HOMD Banner
Taxonomy: V4.3   |  16S rRNA RefSeq: V16.03   |  Genomic RefSeq: V11.03   |  Viruses: V1.2

BAKTAGenome Explorer: Lachnocurva vaginae (GCA_946891925.1)

Select a Genome:
BAKTA Annotations for GCA_946891925.1
Genome Selected: Lachnocurva vaginae
ContigsBases CDSrRNA tmRNAtRNA
30 1504372 1369 0 1 40
[Table]   [AA Fasta]      [Browser]   [Text]   [Excel]  
Search & Sort all 2845 Records
Search These Records: Clear
Sort Column:   Molecule   PID   NA   AA   Gene  Gene Product  Reverse
Annotation Table [page:6]    |    Number of Records Found: 2845 [6 Pages]    |    Previous Page <==> Next Page    |    Jump to Page: [ 1  2  3  4  5  6  ]
Notes:   1- Column headers only sort the current page. 2- Select [NA] or [AA] links to show sequences.
Region Protein-ID Type Genome
Viewer		 Range
(bp)		 Show Sequences
(length) NA / AA		 BAKTA
Gene		 BAKTA
GeneProduct
2501 CAMPNI010000013.1 GCA946891925_01245 gene open 39298-40041
2502 CAMPNI010000013.1 GCA946891925_01246 gene open 40119-40526
2503 CAMPNI010000013.1 GCA946891925_01247 gene open 40608-42293 flgE
2504 CAMPNI010000014.1 GCA946891925_01258 gene open 15359-15452 tracrRNA
2505 CAMPNI010000014.1 GCA946891925_01258 ncRNA open 15359-15452 Trans-activating crRNA
2506 CAMPNI010000014.1 repeat_region open 8534-9305 CRISPR array with 9 repeats of length 36%2C consensus sequence GTTTTAGTCCTATTCAAAACAACACAGTTATAAAAC and spacer length 54
2507 CAMPNI010000014.1 repeat_region open 9062-9305 CRISPR array with 4 repeats of length 36%2C consensus sequence GTTTTAGTCCTATTCAAAACAACACAGTTATAAAAC and spacer length 30
2508 CAMPNI010000014.1 GCA946891925_01248 CDS open 1094-1726 _na     210_aa xrtG Exosortase family protein XrtG
2509 CAMPNI010000014.1 GCA946891925_01249 CDS open 2117-3931 _na     604_aa hypothetical protein
2510 CAMPNI010000014.1 GCA946891925_01250 CDS open 4011-4664 _na     217_aa Glutamate racemase
2511 CAMPNI010000014.1 GCA946891925_01251 CDS open 4836-6317 _na     493_aa Flagellin
2512 CAMPNI010000014.1 GCA946891925_01252 CDS open 6663-7220 _na     185_aa Nicotinamidase
2513 CAMPNI010000014.1 GCA946891925_01253 CDS open 7930-8247 _na     105_aa hypothetical protein
2514 CAMPNI010000014.1 GCA946891925_01254 CDS open 9400-10065 _na     221_aa hypothetical protein
2515 CAMPNI010000014.1 GCA946891925_01255 CDS open 10058-10378 _na     106_aa CRISPR-associated endoribonuclease Cas2
2516 CAMPNI010000014.1 GCA946891925_01256 CDS open 10390-11256 _na     288_aa CRISPR-associated endonuclease Cas1
2517 CAMPNI010000014.1 GCA946891925_01257 CDS open 11257-15297 _na     1346_aa CRISPR-associated endonuclease Cas9
2518 CAMPNI010000014.1 GCA946891925_01259 CDS open 15781-15999 _na     72_aa hypothetical protein
2519 CAMPNI010000014.1 GCA946891925_01266 CDS open 16850-17329 _na     159_aa hypothetical protein
2520 CAMPNI010000014.1 GCA946891925_01267 CDS open 17537-18142 _na     201_aa dITP/XTP pyrophosphatase
2521 CAMPNI010000014.1 GCA946891925_01268 CDS open 18165-19190 _na     341_aa hypothetical protein
2522 CAMPNI010000014.1 GCA946891925_01269 CDS open 19174-20859 _na     561_aa hypothetical protein
2523 CAMPNI010000014.1 GCA946891925_01270 CDS open 20944-22092 _na     382_aa THUMP domain-containing protein
2524 CAMPNI010000014.1 GCA946891925_01271 CDS open 22221-22706 _na     161_aa Cys-tRNA(Pro)/Cys-tRNA(Cys) deacylase
2525 CAMPNI010000014.1 GCA946891925_01272 CDS open 22809-23447 _na     212_aa hypothetical protein
2526 CAMPNI010000014.1 GCA946891925_01273 CDS open 23583-24536 _na     317_aa Proline iminopeptidase
2527 CAMPNI010000014.1 GCA946891925_01274 CDS open 24528-26147 _na     539_aa Site-specific recombinase
2528 CAMPNI010000014.1 GCA946891925_01275 CDS open 26226-26387 _na     53_aa recR Recombinase RecR
2529 CAMPNI010000014.1 GCA946891925_01276 CDS open 26448-27293 _na     281_aa Putative DNA replication protein
2530 CAMPNI010000014.1 GCA946891925_01277 CDS open 27425-28147 _na     240_aa Replisome organizer
2531 CAMPNI010000014.1 GCA946891925_01278 CDS open 28235-29284 _na     349_aa KilA-N DNA-binding domain-containing protein
2532 CAMPNI010000014.1 GCA946891925_01279 CDS open 29385-31091 _na     568_aa mobQ MobQ family relaxase
2533 CAMPNI010000014.1 GCA946891925_01280 CDS open 31499-31909 _na     136_aa PF12958 family protein
2534 CAMPNI010000014.1 GCA946891925_01281 CDS open 32000-32227 _na     75_aa hypothetical protein
2535 CAMPNI010000014.1 GCA946891925_01248 gene open 1094-1726 xrtG
2536 CAMPNI010000014.1 GCA946891925_01249 gene open 2117-3931
2537 CAMPNI010000014.1 GCA946891925_01250 gene open 4011-4664
2538 CAMPNI010000014.1 GCA946891925_01251 gene open 4836-6317
2539 CAMPNI010000014.1 GCA946891925_01252 gene open 6663-7220
2540 CAMPNI010000014.1 GCA946891925_01253 gene open 7930-8247
2541 CAMPNI010000014.1 GCA946891925_01254 gene open 9400-10065
2542 CAMPNI010000014.1 GCA946891925_01255 gene open 10058-10378
2543 CAMPNI010000014.1 GCA946891925_01256 gene open 10390-11256
2544 CAMPNI010000014.1 GCA946891925_01257 gene open 11257-15297
2545 CAMPNI010000014.1 GCA946891925_01259 gene open 15781-15999
2546 CAMPNI010000014.1 GCA946891925_01266 gene open 16850-17329
2547 CAMPNI010000014.1 GCA946891925_01267 gene open 17537-18142
2548 CAMPNI010000014.1 GCA946891925_01268 gene open 18165-19190
2549 CAMPNI010000014.1 GCA946891925_01269 gene open 19174-20859
2550 CAMPNI010000014.1 GCA946891925_01270 gene open 20944-22092
2551 CAMPNI010000014.1 GCA946891925_01271 gene open 22221-22706
2552 CAMPNI010000014.1 GCA946891925_01272 gene open 22809-23447
2553 CAMPNI010000014.1 GCA946891925_01273 gene open 23583-24536
2554 CAMPNI010000014.1 GCA946891925_01274 gene open 24528-26147
2555 CAMPNI010000014.1 GCA946891925_01275 gene open 26226-26387 recR
2556 CAMPNI010000014.1 GCA946891925_01276 gene open 26448-27293
2557 CAMPNI010000014.1 GCA946891925_01277 gene open 27425-28147
2558 CAMPNI010000014.1 GCA946891925_01278 gene open 28235-29284
2559 CAMPNI010000014.1 GCA946891925_01279 gene open 29385-31091 mobQ
2560 CAMPNI010000014.1 GCA946891925_01280 gene open 31499-31909
2561 CAMPNI010000014.1 GCA946891925_01281 gene open 32000-32227
2562 CAMPNI010000014.1 GCA946891925_01260 gene open 16080-16152 trnK
2563 CAMPNI010000014.1 GCA946891925_01261 gene open 16181-16252 trnQ
2564 CAMPNI010000014.1 GCA946891925_01262 gene open 16280-16353 trnH
2565 CAMPNI010000014.1 GCA946891925_01263 gene open 16359-16432 trnR
2566 CAMPNI010000014.1 GCA946891925_01264 gene open 16438-16508 trnG
2567 CAMPNI010000014.1 GCA946891925_01265 gene open 16524-16598 trnP
2568 CAMPNI010000014.1 GCA946891925_01260 tRNA open 16080-16152 trnK tRNA-Lys(ttt)
2569 CAMPNI010000014.1 GCA946891925_01261 tRNA open 16181-16252 trnQ tRNA-Gln(ttg)
2570 CAMPNI010000014.1 GCA946891925_01262 tRNA open 16280-16353 trnH tRNA-His(gtg)
2571 CAMPNI010000014.1 GCA946891925_01263 tRNA open 16359-16432 trnR tRNA-Arg(tct)
2572 CAMPNI010000014.1 GCA946891925_01264 tRNA open 16438-16508 trnG tRNA-Gly(tcc)
2573 CAMPNI010000014.1 GCA946891925_01265 tRNA open 16524-16598 trnP tRNA-Pro(tgg)
2574 CAMPNI010000015.1 GCA946891925_01282 CDS open 161-1453 _na     430_aa RCK C-terminal domain-containing protein
2575 CAMPNI010000015.1 GCA946891925_01283 CDS open 1726-3249 _na     507_aa hypothetical protein
2576 CAMPNI010000015.1 GCA946891925_01284 CDS open 3300-3449 _na     49_aa Six-cysteine ranthipeptide SCIFF
2577 CAMPNI010000015.1 GCA946891925_01285 CDS open 3549-4955 _na     468_aa Thioether cross-link-forming SCIFF peptide maturase
2578 CAMPNI010000015.1 GCA946891925_01286 CDS open 5171-7789 _na     872_aa Aldehyde-alcohol dehydrogenase
2579 CAMPNI010000015.1 GCA946891925_01287 CDS open 7808-8563 _na     251_aa Phosphotransferase enzyme family protein
2580 CAMPNI010000015.1 GCA946891925_01288 CDS open 8881-9960 _na     359_aa hypothetical protein
2581 CAMPNI010000015.1 GCA946891925_01289 CDS open 10153-11244 _na     363_aa Phosphotransferase system EIIC domain-containing protein
2582 CAMPNI010000015.1 GCA946891925_01290 CDS open 11373-11891 _na     172_aa nadR Transcription repressor NadR
2583 CAMPNI010000015.1 GCA946891925_01291 CDS open 12130-13914 _na     594_aa Methyl-accepting chemotaxis protein
2584 CAMPNI010000015.1 GCA946891925_01292 CDS open 14039-14926 _na     295_aa hypothetical protein
2585 CAMPNI010000015.1 GCA946891925_01293 CDS open 14960-15061 _na     33_aa hypothetical protein
2586 CAMPNI010000015.1 GCA946891925_01294 CDS open 15174-15452 _na     92_aa yafQ type II toxin-antitoxin system YafQ family toxin
2587 CAMPNI010000015.1 GCA946891925_01295 CDS open 15458-15742 _na     94_aa relB Damage-inducible protein
2588 CAMPNI010000015.1 GCA946891925_01296 CDS open 16047-16559 _na     170_aa Nitroreductase domain-containing protein
2589 CAMPNI010000015.1 GCA946891925_01297 CDS open 16577-17401 _na     274_aa hypothetical protein
2590 CAMPNI010000015.1 GCA946891925_01282 gene open 161-1453
2591 CAMPNI010000015.1 GCA946891925_01283 gene open 1726-3249
2592 CAMPNI010000015.1 GCA946891925_01284 gene open 3300-3449
2593 CAMPNI010000015.1 GCA946891925_01285 gene open 3549-4955
2594 CAMPNI010000015.1 GCA946891925_01286 gene open 5171-7789
2595 CAMPNI010000015.1 GCA946891925_01287 gene open 7808-8563
2596 CAMPNI010000015.1 GCA946891925_01288 gene open 8881-9960
2597 CAMPNI010000015.1 GCA946891925_01289 gene open 10153-11244
2598 CAMPNI010000015.1 GCA946891925_01290 gene open 11373-11891 nadR
2599 CAMPNI010000015.1 GCA946891925_01291 gene open 12130-13914
2600 CAMPNI010000015.1 GCA946891925_01292 gene open 14039-14926
2601 CAMPNI010000015.1 GCA946891925_01293 gene open 14960-15061
2602 CAMPNI010000015.1 GCA946891925_01294 gene open 15174-15452 yafQ
2603 CAMPNI010000015.1 GCA946891925_01295 gene open 15458-15742 relB
2604 CAMPNI010000015.1 GCA946891925_01296 gene open 16047-16559
2605 CAMPNI010000015.1 GCA946891925_01297 gene open 16577-17401
2606 CAMPNI010000016.1 GCA946891925_01298 CDS open 45-1250 _na     401_aa mobT MobT family relaxase
2607 CAMPNI010000016.1 GCA946891925_01299 CDS open 1428-2813 _na     461_aa ftsK FtsK domain-containing protein
2608 CAMPNI010000016.1 GCA946891925_01300 CDS open 2842-3225 _na     127_aa DUF961 domain-containing protein
2609 CAMPNI010000016.1 GCA946891925_01301 CDS open 3244-3558 _na     104_aa DUF961 domain-containing protein
2610 CAMPNI010000016.1 GCA946891925_01303 CDS open 4157-4966 _na     269_aa hypothetical protein
2611 CAMPNI010000016.1 GCA946891925_01304 CDS open 5089-6009 _na     306_aa S1 motif domain-containing protein
2612 CAMPNI010000016.1 GCA946891925_01305 CDS open 6125-6322 _na     65_aa hypothetical protein
2613 CAMPNI010000016.1 GCA946891925_01306 CDS open 6648-7571 _na     307_aa Thioredoxin reductase
2614 CAMPNI010000016.1 GCA946891925_01307 CDS open 7705-8997 _na     430_aa hypothetical protein
2615 CAMPNI010000016.1 GCA946891925_01308 CDS open 9664-10752 _na     362_aa pucR PucR family transcriptional regulator
2616 CAMPNI010000016.1 GCA946891925_01309 CDS open 10807-11481 _na     224_aa ftsE Cell division ATP-binding protein FtsE
2617 CAMPNI010000016.1 GCA946891925_01310 CDS open 11557-12402 _na     281_aa ftsX Cell division protein FtsX
2618 CAMPNI010000016.1 GCA946891925_01311 CDS open 12420-13697 _na     425_aa hypothetical protein
2619 CAMPNI010000016.1 GCA946891925_01312 CDS open 13755-14894 _na     379_aa Peptide chain release factor 2
2620 CAMPNI010000016.1 GCA946891925_01313 CDS open 14988-15557 _na     189_aa hypothetical protein
2621 CAMPNI010000016.1 GCA946891925_01314 CDS open 15570-16016 _na     148_aa tsaE tRNA threonylcarbamoyladenosine biosynthesis protein TsaE
2622 CAMPNI010000016.1 GCA946891925_01298 gene open 45-1250 mobT
2623 CAMPNI010000016.1 GCA946891925_01299 gene open 1428-2813 ftsK
2624 CAMPNI010000016.1 GCA946891925_01300 gene open 2842-3225
2625 CAMPNI010000016.1 GCA946891925_01301 gene open 3244-3558
2626 CAMPNI010000016.1 GCA946891925_01303 gene open 4157-4966
2627 CAMPNI010000016.1 GCA946891925_01304 gene open 5089-6009
2628 CAMPNI010000016.1 GCA946891925_01305 gene open 6125-6322
2629 CAMPNI010000016.1 GCA946891925_01306 gene open 6648-7571
2630 CAMPNI010000016.1 GCA946891925_01307 gene open 7705-8997
2631 CAMPNI010000016.1 GCA946891925_01308 gene open 9664-10752 pucR
2632 CAMPNI010000016.1 GCA946891925_01309 gene open 10807-11481 ftsE
2633 CAMPNI010000016.1 GCA946891925_01310 gene open 11557-12402 ftsX
2634 CAMPNI010000016.1 GCA946891925_01311 gene open 12420-13697
2635 CAMPNI010000016.1 GCA946891925_01312 gene open 13755-14894
2636 CAMPNI010000016.1 GCA946891925_01313 gene open 14988-15557
2637 CAMPNI010000016.1 GCA946891925_01314 gene open 15570-16016 tsaE
2638 CAMPNI010000016.1 GCA946891925_01302 gene open 4032-4103 trnQ
2639 CAMPNI010000016.1 GCA946891925_01302 tRNA open 4032-4103 trnQ tRNA-Gln(ctg)
2640 CAMPNI010000017.1 GCA946891925_01315 CDS open 92-2347 _na     751_aa hypothetical protein
2641 CAMPNI010000017.1 GCA946891925_01316 CDS open 2632-4872 _na     746_aa Subtilase family protein
2642 CAMPNI010000017.1 GCA946891925_01317 CDS open 4957-6027 _na     356_aa Lon protease
2643 CAMPNI010000017.1 GCA946891925_01318 CDS open 6187-6693 _na     168_aa DUF4143 domain-containing protein
2644 CAMPNI010000017.1 GCA946891925_01319 CDS open 6971-7939 _na     322_aa hypothetical protein
2645 CAMPNI010000017.1 GCA946891925_01320 CDS open 8061-8333 _na     90_aa Type II toxin-antitoxin system RelB/DinJ family antitoxin
2646 CAMPNI010000017.1 GCA946891925_01321 CDS open 8650-9993 _na     447_aa hypothetical protein
2647 CAMPNI010000017.1 GCA946891925_01322 CDS open 10230-10952 _na     240_aa HTH cro/C1-type domain-containing protein
2648 CAMPNI010000017.1 GCA946891925_01323 CDS open 11099-11695 _na     198_aa Abortive infection protein
2649 CAMPNI010000017.1 GCA946891925_01315 gene open 92-2347
2650 CAMPNI010000017.1 GCA946891925_01316 gene open 2632-4872
2651 CAMPNI010000017.1 GCA946891925_01317 gene open 4957-6027
2652 CAMPNI010000017.1 GCA946891925_01318 gene open 6187-6693
2653 CAMPNI010000017.1 GCA946891925_01319 gene open 6971-7939
2654 CAMPNI010000017.1 GCA946891925_01320 gene open 8061-8333
2655 CAMPNI010000017.1 GCA946891925_01321 gene open 8650-9993
2656 CAMPNI010000017.1 GCA946891925_01322 gene open 10230-10952
2657 CAMPNI010000017.1 GCA946891925_01323 gene open 11099-11695
2658 CAMPNI010000017.1 GCA946891925_01324 gene open 11963-12046 trnL
2659 CAMPNI010000017.1 GCA946891925_01325 gene open 12090-12174 trnL
2660 CAMPNI010000017.1 GCA946891925_01324 tRNA open 11963-12046 trnL tRNA-Leu(cag)
2661 CAMPNI010000017.1 GCA946891925_01325 tRNA open 12090-12174 trnL tRNA-Leu(aag)
2662 CAMPNI010000018.1 GCA946891925_01326 CDS open 31-810 _na     259_aa khpB RNA-binding protein KhpB
2663 CAMPNI010000018.1 GCA946891925_01327 CDS open 827-2095 _na     422_aa yidC Membrane protein YidC 1
2664 CAMPNI010000018.1 GCA946891925_01328 CDS open 2101-2346 _na     81_aa Putative membrane protein insertion efficiency factor
2665 CAMPNI010000018.1 GCA946891925_01329 CDS open 2350-2688 _na     112_aa Ribonuclease P protein component
2666 CAMPNI010000018.1 GCA946891925_01330 CDS open 2761-2895 _na     44_aa Large ribosomal subunit protein bL34
2667 CAMPNI010000018.1 GCA946891925_01331 CDS open 3149-4489 _na     446_aa dnaA Chromosomal replication initiator protein DnaA
2668 CAMPNI010000018.1 GCA946891925_01332 CDS open 4653-5756 _na     367_aa Beta sliding clamp
2669 CAMPNI010000018.1 GCA946891925_01333 CDS open 5773-5991 _na     72_aa RNA-binding S4 domain-containing protein
2670 CAMPNI010000018.1 GCA946891925_01334 CDS open 5988-7079 _na     363_aa recF DNA replication and repair protein RecF
2671 CAMPNI010000018.1 GCA946891925_01335 CDS open 7097-9019 _na     640_aa DNA gyrase subunit B
2672 CAMPNI010000018.1 GCA946891925_01336 CDS open 9034-11478 _na     814_aa DNA gyrase subunit A
2673 CAMPNI010000018.1 GCA946891925_01326 gene open 31-810 khpB
2674 CAMPNI010000018.1 GCA946891925_01327 gene open 827-2095 yidC
2675 CAMPNI010000018.1 GCA946891925_01328 gene open 2101-2346
2676 CAMPNI010000018.1 GCA946891925_01329 gene open 2350-2688
2677 CAMPNI010000018.1 GCA946891925_01330 gene open 2761-2895
2678 CAMPNI010000018.1 GCA946891925_01331 gene open 3149-4489 dnaA
2679 CAMPNI010000018.1 GCA946891925_01332 gene open 4653-5756
2680 CAMPNI010000018.1 GCA946891925_01333 gene open 5773-5991
2681 CAMPNI010000018.1 GCA946891925_01334 gene open 5988-7079 recF
2682 CAMPNI010000018.1 GCA946891925_01335 gene open 7097-9019
2683 CAMPNI010000018.1 GCA946891925_01336 gene open 9034-11478
2684 CAMPNI010000018.1 GCA946891925_01337 gene open 11621-11708 trnS
2685 CAMPNI010000018.1 GCA946891925_01337 tRNA open 11621-11708 trnS tRNA-Ser(gct)
2686 CAMPNI010000019.1 GCA946891925_01338 CDS open 491-1297 _na     268_aa hipB ICESt1 APR2 Cro/CI family transcriptional regulator
2687 CAMPNI010000019.1 GCA946891925_01339 CDS open 1334-1543 _na     69_aa Putative transcriptional regulator
2688 CAMPNI010000019.1 GCA946891925_01340 CDS open 1626-1784 _na     52_aa hypothetical protein
2689 CAMPNI010000019.1 GCA946891925_01341 CDS open 1978-2229 _na     83_aa Amino acid ABC transporter%2C permease protein
2690 CAMPNI010000019.1 GCA946891925_01342 CDS open 2266-2982 _na     238_aa hypothetical protein
2691 CAMPNI010000019.1 GCA946891925_01343 CDS open 2972-3682 _na     236_aa ABC transporter ATP-binding protein
2692 CAMPNI010000019.1 GCA946891925_01344 CDS open 3683-4429 _na     248_aa ABC transporter permease
2693 CAMPNI010000019.1 GCA946891925_01345 CDS open 4413-5348 _na     311_aa ABC transporter ATP-binding protein
2694 CAMPNI010000019.1 GCA946891925_01346 CDS open 5461-6078 _na     205_aa TetR/AcrR family transcriptional regulator
2695 CAMPNI010000019.1 GCA946891925_01347 CDS open 6094-6291 _na     65_aa helix-turn-helix transcriptional regulator
2696 CAMPNI010000019.1 GCA946891925_01348 CDS open 6727-7056 _na     109_aa sdpI SdpI family protein
2697 CAMPNI010000019.1 GCA946891925_01349 CDS open 7476-7754 _na     92_aa hypothetical protein
2698 CAMPNI010000019.1 GCA946891925_01338 gene open 491-1297 hipB
2699 CAMPNI010000019.1 GCA946891925_01339 gene open 1334-1543
2700 CAMPNI010000019.1 GCA946891925_01340 gene open 1626-1784
2701 CAMPNI010000019.1 GCA946891925_01341 gene open 1978-2229
2702 CAMPNI010000019.1 GCA946891925_01342 gene open 2266-2982
2703 CAMPNI010000019.1 GCA946891925_01343 gene open 2972-3682
2704 CAMPNI010000019.1 GCA946891925_01344 gene open 3683-4429
2705 CAMPNI010000019.1 GCA946891925_01345 gene open 4413-5348
2706 CAMPNI010000019.1 GCA946891925_01346 gene open 5461-6078
2707 CAMPNI010000019.1 GCA946891925_01347 gene open 6094-6291
2708 CAMPNI010000019.1 GCA946891925_01348 gene open 6727-7056 sdpI
2709 CAMPNI010000019.1 GCA946891925_01349 gene open 7476-7754
2710 CAMPNI010000019.1 GCA946891925_01350 gene open 7842-7916 trnR
2711 CAMPNI010000019.1 GCA946891925_01351 gene open 7929-8002 trnD
2712 CAMPNI010000019.1 GCA946891925_01352 gene open 8006-8079 trnI
2713 CAMPNI010000019.1 GCA946891925_01353 gene open 8086-8157 trnE
2714 CAMPNI010000019.1 GCA946891925_01354 gene open 8163-8234 trnN
2715 CAMPNI010000019.1 GCA946891925_01350 tRNA open 7842-7916 trnR tRNA-Arg(acg)
2716 CAMPNI010000019.1 GCA946891925_01351 tRNA open 7929-8002 trnD tRNA-Asp(gtc)
2717 CAMPNI010000019.1 GCA946891925_01352 tRNA open 8006-8079 trnI tRNA-Ile2(cat)
2718 CAMPNI010000019.1 GCA946891925_01353 tRNA open 8086-8157 trnE tRNA-Glu(ttc)
2719 CAMPNI010000019.1 GCA946891925_01354 tRNA open 8163-8234 trnN tRNA-Asn(gtt)
2720 CAMPNI010000020.1 GCA946891925_01355 CDS open 904-1773 _na     289_aa hypothetical protein
2721 CAMPNI010000020.1 GCA946891925_01356 CDS open 1766-2743 _na     325_aa hypothetical protein
2722 CAMPNI010000020.1 GCA946891925_01357 CDS open 2757-4073 _na     438_aa hypothetical protein
2723 CAMPNI010000020.1 GCA946891925_01358 CDS open 4048-4662 _na     204_aa hypothetical protein
2724 CAMPNI010000020.1 GCA946891925_01359 CDS open 4649-5515 _na     288_aa hypothetical protein
2725 CAMPNI010000020.1 GCA946891925_01360 CDS open 5518-6276 _na     252_aa ABC transporter permease
2726 CAMPNI010000020.1 GCA946891925_01355 gene open 904-1773
2727 CAMPNI010000020.1 GCA946891925_01356 gene open 1766-2743
2728 CAMPNI010000020.1 GCA946891925_01357 gene open 2757-4073
2729 CAMPNI010000020.1 GCA946891925_01358 gene open 4048-4662
2730 CAMPNI010000020.1 GCA946891925_01359 gene open 4649-5515
2731 CAMPNI010000020.1 GCA946891925_01360 gene open 5518-6276
2732 CAMPNI010000021.1 GCA946891925_01361 CDS open 571-927 _na     118_aa nikA Mobilization protein NikA
2733 CAMPNI010000021.1 GCA946891925_01362 CDS open 929-1675 _na     248_aa Relaxase/mobilization nuclease family protein
2734 CAMPNI010000021.1 GCA946891925_01363 CDS open 1823-2212 _na     129_aa hypothetical protein
2735 CAMPNI010000021.1 GCA946891925_01364 CDS open 2233-6009 _na     1258_aa YobI-like P-loop NTPase domain-containing protein
2736 CAMPNI010000021.1 GCA946891925_01365 CDS open 6019-6225 _na     68_aa HTH cro/C1-type domain-containing protein
2737 CAMPNI010000021.1 GCA946891925_01366 CDS open 6358-6669 _na     103_aa hypothetical protein
2738 CAMPNI010000021.1 GCA946891925_01367 CDS open 6763-6996 _na     77_aa Conserved domain protein
2739 CAMPNI010000021.1 GCA946891925_01368 CDS open 7039-7182 _na     47_aa hypothetical protein
2740 CAMPNI010000021.1 GCA946891925_01369 CDS open 7213-7446 _na     77_aa hypothetical protein
2741 CAMPNI010000021.1 GCA946891925_01361 gene open 571-927 nikA
2742 CAMPNI010000021.1 GCA946891925_01362 gene open 929-1675
2743 CAMPNI010000021.1 GCA946891925_01363 gene open 1823-2212
2744 CAMPNI010000021.1 GCA946891925_01364 gene open 2233-6009
2745 CAMPNI010000021.1 GCA946891925_01365 gene open 6019-6225
2746 CAMPNI010000021.1 GCA946891925_01366 gene open 6358-6669
2747 CAMPNI010000021.1 GCA946891925_01367 gene open 6763-6996
2748 CAMPNI010000021.1 GCA946891925_01368 gene open 7039-7182
2749 CAMPNI010000021.1 GCA946891925_01369 gene open 7213-7446
2750 CAMPNI010000022.1 GCA946891925_01370 CDS open 56-730 _na     224_aa Thiamine transporter
2751 CAMPNI010000022.1 GCA946891925_01371 CDS open 823-2631 _na     602_aa hypothetical protein
2752 CAMPNI010000022.1 GCA946891925_01372 CDS open 2904-4250 _na     448_aa mgtE Magnesium transporter MgtE
2753 CAMPNI010000022.1 GCA946891925_01373 CDS open 4324-4974 _na     216_aa Uridine kinase
2754 CAMPNI010000022.1 GCA946891925_01374 CDS open 5025-6008 _na     327_aa Sodium/calcium exchanger membrane region domain-containing protein
2755 CAMPNI010000022.1 GCA946891925_01375 CDS open 6260-7276 _na     338_aa Alcohol dehydrogenase 1
2756 CAMPNI010000022.1 GCA946891925_01370 gene open 56-730
2757 CAMPNI010000022.1 GCA946891925_01371 gene open 823-2631
2758 CAMPNI010000022.1 GCA946891925_01372 gene open 2904-4250 mgtE
2759 CAMPNI010000022.1 GCA946891925_01373 gene open 4324-4974
2760 CAMPNI010000022.1 GCA946891925_01374 gene open 5025-6008
2761 CAMPNI010000022.1 GCA946891925_01375 gene open 6260-7276
2762 CAMPNI010000023.1 GCA946891925_01376 CDS open 25-606 _na     193_aa hypothetical protein
2763 CAMPNI010000023.1 GCA946891925_01377 CDS open 618-1367 _na     249_aa trmH TrmH family tRNA/rRNA methyltransferase
2764 CAMPNI010000023.1 GCA946891925_01378 CDS open 1357-1806 _na     149_aa Mini-ribonuclease 3
2765 CAMPNI010000023.1 GCA946891925_01379 CDS open 1791-3209 _na     472_aa Cysteine--tRNA ligase
2766 CAMPNI010000023.1 GCA946891925_01380 CDS open 3292-3834 _na     180_aa 2-C-methyl-D-erythritol 2%2C4-cyclodiphosphate synthase
2767 CAMPNI010000023.1 GCA946891925_01383 CDS open 4384-5190 _na     268_aa hypothetical protein
2768 CAMPNI010000023.1 GCA946891925_01376 gene open 25-606
2769 CAMPNI010000023.1 GCA946891925_01377 gene open 618-1367 trmH
2770 CAMPNI010000023.1 GCA946891925_01378 gene open 1357-1806
2771 CAMPNI010000023.1 GCA946891925_01379 gene open 1791-3209
2772 CAMPNI010000023.1 GCA946891925_01380 gene open 3292-3834
2773 CAMPNI010000023.1 GCA946891925_01383 gene open 4384-5190
2774 CAMPNI010000023.1 GCA946891925_01381 gene open 4144-4217 trnM
2775 CAMPNI010000023.1 GCA946891925_01382 gene open 4226-4298 trnV
2776 CAMPNI010000023.1 GCA946891925_01384 gene open 5417-5489 trnW
2777 CAMPNI010000023.1 GCA946891925_01381 tRNA open 4144-4217 trnM tRNA-Met(cat)
2778 CAMPNI010000023.1 GCA946891925_01382 tRNA open 4226-4298 trnV tRNA-Val(tac)
2779 CAMPNI010000023.1 GCA946891925_01384 tRNA open 5417-5489 trnW tRNA-Trp(cca)
2780 CAMPNI010000024.1 GCA946891925_01385 CDS open 277-1815 _na     512_aa hypothetical protein
2781 CAMPNI010000024.1 GCA946891925_01386 CDS open 2210-3250 _na     346_aa ABC transporter substrate binding protein
2782 CAMPNI010000024.1 GCA946891925_01387 CDS open 3286-4185 _na     299_aa Branched-chain amino acid ABC transporter%2C permease protein
2783 CAMPNI010000024.1 GCA946891925_01388 CDS open 4175-4945 _na     256_aa ABC transporter ATP-binding protein
2784 CAMPNI010000024.1 GCA946891925_01385 gene open 277-1815
2785 CAMPNI010000024.1 GCA946891925_01386 gene open 2210-3250
2786 CAMPNI010000024.1 GCA946891925_01387 gene open 3286-4185
2787 CAMPNI010000024.1 GCA946891925_01388 gene open 4175-4945
2788 CAMPNI010000024.1 GCA946891925_01389 gene open 5104-5189 trnS
2789 CAMPNI010000024.1 GCA946891925_01390 gene open 5241-5328 trnS
2790 CAMPNI010000024.1 GCA946891925_01389 tRNA open 5104-5189 trnS tRNA-Ser(tga)
2791 CAMPNI010000024.1 GCA946891925_01390 tRNA open 5241-5328 trnS tRNA-Ser(gga)
2792 CAMPNI010000025.1 GCA946891925_01391 CDS open 52-525 _na     157_aa hypothetical protein
2793 CAMPNI010000025.1 GCA946891925_01392 CDS open 827-1471 _na     214_aa HTH cro/C1-type domain-containing protein
2794 CAMPNI010000025.1 GCA946891925_01393 CDS open 1495-1896 _na     133_aa DUF2178 domain-containing protein
2795 CAMPNI010000025.1 GCA946891925_01394 CDS open 1893-2096 _na     67_aa xRE HTH cro/C1-type domain-containing protein
2796 CAMPNI010000025.1 GCA946891925_01395 CDS open 2306-2602 _na     98_aa Addiction module antitoxin%2C RelB/DinJ family protein
2797 CAMPNI010000025.1 GCA946891925_01396 CDS open 2851-3291 _na     146_aa hypothetical protein
2798 CAMPNI010000025.1 GCA946891925_01397 CDS open 3425-3781 _na     118_aa hypothetical protein
2799 CAMPNI010000025.1 GCA946891925_01398 CDS open 4174-5205 _na     343_aa yhcG DUF1016 domain-containing protein
2800 CAMPNI010000025.1 GCA946891925_01391 gene open 52-525
2801 CAMPNI010000025.1 GCA946891925_01392 gene open 827-1471
2802 CAMPNI010000025.1 GCA946891925_01393 gene open 1495-1896
2803 CAMPNI010000025.1 GCA946891925_01394 gene open 1893-2096 xRE
2804 CAMPNI010000025.1 GCA946891925_01395 gene open 2306-2602
2805 CAMPNI010000025.1 GCA946891925_01396 gene open 2851-3291
2806 CAMPNI010000025.1 GCA946891925_01397 gene open 3425-3781
2807 CAMPNI010000025.1 GCA946891925_01398 gene open 4174-5205 yhcG
2808 CAMPNI010000026.1 GCA946891925_01399 CDS open 95-835 _na     246_aa N(6)-L-threonylcarbamoyladenine synthase
2809 CAMPNI010000026.1 GCA946891925_01400 CDS open 825-1298 _na     157_aa hypothetical protein
2810 CAMPNI010000026.1 GCA946891925_01401 CDS open 1380-2288 _na     302_aa Ribonuclease Z
2811 CAMPNI010000026.1 GCA946891925_01402 CDS open 2339-2926 _na     195_aa hypothetical protein
2812 CAMPNI010000026.1 GCA946891925_01403 CDS open 3023-4024 _na     333_aa tRNA N6-adenosine threonylcarbamoyltransferase
2813 CAMPNI010000026.1 GCA946891925_01404 CDS open 4027-4722 _na     231_aa 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase
2814 CAMPNI010000026.1 GCA946891925_01399 gene open 95-835
2815 CAMPNI010000026.1 GCA946891925_01400 gene open 825-1298
2816 CAMPNI010000026.1 GCA946891925_01401 gene open 1380-2288
2817 CAMPNI010000026.1 GCA946891925_01402 gene open 2339-2926
2818 CAMPNI010000026.1 GCA946891925_01403 gene open 3023-4024
2819 CAMPNI010000026.1 GCA946891925_01404 gene open 4027-4722
2820 CAMPNI010000027.1 GCA946891925_01405 CDS open 163-1932 _na     589_aa hypothetical protein
2821 CAMPNI010000027.1 GCA946891925_01406 CDS open 2052-2816 _na     254_aa yxlF ABC transporter ATP-binding protein YxlF
2822 CAMPNI010000027.1 GCA946891925_01407 CDS open 2974-4302 _na     442_aa ATPase
2823 CAMPNI010000027.1 GCA946891925_01405 gene open 163-1932
2824 CAMPNI010000027.1 GCA946891925_01406 gene open 2052-2816 yxlF
2825 CAMPNI010000027.1 GCA946891925_01407 gene open 2974-4302
2826 CAMPNI010000028.1 GCA946891925_01408 gene open 43-273 sRNA_1300
2827 CAMPNI010000028.1 GCA946891925_01408 ncRNA open 43-273 Enterococcus sRNA 1300
2828 CAMPNI010000028.1 GCA946891925_01409 CDS open 368-538 _na     56_aa DNA recombinase
2829 CAMPNI010000028.1 GCA946891925_01410 CDS open 1166-3064 _na     632_aa SWI2/SNF2 ATPase
2830 CAMPNI010000028.1 GCA946891925_01411 CDS open 3157-4053 _na     298_aa AbiTii domain-containing protein
2831 CAMPNI010000028.1 GCA946891925_01409 gene open 368-538
2832 CAMPNI010000028.1 GCA946891925_01410 gene open 1166-3064
2833 CAMPNI010000028.1 GCA946891925_01411 gene open 3157-4053
2834 CAMPNI010000029.1 GCA946891925_01412 CDS open 331-1809 _na     492_aa lsa Lsa family ABC-F type ribosomal protection protein
2835 CAMPNI010000029.1 GCA946891925_01413 CDS open 1913-2203 _na     96_aa 23S rRNA methyltransferase
2836 CAMPNI010000029.1 GCA946891925_01414 CDS open 2405-3310 _na     301_aa site-specific DNA-methyltransferase (adenine-specific)
2837 CAMPNI010000029.1 GCA946891925_01412 gene open 331-1809 lsa
2838 CAMPNI010000029.1 GCA946891925_01413 gene open 1913-2203
2839 CAMPNI010000029.1 GCA946891925_01414 gene open 2405-3310
2840 CAMPNI010000030.1 GCA946891925_01415 CDS open 388-627 _na     79_aa hypothetical protein
2841 CAMPNI010000030.1 GCA946891925_01416 CDS open 871-1050 _na     59_aa hypothetical protein
2842 CAMPNI010000030.1 GCA946891925_01417 CDS open 1270-3744 _na     824_aa Phosphoenolpyruvate synthase
2843 CAMPNI010000030.1 GCA946891925_01415 gene open 388-627
2844 CAMPNI010000030.1 GCA946891925_01416 gene open 871-1050
2845 CAMPNI010000030.1 GCA946891925_01417 gene open 1270-3744