01200 gene open 4714-5985 obgE
2428 CAMIHS010000035.1 GCA946223045_01201 gene open 6003-7142 ctpA
2429 CAMIHS010000035.1 GCA946223045_01202 gene open 7144-8325 envC
2430 CAMIHS010000035.1 GCA946223045_01203 gene open 8331-9218 ftsX
2431 CAMIHS010000035.1 GCA946223045_01204 gene open 9208-9894 ftsE
2432 CAMIHS010000035.1 GCA946223045_01205 gene open 9909-10841 tktA2
2433 CAMIHS010000035.1 GCA946223045_01206 gene open 10841-11677 tktA1
2434 CAMIHS010000035.1 GCA946223045_01207 gene open 11711-12811 csaB
2435 CAMIHS010000035.1 GCA946223045_01208 gene open 12804-14846
2436 CAMIHS010000035.1 GCA946223045_01209 gene open 14859-15554
2437 CAMIHS010000035.1 GCA946223045_01210 gene open 15563-16555 prfB
2438 CAMIHS010000035.1 GCA946223045_01211 gene open 16791-19250 secA
2439 CAMIHS010000035.1 GCA946223045_01212 gene open 19445-19972 hpf
2440 CAMIHS010000036.1 GCA946223045_01213 CDS open 951-2411 _na     486_aa tolC Outer membrane protein TolC
2441 CAMIHS010000036.1 GCA946223045_01214 CDS open 2454-3713 _na     419_aa mlaD Putative phospholipid ABC transporter-binding protein MlaD
2442 CAMIHS010000036.1 GCA946223045_01215 CDS open 3713-4471 _na     252_aa mlaF ABC transporter%2C ATP-binding protein
2443 CAMIHS010000036.1 GCA946223045_01216 CDS open 4493-5254 _na     253_aa mlaE ABC transporter permease
2444 CAMIHS010000036.1 GCA946223045_01217 CDS open 5285-7267 _na     660_aa spoIVB SpoIVB peptidase
2445 CAMIHS010000036.1 GCA946223045_01218 CDS open 7280-7564 _na     94_aa Lipoyl-binding domain-containing protein
2446 CAMIHS010000036.1 GCA946223045_01219 CDS open 7653-8993 _na     446_aa nAGPA Phosphodiester glycosidase domain-containing protein
2447 CAMIHS010000036.1 GCA946223045_01220 CDS open 9222-10616 _na     464_aa mreB Cell shape-determining protein MreB
2448 CAMIHS010000036.1 GCA946223045_01221 CDS open 10588-11853 _na     421_aa murA UDP-N-acetylglucosamine 1-carboxyvinyltransferase
2449 CAMIHS010000036.1 GCA946223045_01222 CDS open 12055-13017 _na     320_aa glpX class II fructose-bisphosphatase
2450 CAMIHS010000036.1 GCA946223045_01223 CDS open 13077-13721 _na     214_aa fsa fructose-6-phosphate aldolase
2451 CAMIHS010000036.1 GCA946223045_01224 CDS open 13735-15015 _na     426_aa serS serine--tRNA ligase
2452 CAMIHS010000036.1 GCA946223045_01225 CDS open 15141-16094 _na     317_aa Cation diffusion facilitator family transporter
2453 CAMIHS010000036.1 GCA946223045_01226 CDS open 16337-17617 _na     426_aa guaD guanine deaminase
2454 CAMIHS010000036.1 GCA946223045_01227 CDS open 17718-19061 _na     447_aa nCS2 NCS2 family permease
2455 CAMIHS010000036.1 GCA946223045_01213 gene open 951-2411 tolC
2456 CAMIHS010000036.1 GCA946223045_01214 gene open 2454-3713 mlaD
2457 CAMIHS010000036.1 GCA946223045_01215 gene open 3713-4471 mlaF
2458 CAMIHS010000036.1 GCA946223045_01216 gene open 4493-5254 mlaE
2459 CAMIHS010000036.1 GCA946223045_01217 gene open 5285-7267 spoIVB
2460 CAMIHS010000036.1 GCA946223045_01218 gene open 7280-7564
2461 CAMIHS010000036.1 GCA946223045_01219 gene open 7653-8993 nAGPA
2462 CAMIHS010000036.1 GCA946223045_01220 gene open 9222-10616 mreB
2463 CAMIHS010000036.1 GCA946223045_01221 gene open 10588-11853 murA
2464 CAMIHS010000036.1 GCA946223045_01222 gene open 12055-13017 glpX
2465 CAMIHS010000036.1 GCA946223045_01223 gene open 13077-13721 fsa
2466 CAMIHS010000036.1 GCA946223045_01224 gene open 13735-15015 serS
2467 CAMIHS010000036.1 GCA946223045_01225 gene open 15141-16094
2468 CAMIHS010000036.1 GCA946223045_01226 gene open 16337-17617 guaD
2469 CAMIHS010000036.1 GCA946223045_01227 gene open 17718-19061 nCS2
2470 CAMIHS010000037.1 GCA946223045_01228 CDS open 269-844 _na     191_aa hypothetical protein
2471 CAMIHS010000037.1 GCA946223045_01229 CDS open 1022-1876 _na     284_aa atpG ATP synthase F1 subunit gamma
2472 CAMIHS010000037.1 GCA946223045_01230 CDS open 1880-3418 _na     512_aa atpA F0F1 ATP synthase subunit alpha
2473 CAMIHS010000037.1 GCA946223045_01231 CDS open 3435-3986 _na     183_aa atpH ATP synthase F1 subunit delta
2474 CAMIHS010000037.1 GCA946223045_01232 CDS open 3991-4488 _na     165_aa atpF F0F1 ATP synthase subunit B
2475 CAMIHS010000037.1 GCA946223045_01233 CDS open 4507-4734 _na     75_aa atpE F0F1 ATP synthase subunit C
2476 CAMIHS010000037.1 GCA946223045_01234 CDS open 4758-5450 _na     230_aa atpB F0F1 ATP synthase subunit A
2477 CAMIHS010000037.1 GCA946223045_01235 CDS open 5633-6001 _na     122_aa Tat pathway signal protein
2478 CAMIHS010000037.1 GCA946223045_01236 CDS open 6012-6206 _na     64_aa AtpZ/AtpI family protein
2479 CAMIHS010000037.1 GCA946223045_01237 CDS open 6208-7350 _na     380_aa wecB non-hydrolyzing UDP-N-acetylglucosamine 2-epimerase
2480 CAMIHS010000037.1 GCA946223045_01238 CDS open 7408-8559 _na     383_aa rfe Phospho-N-acetylmuramoyl-pentapeptide-transferase
2481 CAMIHS010000037.1 GCA946223045_01239 CDS open 8594-9952 _na     452_aa UPF0210 protein HMPREF1477_01584
2482 CAMIHS010000037.1 GCA946223045_01240 CDS open 9961-10236 _na     91_aa aCT ACT domain-containing protein
2483 CAMIHS010000037.1 GCA946223045_01241 CDS open 10371-12008 _na     545_aa pgm Phosphoglucomutase
2484 CAMIHS010000037.1 GCA946223045_01242 CDS open 12180-13124 _na     314_aa yitT DUF2179 domain-containing protein
2485 CAMIHS010000037.1 GCA946223045_01243 CDS open 13330-14226 _na     298_aa ispE 4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase
2486 CAMIHS010000037.1 GCA946223045_01244 CDS open 14223-14915 _na     230_aa gntR HTH gntR-type domain-containing protein
2487 CAMIHS010000037.1 GCA946223045_01245 CDS open 15054-16514 _na     486_aa alsT Amino acid carrier protein
2488 CAMIHS010000037.1 GCA946223045_01246 CDS open 16874-18130 _na     418_aa gdhA Glutamate dehydrogenase
2489 CAMIHS010000037.1 GCA946223045_01247 CDS open 18272-18763 _na     163_aa queT QueT transporter
2490 CAMIHS010000037.1 GCA946223045_01228 gene open 269-844
2491 CAMIHS010000037.1 GCA946223045_01229 gene open 1022-1876 atpG
2492 CAMIHS010000037.1 GCA946223045_01230 gene open 1880-3418 atpA
2493 CAMIHS010000037.1 GCA946223045_01231 gene open 3435-3986 atpH
2494 CAMIHS010000037.1 GCA946223045_01232 gene open 3991-4488 atpF
2495 CAMIHS010000037.1 GCA946223045_01233 gene open 4507-4734 atpE
2496 CAMIHS010000037.1 GCA946223045_01234 gene open 4758-5450 atpB
2497 CAMIHS010000037.1 GCA946223045_01235 gene open 5633-6001
2498 CAMIHS010000037.1 GCA946223045_01236 gene open 6012-6206
2499 CAMIHS010000037.1 GCA946223045_01237 gene open 6208-7350 wecB
2500 CAMIHS010000037.1 GCA946223045_01238 gene open 7408-8559 rfe