HOMD Banner
Taxonomy: V4.3   |  16S rRNA RefSeq: V16.03   |  Genomic RefSeq: V11.03   |  Viruses: V1.2

BAKTAGenome Explorer: Anaerococcus tetradius (GCA_946891905.1)

Select a Genome:
BAKTA Annotations for GCA_946891905.1
Genome Selected: Anaerococcus tetradius
ContigsBases CDSrRNA tmRNAtRNA
55 1,769,598 1670 0 1 21
[Table]   [AA Fasta]      [Browser]   [Text]   [Excel]  
Search & Sort all 3420 Records
Search These Records: Clear
Sort Column:   Molecule   PID   NA   AA   Gene  Gene Product  Reverse
Annotation Table [page:1]    |    Number of Records Found: 3420 [7 Pages]    |    Previous Page <==> Next Page    |    Jump to Page: [ 1  2  3  4  5  6  7  ]
Notes:   1- Column headers only sort the current page. 2- Select [NA] or [AA] links to show sequences.
Region Protein-ID Type Genome
Viewer
Range
(bp)
Show Sequences
(length) NA / AA
BAKTA
Gene
BAKTA
GeneProduct
1 CAMPNK010000001.1 GCA946891905_00008 gene open 8229-8567 RNaseP_bact_a
2 CAMPNK010000001.1 GCA946891905_00080 gene open 89156-89422 Bacteria_large_SRP
3 CAMPNK010000001.1 GCA946891905_00081 gene open 89209-89308 Bacteria_small_SRP
4 CAMPNK010000001.1 GCA946891905_00008 ncRNA open 8229-8567 Bacterial RNase P class A
5 CAMPNK010000001.1 GCA946891905_00080 ncRNA open 89156-89422 Bacterial large signal recognition particle RNA
6 CAMPNK010000001.1 GCA946891905_00081 ncRNA open 89209-89308 Bacterial small signal recognition particle RNA
7 CAMPNK010000001.1 regulatory_region open 54403-54514 SAM riboswitch aptamer (S box leader)
8 CAMPNK010000001.1 repeat_region open 15797-16589 CRISPR array with 13 repeats of length 28%2C consensus sequence GTTTTACCCGCACACGCGGGGGTGATCC and spacer length 33
9 CAMPNK010000001.1 repeat_region open 27217-27826 CRISPR array with 10 repeats of length 28%2C consensus sequence GTAATACCCGCACACGCGGGGGTGATCC and spacer length 33
10 CAMPNK010000001.1 GCA946891905_00001 CDS open 138-1412 _na     424_aa DUF4015 domain-containing protein
11 CAMPNK010000001.1 GCA946891905_00002 CDS open 1412-2038 _na     208_aa Transporter-associated domain-containing protein
12 CAMPNK010000001.1 GCA946891905_00003 CDS open 2118-3035 _na     305_aa araC Transcriptional regulator%2C AraC family
13 CAMPNK010000001.1 GCA946891905_00004 CDS open 3269-4903 _na     544_aa DNA primase
14 CAMPNK010000001.1 GCA946891905_00005 CDS open 4928-6748 _na     606_aa sigA RNA polymerase sigma factor SigA
15 CAMPNK010000001.1 GCA946891905_00006 CDS open 6748-7440 _na     230_aa SAM-dependent methyltransferase
16 CAMPNK010000001.1 GCA946891905_00007 CDS open 7422-8192 _na     256_aa Nif3-like dinuclear metal center hexameric protein
17 CAMPNK010000001.1 GCA946891905_00009 CDS open 8828-10354 _na     508_aa NlpC/P60 family protein
18 CAMPNK010000001.1 GCA946891905_00010 CDS open 10414-11196 _na     260_aa methenyltetrahydrofolate cyclohydrolase
19 CAMPNK010000001.1 GCA946891905_00011 CDS open 11231-11740 _na     169_aa tpx thiol peroxidase
20 CAMPNK010000001.1 GCA946891905_00012 CDS open 11867-12514 _na     215_aa 50S ribosomal protein L25
21 CAMPNK010000001.1 GCA946891905_00013 CDS open 12601-13239 _na     212_aa tmk dTMP kinase
22 CAMPNK010000001.1 GCA946891905_00014 CDS open 13227-13565 _na     112_aa darA Nitrogen regulatory protein P-II
23 CAMPNK010000001.1 GCA946891905_00015 CDS open 13553-15151 _na     532_aa hypothetical protein
24 CAMPNK010000001.1 GCA946891905_00016 CDS open 15299-15472 _na     57_aa dsrA Ferredoxin
25 CAMPNK010000001.1 GCA946891905_00017 CDS open 16984-17616 _na     210_aa helix-turn-helix transcriptional regulator
26 CAMPNK010000001.1 GCA946891905_00018 CDS open 17918-20680 _na     920_aa CRISPR-associated helicase Cas3'
27 CAMPNK010000001.1 GCA946891905_00019 CDS open 20662-22374 _na     570_aa type I-E CRISPR-associated protein Cse1/CasA
28 CAMPNK010000001.1 GCA946891905_00020 CDS open 22367-22972 _na     201_aa casB type I-E CRISPR-associated protein Cse2/CasB
29 CAMPNK010000001.1 GCA946891905_00021 CDS open 22965-24032 _na     355_aa cas7e type I-E CRISPR-associated protein Cas7/Cse4/CasC
30 CAMPNK010000001.1 GCA946891905_00022 CDS open 24042-24737 _na     231_aa cas5e type I-E CRISPR-associated protein Cas5/CasD
31 CAMPNK010000001.1 GCA946891905_00023 CDS open 24740-25378 _na     212_aa cas6e type I-E CRISPR-associated protein Cas6/Cse3/CasE
32 CAMPNK010000001.1 GCA946891905_00024 CDS open 25368-26306 _na     312_aa cas1e type I-E CRISPR-associated endonuclease Cas1e
33 CAMPNK010000001.1 GCA946891905_00025 CDS open 26306-27184 _na     292_aa cas2e type I-E CRISPR-associated endoribonuclease Cas2e
34 CAMPNK010000001.1 GCA946891905_00027 CDS open 28237-29418 _na     393_aa cvpA CvpA family protein
35 CAMPNK010000001.1 GCA946891905_00028 CDS open 29495-31624 _na     709_aa Tex-like protein
36 CAMPNK010000001.1 GCA946891905_00029 CDS open 31591-33309 _na     572_aa proline--tRNA ligase
37 CAMPNK010000001.1 GCA946891905_00030 CDS open 33366-34229 _na     287_aa fba class II fructose-1%2C6-bisphosphate aldolase
38 CAMPNK010000001.1 GCA946891905_00031 CDS open 34280-35584 _na     434_aa rho transcription termination factor Rho
39 CAMPNK010000001.1 GCA946891905_00032 CDS open 35656-35859 _na     67_aa rpmE 50S ribosomal protein L31
40 CAMPNK010000001.1 GCA946891905_00033 CDS open 35920-36714 _na     264_aa prmC peptide chain release factor N(5)-glutamine methyltransferase
41 CAMPNK010000001.1 GCA946891905_00034 CDS open 36718-37794 _na     358_aa prfA peptide chain release factor 1
42 CAMPNK010000001.1 GCA946891905_00035 CDS open 37795-38760 _na     321_aa Cation diffusion facilitator family transporter
43 CAMPNK010000001.1 GCA946891905_00036 CDS open 38742-39776 _na     344_aa L-threonylcarbamoyladenylate synthase
44 CAMPNK010000001.1 GCA946891905_00037 CDS open 39785-40414 _na     209_aa upp uracil phosphoribosyltransferase
45 CAMPNK010000001.1 GCA946891905_00038 CDS open 40424-41698 _na     424_aa murA UDP-N-acetylglucosamine 1-carboxyvinyltransferase
46 CAMPNK010000001.1 GCA946891905_00039 CDS open 41710-43887 _na     725_aa recD2 ATP-dependent RecD2 DNA helicase
47 CAMPNK010000001.1 GCA946891905_00040 CDS open 43862-44485 _na     207_aa comF ComF family protein
48 CAMPNK010000001.1 GCA946891905_00041 CDS open 45245-48457 _na     1070_aa Type III restriction enzyme%2C res subunit
49 CAMPNK010000001.1 GCA946891905_00042 CDS open 48457-49479 _na     340_aa site-specific DNA-methyltransferase (adenine-specific)
50 CAMPNK010000001.1 GCA946891905_00043 CDS open 49458-50396 _na     312_aa Restriction endonuclease subunit M
51 CAMPNK010000001.1 GCA946891905_00044 CDS open 50619-51317 _na     232_aa DUF5986 domain-containing protein
52 CAMPNK010000001.1 GCA946891905_00045 CDS open 51332-52498 _na     388_aa DNA-binding helix-turn-helix protein
53 CAMPNK010000001.1 GCA946891905_00046 CDS open 52815-53639 _na     274_aa hypothetical protein
54 CAMPNK010000001.1 GCA946891905_00047 CDS open 54050-54373 _na     107_aa hypothetical protein
55 CAMPNK010000001.1 GCA946891905_00048 CDS open 54765-57011 _na     748_aa Restriction endonuclease type II NgoFVII N-terminal domain-containing protein
56 CAMPNK010000001.1 GCA946891905_00049 CDS open 57192-58346 _na     384_aa rodA rod shape-determining protein RodA
57 CAMPNK010000001.1 GCA946891905_00050 CDS open 58498-59091 _na     197_aa nth endonuclease III
58 CAMPNK010000001.1 GCA946891905_00051 CDS open 59084-59923 _na     279_aa Cof-like hydrolase
59 CAMPNK010000001.1 GCA946891905_00052 CDS open 59916-60374 _na     152_aa Putative tRNA (cytidine(34)-2'-O)-methyltransferase
60 CAMPNK010000001.1 GCA946891905_00053 CDS open 60384-61310 _na     308_aa trxB thioredoxin-disulfide reductase
61 CAMPNK010000001.1 GCA946891905_00054 CDS open 61377-62384 _na     335_aa gap type I glyceraldehyde-3-phosphate dehydrogenase
62 CAMPNK010000001.1 GCA946891905_00055 CDS open 62443-63639 _na     398_aa pgk Phosphoglycerate kinase
63 CAMPNK010000001.1 GCA946891905_00056 CDS open 63649-64401 _na     250_aa tpiA triose-phosphate isomerase
64 CAMPNK010000001.1 GCA946891905_00057 CDS open 64412-65707 _na     431_aa eno phosphopyruvate hydratase
65 CAMPNK010000001.1 GCA946891905_00058 CDS open 65809-67632 _na     607_aa uidA beta-glucuronidase
66 CAMPNK010000001.1 GCA946891905_00059 CDS open 67776-68003 _na     75_aa secG preprotein translocase subunit SecG
67 CAMPNK010000001.1 GCA946891905_00060 CDS open 68065-70191 _na     708_aa rnr ribonuclease R
68 CAMPNK010000001.1 GCA946891905_00061 CDS open 70169-70612 _na     147_aa smpB SsrA-binding protein SmpB
69 CAMPNK010000001.1 GCA946891905_00062 CDS open 70632-71411 _na     259_aa thyX FAD-dependent thymidylate synthase
70 CAMPNK010000001.1 GCA946891905_00063 CDS open 71444-72145 _na     233_aa ABC transporter%2C ATP-binding protein
71 CAMPNK010000001.1 GCA946891905_00064 CDS open 72147-75578 _na     1143_aa Efflux ABC transporter%2C permease protein
72 CAMPNK010000001.1 GCA946891905_00065 CDS open 75710-76354 _na     214_aa Phosphoglycerate mutase family protein
73 CAMPNK010000001.1 GCA946891905_00066 CDS open 76309-77346 _na     345_aa Ser/Thr phosphatase family protein
74 CAMPNK010000001.1 GCA946891905_00067 CDS open 77288-79153 _na     621_aa yhaN putative protein YhaN AAA domain-containing protein
75 CAMPNK010000001.1 GCA946891905_00068 CDS open 79138-79815 _na     225_aa Ser/Thr phosphatase family protein
76 CAMPNK010000001.1 GCA946891905_00069 CDS open 79815-80345 _na     176_aa cyaB Putative adenylyl cyclase CyaB
77 CAMPNK010000001.1 GCA946891905_00070 CDS open 80404-81342 _na     312_aa pyrB aspartate carbamoyltransferase
78 CAMPNK010000001.1 GCA946891905_00071 CDS open 81326-81754 _na     142_aa aspartate carbamoyltransferase regulatory subunit
79 CAMPNK010000001.1 GCA946891905_00072 CDS open 81755-82948 _na     397_aa Amidohydrolase family protein
80 CAMPNK010000001.1 GCA946891905_00073 CDS open 82932-83795 _na     287_aa pyrF orotidine-5'-phosphate decarboxylase
81 CAMPNK010000001.1 GCA946891905_00074 CDS open 83782-84513 _na     243_aa dihydroorotate dehydrogenase electron transfer subunit
82 CAMPNK010000001.1 GCA946891905_00075 CDS open 84498-85397 _na     299_aa dihydroorotate dehydrogenase
83 CAMPNK010000001.1 GCA946891905_00076 CDS open 85406-85981 _na     191_aa pyrE orotate phosphoribosyltransferase
84 CAMPNK010000001.1 GCA946891905_00077 CDS open 86042-86746 _na     234_aa Mannosyl-glycoprotein endo-beta-N-acetylglucosaminidase
85 CAMPNK010000001.1 GCA946891905_00078 CDS open 86794-88449 _na     551_aa Isoamylase protein
86 CAMPNK010000001.1 GCA946891905_00079 CDS open 88553-89032 _na     159_aa cbpB cyclic-di-AMP-binding protein CbpB
87 CAMPNK010000001.1 GCA946891905_00083 CDS open 89634-91451 _na     605_aa dnaX DNA polymerase III subunit gamma/tau
88 CAMPNK010000001.1 GCA946891905_00084 CDS open 91467-91805 _na     112_aa YbaB/EbfC family nucleoid-associated protein
89 CAMPNK010000001.1 GCA946891905_00085 CDS open 91805-92410 _na     201_aa recR recombination mediator RecR
90 CAMPNK010000001.1 GCA946891905_00086 CDS open 92403-93386 _na     327_aa SsuA/THI5-like domain-containing protein
91 CAMPNK010000001.1 GCA946891905_00087 CDS open 93403-94800 _na     465_aa Sucrose-6-phosphate hydrolase
92 CAMPNK010000001.1 GCA946891905_00088 CDS open 95367-96428 _na     353_aa Site-specific recombinase%2C phage integrase family
93 CAMPNK010000001.1 GCA946891905_00089 CDS open 96536-97075 _na     179_aa hypothetical protein
94 CAMPNK010000001.1 GCA946891905_00090 CDS open 97343-97870 _na     175_aa HIRAN domain-containing protein
95 CAMPNK010000001.1 GCA946891905_00091 CDS open 97884-98294 _na     136_aa ImmA/IrrE family metallo-endopeptidase
96 CAMPNK010000001.1 GCA946891905_00092 CDS open 98297-98512 _na     71_aa hypothetical protein
97 CAMPNK010000001.1 GCA946891905_00093 CDS open 98523-99008 _na     161_aa DNA-binding helix-turn-helix protein
98 CAMPNK010000001.1 GCA946891905_00094 CDS open 99022-99486 _na     154_aa helix-turn-helix domain-containing protein
99 CAMPNK010000001.1 GCA946891905_00095 CDS open 99639-99779 _na     46_aa Holin-like toxin
100 CAMPNK010000001.1 GCA946891905_00096 CDS open 99968-100174 _na     68_aa toxin-antitoxin system%2C antitoxin component%2C Xre family protein
101 CAMPNK010000001.1 GCA946891905_00097 CDS open 100217-100345 _na     42_aa hypothetical protein
102 CAMPNK010000001.1 GCA946891905_00098 CDS open 100308-100541 _na     77_aa hypothetical protein
103 CAMPNK010000001.1 GCA946891905_00099 CDS open 100858-101229 _na     123_aa hypothetical protein
104 CAMPNK010000001.1 GCA946891905_00100 CDS open 101319-101663 _na     114_aa hypothetical protein
105 CAMPNK010000001.1 GCA946891905_00101 CDS open 101660-101845 _na     61_aa hypothetical protein
106 CAMPNK010000001.1 GCA946891905_00102 CDS open 101938-102120 _na     60_aa hypothetical protein
107 CAMPNK010000001.1 GCA946891905_00103 CDS open 102083-102742 _na     219_aa DUF4145 domain-containing protein
108 CAMPNK010000001.1 GCA946891905_00104 CDS open 102824-103009 _na     61_aa hypothetical protein
109 CAMPNK010000001.1 GCA946891905_00105 CDS open 103004-103510 _na     168_aa DUF4352 domain-containing protein
110 CAMPNK010000001.1 GCA946891905_00106 CDS open 103601-103888 _na     95_aa hypothetical protein
111 CAMPNK010000001.1 GCA946891905_00107 CDS open 103784-104119 _na     111_aa hypothetical protein
112 CAMPNK010000001.1 GCA946891905_00108 CDS open 104194-104391 _na     65_aa hypothetical protein
113 CAMPNK010000001.1 GCA946891905_00109 CDS open 104585-105100 _na     171_aa hypothetical protein
114 CAMPNK010000001.1 GCA946891905_00110 CDS open 105164-105349 _na     61_aa DNA-binding helix-turn-helix protein
115 CAMPNK010000001.1 GCA946891905_00111 CDS open 105365-105829 _na     154_aa hypothetical protein
116 CAMPNK010000001.1 GCA946891905_00112 CDS open 105841-106038 _na     65_aa hypothetical protein
117 CAMPNK010000001.1 GCA946891905_00113 CDS open 106265-106831 _na     188_aa hypothetical protein
118 CAMPNK010000001.1 GCA946891905_00114 CDS open 107030-107848 _na     272_aa Rep protein
119 CAMPNK010000001.1 GCA946891905_00115 CDS open 108110-108478 _na     122_aa hypothetical protein
120 CAMPNK010000001.1 GCA946891905_00116 CDS open 108471-109019 _na     182_aa recU Holliday junction resolvase RecU
121 CAMPNK010000001.1 GCA946891905_00117 CDS open 109022-109183 _na     53_aa hypothetical protein
122 CAMPNK010000001.1 GCA946891905_00118 CDS open 109156-109569 _na     137_aa dut dUTP diphosphatase
123 CAMPNK010000001.1 GCA946891905_00119 CDS open 109511-109723 _na     70_aa hypothetical protein
124 CAMPNK010000001.1 GCA946891905_00120 CDS open 109726-110166 _na     146_aa rinA Phage transcriptional regulator%2C RinA family
125 CAMPNK010000001.1 GCA946891905_00121 CDS open 110411-110743 _na     110_aa HNH endonuclease domain protein
126 CAMPNK010000001.1 GCA946891905_00122 CDS open 110861-112117 _na     418_aa Phage portal protein%2C SPP1 Gp6
127 CAMPNK010000001.1 GCA946891905_00001 gene open 138-1412
128 CAMPNK010000001.1 GCA946891905_00002 gene open 1412-2038
129 CAMPNK010000001.1 GCA946891905_00003 gene open 2118-3035 araC
130 CAMPNK010000001.1 GCA946891905_00004 gene open 3269-4903
131 CAMPNK010000001.1 GCA946891905_00005 gene open 4928-6748 sigA
132 CAMPNK010000001.1 GCA946891905_00006 gene open 6748-7440
133 CAMPNK010000001.1 GCA946891905_00007 gene open 7422-8192
134 CAMPNK010000001.1 GCA946891905_00009 gene open 8828-10354
135 CAMPNK010000001.1 GCA946891905_00010 gene open 10414-11196
136 CAMPNK010000001.1 GCA946891905_00011 gene open 11231-11740 tpx
137 CAMPNK010000001.1 GCA946891905_00012 gene open 11867-12514
138 CAMPNK010000001.1 GCA946891905_00013 gene open 12601-13239 tmk
139 CAMPNK010000001.1 GCA946891905_00014 gene open 13227-13565 darA
140 CAMPNK010000001.1 GCA946891905_00015 gene open 13553-15151
141 CAMPNK010000001.1 GCA946891905_00016 gene open 15299-15472 dsrA
142 CAMPNK010000001.1 GCA946891905_00017 gene open 16984-17616
143 CAMPNK010000001.1 GCA946891905_00018 gene open 17918-20680
144 CAMPNK010000001.1 GCA946891905_00019 gene open 20662-22374
145 CAMPNK010000001.1 GCA946891905_00020 gene open 22367-22972 casB
146 CAMPNK010000001.1 GCA946891905_00021 gene open 22965-24032 cas7e
147 CAMPNK010000001.1 GCA946891905_00022 gene open 24042-24737 cas5e
148 CAMPNK010000001.1 GCA946891905_00023 gene open 24740-25378 cas6e
149 CAMPNK010000001.1 GCA946891905_00024 gene open 25368-26306 cas1e
150 CAMPNK010000001.1 GCA946891905_00025 gene open 26306-27184 cas2e
151 CAMPNK010000001.1 GCA946891905_00027 gene open 28237-29418 cvpA
152 CAMPNK010000001.1 GCA946891905_00028 gene open 29495-31624
153 CAMPNK010000001.1 GCA946891905_00029 gene open 31591-33309
154 CAMPNK010000001.1 GCA946891905_00030 gene open 33366-34229 fba
155 CAMPNK010000001.1 GCA946891905_00031 gene open 34280-35584 rho
156 CAMPNK010000001.1 GCA946891905_00032 gene open 35656-35859 rpmE
157 CAMPNK010000001.1 GCA946891905_00033 gene open 35920-36714 prmC
158 CAMPNK010000001.1 GCA946891905_00034 gene open 36718-37794 prfA
159 CAMPNK010000001.1 GCA946891905_00035 gene open 37795-38760
160 CAMPNK010000001.1 GCA946891905_00036 gene open 38742-39776
161 CAMPNK010000001.1 GCA946891905_00037 gene open 39785-40414 upp
162 CAMPNK010000001.1 GCA946891905_00038 gene open 40424-41698 murA
163 CAMPNK010000001.1 GCA946891905_00039 gene open 41710-43887 recD2
164 CAMPNK010000001.1 GCA946891905_00040 gene open 43862-44485 comF
165 CAMPNK010000001.1 GCA946891905_00041 gene open 45245-48457
166 CAMPNK010000001.1 GCA946891905_00042 gene open 48457-49479
167 CAMPNK010000001.1 GCA946891905_00043 gene open 49458-50396
168 CAMPNK010000001.1 GCA946891905_00044 gene open 50619-51317
169 CAMPNK010000001.1 GCA946891905_00045 gene open 51332-52498
170 CAMPNK010000001.1 GCA946891905_00046 gene open 52815-53639
171 CAMPNK010000001.1 GCA946891905_00047 gene open 54050-54373
172 CAMPNK010000001.1 GCA946891905_00048 gene open 54765-57011
173 CAMPNK010000001.1 GCA946891905_00049 gene open 57192-58346 rodA
174 CAMPNK010000001.1 GCA946891905_00050 gene open 58498-59091 nth
175 CAMPNK010000001.1 GCA946891905_00051 gene open 59084-59923
176 CAMPNK010000001.1 GCA946891905_00052 gene open 59916-60374
177 CAMPNK010000001.1 GCA946891905_00053 gene open 60384-61310 trxB
178 CAMPNK010000001.1 GCA946891905_00054 gene open 61377-62384 gap
179 CAMPNK010000001.1 GCA946891905_00055 gene open 62443-63639 pgk
180 CAMPNK010000001.1 GCA946891905_00056 gene open 63649-64401 tpiA
181 CAMPNK010000001.1 GCA946891905_00057 gene open 64412-65707 eno
182 CAMPNK010000001.1 GCA946891905_00058 gene open 65809-67632 uidA
183 CAMPNK010000001.1 GCA946891905_00059 gene open 67776-68003 secG
184 CAMPNK010000001.1 GCA946891905_00060 gene open 68065-70191 rnr
185 CAMPNK010000001.1 GCA946891905_00061 gene open 70169-70612 smpB
186 CAMPNK010000001.1 GCA946891905_00062 gene open 70632-71411 thyX
187 CAMPNK010000001.1 GCA946891905_00063 gene open 71444-72145
188 CAMPNK010000001.1 GCA946891905_00064 gene open 72147-75578
189 CAMPNK010000001.1 GCA946891905_00065 gene open 75710-76354
190 CAMPNK010000001.1 GCA946891905_00066 gene open 76309-77346
191 CAMPNK010000001.1 GCA946891905_00067 gene open 77288-79153 yhaN
192 CAMPNK010000001.1 GCA946891905_00068 gene open 79138-79815
193 CAMPNK010000001.1 GCA946891905_00069 gene open 79815-80345 cyaB
194 CAMPNK010000001.1 GCA946891905_00070 gene open 80404-81342 pyrB
195 CAMPNK010000001.1 GCA946891905_00071 gene open 81326-81754
196 CAMPNK010000001.1 GCA946891905_00072 gene open 81755-82948
197 CAMPNK010000001.1 GCA946891905_00073 gene open 82932-83795 pyrF
198 CAMPNK010000001.1 GCA946891905_00074 gene open 83782-84513
199 CAMPNK010000001.1 GCA946891905_00075 gene open 84498-85397
200 CAMPNK010000001.1 GCA946891905_00076 gene open 85406-85981 pyrE
201 CAMPNK010000001.1 GCA946891905_00077 gene open 86042-86746
202 CAMPNK010000001.1 GCA946891905_00078 gene open 86794-88449
203 CAMPNK010000001.1 GCA946891905_00079 gene open 88553-89032 cbpB
204 CAMPNK010000001.1 GCA946891905_00083 gene open 89634-91451 dnaX
205 CAMPNK010000001.1 GCA946891905_00084 gene open 91467-91805
206 CAMPNK010000001.1 GCA946891905_00085 gene open 91805-92410 recR
207 CAMPNK010000001.1 GCA946891905_00086 gene open 92403-93386
208 CAMPNK010000001.1 GCA946891905_00087 gene open 93403-94800
209 CAMPNK010000001.1 GCA946891905_00088 gene open 95367-96428
210 CAMPNK010000001.1 GCA946891905_00089 gene open 96536-97075
211 CAMPNK010000001.1 GCA946891905_00090 gene open 97343-97870
212 CAMPNK010000001.1 GCA946891905_00091 gene open 97884-98294
213 CAMPNK010000001.1 GCA946891905_00092 gene open 98297-98512
214 CAMPNK010000001.1 GCA946891905_00093 gene open 98523-99008
215 CAMPNK010000001.1 GCA946891905_00094 gene open 99022-99486
216 CAMPNK010000001.1 GCA946891905_00095 gene open 99639-99779
217 CAMPNK010000001.1 GCA946891905_00096 gene open 99968-100174
218 CAMPNK010000001.1 GCA946891905_00097 gene open 100217-100345
219 CAMPNK010000001.1 GCA946891905_00098 gene open 100308-100541
220 CAMPNK010000001.1 GCA946891905_00099 gene open 100858-101229
221 CAMPNK010000001.1 GCA946891905_00100 gene open 101319-101663
222 CAMPNK010000001.1 GCA946891905_00101 gene open 101660-101845
223 CAMPNK010000001.1 GCA946891905_00102 gene open 101938-102120
224 CAMPNK010000001.1 GCA946891905_00103 gene open 102083-102742
225 CAMPNK010000001.1 GCA946891905_00104 gene open 102824-103009
226 CAMPNK010000001.1 GCA946891905_00105 gene open 103004-103510
227 CAMPNK010000001.1 GCA946891905_00106 gene open 103601-103888
228 CAMPNK010000001.1 GCA946891905_00107 gene open 103784-104119
229 CAMPNK010000001.1 GCA946891905_00108 gene open 104194-104391
230 CAMPNK010000001.1 GCA946891905_00109 gene open 104585-105100
231 CAMPNK010000001.1 GCA946891905_00110 gene open 105164-105349
232 CAMPNK010000001.1 GCA946891905_00111 gene open 105365-105829
233 CAMPNK010000001.1 GCA946891905_00112 gene open 105841-106038
234 CAMPNK010000001.1 GCA946891905_00113 gene open 106265-106831
235 CAMPNK010000001.1 GCA946891905_00114 gene open 107030-107848
236 CAMPNK010000001.1 GCA946891905_00115 gene open 108110-108478
237 CAMPNK010000001.1 GCA946891905_00116 gene open 108471-109019 recU
238 CAMPNK010000001.1 GCA946891905_00117 gene open 109022-109183
239 CAMPNK010000001.1 GCA946891905_00118 gene open 109156-109569 dut
240 CAMPNK010000001.1 GCA946891905_00119 gene open 109511-109723
241 CAMPNK010000001.1 GCA946891905_00120 gene open 109726-110166 rinA
242 CAMPNK010000001.1 GCA946891905_00121 gene open 110411-110743
243 CAMPNK010000001.1 GCA946891905_00122 gene open 110861-112117
244 CAMPNK010000001.1 GCA946891905_00026 gene open 28062-28137 trnT
245 CAMPNK010000001.1 GCA946891905_00082 gene open 89422-89514 trnS
246 CAMPNK010000001.1 GCA946891905_00026 tRNA open 28062-28137 trnT tRNA-Thr(cgt)
247 CAMPNK010000001.1 GCA946891905_00082 tRNA open 89422-89514 trnS tRNA-Ser(gga)
248 CAMPNK010000002.1 regulatory_region open 23999-24227 T-box leader
249 CAMPNK010000002.1 regulatory_region open 54488-54585 Purine riboswitch aptamer
250 CAMPNK010000002.1 GCA946891905_00123 CDS open 373-630 _na     85_aa Transposase IS204/IS1001/IS1096/IS1165 zinc-finger domain-containing protein
251 CAMPNK010000002.1 GCA946891905_00124 CDS open 970-3216 _na     748_aa pflB formate C-acetyltransferase
252 CAMPNK010000002.1 GCA946891905_00125 CDS open 3229-3948 _na     239_aa pflA pyruvate formate-lyase-activating protein
253 CAMPNK010000002.1 GCA946891905_00126 CDS open 3958-4632 _na     224_aa Cyclic nucleotide-binding domain protein
254 CAMPNK010000002.1 GCA946891905_00127 CDS open 4811-6049 _na     412_aa Branched-chain amino acid transport protein
255 CAMPNK010000002.1 GCA946891905_00128 CDS open 6354-7475 _na     373_aa Sortase B cell surface sorting signal
256 CAMPNK010000002.1 GCA946891905_00129 CDS open 7817-8503 _na     228_aa lldD Hydrolase
257 CAMPNK010000002.1 GCA946891905_00130 CDS open 8503-9426 _na     307_aa Peptidase family T4
258 CAMPNK010000002.1 GCA946891905_00131 CDS open 9925-10272 _na     115_aa lrgA LrgA family protein
259 CAMPNK010000002.1 GCA946891905_00132 CDS open 10274-11017 _na     247_aa TIGR00659 family protein
260 CAMPNK010000002.1 GCA946891905_00133 CDS open 11039-12232 _na     397_aa Arsenite-activated ATPase (ArsA)
261 CAMPNK010000002.1 GCA946891905_00134 CDS open 12213-13379 _na     388_aa Arsenite-activated ATPase (ArsA)
262 CAMPNK010000002.1 GCA946891905_00135 CDS open 13418-13966 _na     182_aa LUD domain-containing protein
263 CAMPNK010000002.1 GCA946891905_00136 CDS open 13998-16157 _na     719_aa ldhH L-lactate dehydrogenase (quinone) large subunit LdhH
264 CAMPNK010000002.1 GCA946891905_00137 CDS open 16160-17152 _na     330_aa Polyprenyl synthetase
265 CAMPNK010000002.1 GCA946891905_00138 CDS open 17170-18072 _na     300_aa ubiA Prenyltransferase%2C UbiA family
266 CAMPNK010000002.1 GCA946891905_00139 CDS open 18074-18763 _na     229_aa Demethylmenaquinone methyltransferase
267 CAMPNK010000002.1 GCA946891905_00140 CDS open 18791-20086 _na     431_aa FAD dependent oxidoreductase
268 CAMPNK010000002.1 GCA946891905_00141 CDS open 20086-20370 _na     94_aa fixX Ferredoxin-like protein FixX family protein
269 CAMPNK010000002.1 GCA946891905_00142 CDS open 20651-20935 _na     94_aa rpsF 30S ribosomal protein S6
270 CAMPNK010000002.1 GCA946891905_00143 CDS open 20939-21469 _na     176_aa Single-stranded DNA-binding protein
271 CAMPNK010000002.1 GCA946891905_00144 CDS open 21488-21715 _na     75_aa rpsR 30S ribosomal protein S18
272 CAMPNK010000002.1 GCA946891905_00145 CDS open 21969-23933 _na     654_aa oVP1 sodium-translocating pyrophosphatase
273 CAMPNK010000002.1 GCA946891905_00146 CDS open 24321-25544 _na     407_aa argininosuccinate synthase
274 CAMPNK010000002.1 GCA946891905_00147 CDS open 25553-26932 _na     459_aa argH argininosuccinate lyase
275 CAMPNK010000002.1 GCA946891905_00148 CDS open 26929-28404 _na     491_aa ABC transporter%2C permease protein
276 CAMPNK010000002.1 GCA946891905_00149 CDS open 28397-29122 _na     241_aa glnQ ABC transporter related
277 CAMPNK010000002.1 GCA946891905_00151 CDS open 29537-29764 _na     75_aa relB type II toxin-antitoxin system RelB family antitoxin
278 CAMPNK010000002.1 GCA946891905_00152 CDS open 29754-30020 _na     88_aa Addiction module toxin%2C RelE/StbE family
279 CAMPNK010000002.1 GCA946891905_00153 CDS open 30218-31054 _na     278_aa ispE 4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase
280 CAMPNK010000002.1 GCA946891905_00154 CDS open 31047-31799 _na     250_aa murI glutamate racemase
281 CAMPNK010000002.1 GCA946891905_00155 CDS open 31796-32701 _na     301_aa Ppx/GppA phosphatase family protein
282 CAMPNK010000002.1 GCA946891905_00156 CDS open 32703-34901 _na     732_aa RNA degradosome polyphosphate kinase
283 CAMPNK010000002.1 GCA946891905_00157 CDS open 35227-36225 _na     332_aa Serine-type D-Ala-D-Ala carboxypeptidase
284 CAMPNK010000002.1 GCA946891905_00158 CDS open 36291-36662 _na     123_aa Putative endoribonuclease L-PSP
285 CAMPNK010000002.1 GCA946891905_00159 CDS open 36719-37906 _na     395_aa Amidohydrolase
286 CAMPNK010000002.1 GCA946891905_00160 CDS open 38215-39051 _na     278_aa S-adenosyl-l-methionine hydroxide adenosyltransferase
287 CAMPNK010000002.1 GCA946891905_00161 CDS open 39051-39602 _na     183_aa ECF-type riboflavin transporter substrate-binding protein
288 CAMPNK010000002.1 GCA946891905_00162 CDS open 39604-41322 _na     572_aa energy-coupling factor transporter ATPase
289 CAMPNK010000002.1 GCA946891905_00163 CDS open 41315-42142 _na     275_aa Cobalt transport protein
290 CAMPNK010000002.1 GCA946891905_00164 CDS open 42288-43655 _na     455_aa Aldehyde dehydrogenase
291 CAMPNK010000002.1 GCA946891905_00165 CDS open 44136-50765 _na     2209_aa LPXTG-motif cell wall anchor domain protein
292 CAMPNK010000002.1 GCA946891905_00166 CDS open 50946-52160 _na     404_aa norV Beta-lactamase domain protein
293 CAMPNK010000002.1 GCA946891905_00167 CDS open 52417-54102 _na     561_aa Electron transfer flavoprotein FAD-binding domain protein
294 CAMPNK010000002.1 GCA946891905_00168 CDS open 54647-56062 _na     471_aa Putative permease
295 CAMPNK010000002.1 GCA946891905_00169 CDS open 56071-57342 _na     423_aa Putative guanine deaminase
296 CAMPNK010000002.1 GCA946891905_00170 CDS open 57361-57879 _na     172_aa Nucleoside 2-deoxyribosyltransferase
297 CAMPNK010000002.1 GCA946891905_00171 CDS open 57965-59767 _na     600_aa NAD(+) synthase
298 CAMPNK010000002.1 GCA946891905_00173 CDS open 61068-61334 _na     88_aa relE Addiction module toxin%2C RelE/StbE family
299 CAMPNK010000002.1 GCA946891905_00174 CDS open 61334-61591 _na     85_aa abrB Transcriptional regulator%2C AbrB family
300 CAMPNK010000002.1 GCA946891905_00175 CDS open 61835-61942 _na     35_aa hypothetical protein
301 CAMPNK010000002.1 GCA946891905_00176 CDS open 61978-62148 _na     56_aa HNH nuclease domain-containing protein
302 CAMPNK010000002.1 GCA946891905_00177 CDS open 62126-62413 _na     95_aa hypothetical protein
303 CAMPNK010000002.1 GCA946891905_00178 CDS open 62942-63076 _na     44_aa hypothetical protein
304 CAMPNK010000002.1 GCA946891905_00179 CDS open 63073-63492 _na     139_aa Transcriptional regulator%2C Fur family
305 CAMPNK010000002.1 GCA946891905_00180 CDS open 63593-64678 _na     361_aa ABC transporter%2C substrate-binding protein
306 CAMPNK010000002.1 GCA946891905_00181 CDS open 64823-65488 _na     221_aa ABC transporter%2C ATP-binding protein
307 CAMPNK010000002.1 GCA946891905_00182 CDS open 65481-66290 _na     269_aa ABC 3 transport family protein
308 CAMPNK010000002.1 GCA946891905_00183 CDS open 66346-67020 _na     224_aa NYN domain-containing protein
309 CAMPNK010000002.1 GCA946891905_00184 CDS open 67243-67965 _na     240_aa UPF0246 protein HMPREF3200_00948
310 CAMPNK010000002.1 GCA946891905_00185 CDS open 67962-69074 _na     370_aa Nuclease SbcCD subunit D
311 CAMPNK010000002.1 GCA946891905_00186 CDS open 69056-72091 _na     1011_aa Nuclease SbcCD subunit C
312 CAMPNK010000002.1 GCA946891905_00187 CDS open 72088-75450 _na     1120_aa Putative ATP-dependent nuclease subunit B
313 CAMPNK010000002.1 GCA946891905_00188 CDS open 75443-78808 _na     1121_aa addA helicase-exonuclease AddAB subunit AddA
314 CAMPNK010000002.1 GCA946891905_00189 CDS open 79173-80612 _na     479_aa Cell envelope-like function transcriptional attenuator common domain protein
315 CAMPNK010000002.1 GCA946891905_00190 CDS open 81554-83056 _na     500_aa murJ murein biosynthesis integral membrane protein MurJ
316 CAMPNK010000002.1 GCA946891905_00191 CDS open 83060-85021 _na     653_aa Polysaccharide biosynthesis protein
317 CAMPNK010000002.1 GCA946891905_00192 CDS open 85023-86225 _na     400_aa wecE DegT/DnrJ/EryC1/StrS aminotransferase
318 CAMPNK010000002.1 GCA946891905_00193 CDS open 86228-86920 _na     230_aa sugar transferase
319 CAMPNK010000002.1 GCA946891905_00194 CDS open 86941-87561 _na     206_aa N-acetyltransferase
320 CAMPNK010000002.1 GCA946891905_00195 CDS open 87727-88857 _na     376_aa glycosyltransferase family 4 protein
321 CAMPNK010000002.1 GCA946891905_00196 CDS open 88850-89953 _na     367_aa glycosyltransferase family 1 protein
322 CAMPNK010000002.1 GCA946891905_00197 CDS open 89946-90656 _na     236_aa DUF2334 domain-containing protein
323 CAMPNK010000002.1 GCA946891905_00198 CDS open 90674-91765 _na     363_aa glycosyltransferase family 4 protein
324 CAMPNK010000002.1 GCA946891905_00199 CDS open 91797-92861 _na     354_aa epsG EpsG family protein
325 CAMPNK010000002.1 GCA946891905_00200 CDS open 92915-93826 _na     303_aa ATP-grasp fold amidoligase family protein
326 CAMPNK010000002.1 GCA946891905_00201 CDS open 94056-94271 _na     71_aa hypothetical protein
327 CAMPNK010000002.1 GCA946891905_00202 CDS open 94275-94544 _na     89_aa serine O-acetyltransferase
328 CAMPNK010000002.1 GCA946891905_00203 CDS open 94531-95985 _na     484_aa flippase
329 CAMPNK010000002.1 GCA946891905_00204 CDS open 96042-97127 _na     361_aa NAD-dependent epimerase/dehydratase family protein
330 CAMPNK010000002.1 GCA946891905_00205 CDS open 97162-98688 _na     508_aa hypothetical protein
331 CAMPNK010000002.1 GCA946891905_00206 CDS open 98694-100163 _na     489_aa UDP-glucose 6-dehydrogenase
332 CAMPNK010000002.1 GCA946891905_00207 CDS open 100740-101288 _na     182_aa RNA polymerase sigma factor%2C sigma-70 family
333 CAMPNK010000002.1 GCA946891905_00208 CDS open 101667-101804 _na     45_aa yvrJ YvrJ family protein
334 CAMPNK010000002.1 GCA946891905_00209 CDS open 101825-102514 _na     229_aa SH3 domain protein
335 CAMPNK010000002.1 GCA946891905_00123 gene open 373-630
336 CAMPNK010000002.1 GCA946891905_00124 gene open 970-3216 pflB
337 CAMPNK010000002.1 GCA946891905_00125 gene open 3229-3948 pflA
338 CAMPNK010000002.1 GCA946891905_00126 gene open 3958-4632
339 CAMPNK010000002.1 GCA946891905_00127 gene open 4811-6049
340 CAMPNK010000002.1 GCA946891905_00128 gene open 6354-7475
341 CAMPNK010000002.1 GCA946891905_00129 gene open 7817-8503 lldD
342 CAMPNK010000002.1 GCA946891905_00130 gene open 8503-9426
343 CAMPNK010000002.1 GCA946891905_00131 gene open 9925-10272 lrgA
344 CAMPNK010000002.1 GCA946891905_00132 gene open 10274-11017
345 CAMPNK010000002.1 GCA946891905_00133 gene open 11039-12232
346 CAMPNK010000002.1 GCA946891905_00134 gene open 12213-13379
347 CAMPNK010000002.1 GCA946891905_00135 gene open 13418-13966
348 CAMPNK010000002.1 GCA946891905_00136 gene open 13998-16157 ldhH
349 CAMPNK010000002.1 GCA946891905_00137 gene open 16160-17152
350 CAMPNK010000002.1 GCA946891905_00138 gene open 17170-18072 ubiA
351 CAMPNK010000002.1 GCA946891905_00139 gene open 18074-18763
352 CAMPNK010000002.1 GCA946891905_00140 gene open 18791-20086
353 CAMPNK010000002.1 GCA946891905_00141 gene open 20086-20370 fixX
354 CAMPNK010000002.1 GCA946891905_00142 gene open 20651-20935 rpsF
355 CAMPNK010000002.1 GCA946891905_00143 gene open 20939-21469
356 CAMPNK010000002.1 GCA946891905_00144 gene open 21488-21715 rpsR
357 CAMPNK010000002.1 GCA946891905_00145 gene open 21969-23933 oVP1
358 CAMPNK010000002.1 GCA946891905_00146 gene open 24321-25544
359 CAMPNK010000002.1 GCA946891905_00147 gene open 25553-26932 argH
360 CAMPNK010000002.1 GCA946891905_00148 gene open 26929-28404
361 CAMPNK010000002.1 GCA946891905_00149 gene open 28397-29122 glnQ
362 CAMPNK010000002.1 GCA946891905_00151 gene open 29537-29764 relB
363 CAMPNK010000002.1 GCA946891905_00152 gene open 29754-30020
364 CAMPNK010000002.1 GCA946891905_00153 gene open 30218-31054 ispE
365 CAMPNK010000002.1 GCA946891905_00154 gene open 31047-31799 murI
366 CAMPNK010000002.1 GCA946891905_00155 gene open 31796-32701
367 CAMPNK010000002.1 GCA946891905_00156 gene open 32703-34901
368 CAMPNK010000002.1 GCA946891905_00157 gene open 35227-36225
369 CAMPNK010000002.1 GCA946891905_00158 gene open 36291-36662
370 CAMPNK010000002.1 GCA946891905_00159 gene open 36719-37906
371 CAMPNK010000002.1 GCA946891905_00160 gene open 38215-39051
372 CAMPNK010000002.1 GCA946891905_00161 gene open 39051-39602
373 CAMPNK010000002.1 GCA946891905_00162 gene open 39604-41322
374 CAMPNK010000002.1 GCA946891905_00163 gene open 41315-42142
375 CAMPNK010000002.1 GCA946891905_00164 gene open 42288-43655
376 CAMPNK010000002.1 GCA946891905_00165 gene open 44136-50765
377 CAMPNK010000002.1 GCA946891905_00166 gene open 50946-52160 norV
378 CAMPNK010000002.1 GCA946891905_00167 gene open 52417-54102
379 CAMPNK010000002.1 GCA946891905_00168 gene open 54647-56062
380 CAMPNK010000002.1 GCA946891905_00169 gene open 56071-57342
381 CAMPNK010000002.1 GCA946891905_00170 gene open 57361-57879
382 CAMPNK010000002.1 GCA946891905_00171 gene open 57965-59767
383 CAMPNK010000002.1 GCA946891905_00173 gene open 61068-61334 relE
384 CAMPNK010000002.1 GCA946891905_00174 gene open 61334-61591 abrB
385 CAMPNK010000002.1 GCA946891905_00175 gene open 61835-61942
386 CAMPNK010000002.1 GCA946891905_00176 gene open 61978-62148
387 CAMPNK010000002.1 GCA946891905_00177 gene open 62126-62413
388 CAMPNK010000002.1 GCA946891905_00178 gene open 62942-63076
389 CAMPNK010000002.1 GCA946891905_00179 gene open 63073-63492
390 CAMPNK010000002.1 GCA946891905_00180 gene open 63593-64678
391 CAMPNK010000002.1 GCA946891905_00181 gene open 64823-65488
392 CAMPNK010000002.1 GCA946891905_00182 gene open 65481-66290
393 CAMPNK010000002.1 GCA946891905_00183 gene open 66346-67020
394 CAMPNK010000002.1 GCA946891905_00184 gene open 67243-67965
395 CAMPNK010000002.1 GCA946891905_00185 gene open 67962-69074
396 CAMPNK010000002.1 GCA946891905_00186 gene open 69056-72091
397 CAMPNK010000002.1 GCA946891905_00187 gene open 72088-75450
398 CAMPNK010000002.1 GCA946891905_00188 gene open 75443-78808 addA
399 CAMPNK010000002.1 GCA946891905_00189 gene open 79173-80612
400 CAMPNK010000002.1 GCA946891905_00190 gene open 81554-83056 murJ
401 CAMPNK010000002.1 GCA946891905_00191 gene open 83060-85021
402 CAMPNK010000002.1 GCA946891905_00192 gene open 85023-86225 wecE
403 CAMPNK010000002.1 GCA946891905_00193 gene open 86228-86920
404 CAMPNK010000002.1 GCA946891905_00194 gene open 86941-87561
405 CAMPNK010000002.1 GCA946891905_00195 gene open 87727-88857
406 CAMPNK010000002.1 GCA946891905_00196 gene open 88850-89953
407 CAMPNK010000002.1 GCA946891905_00197 gene open 89946-90656
408 CAMPNK010000002.1 GCA946891905_00198 gene open 90674-91765
409 CAMPNK010000002.1 GCA946891905_00199 gene open 91797-92861 epsG
410 CAMPNK010000002.1 GCA946891905_00200 gene open 92915-93826
411 CAMPNK010000002.1 GCA946891905_00201 gene open 94056-94271
412 CAMPNK010000002.1 GCA946891905_00202 gene open 94275-94544
413 CAMPNK010000002.1 GCA946891905_00203 gene open 94531-95985
414 CAMPNK010000002.1 GCA946891905_00204 gene open 96042-97127
415 CAMPNK010000002.1 GCA946891905_00205 gene open 97162-98688
416 CAMPNK010000002.1 GCA946891905_00206 gene open 98694-100163
417 CAMPNK010000002.1 GCA946891905_00207 gene open 100740-101288
418 CAMPNK010000002.1 GCA946891905_00208 gene open 101667-101804 yvrJ
419 CAMPNK010000002.1 GCA946891905_00209 gene open 101825-102514
420 CAMPNK010000002.1 GCA946891905_00150 gene open 29175-29265 trnL
421 CAMPNK010000002.1 GCA946891905_00172 gene open 60549-60622 trnR
422 CAMPNK010000002.1 GCA946891905_00150 tRNA open 29175-29265 trnL tRNA-Leu(aag)
423 CAMPNK010000002.1 GCA946891905_00172 tRNA open 60549-60622 trnR tRNA-Arg(ccg)
424 CAMPNK010000003.1 regulatory_region open 51112-51341 T-box leader
425 CAMPNK010000003.1 GCA946891905_00210 CDS open 207-542 _na     111_aa Nitrous oxide-stimulated promoter
426 CAMPNK010000003.1 GCA946891905_00211 CDS open 565-759 _na     64_aa PTS ascorbate transporter subunit IIC
427 CAMPNK010000003.1 GCA946891905_00212 CDS open 759-1823 _na     354_aa SPFH/Band 7/PHB domain protein
428 CAMPNK010000003.1 GCA946891905_00213 CDS open 1960-2733 _na     257_aa Serine aminopeptidase S33 domain-containing protein
429 CAMPNK010000003.1 GCA946891905_00214 CDS open 2730-3275 _na     181_aa Putative rRNA methylase
430 CAMPNK010000003.1 GCA946891905_00215 CDS open 3307-4170 _na     287_aa DNA-binding helix-turn-helix protein
431 CAMPNK010000003.1 GCA946891905_00216 CDS open 4285-4416 _na     43_aa hypothetical protein
432 CAMPNK010000003.1 GCA946891905_00217 CDS open 4535-4657 _na     40_aa hypothetical protein
433 CAMPNK010000003.1 GCA946891905_00218 CDS open 4823-6160 _na     445_aa Radical SAM domain protein
434 CAMPNK010000003.1 GCA946891905_00219 CDS open 6163-6720 _na     185_aa Flagellin N-methylase
435 CAMPNK010000003.1 GCA946891905_00220 CDS open 7003-8544 _na     513_aa ABC transporter%2C ATP-binding protein
436 CAMPNK010000003.1 GCA946891905_00221 CDS open 8531-9946 _na     471_aa hypothetical protein
437 CAMPNK010000003.1 GCA946891905_00222 CDS open 10135-10854 _na     239_aa ABC transporter%2C ATP-binding protein
438 CAMPNK010000003.1 GCA946891905_00223 CDS open 11059-11856 _na     265_aa Cof-like hydrolase
439 CAMPNK010000003.1 GCA946891905_00224 CDS open 11856-12665 _na     269_aa Cof-like hydrolase
440 CAMPNK010000003.1 GCA946891905_00225 CDS open 12892-13422 _na     176_aa PTS system%2C glucose subfamily%2C IIA component
441 CAMPNK010000003.1 GCA946891905_00226 CDS open 13574-15190 _na     538_aa hcp hydroxylamine reductase
442 CAMPNK010000003.1 GCA946891905_00227 CDS open 15425-16603 _na     392_aa Amidohydrolase
443 CAMPNK010000003.1 GCA946891905_00228 CDS open 16693-17226 _na     177_aa DUF4367 domain-containing protein
444 CAMPNK010000003.1 GCA946891905_00229 CDS open 17294-17833 _na     179_aa immA IrrE N-terminal-like domain-containing protein
445 CAMPNK010000003.1 GCA946891905_00230 CDS open 17833-18222 _na     129_aa hipB Transcriptional regulator%2C XRE family
446 CAMPNK010000003.1 GCA946891905_00231 CDS open 18358-19599 _na     413_aa DNA polymerase IV
447 CAMPNK010000003.1 GCA946891905_00232 CDS open 19695-20072 _na     125_aa gntR Transcriptional regulator%2C GntR family
448 CAMPNK010000003.1 GCA946891905_00233 CDS open 20065-21147 _na     360_aa DUF5808 domain-containing protein
449 CAMPNK010000003.1 GCA946891905_00234 CDS open 21170-22060 _na     296_aa ABC transporter%2C ATP-binding protein
450 CAMPNK010000003.1 GCA946891905_00235 CDS open 22053-23231 _na     392_aa ABC-2 type transporter transmembrane domain-containing protein
451 CAMPNK010000003.1 GCA946891905_00236 CDS open 23304-24458 _na     384_aa Putative NAD-dependent malic enzyme
452 CAMPNK010000003.1 GCA946891905_00237 CDS open 24549-24899 _na     116_aa lysR Transcriptional regulator%2C LysR family
453 CAMPNK010000003.1 GCA946891905_00238 CDS open 25049-25870 _na     273_aa Cof-like hydrolase
454 CAMPNK010000003.1 GCA946891905_00239 CDS open 25863-26654 _na     263_aa Metallo-beta-lactamase domain protein
455 CAMPNK010000003.1 GCA946891905_00240 CDS open 26654-27463 _na     269_aa ttcA PP-loop family protein
456 CAMPNK010000003.1 GCA946891905_00241 CDS open 27460-28341 _na     293_aa undecaprenyl-diphosphate phosphatase
457 CAMPNK010000003.1 GCA946891905_00242 CDS open 28343-28885 _na     180_aa DNA-3-methyladenine glycosylase I
458 CAMPNK010000003.1 GCA946891905_00243 CDS open 28947-30557 _na     536_aa Glucan 1%2C6-alpha-glucosidase
459 CAMPNK010000003.1 GCA946891905_00244 CDS open 30597-31775 _na     392_aa gltS sodium/glutamate symporter
460 CAMPNK010000003.1 GCA946891905_00245 CDS open 31910-33052 _na     380_aa Glycosyltransferase%2C group 2 family protein
461 CAMPNK010000003.1 GCA946891905_00246 CDS open 33055-33834 _na     259_aa Glycosyltransferase 2-like domain-containing protein
462 CAMPNK010000003.1 GCA946891905_00247 CDS open 33836-34795 _na     319_aa Chain length determinant protein
463 CAMPNK010000003.1 GCA946891905_00248 CDS open 34788-35447 _na     219_aa AAA domain-containing protein
464 CAMPNK010000003.1 GCA946891905_00249 CDS open 35447-35905 _na     152_aa SH3 domain protein
465 CAMPNK010000003.1 GCA946891905_00250 CDS open 36053-36334 _na     93_aa hypothetical protein
466 CAMPNK010000003.1 GCA946891905_00251 CDS open 36494-37585 _na     363_aa FMN-binding domain-containing protein
467 CAMPNK010000003.1 GCA946891905_00252 CDS open 37796-39001 _na     401_aa Arginine deiminase
468 CAMPNK010000003.1 GCA946891905_00253 CDS open 39131-39325 _na     64_aa ytxH YtxH domain-containing protein
469 CAMPNK010000003.1 GCA946891905_00254 CDS open 39459-40724 _na     421_aa uraA uracil permease
470 CAMPNK010000003.1 GCA946891905_00255 CDS open 40834-41001 _na     55_aa Glycine transporter domain-containing protein
471 CAMPNK010000003.1 GCA946891905_00256 CDS open 41129-41671 _na     180_aa DUF5667 domain-containing protein
472 CAMPNK010000003.1 GCA946891905_00257 CDS open 41683-42726 _na     347_aa hypothetical protein
473 CAMPNK010000003.1 GCA946891905_00258 CDS open 42914-44119 _na     401_aa Peptidase%2C S41 family
474 CAMPNK010000003.1 GCA946891905_00259 CDS open 44135-45493 _na     452_aa mgtE magnesium transporter
475 CAMPNK010000003.1 GCA946891905_00260 CDS open 45519-46214 _na     231_aa Acyl-ACP thioesterase
476 CAMPNK010000003.1 GCA946891905_00261 CDS open 46207-46824 _na     205_aa hypothetical protein
477 CAMPNK010000003.1 GCA946891905_00262 CDS open 46979-47236 _na     85_aa DUF1450 domain-containing protein
478 CAMPNK010000003.1 GCA946891905_00263 CDS open 47243-48286 _na     347_aa hydE [FeFe] hydrogenase H-cluster radical SAM maturase HydE
479 CAMPNK010000003.1 GCA946891905_00264 CDS open 48344-49492 _na     382_aa hydF [FeFe] hydrogenase H-cluster maturation GTPase HydF
480 CAMPNK010000003.1 GCA946891905_00265 CDS open 49494-50912 _na     472_aa hydG [FeFe] hydrogenase H-cluster radical SAM maturase HydG
481 CAMPNK010000003.1 GCA946891905_00266 CDS open 51078-51212 _na     44_aa hypothetical protein
482 CAMPNK010000003.1 GCA946891905_00267 CDS open 51393-52424 _na     343_aa ABC transporter%2C ATP-binding protein
483 CAMPNK010000003.1 GCA946891905_00268 CDS open 52411-53076 _na     221_aa metI D-methionine transport system permease protein MetI
484 CAMPNK010000003.1 GCA946891905_00269 CDS open 53146-54033 _na     295_aa Lipoprotein
485 CAMPNK010000003.1 GCA946891905_00270 CDS open 54233-54709 _na     158_aa btuE Glutathione peroxidase
486 CAMPNK010000003.1 GCA946891905_00271 CDS open 54713-55198 _na     161_aa AMMECR1 domain-containing protein
487 CAMPNK010000003.1 GCA946891905_00272 CDS open 55478-58591 _na     1037_aa ileS isoleucine--tRNA ligase
488 CAMPNK010000003.1 GCA946891905_00273 CDS open 58723-58842 _na     39_aa hypothetical protein
489 CAMPNK010000003.1 GCA946891905_00274 CDS open 59072-60163 _na     363_aa eamA EamA domain-containing protein
490 CAMPNK010000003.1 GCA946891905_00275 CDS open 60163-60426 _na     87_aa yjcQ YjcQ protein
491 CAMPNK010000003.1 GCA946891905_00276 CDS open 60435-60728 _na     97_aa BMC domain protein
492 CAMPNK010000003.1 GCA946891905_00277 CDS open 60737-61027 _na     96_aa BMC domain protein
493 CAMPNK010000003.1 GCA946891905_00278 CDS open 61038-62471 _na     477_aa Aldehyde dehydrogenase domain-containing protein
494 CAMPNK010000003.1 GCA946891905_00279 CDS open 62480-65029 _na     849_aa cutC choline trimethylamine-lyase
495 CAMPNK010000003.1 GCA946891905_00280 CDS open 65047-66009 _na     320_aa cutD choline TMA-lyase-activating enzyme
496 CAMPNK010000003.1 GCA946891905_00281 CDS open 66018-66356 _na     112_aa BMC domain protein
497 CAMPNK010000003.1 GCA946891905_00282 CDS open 66353-66808 _na     151_aa eutP Ethanolamine utilization protein%2C EutP
498 CAMPNK010000003.1 GCA946891905_00283 CDS open 66796-67344 _na     182_aa Cobalamin adenosyltransferase
499 CAMPNK010000003.1 GCA946891905_00284 CDS open 67469-68170 _na     233_aa eutJ ethanolamine utilization protein EutJ
500 CAMPNK010000003.1 GCA946891905_00285 CDS open 68174-68467 _na     97_aa BMC domain protein