HOMD Banner
Taxonomy: V4.3   |  16S rRNA RefSeq: V16.03   |  Genomic RefSeq: V11.03   |  Viruses: V1.2

BAKTAGenome Explorer: Veillonella parvula (GCA_946223045.1)

Select a Genome:
BAKTA Annotations for GCA_946223045.1
Genome Selected: Veillonella parvula
ContigsBases CDSrRNA tmRNAtRNA
108 1,961,210 1781 1 1 39
[Table]   [AA Fasta]      [Browser]   [Text]   [Excel]  
Search & Sort all 3675 Records
Search These Records: Clear
Sort Column:   Molecule   PID   NA   AA   Gene  Gene Product  Reverse
Annotation Table [page:6]    |    Number of Records Found: 3675 [8 Pages]    |    Previous Page <==> Next Page    |    Jump to Page: [ 1  2  3  4  5  6  7  8  ]
Notes:   1- Column headers only sort the current page. 2- Select [NA] or [AA] links to show sequences.
Region Protein-ID Type Genome
Viewer		 Range
(bp)		 Show Sequences
(length) NA / AA		 BAKTA
Gene		 BAKTA
GeneProduct
2501 CAMIHS010000037.1 GCA946223045_01239 gene open 8594-9952
2502 CAMIHS010000037.1 GCA946223045_01240 gene open 9961-10236 aCT
2503 CAMIHS010000037.1 GCA946223045_01241 gene open 10371-12008 pgm
2504 CAMIHS010000037.1 GCA946223045_01242 gene open 12180-13124 yitT
2505 CAMIHS010000037.1 GCA946223045_01243 gene open 13330-14226 ispE
2506 CAMIHS010000037.1 GCA946223045_01244 gene open 14223-14915 gntR
2507 CAMIHS010000037.1 GCA946223045_01245 gene open 15054-16514 alsT
2508 CAMIHS010000037.1 GCA946223045_01246 gene open 16874-18130 gdhA
2509 CAMIHS010000037.1 GCA946223045_01247 gene open 18272-18763 queT
2510 CAMIHS010000038.1 GCA946223045_01248 CDS open 105-458 _na     117_aa hypothetical protein
2511 CAMIHS010000038.1 GCA946223045_01249 CDS open 451-1488 _na     345_aa fepD Hemin transport system permease protein HmuU
2512 CAMIHS010000038.1 GCA946223045_01250 CDS open 1488-2333 _na     281_aa fepC ABC transporter ATP-binding protein
2513 CAMIHS010000038.1 GCA946223045_01251 CDS open 2418-3347 _na     309_aa Mg-protoporphyrin IX chelatase
2514 CAMIHS010000038.1 GCA946223045_01252 CDS open 3350-5365 _na     671_aa chlD VWA domain-containing protein
2515 CAMIHS010000038.1 GCA946223045_01253 CDS open 5369-8992 _na     1207_aa cobN cobaltochelatase subunit CobN
2516 CAMIHS010000038.1 GCA946223045_01254 CDS open 8994-9905 _na     303_aa fepB Fe/B12 periplasmic-binding domain-containing protein
2517 CAMIHS010000038.1 GCA946223045_01255 CDS open 9928-11796 _na     622_aa btuB TonB-dependent receptor
2518 CAMIHS010000038.1 GCA946223045_01256 CDS open 12237-13559 _na     440_aa aspB Aminotransferase class I/classII large domain-containing protein
2519 CAMIHS010000038.1 GCA946223045_01257 CDS open 13729-14190 _na     153_aa arsR Transcriptional regulator%2C ArsR family
2520 CAMIHS010000038.1 GCA946223045_01258 CDS open 14579-15886 _na     435_aa fixC Electron transfer flavoprotein-ubiquinone oxidoreductase
2521 CAMIHS010000038.1 GCA946223045_01259 CDS open 15883-16161 _na     92_aa fixX Ferredoxin family protein
2522 CAMIHS010000038.1 GCA946223045_01260 CDS open 16166-17155 _na     329_aa fixA Electron transfer flavoprotein small subunit
2523 CAMIHS010000038.1 GCA946223045_01261 CDS open 17155-18156 _na     333_aa fixB Electron transfer flavoprotein alpha/beta-subunit N-terminal domain-containing protein
2524 CAMIHS010000038.1 GCA946223045_01248 gene open 105-458
2525 CAMIHS010000038.1 GCA946223045_01249 gene open 451-1488 fepD
2526 CAMIHS010000038.1 GCA946223045_01250 gene open 1488-2333 fepC
2527 CAMIHS010000038.1 GCA946223045_01251 gene open 2418-3347
2528 CAMIHS010000038.1 GCA946223045_01252 gene open 3350-5365 chlD
2529 CAMIHS010000038.1 GCA946223045_01253 gene open 5369-8992 cobN
2530 CAMIHS010000038.1 GCA946223045_01254 gene open 8994-9905 fepB
2531 CAMIHS010000038.1 GCA946223045_01255 gene open 9928-11796 btuB
2532 CAMIHS010000038.1 GCA946223045_01256 gene open 12237-13559 aspB
2533 CAMIHS010000038.1 GCA946223045_01257 gene open 13729-14190 arsR
2534 CAMIHS010000038.1 GCA946223045_01258 gene open 14579-15886 fixC
2535 CAMIHS010000038.1 GCA946223045_01259 gene open 15883-16161 fixX
2536 CAMIHS010000038.1 GCA946223045_01260 gene open 16166-17155 fixA
2537 CAMIHS010000038.1 GCA946223045_01261 gene open 17155-18156 fixB
2538 CAMIHS010000039.1 GCA946223045_01262 CDS open 989-1408 _na     139_aa Cysteine metabolism repressor
2539 CAMIHS010000039.1 GCA946223045_01263 CDS open 1554-2921 _na     455_aa nCS2 MFS transporter%2C AGZA family%2C xanthine/uracil permease
2540 CAMIHS010000039.1 GCA946223045_01264 CDS open 3170-4534 _na     454_aa DUF4367 domain-containing protein
2541 CAMIHS010000039.1 GCA946223045_01265 CDS open 4608-5378 _na     256_aa Secreted protein
2542 CAMIHS010000039.1 GCA946223045_01266 CDS open 5617-6129 _na     170_aa 5-nitroimidazole antibiotic resistance protein
2543 CAMIHS010000039.1 GCA946223045_01267 CDS open 6165-6554 _na     129_aa marR Transcriptional regulator HosA
2544 CAMIHS010000039.1 GCA946223045_01268 CDS open 6621-7028 _na     135_aa Polyketide cyclase
2545 CAMIHS010000039.1 GCA946223045_01269 CDS open 7322-8764 _na     480_aa ansP Amino acid permease/ SLC12A domain-containing protein
2546 CAMIHS010000039.1 GCA946223045_01270 CDS open 8799-9371 _na     190_aa DUF600 domain-containing protein
2547 CAMIHS010000039.1 GCA946223045_01271 CDS open 9420-10544 _na     374_aa fieF Ferrous-iron efflux pump FieF
2548 CAMIHS010000039.1 GCA946223045_01272 CDS open 10805-11923 _na     372_aa Pseudouridine synthase
2549 CAMIHS010000039.1 GCA946223045_01273 CDS open 11923-14511 _na     862_aa polC DNA 3'-5' helicase
2550 CAMIHS010000039.1 GCA946223045_01274 CDS open 14524-14775 _na     83_aa bofA SigmaK-factor processing regulatory BofA
2551 CAMIHS010000039.1 GCA946223045_01275 CDS open 14780-15376 _na     198_aa recR recombination mediator RecR
2552 CAMIHS010000039.1 GCA946223045_01276 CDS open 15377-15706 _na     109_aa ybaB YbaB/EbfC family nucleoid-associated protein
2553 CAMIHS010000039.1 GCA946223045_01277 CDS open 15848-18265 _na     805_aa dnaX DNA polymerase III subunit gamma/tau
2554 CAMIHS010000039.1 GCA946223045_01262 gene open 989-1408
2555 CAMIHS010000039.1 GCA946223045_01263 gene open 1554-2921 nCS2
2556 CAMIHS010000039.1 GCA946223045_01264 gene open 3170-4534
2557 CAMIHS010000039.1 GCA946223045_01265 gene open 4608-5378
2558 CAMIHS010000039.1 GCA946223045_01266 gene open 5617-6129
2559 CAMIHS010000039.1 GCA946223045_01267 gene open 6165-6554 marR
2560 CAMIHS010000039.1 GCA946223045_01268 gene open 6621-7028
2561 CAMIHS010000039.1 GCA946223045_01269 gene open 7322-8764 ansP
2562 CAMIHS010000039.1 GCA946223045_01270 gene open 8799-9371
2563 CAMIHS010000039.1 GCA946223045_01271 gene open 9420-10544 fieF
2564 CAMIHS010000039.1 GCA946223045_01272 gene open 10805-11923
2565 CAMIHS010000039.1 GCA946223045_01273 gene open 11923-14511 polC
2566 CAMIHS010000039.1 GCA946223045_01274 gene open 14524-14775 bofA
2567 CAMIHS010000039.1 GCA946223045_01275 gene open 14780-15376 recR
2568 CAMIHS010000039.1 GCA946223045_01276 gene open 15377-15706 ybaB
2569 CAMIHS010000039.1 GCA946223045_01277 gene open 15848-18265 dnaX
2570 CAMIHS010000040.1 GCA946223045_01278 CDS open 39-473 _na     144_aa vanZ VanZ family protein
2571 CAMIHS010000040.1 GCA946223045_01279 CDS open 510-1676 _na     388_aa ugd UDP-glucose 6-dehydrogenase
2572 CAMIHS010000040.1 GCA946223045_01280 CDS open 1677-2774 _na     365_aa wcaG dTDP-glucose 4%2C6-dehydratase
2573 CAMIHS010000040.1 GCA946223045_01281 CDS open 2797-4251 _na     484_aa rfbX Polysaccharide biosynthesis protein
2574 CAMIHS010000040.1 GCA946223045_01282 CDS open 4251-5384 _na     377_aa capA Bacterial capsule synthesis protein
2575 CAMIHS010000040.1 GCA946223045_01283 CDS open 5368-6300 _na     310_aa Glycosyltransferase
2576 CAMIHS010000040.1 GCA946223045_01284 CDS open 6278-7519 _na     413_aa O-antigen ligase family protein
2577 CAMIHS010000040.1 GCA946223045_01285 CDS open 7539-8606 _na     355_aa rfaB putative poly(Glycerol-phosphate) alpha-glucosyltransferase
2578 CAMIHS010000040.1 GCA946223045_01286 CDS open 8603-9652 _na     349_aa wcaG NAD-dependent epimerase/dehydratase
2579 CAMIHS010000040.1 GCA946223045_01287 CDS open 9645-10367 _na     240_aa ispD 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase
2580 CAMIHS010000040.1 GCA946223045_01288 CDS open 10377-11243 _na     288_aa licD 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase
2581 CAMIHS010000040.1 GCA946223045_01289 CDS open 11255-11941 _na     228_aa wcaJ Bacterial sugar transferase
2582 CAMIHS010000040.1 GCA946223045_01290 CDS open 11935-13185 _na     416_aa wecE UDP-4-amino-4-deoxy-L-arabinose--oxoglutarate aminotransferase
2583 CAMIHS010000040.1 GCA946223045_01291 CDS open 13212-13823 _na     203_aa mrp non-specific protein-tyrosine kinase
2584 CAMIHS010000040.1 GCA946223045_01292 CDS open 13825-15300 _na     491_aa gumC Chain length determinant protein
2585 CAMIHS010000040.1 GCA946223045_01293 CDS open 15421-17247 _na     608_aa flaA1 UDP-N-acetyl-alpha-D-glucosamine C6 dehydratase
2586 CAMIHS010000040.1 GCA946223045_01294 CDS open 17285-17671 _na     128_aa polysaccharide biosynthesis/export family protein
2587 CAMIHS010000040.1 GCA946223045_01278 gene open 39-473 vanZ
2588 CAMIHS010000040.1 GCA946223045_01279 gene open 510-1676 ugd
2589 CAMIHS010000040.1 GCA946223045_01280 gene open 1677-2774 wcaG
2590 CAMIHS010000040.1 GCA946223045_01281 gene open 2797-4251 rfbX
2591 CAMIHS010000040.1 GCA946223045_01282 gene open 4251-5384 capA
2592 CAMIHS010000040.1 GCA946223045_01283 gene open 5368-6300
2593 CAMIHS010000040.1 GCA946223045_01284 gene open 6278-7519
2594 CAMIHS010000040.1 GCA946223045_01285 gene open 7539-8606 rfaB
2595 CAMIHS010000040.1 GCA946223045_01286 gene open 8603-9652 wcaG
2596 CAMIHS010000040.1 GCA946223045_01287 gene open 9645-10367 ispD
2597 CAMIHS010000040.1 GCA946223045_01288 gene open 10377-11243 licD
2598 CAMIHS010000040.1 GCA946223045_01289 gene open 11255-11941 wcaJ
2599 CAMIHS010000040.1 GCA946223045_01290 gene open 11935-13185 wecE
2600 CAMIHS010000040.1 GCA946223045_01291 gene open 13212-13823 mrp
2601 CAMIHS010000040.1 GCA946223045_01292 gene open 13825-15300 gumC
2602 CAMIHS010000040.1 GCA946223045_01293 gene open 15421-17247 flaA1
2603 CAMIHS010000040.1 GCA946223045_01294 gene open 17285-17671
2604 CAMIHS010000041.1 GCA946223045_01295 CDS open 4-453 _na     149_aa glycosyltransferase family 9 protein
2605 CAMIHS010000041.1 GCA946223045_01296 CDS open 509-1573 _na     354_aa Acyltransferase 3 domain-containing protein
2606 CAMIHS010000041.1 GCA946223045_01297 CDS open 1648-2208 _na     186_aa gmhA D-sedoheptulose 7-phosphate isomerase
2607 CAMIHS010000041.1 GCA946223045_01298 CDS open 2201-3682 _na     493_aa hldE Bifunctional protein HldE
2608 CAMIHS010000041.1 GCA946223045_01299 CDS open 3708-3845 _na     45_aa hypothetical protein
2609 CAMIHS010000041.1 GCA946223045_01300 CDS open 3863-4210 _na     115_aa IS30 family transposase
2610 CAMIHS010000041.1 GCA946223045_01301 CDS open 4658-5998 _na     446_aa ATP/GTP-binding protein
2611 CAMIHS010000041.1 GCA946223045_01302 CDS open 6010-6696 _na     228_aa rloB RloB family protein
2612 CAMIHS010000041.1 GCA946223045_01303 CDS open 6985-8061 _na     358_aa wecH Acyltransferase 3 domain-containing protein
2613 CAMIHS010000041.1 GCA946223045_01304 CDS open 8128-8454 _na     108_aa Tat pathway signal protein
2614 CAMIHS010000041.1 GCA946223045_01305 CDS open 9111-10520 _na     469_aa YadA-like family protein
2615 CAMIHS010000041.1 GCA946223045_01306 CDS open 10940-11983 _na     347_aa Inverse autotransporter beta-domain domain-containing protein
2616 CAMIHS010000041.1 GCA946223045_01307 CDS open 12245-14653 _na     802_aa S-layer domain protein
2617 CAMIHS010000041.1 GCA946223045_01308 CDS open 14667-14777 _na     36_aa hypothetical protein
2618 CAMIHS010000041.1 GCA946223045_01309 CDS open 16062-16463 _na     133_aa hypothetical protein
2619 CAMIHS010000041.1 GCA946223045_01295 gene open 4-453
2620 CAMIHS010000041.1 GCA946223045_01296 gene open 509-1573
2621 CAMIHS010000041.1 GCA946223045_01297 gene open 1648-2208 gmhA
2622 CAMIHS010000041.1 GCA946223045_01298 gene open 2201-3682 hldE
2623 CAMIHS010000041.1 GCA946223045_01299 gene open 3708-3845
2624 CAMIHS010000041.1 GCA946223045_01300 gene open 3863-4210
2625 CAMIHS010000041.1 GCA946223045_01301 gene open 4658-5998
2626 CAMIHS010000041.1 GCA946223045_01302 gene open 6010-6696 rloB
2627 CAMIHS010000041.1 GCA946223045_01303 gene open 6985-8061 wecH
2628 CAMIHS010000041.1 GCA946223045_01304 gene open 8128-8454
2629 CAMIHS010000041.1 GCA946223045_01305 gene open 9111-10520
2630 CAMIHS010000041.1 GCA946223045_01306 gene open 10940-11983
2631 CAMIHS010000041.1 GCA946223045_01307 gene open 12245-14653
2632 CAMIHS010000041.1 GCA946223045_01308 gene open 14667-14777
2633 CAMIHS010000041.1 GCA946223045_01309 gene open 16062-16463
2634 CAMIHS010000042.1 regulatory_region open 8226-8341 PyrR binding site
2635 CAMIHS010000042.1 GCA946223045_01310 CDS open 319-750 _na     143_aa hypothetical protein
2636 CAMIHS010000042.1 GCA946223045_01311 CDS open 944-1711 _na     255_aa mcr1 Dihydroorotate dehydrogenase B (NAD(+))%2C electron transfer subunit
2637 CAMIHS010000042.1 GCA946223045_01312 CDS open 1716-4916 _na     1066_aa carB carbamoyl-phosphate synthase large subunit
2638 CAMIHS010000042.1 GCA946223045_01313 CDS open 4918-5985 _na     355_aa carA carbamoyl phosphate synthase small subunit
2639 CAMIHS010000042.1 GCA946223045_01314 CDS open 5985-7271 _na     428_aa allB Dihydroorotase
2640 CAMIHS010000042.1 GCA946223045_01315 CDS open 7255-8205 _na     316_aa pyrB aspartate carbamoyltransferase catalytic subunit
2641 CAMIHS010000042.1 GCA946223045_01316 CDS open 8557-11604 _na     1015_aa tolA ATPase
2642 CAMIHS010000042.1 GCA946223045_01317 CDS open 11617-12564 _na     315_aa whiA DNA-binding protein WhiA
2643 CAMIHS010000042.1 GCA946223045_01318 CDS open 12580-13929 _na     449_aa cofD Putative gluconeogenesis factor
2644 CAMIHS010000042.1 GCA946223045_01319 CDS open 13942-14856 _na     304_aa rapZ RNase adapter RapZ
2645 CAMIHS010000042.1 GCA946223045_01320 CDS open 14869-15681 _na     270_aa Phosphatase
2646 CAMIHS010000042.1 GCA946223045_01321 CDS open 15968-17209 _na     413_aa Porin
2647 CAMIHS010000042.1 GCA946223045_01310 gene open 319-750
2648 CAMIHS010000042.1 GCA946223045_01311 gene open 944-1711 mcr1
2649 CAMIHS010000042.1 GCA946223045_01312 gene open 1716-4916 carB
2650 CAMIHS010000042.1 GCA946223045_01313 gene open 4918-5985 carA
2651 CAMIHS010000042.1 GCA946223045_01314 gene open 5985-7271 allB
2652 CAMIHS010000042.1 GCA946223045_01315 gene open 7255-8205 pyrB
2653 CAMIHS010000042.1 GCA946223045_01316 gene open 8557-11604 tolA
2654 CAMIHS010000042.1 GCA946223045_01317 gene open 11617-12564 whiA
2655 CAMIHS010000042.1 GCA946223045_01318 gene open 12580-13929 cofD
2656 CAMIHS010000042.1 GCA946223045_01319 gene open 13942-14856 rapZ
2657 CAMIHS010000042.1 GCA946223045_01320 gene open 14869-15681
2658 CAMIHS010000042.1 GCA946223045_01321 gene open 15968-17209
2659 CAMIHS010000043.1 GCA946223045_01322 CDS open 805-2934 _na     709_aa Cd(2+)-exporting ATPase
2660 CAMIHS010000043.1 GCA946223045_01323 CDS open 3190-4722 _na     510_aa osmF Carnitine transport binding protein OpuCC
2661 CAMIHS010000043.1 GCA946223045_01324 CDS open 4900-5226 _na     108_aa YolD-like protein
2662 CAMIHS010000043.1 GCA946223045_01325 CDS open 5283-6566 _na     427_aa dinP DNA polymerase IV
2663 CAMIHS010000043.1 GCA946223045_01326 CDS open 6788-7204 _na     138_aa DUF3592 domain-containing protein
2664 CAMIHS010000043.1 GCA946223045_01327 CDS open 7418-8821 _na     467_aa dnaB replicative DNA helicase
2665 CAMIHS010000043.1 GCA946223045_01328 CDS open 8846-9292 _na     148_aa rplI 50S ribosomal protein L9
2666 CAMIHS010000043.1 GCA946223045_01329 CDS open 9289-11316 _na     675_aa gdpP Cyclic-di-AMP phosphodiesterase
2667 CAMIHS010000043.1 GCA946223045_01330 CDS open 11333-12292 _na     319_aa DUF2232 domain-containing protein
2668 CAMIHS010000043.1 GCA946223045_01331 CDS open 12486-14654 _na     722_aa rnjA Ribonuclease J
2669 CAMIHS010000043.1 GCA946223045_01332 CDS open 14699-14887 _na     62_aa hypothetical protein
2670 CAMIHS010000043.1 GCA946223045_01333 CDS open 15050-16126 _na     358_aa yhaH Inner membrane protein yhaH
2671 CAMIHS010000043.1 GCA946223045_01334 CDS open 16139-16936 _na     265_aa Uracil-DNA glycosylase
2672 CAMIHS010000043.1 GCA946223045_01322 gene open 805-2934
2673 CAMIHS010000043.1 GCA946223045_01323 gene open 3190-4722 osmF
2674 CAMIHS010000043.1 GCA946223045_01324 gene open 4900-5226
2675 CAMIHS010000043.1 GCA946223045_01325 gene open 5283-6566 dinP
2676 CAMIHS010000043.1 GCA946223045_01326 gene open 6788-7204
2677 CAMIHS010000043.1 GCA946223045_01327 gene open 7418-8821 dnaB
2678 CAMIHS010000043.1 GCA946223045_01328 gene open 8846-9292 rplI
2679 CAMIHS010000043.1 GCA946223045_01329 gene open 9289-11316 gdpP
2680 CAMIHS010000043.1 GCA946223045_01330 gene open 11333-12292
2681 CAMIHS010000043.1 GCA946223045_01331 gene open 12486-14654 rnjA
2682 CAMIHS010000043.1 GCA946223045_01332 gene open 14699-14887
2683 CAMIHS010000043.1 GCA946223045_01333 gene open 15050-16126 yhaH
2684 CAMIHS010000043.1 GCA946223045_01334 gene open 16139-16936
2685 CAMIHS010000044.1 GCA946223045_01335 CDS open 91-657 _na     188_aa dTTP/UTP pyrophosphatase
2686 CAMIHS010000044.1 GCA946223045_01336 CDS open 744-1364 _na     206_aa DUF3137 domain-containing protein
2687 CAMIHS010000044.1 GCA946223045_01337 CDS open 1517-2722 _na     401_aa ackA Acetate kinase
2688 CAMIHS010000044.1 GCA946223045_01338 CDS open 2726-3289 _na     187_aa Lipoprotein
2689 CAMIHS010000044.1 GCA946223045_01339 CDS open 3476-4795 _na     439_aa tmcAL tRNA(Met) cytidine acetate ligase
2690 CAMIHS010000044.1 GCA946223045_01340 CDS open 4919-5440 _na     173_aa pyrR bifunctional pyr operon transcriptional regulator/uracil phosphoribosyltransferase PyrR
2691 CAMIHS010000044.1 GCA946223045_01341 CDS open 5534-6457 _na     307_aa rluA Pseudouridine synthase
2692 CAMIHS010000044.1 GCA946223045_01342 CDS open 6544-6984 _na     146_aa lspA signal peptidase II
2693 CAMIHS010000044.1 GCA946223045_01343 CDS open 7093-7257 _na     54_aa rnfC Ferredoxin
2694 CAMIHS010000044.1 GCA946223045_01344 CDS open 7749-8012 _na     87_aa Integral membrane protein
2695 CAMIHS010000044.1 GCA946223045_01345 CDS open 8253-9554 _na     433_aa citT Sodium-dependent dicarboxylate transporter SdcS
2696 CAMIHS010000044.1 GCA946223045_01346 CDS open 9593-9850 _na     85_aa DUF3899 domain-containing protein
2697 CAMIHS010000044.1 GCA946223045_01347 CDS open 10044-11165 _na     373_aa mmdB Methylmalonyl-CoA decarboxylase subunit beta
2698 CAMIHS010000044.1 GCA946223045_01348 CDS open 11236-11625 _na     129_aa mmdC Methylmalonyl-CoA decarboxylase subunit gamma
2699 CAMIHS010000044.1 GCA946223045_01349 CDS open 11727-11894 _na     55_aa mmdE Methylmalonyl-CoA decarboxylase subunit epsilon
2700 CAMIHS010000044.1 GCA946223045_01350 CDS open 11918-12265 _na     115_aa mmdD Methylmalonyl-CoA decarboxylase subunit delta
2701 CAMIHS010000044.1 GCA946223045_01351 CDS open 12339-13868 _na     509_aa mmdA Methylmalonyl-CoA decarboxylase subunit alpha
2702 CAMIHS010000044.1 GCA946223045_01352 CDS open 14019-14441 _na     140_aa mce methylmalonyl-CoA epimerase
2703 CAMIHS010000044.1 GCA946223045_01353 CDS open 14493-15431 _na     312_aa meaB methylmalonyl Co-A mutase-associated GTPase MeaB
2704 CAMIHS010000044.1 GCA946223045_01354 CDS open 15510-15692 _na     60_aa hypothetical protein
2705 CAMIHS010000044.1 GCA946223045_01335 gene open 91-657
2706 CAMIHS010000044.1 GCA946223045_01336 gene open 744-1364
2707 CAMIHS010000044.1 GCA946223045_01337 gene open 1517-2722 ackA
2708 CAMIHS010000044.1 GCA946223045_01338 gene open 2726-3289
2709 CAMIHS010000044.1 GCA946223045_01339 gene open 3476-4795 tmcAL
2710 CAMIHS010000044.1 GCA946223045_01340 gene open 4919-5440 pyrR
2711 CAMIHS010000044.1 GCA946223045_01341 gene open 5534-6457 rluA
2712 CAMIHS010000044.1 GCA946223045_01342 gene open 6544-6984 lspA
2713 CAMIHS010000044.1 GCA946223045_01343 gene open 7093-7257 rnfC
2714 CAMIHS010000044.1 GCA946223045_01344 gene open 7749-8012
2715 CAMIHS010000044.1 GCA946223045_01345 gene open 8253-9554 citT
2716 CAMIHS010000044.1 GCA946223045_01346 gene open 9593-9850
2717 CAMIHS010000044.1 GCA946223045_01347 gene open 10044-11165 mmdB
2718 CAMIHS010000044.1 GCA946223045_01348 gene open 11236-11625 mmdC
2719 CAMIHS010000044.1 GCA946223045_01349 gene open 11727-11894 mmdE
2720 CAMIHS010000044.1 GCA946223045_01350 gene open 11918-12265 mmdD
2721 CAMIHS010000044.1 GCA946223045_01351 gene open 12339-13868 mmdA
2722 CAMIHS010000044.1 GCA946223045_01352 gene open 14019-14441 mce
2723 CAMIHS010000044.1 GCA946223045_01353 gene open 14493-15431 meaB
2724 CAMIHS010000044.1 GCA946223045_01354 gene open 15510-15692
2725 CAMIHS010000045.1 regulatory_region open 13109-13312 T-box leader
2726 CAMIHS010000045.1 GCA946223045_01355 CDS open 3-761 _na     252_aa ydfG NADP-dependent 3-hydroxy acid dehydrogenase YdfG
2727 CAMIHS010000045.1 GCA946223045_01356 CDS open 874-1635 _na     253_aa Serine 3-dehydrogenase
2728 CAMIHS010000045.1 GCA946223045_01357 CDS open 1903-2490 _na     195_aa DUF4367 domain-containing protein
2729 CAMIHS010000045.1 GCA946223045_01358 CDS open 2737-3687 _na     316_aa dppB Nickel transport system permease protein NikB
2730 CAMIHS010000045.1 GCA946223045_01359 CDS open 3680-4489 _na     269_aa dppC ABC transmembrane type-1 domain-containing protein
2731 CAMIHS010000045.1 GCA946223045_01360 CDS open 4554-6068 _na     504_aa gsiB Glutathione-binding protein gsiB
2732 CAMIHS010000045.1 GCA946223045_01361 CDS open 6061-6828 _na     255_aa gsiA Glutathione import ATP-binding protein GsiA
2733 CAMIHS010000045.1 GCA946223045_01362 CDS open 6830-7570 _na     246_aa gsiA Glutathione import ATP-binding protein GsiA
2734 CAMIHS010000045.1 GCA946223045_01363 CDS open 7677-8303 _na     208_aa GyrI-like domain-containing protein
2735 CAMIHS010000045.1 GCA946223045_01364 CDS open 8353-8829 _na     158_aa HXXEE domain-containing protein
2736 CAMIHS010000045.1 GCA946223045_01365 CDS open 8964-9311 _na     115_aa Molecular chaperone Hsp90
2737 CAMIHS010000045.1 GCA946223045_01366 CDS open 9630-10247 _na     205_aa Phosphomethylpyrimidine kinase
2738 CAMIHS010000045.1 GCA946223045_01367 CDS open 10297-10725 _na     142_aa Glyoxalase-like domain protein
2739 CAMIHS010000045.1 GCA946223045_01368 CDS open 10868-11500 _na     210_aa DUF4367 domain-containing protein
2740 CAMIHS010000045.1 GCA946223045_01369 CDS open 11888-12301 _na     137_aa DUF4825 domain-containing protein
2741 CAMIHS010000045.1 GCA946223045_01370 CDS open 12437-12952 _na     171_aa DUF308 domain-containing protein
2742 CAMIHS010000045.1 GCA946223045_01355 gene open 3-761 ydfG
2743 CAMIHS010000045.1 GCA946223045_01356 gene open 874-1635
2744 CAMIHS010000045.1 GCA946223045_01357 gene open 1903-2490
2745 CAMIHS010000045.1 GCA946223045_01358 gene open 2737-3687 dppB
2746 CAMIHS010000045.1 GCA946223045_01359 gene open 3680-4489 dppC
2747 CAMIHS010000045.1 GCA946223045_01360 gene open 4554-6068 gsiB
2748 CAMIHS010000045.1 GCA946223045_01361 gene open 6061-6828 gsiA
2749 CAMIHS010000045.1 GCA946223045_01362 gene open 6830-7570 gsiA
2750 CAMIHS010000045.1 GCA946223045_01363 gene open 7677-8303
2751 CAMIHS010000045.1 GCA946223045_01364 gene open 8353-8829
2752 CAMIHS010000045.1 GCA946223045_01365 gene open 8964-9311
2753 CAMIHS010000045.1 GCA946223045_01366 gene open 9630-10247
2754 CAMIHS010000045.1 GCA946223045_01367 gene open 10297-10725
2755 CAMIHS010000045.1 GCA946223045_01368 gene open 10868-11500
2756 CAMIHS010000045.1 GCA946223045_01369 gene open 11888-12301
2757 CAMIHS010000045.1 GCA946223045_01370 gene open 12437-12952
2758 CAMIHS010000046.1 GCA946223045_01371 CDS open 35-373 _na     112_aa Dyp family peroxidase family protein
2759 CAMIHS010000046.1 GCA946223045_01372 CDS open 556-2055 _na     499_aa thrC threonine synthase
2760 CAMIHS010000046.1 GCA946223045_01373 CDS open 2266-3153 _na     295_aa rhaT DMT family transporter
2761 CAMIHS010000046.1 GCA946223045_01374 CDS open 3326-4993 _na     555_aa ybjD ATP-dependent endonuclease of the OLD family-like protein
2762 CAMIHS010000046.1 GCA946223045_01375 CDS open 5278-5745 _na     155_aa mscL large conductance mechanosensitive channel protein MscL
2763 CAMIHS010000046.1 GCA946223045_01376 CDS open 5869-6918 _na     349_aa ldhA 4-phosphoerythronate dehydrogenase
2764 CAMIHS010000046.1 GCA946223045_01377 CDS open 6986-8689 _na     567_aa glnS glutamine--tRNA ligase/YqeY domain fusion protein
2765 CAMIHS010000046.1 GCA946223045_01378 CDS open 8880-9512 _na     210_aa Peptidase
2766 CAMIHS010000046.1 GCA946223045_01379 CDS open 9617-10204 _na     195_aa DUF3793 domain-containing protein
2767 CAMIHS010000046.1 GCA946223045_01380 CDS open 10215-10634 _na     139_aa norV flavodoxin
2768 CAMIHS010000046.1 GCA946223045_01381 CDS open 10726-10887 _na     53_aa hypothetical protein
2769 CAMIHS010000046.1 GCA946223045_01382 CDS open 11033-11665 _na     210_aa yheO PAC domain-containing protein
2770 CAMIHS010000046.1 GCA946223045_01383 CDS open 11675-12886 _na     403_aa dpaL diaminopropionate ammonia-lyase
2771 CAMIHS010000046.1 GCA946223045_01384 CDS open 12899-14209 _na     436_aa argE YgeY family selenium metabolism-linked hydrolase
2772 CAMIHS010000046.1 GCA946223045_01371 gene open 35-373
2773 CAMIHS010000046.1 GCA946223045_01372 gene open 556-2055 thrC
2774 CAMIHS010000046.1 GCA946223045_01373 gene open 2266-3153 rhaT
2775 CAMIHS010000046.1 GCA946223045_01374 gene open 3326-4993 ybjD
2776 CAMIHS010000046.1 GCA946223045_01375 gene open 5278-5745 mscL
2777 CAMIHS010000046.1 GCA946223045_01376 gene open 5869-6918 ldhA
2778 CAMIHS010000046.1 GCA946223045_01377 gene open 6986-8689 glnS
2779 CAMIHS010000046.1 GCA946223045_01378 gene open 8880-9512
2780 CAMIHS010000046.1 GCA946223045_01379 gene open 9617-10204
2781 CAMIHS010000046.1 GCA946223045_01380 gene open 10215-10634 norV
2782 CAMIHS010000046.1 GCA946223045_01381 gene open 10726-10887
2783 CAMIHS010000046.1 GCA946223045_01382 gene open 11033-11665 yheO
2784 CAMIHS010000046.1 GCA946223045_01383 gene open 11675-12886 dpaL
2785 CAMIHS010000046.1 GCA946223045_01384 gene open 12899-14209 argE
2786 CAMIHS010000047.1 GCA946223045_01385 CDS open 127-3534 _na     1135_aa dnaE DNA polymerase III subunit alpha
2787 CAMIHS010000047.1 GCA946223045_01386 CDS open 3628-5376 _na     582_aa pyk pyruvate kinase
2788 CAMIHS010000047.1 GCA946223045_01387 CDS open 5412-6155 _na     247_aa ybhL BAX inhibitor (BI)-1/YccA family protein
2789 CAMIHS010000047.1 GCA946223045_01388 CDS open 6169-7080 _na     303_aa lysR HTH-type transcriptional activator CmpR
2790 CAMIHS010000047.1 GCA946223045_01389 CDS open 7466-8869 _na     467_aa citT Anion permease
2791 CAMIHS010000047.1 GCA946223045_01390 CDS open 8992-9261 _na     89_aa Citrate lyase acyl carrier protein
2792 CAMIHS010000047.1 GCA946223045_01391 CDS open 9261-10226 _na     321_aa citE Citrate (Pro-3S)-lyase%2C beta subunit
2793 CAMIHS010000047.1 GCA946223045_01392 CDS open 10216-11763 _na     515_aa citF citrate lyase subunit alpha
2794 CAMIHS010000047.1 GCA946223045_01393 CDS open 11989-12489 _na     166_aa hypothetical protein
2795 CAMIHS010000047.1 GCA946223045_01394 CDS open 12522-13520 _na     332_aa hypothetical protein
2796 CAMIHS010000047.1 GCA946223045_01385 gene open 127-3534 dnaE
2797 CAMIHS010000047.1 GCA946223045_01386 gene open 3628-5376 pyk
2798 CAMIHS010000047.1 GCA946223045_01387 gene open 5412-6155 ybhL
2799 CAMIHS010000047.1 GCA946223045_01388 gene open 6169-7080 lysR
2800 CAMIHS010000047.1 GCA946223045_01389 gene open 7466-8869 citT
2801 CAMIHS010000047.1 GCA946223045_01390 gene open 8992-9261
2802 CAMIHS010000047.1 GCA946223045_01391 gene open 9261-10226 citE
2803 CAMIHS010000047.1 GCA946223045_01392 gene open 10216-11763 citF
2804 CAMIHS010000047.1 GCA946223045_01393 gene open 11989-12489
2805 CAMIHS010000047.1 GCA946223045_01394 gene open 12522-13520
2806 CAMIHS010000048.1 GCA946223045_01395 CDS open 253-1392 _na     379_aa pheA Bifunctional chorismate mutase/prephenate dehydratase
2807 CAMIHS010000048.1 GCA946223045_01396 CDS open 1379-2473 _na     364_aa aroC chorismate synthase
2808 CAMIHS010000048.1 GCA946223045_01397 CDS open 2463-3731 _na     422_aa aroA 3-phosphoshikimate 1-carboxyvinyltransferase
2809 CAMIHS010000048.1 GCA946223045_01398 CDS open 3750-4802 _na     350_aa aroB 3-dehydroquinate synthase
2810 CAMIHS010000048.1 GCA946223045_01399 CDS open 4877-5890 _na     337_aa aroGA bifunctional 3-deoxy-7-phosphoheptulonate synthase/chorismate mutase
2811 CAMIHS010000048.1 GCA946223045_01400 CDS open 6364-6780 _na     138_aa GNAT family N-acetyltransferase
2812 CAMIHS010000048.1 GCA946223045_01401 CDS open 6882-7340 _na     152_aa Septicolysin
2813 CAMIHS010000048.1 GCA946223045_01402 CDS open 7719-8747 _na     342_aa nrdB ribonucleotide-diphosphate reductase subunit beta
2814 CAMIHS010000048.1 GCA946223045_01403 CDS open 8896-11178 _na     760_aa nrdA ribonucleoside-diphosphate reductase subunit alpha
2815 CAMIHS010000048.1 GCA946223045_01404 CDS open 11461-13020 _na     519_aa Lipoprotein
2816 CAMIHS010000048.1 GCA946223045_01395 gene open 253-1392 pheA
2817 CAMIHS010000048.1 GCA946223045_01396 gene open 1379-2473 aroC
2818 CAMIHS010000048.1 GCA946223045_01397 gene open 2463-3731 aroA
2819 CAMIHS010000048.1 GCA946223045_01398 gene open 3750-4802 aroB
2820 CAMIHS010000048.1 GCA946223045_01399 gene open 4877-5890 aroGA
2821 CAMIHS010000048.1 GCA946223045_01400 gene open 6364-6780
2822 CAMIHS010000048.1 GCA946223045_01401 gene open 6882-7340
2823 CAMIHS010000048.1 GCA946223045_01402 gene open 7719-8747 nrdB
2824 CAMIHS010000048.1 GCA946223045_01403 gene open 8896-11178 nrdA
2825 CAMIHS010000048.1 GCA946223045_01404 gene open 11461-13020
2826 CAMIHS010000049.1 GCA946223045_01405 CDS open 697-1449 _na     250_aa tauC ABC transmembrane type-1 domain-containing protein
2827 CAMIHS010000049.1 GCA946223045_01406 CDS open 1460-2413 _na     317_aa tauA SsuA/THI5-like domain-containing protein
2828 CAMIHS010000049.1 GCA946223045_01407 CDS open 2736-4367 _na     543_aa arnT Undecaprenyl phosphate-alpha-4-amino-4-deoxy-L-arabinose arabinosyl transferase
2829 CAMIHS010000049.1 GCA946223045_01408 CDS open 4379-4966 _na     195_aa dedA SNARE associated Golgi protein
2830 CAMIHS010000049.1 GCA946223045_01409 CDS open 5219-6007 _na     262_aa fepC Putative siderophore transport system ATP-binding protein YusV
2831 CAMIHS010000049.1 GCA946223045_01410 CDS open 6004-7005 _na     333_aa fepD Transport system permease protein
2832 CAMIHS010000049.1 GCA946223045_01411 CDS open 6989-7972 _na     327_aa fepB High-affinity heme uptake system protein IsdE
2833 CAMIHS010000049.1 GCA946223045_01412 CDS open 8096-10159 _na     687_aa fepA Colicin I receptor
2834 CAMIHS010000049.1 GCA946223045_01413 CDS open 10326-11129 _na     267_aa tonB Gram-negative bacterial tonB protein
2835 CAMIHS010000049.1 GCA946223045_01414 CDS open 11138-11542 _na     134_aa exbD Transport energizing protein%2C ExbD/TolR family
2836 CAMIHS010000049.1 GCA946223045_01415 CDS open 11539-12150 _na     203_aa exbB Biopolymer transport protein ExbB
2837 CAMIHS010000049.1 GCA946223045_01416 CDS open 12462-12683 _na     73_aa DUF2922 domain-containing protein
2838 CAMIHS010000049.1 GCA946223045_01417 CDS open 12907-13113 _na     68_aa DUF1659 domain-containing protein
2839 CAMIHS010000049.1 GCA946223045_01418 CDS open 13339-13740 _na     133_aa hypothetical protein
2840 CAMIHS010000049.1 GCA946223045_01405 gene open 697-1449 tauC
2841 CAMIHS010000049.1 GCA946223045_01406 gene open 1460-2413 tauA
2842 CAMIHS010000049.1 GCA946223045_01407 gene open 2736-4367 arnT
2843 CAMIHS010000049.1 GCA946223045_01408 gene open 4379-4966 dedA
2844 CAMIHS010000049.1 GCA946223045_01409 gene open 5219-6007 fepC
2845 CAMIHS010000049.1 GCA946223045_01410 gene open 6004-7005 fepD
2846 CAMIHS010000049.1 GCA946223045_01411 gene open 6989-7972 fepB
2847 CAMIHS010000049.1 GCA946223045_01412 gene open 8096-10159 fepA
2848 CAMIHS010000049.1 GCA946223045_01413 gene open 10326-11129 tonB
2849 CAMIHS010000049.1 GCA946223045_01414 gene open 11138-11542 exbD
2850 CAMIHS010000049.1 GCA946223045_01415 gene open 11539-12150 exbB
2851 CAMIHS010000049.1 GCA946223045_01416 gene open 12462-12683
2852 CAMIHS010000049.1 GCA946223045_01417 gene open 12907-13113
2853 CAMIHS010000049.1 GCA946223045_01418 gene open 13339-13740
2854 CAMIHS010000050.1 GCA946223045_01419 CDS open 17-421 _na     134_aa hypothetical protein
2855 CAMIHS010000050.1 GCA946223045_01420 CDS open 418-1656 _na     412_aa ynbB Cystathionine gamma-synthase
2856 CAMIHS010000050.1 GCA946223045_01421 CDS open 1855-2916 _na     353_aa mnmA tRNA 2-thiouridine(34) synthase MnmA
2857 CAMIHS010000050.1 GCA946223045_01422 CDS open 2955-4754 _na     599_aa lepA translation elongation factor 4
2858 CAMIHS010000050.1 GCA946223045_01423 CDS open 4846-5943 _na     365_aa hemW radical SAM family heme chaperone HemW
2859 CAMIHS010000050.1 GCA946223045_01424 CDS open 6025-6627 _na     200_aa nirB Nitrite reductase [NAD(P)H]
2860 CAMIHS010000050.1 GCA946223045_01425 CDS open 7035-8063 _na     342_aa hrcA heat-inducible transcriptional repressor HrcA
2861 CAMIHS010000050.1 GCA946223045_01426 CDS open 8063-8608 _na     181_aa grpE nucleotide exchange factor GrpE
2862 CAMIHS010000050.1 GCA946223045_01427 CDS open 8636-10477 _na     613_aa dnaK molecular chaperone DnaK
2863 CAMIHS010000050.1 GCA946223045_01428 CDS open 10494-11651 _na     385_aa dnaJ molecular chaperone DnaJ
2864 CAMIHS010000050.1 GCA946223045_01429 CDS open 11707-12570 _na     287_aa prmA 50S ribosomal protein L11 methyltransferase
2865 CAMIHS010000050.1 GCA946223045_01419 gene open 17-421
2866 CAMIHS010000050.1 GCA946223045_01420 gene open 418-1656 ynbB
2867 CAMIHS010000050.1 GCA946223045_01421 gene open 1855-2916 mnmA
2868 CAMIHS010000050.1 GCA946223045_01422 gene open 2955-4754 lepA
2869 CAMIHS010000050.1 GCA946223045_01423 gene open 4846-5943 hemW
2870 CAMIHS010000050.1 GCA946223045_01424 gene open 6025-6627 nirB
2871 CAMIHS010000050.1 GCA946223045_01425 gene open 7035-8063 hrcA
2872 CAMIHS010000050.1 GCA946223045_01426 gene open 8063-8608 grpE
2873 CAMIHS010000050.1 GCA946223045_01427 gene open 8636-10477 dnaK
2874 CAMIHS010000050.1 GCA946223045_01428 gene open 10494-11651 dnaJ
2875 CAMIHS010000050.1 GCA946223045_01429 gene open 11707-12570 prmA
2876 CAMIHS010000051.1 GCA946223045_01430 CDS open 868-1743 _na     291_aa hdrB Cysteine-rich domain-containing protein
2877 CAMIHS010000051.1 GCA946223045_01431 CDS open 1743-2705 _na     320_aa sdhB succinate dehydrogenase
2878 CAMIHS010000051.1 GCA946223045_01432 CDS open 2707-4425 _na     572_aa sdhA FAD-binding protein
2879 CAMIHS010000051.1 GCA946223045_01433 CDS open 5311-5985 _na     224_aa ompR Response regulator ArlR
2880 CAMIHS010000051.1 GCA946223045_01434 CDS open 5963-7378 _na     471_aa baeS histidine kinase
2881 CAMIHS010000051.1 GCA946223045_01435 CDS open 7547-8860 _na     437_aa yjiN DUF445 domain-containing protein
2882 CAMIHS010000051.1 GCA946223045_01436 CDS open 8857-10092 _na     411_aa yjiN DUF445 domain-containing protein
2883 CAMIHS010000051.1 GCA946223045_01437 CDS open 10188-10889 _na     233_aa ulaG Metallo-beta-lactamase domain-containing protein
2884 CAMIHS010000051.1 GCA946223045_01438 CDS open 11078-11434 _na     118_aa hxlR HTH hxlR-type domain-containing protein
2885 CAMIHS010000051.1 GCA946223045_01439 CDS open 11875-12669 _na     264_aa ygiD 4%2C5-DOPA dioxygenase extradiol
2886 CAMIHS010000051.1 GCA946223045_01430 gene open 868-1743 hdrB
2887 CAMIHS010000051.1 GCA946223045_01431 gene open 1743-2705 sdhB
2888 CAMIHS010000051.1 GCA946223045_01432 gene open 2707-4425 sdhA
2889 CAMIHS010000051.1 GCA946223045_01433 gene open 5311-5985 ompR
2890 CAMIHS010000051.1 GCA946223045_01434 gene open 5963-7378 baeS
2891 CAMIHS010000051.1 GCA946223045_01435 gene open 7547-8860 yjiN
2892 CAMIHS010000051.1 GCA946223045_01436 gene open 8857-10092 yjiN
2893 CAMIHS010000051.1 GCA946223045_01437 gene open 10188-10889 ulaG
2894 CAMIHS010000051.1 GCA946223045_01438 gene open 11078-11434 hxlR
2895 CAMIHS010000051.1 GCA946223045_01439 gene open 11875-12669 ygiD
2896 CAMIHS010000052.1 GCA946223045_01440 CDS open 222-818 _na     198_aa hypothetical protein
2897 CAMIHS010000052.1 GCA946223045_01441 CDS open 784-1062 _na     92_aa hypothetical protein
2898 CAMIHS010000052.1 GCA946223045_01442 CDS open 1457-2362 _na     301_aa Hydrogen peroxide-inducible genes activator
2899 CAMIHS010000052.1 GCA946223045_01443 CDS open 2594-4354 _na     586_aa pckA phosphoenolpyruvate carboxykinase (ATP)
2900 CAMIHS010000052.1 GCA946223045_01444 CDS open 4474-6090 _na     538_aa Diguanylate cyclase
2901 CAMIHS010000052.1 GCA946223045_01445 CDS open 6320-6667 _na     115_aa tonB TonB family protein
2902 CAMIHS010000052.1 GCA946223045_01446 CDS open 6678-7055 _na     125_aa tonB Energy transducer TonB
2903 CAMIHS010000052.1 GCA946223045_01447 CDS open 7235-7330 _na     31_aa Secreted protein
2904 CAMIHS010000052.1 GCA946223045_01448 CDS open 7520-8461 _na     313_aa znuA Manganese transporter
2905 CAMIHS010000052.1 GCA946223045_01449 CDS open 8607-9338 _na     243_aa znuC ABC transporter domain-containing protein
2906 CAMIHS010000052.1 GCA946223045_01450 CDS open 9335-10300 _na     321_aa znuB ABC 3 transport family protein
2907 CAMIHS010000052.1 GCA946223045_01451 CDS open 10297-11397 _na     366_aa znuB ABC 3 transport family protein
2908 CAMIHS010000052.1 GCA946223045_01452 CDS open 11525-12562 _na     345_aa Reverse transcriptase domain-containing protein
2909 CAMIHS010000052.1 GCA946223045_01440 gene open 222-818
2910 CAMIHS010000052.1 GCA946223045_01441 gene open 784-1062
2911 CAMIHS010000052.1 GCA946223045_01442 gene open 1457-2362
2912 CAMIHS010000052.1 GCA946223045_01443 gene open 2594-4354 pckA
2913 CAMIHS010000052.1 GCA946223045_01444 gene open 4474-6090
2914 CAMIHS010000052.1 GCA946223045_01445 gene open 6320-6667 tonB
2915 CAMIHS010000052.1 GCA946223045_01446 gene open 6678-7055 tonB
2916 CAMIHS010000052.1 GCA946223045_01447 gene open 7235-7330
2917 CAMIHS010000052.1 GCA946223045_01448 gene open 7520-8461 znuA
2918 CAMIHS010000052.1 GCA946223045_01449 gene open 8607-9338 znuC
2919 CAMIHS010000052.1 GCA946223045_01450 gene open 9335-10300 znuB
2920 CAMIHS010000052.1 GCA946223045_01451 gene open 10297-11397 znuB
2921 CAMIHS010000052.1 GCA946223045_01452 gene open 11525-12562
2922 CAMIHS010000053.1 GCA946223045_01453 gene open 258-439 Bacteria_large_SRP
2923 CAMIHS010000053.1 GCA946223045_01454 gene open 282-381 Bacteria_small_SRP
2924 CAMIHS010000053.1 GCA946223045_01453 ncRNA open 258-439 Bacterial large signal recognition particle RNA
2925 CAMIHS010000053.1 GCA946223045_01454 ncRNA open 282-381 Bacterial small signal recognition particle RNA
2926 CAMIHS010000053.1 GCA946223045_01455 CDS open 499-5079 _na     1526_aa gltB glutamate synthase large subunit
2927 CAMIHS010000053.1 GCA946223045_01456 CDS open 5395-6264 _na     289_aa rluA Pseudouridine synthase
2928 CAMIHS010000053.1 GCA946223045_01457 CDS open 6266-7459 _na     397_aa N-acetyltransferase domain-containing protein
2929 CAMIHS010000053.1 GCA946223045_01458 CDS open 7641-8453 _na     270_aa Phosphatidylglycerol lysyltransferase C-terminal domain-containing protein
2930 CAMIHS010000053.1 GCA946223045_01459 CDS open 8678-9793 _na     371_aa acrA Efflux transporter%2C RND family%2C MFP subunit
2931 CAMIHS010000053.1 GCA946223045_01460 CDS open 9905-10756 _na     283_aa aRA1 Putative oxidoreductase/MSMEI_2347
2932 CAMIHS010000053.1 GCA946223045_01461 CDS open 10913-11236 _na     107_aa azlD Branched-chain amino acid transport protein AzlD
2933 CAMIHS010000053.1 GCA946223045_01462 CDS open 11244-11957 _na     237_aa ygaZ Inner membrane protein YgaZ
2934 CAMIHS010000053.1 GCA946223045_01455 gene open 499-5079 gltB
2935 CAMIHS010000053.1 GCA946223045_01456 gene open 5395-6264 rluA
2936 CAMIHS010000053.1 GCA946223045_01457 gene open 6266-7459
2937 CAMIHS010000053.1 GCA946223045_01458 gene open 7641-8453
2938 CAMIHS010000053.1 GCA946223045_01459 gene open 8678-9793 acrA
2939 CAMIHS010000053.1 GCA946223045_01460 gene open 9905-10756 aRA1
2940 CAMIHS010000053.1 GCA946223045_01461 gene open 10913-11236 azlD
2941 CAMIHS010000053.1 GCA946223045_01462 gene open 11244-11957 ygaZ
2942 CAMIHS010000054.1 GCA946223045_01463 CDS open 2700-4397 _na     565_aa ShlB/FhaC/HecB family hemolysin secretion/activation protein
2943 CAMIHS010000054.1 GCA946223045_01464 CDS open 4576-5346 _na     256_aa Tat protein
2944 CAMIHS010000054.1 GCA946223045_01465 CDS open 5514-7139 _na     541_aa asmA Membrane biogenesis protein AsmA
2945 CAMIHS010000054.1 GCA946223045_01466 CDS open 7361-9193 _na     610_aa cstA CstA N-terminal domain-containing protein
2946 CAMIHS010000054.1 GCA946223045_01467 CDS open 9475-10101 _na     208_aa hisH imidazole glycerol phosphate synthase subunit HisH
2947 CAMIHS010000054.1 GCA946223045_01468 CDS open 10180-11256 _na     358_aa hisC histidinol-phosphate transaminase
2948 CAMIHS010000054.1 GCA946223045_01469 CDS open 11364-11690 _na     108_aa hisI2 phosphoribosyl-ATP diphosphatase
2949 CAMIHS010000054.1 GCA946223045_01463 gene open 2700-4397
2950 CAMIHS010000054.1 GCA946223045_01464 gene open 4576-5346
2951 CAMIHS010000054.1 GCA946223045_01465 gene open 5514-7139 asmA
2952 CAMIHS010000054.1 GCA946223045_01466 gene open 7361-9193 cstA
2953 CAMIHS010000054.1 GCA946223045_01467 gene open 9475-10101 hisH
2954 CAMIHS010000054.1 GCA946223045_01468 gene open 10180-11256 hisC
2955 CAMIHS010000054.1 GCA946223045_01469 gene open 11364-11690 hisI2
2956 CAMIHS010000055.1 GCA946223045_01470 CDS open 664-1572 _na     302_aa Haloacid dehalogenase-like hydrolase
2957 CAMIHS010000055.1 GCA946223045_01471 CDS open 1712-2650 _na     312_aa DUF1848 domain-containing protein
2958 CAMIHS010000055.1 GCA946223045_01472 CDS open 2798-3547 _na     249_aa ubiE Demethylmenaquinone methyltransferase
2959 CAMIHS010000055.1 GCA946223045_01473 CDS open 3658-4320 _na     220_aa Lipoprotein
2960 CAMIHS010000055.1 GCA946223045_01474 CDS open 4428-5717 _na     429_aa ssnA 5-methylthioadenosine/S-adenosylhomocysteine deaminase
2961 CAMIHS010000055.1 GCA946223045_01475 CDS open 5836-7080 _na     414_aa sAM1 adenosylhomocysteinase
2962 CAMIHS010000055.1 GCA946223045_01476 CDS open 7256-8320 _na     354_aa mtnA S-methyl-5-thioribose-1-phosphate isomerase
2963 CAMIHS010000055.1 GCA946223045_01477 CDS open 8363-9157 _na     264_aa mtnP S-methyl-5'-thioadenosine phosphorylase
2964 CAMIHS010000055.1 GCA946223045_01478 CDS open 9267-10145 _na     292_aa hslO Hsp33 family molecular chaperone HslO
2965 CAMIHS010000055.1 GCA946223045_01479 CDS open 10344-10805 _na     153_aa ribE 6%2C7-dimethyl-8-ribityllumazine synthase
2966 CAMIHS010000055.1 GCA946223045_01470 gene open 664-1572
2967 CAMIHS010000055.1 GCA946223045_01471 gene open 1712-2650
2968 CAMIHS010000055.1 GCA946223045_01472 gene open 2798-3547 ubiE
2969 CAMIHS010000055.1 GCA946223045_01473 gene open 3658-4320
2970 CAMIHS010000055.1 GCA946223045_01474 gene open 4428-5717 ssnA
2971 CAMIHS010000055.1 GCA946223045_01475 gene open 5836-7080 sAM1
2972 CAMIHS010000055.1 GCA946223045_01476 gene open 7256-8320 mtnA
2973 CAMIHS010000055.1 GCA946223045_01477 gene open 8363-9157 mtnP
2974 CAMIHS010000055.1 GCA946223045_01478 gene open 9267-10145 hslO
2975 CAMIHS010000055.1 GCA946223045_01479 gene open 10344-10805 ribE
2976 CAMIHS010000056.1 repeat_region open 61-1182 CRISPR array with 17 repeats of length 35%2C consensus sequence GTTTGAGAGTAGTGTAATTCTGTAAACCTCTAAAA and spacer length 31
2977 CAMIHS010000056.1 GCA946223045_01480 CDS open 1793-3052 _na     419_aa hypothetical protein
2978 CAMIHS010000056.1 GCA946223045_01481 CDS open 3513-4049 _na     178_aa rutF Flavin reductase like domain-containing protein
2979 CAMIHS010000056.1 GCA946223045_01482 CDS open 4254-5585 _na     443_aa DUF3298 domain-containing protein
2980 CAMIHS010000056.1 GCA946223045_01483 CDS open 5843-6421 _na     192_aa TonB-dependent receptor
2981 CAMIHS010000056.1 GCA946223045_01484 CDS open 6475-7197 _na     240_aa Uracil-DNA glycosylase-like domain-containing protein
2982 CAMIHS010000056.1 GCA946223045_01485 CDS open 7236-7679 _na     147_aa hypothetical protein
2983 CAMIHS010000056.1 GCA946223045_01486 CDS open 7679-8278 _na     199_aa tag DNA-3-methyladenine glycosylase I
2984 CAMIHS010000056.1 GCA946223045_01487 CDS open 8729-9445 _na     238_aa yqgA DUF554 domain-containing protein
2985 CAMIHS010000056.1 GCA946223045_01488 CDS open 9801-10085 _na     94_aa higB Toxin HigB-1
2986 CAMIHS010000056.1 GCA946223045_01489 CDS open 10102-10422 _na     106_aa higA HigA family addiction module antitoxin
2987 CAMIHS010000056.1 GCA946223045_01490 CDS open 10509-10862 _na     117_aa mgsR Regulatory protein MgsR
2988 CAMIHS010000056.1 GCA946223045_01480 gene open 1793-3052
2989 CAMIHS010000056.1 GCA946223045_01481 gene open 3513-4049 rutF
2990 CAMIHS010000056.1 GCA946223045_01482 gene open 4254-5585
2991 CAMIHS010000056.1 GCA946223045_01483 gene open 5843-6421
2992 CAMIHS010000056.1 GCA946223045_01484 gene open 6475-7197
2993 CAMIHS010000056.1 GCA946223045_01485 gene open 7236-7679
2994 CAMIHS010000056.1 GCA946223045_01486 gene open 7679-8278 tag
2995 CAMIHS010000056.1 GCA946223045_01487 gene open 8729-9445 yqgA
2996 CAMIHS010000056.1 GCA946223045_01488 gene open 9801-10085 higB
2997 CAMIHS010000056.1 GCA946223045_01489 gene open 10102-10422 higA
2998 CAMIHS010000056.1 GCA946223045_01490 gene open 10509-10862 mgsR
2999 CAMIHS010000057.1 GCA946223045_01491 CDS open 29-733 _na     234_aa hypothetical protein
3000 CAMIHS010000057.1 GCA946223045_01492 CDS open 897-1364 _na     155_aa ATPase