HOMD Banner
Taxonomy: V4.3   |  16S rRNA RefSeq: V16.03   |  Genomic RefSeq: V11.03   |  Viruses: V1.2

BAKTAGenome Explorer: Porphyromonas uenonis (GCA_946997265.1)

Select a Genome:
BAKTA Annotations for GCA_946997265.1
Genome Selected: Porphyromonas uenonis
ContigsBases CDSrRNA tmRNAtRNA
83 2035398 1606 0 1 42
[Table]   [AA Fasta]      [Browser]   [Text]   [Excel]  
Search & Sort all 3314 Records
Search These Records: Clear
Sort Column:   Molecule   PID   NA   AA   Gene  Gene Product  Reverse
Annotation Table [page:3]    |    Number of Records Found: 3314 [7 Pages]    |    Previous Page <==> Next Page    |    Jump to Page: [ 1  2  3  4  5  6  7  ]
Notes:   1- Column headers only sort the current page. 2- Select [NA] or [AA] links to show sequences.
Region Protein-ID Type Genome
Viewer		 Range
(bp)		 Show Sequences
(length) NA / AA		 BAKTA
Gene		 BAKTA
GeneProduct
1001 CAMPUJ010000010.1 GCA946997265_00507 CDS open 12270-13313 _na     347_aa nusB transcription antitermination factor NusB
1002 CAMPUJ010000010.1 GCA946997265_00508 CDS open 13356-15392 _na     678_aa Permease%2C YjgP/YjgQ family
1003 CAMPUJ010000010.1 GCA946997265_00509 CDS open 15424-16644 _na     406_aa bifunctional 3%2C4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II
1004 CAMPUJ010000010.1 GCA946997265_00510 CDS open 16674-17474 _na     266_aa DUF6263 domain-containing protein
1005 CAMPUJ010000010.1 GCA946997265_00511 CDS open 17693-18217 _na     174_aa ybeY rRNA maturation RNase YbeY
1006 CAMPUJ010000010.1 GCA946997265_00512 CDS open 18239-19267 _na     342_aa tsaD tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD
1007 CAMPUJ010000010.1 GCA946997265_00513 CDS open 19278-19769 _na     163_aa cinA Competence/damage-inducible domain protein CinA
1008 CAMPUJ010000010.1 GCA946997265_00514 CDS open 19805-21226 _na     473_aa PDZ/DHR/GLGF domain protein
1009 CAMPUJ010000010.1 GCA946997265_00515 CDS open 21257-22534 _na     425_aa queA tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA
1010 CAMPUJ010000010.1 GCA946997265_00516 CDS open 22580-23440 _na     286_aa panC pantoate--beta-alanine ligase
1011 CAMPUJ010000010.1 GCA946997265_00517 CDS open 23445-23594 _na     49_aa hypothetical protein
1012 CAMPUJ010000010.1 GCA946997265_00518 CDS open 23717-24922 _na     401_aa gldN Gliding motility-associated protein GldN
1013 CAMPUJ010000010.1 GCA946997265_00519 CDS open 24961-26511 _na     516_aa gldM Gliding motility-associated protein GldM
1014 CAMPUJ010000010.1 GCA946997265_00520 CDS open 26566-27600 _na     344_aa gldL Gliding motility-associated protein GldL
1015 CAMPUJ010000010.1 GCA946997265_00521 CDS open 27654-29168 _na     504_aa Sulphatase-modifying factor protein
1016 CAMPUJ010000010.1 GCA946997265_00522 CDS open 29216-30262 _na     348_aa Membrane protein
1017 CAMPUJ010000010.1 GCA946997265_00523 CDS open 30348-30569 _na     73_aa DUF2795 domain-containing protein
1018 CAMPUJ010000010.1 GCA946997265_00524 CDS open 31366-32583 _na     405_aa ATP-binding protein
1019 CAMPUJ010000010.1 GCA946997265_00525 CDS open 32886-33383 _na     165_aa Transcriptional regulator%2C Fur family
1020 CAMPUJ010000010.1 GCA946997265_00526 CDS open 33405-34694 _na     429_aa adenylosuccinate synthase
1021 CAMPUJ010000010.1 GCA946997265_00527 CDS open 34684-36003 _na     439_aa tetrahydrofolate synthase
1022 CAMPUJ010000010.1 GCA946997265_00528 CDS open 36107-37471 _na     454_aa Lysosomal dipeptide transporter MFSD1
1023 CAMPUJ010000010.1 GCA946997265_00529 CDS open 37654-38361 _na     235_aa tonB TonB family protein
1024 CAMPUJ010000010.1 GCA946997265_00530 CDS open 38477-39481 _na     334_aa polyprenyl synthetase family protein
1025 CAMPUJ010000010.1 GCA946997265_00531 CDS open 39556-40347 _na     263_aa tatD Hydrolase%2C TatD family
1026 CAMPUJ010000010.1 GCA946997265_00533 CDS open 40676-41509 _na     277_aa MotA/TolQ/ExbB proton channel
1027 CAMPUJ010000010.1 GCA946997265_00534 CDS open 41519-41989 _na     156_aa hypothetical protein
1028 CAMPUJ010000010.1 GCA946997265_00535 CDS open 42059-42619 _na     186_aa Transport energizing protein%2C ExbD/TolR family
1029 CAMPUJ010000010.1 GCA946997265_00536 CDS open 42676-43119 _na     147_aa Transport energizing protein%2C ExbD/TolR family
1030 CAMPUJ010000010.1 GCA946997265_00496 gene open 338-3235
1031 CAMPUJ010000010.1 GCA946997265_00497 gene open 3232-3945 lrgB
1032 CAMPUJ010000010.1 GCA946997265_00498 gene open 3942-4313 lrgA
1033 CAMPUJ010000010.1 GCA946997265_00499 gene open 4576-5760 uspA
1034 CAMPUJ010000010.1 GCA946997265_00500 gene open 5882-6142
1035 CAMPUJ010000010.1 GCA946997265_00501 gene open 6239-8185
1036 CAMPUJ010000010.1 GCA946997265_00502 gene open 8182-8472
1037 CAMPUJ010000010.1 GCA946997265_00504 gene open 8742-9095
1038 CAMPUJ010000010.1 GCA946997265_00505 gene open 9079-10617
1039 CAMPUJ010000010.1 GCA946997265_00506 gene open 10614-11444
1040 CAMPUJ010000010.1 GCA946997265_00507 gene open 12270-13313 nusB
1041 CAMPUJ010000010.1 GCA946997265_00508 gene open 13356-15392
1042 CAMPUJ010000010.1 GCA946997265_00509 gene open 15424-16644
1043 CAMPUJ010000010.1 GCA946997265_00510 gene open 16674-17474
1044 CAMPUJ010000010.1 GCA946997265_00511 gene open 17693-18217 ybeY
1045 CAMPUJ010000010.1 GCA946997265_00512 gene open 18239-19267 tsaD
1046 CAMPUJ010000010.1 GCA946997265_00513 gene open 19278-19769 cinA
1047 CAMPUJ010000010.1 GCA946997265_00514 gene open 19805-21226
1048 CAMPUJ010000010.1 GCA946997265_00515 gene open 21257-22534 queA
1049 CAMPUJ010000010.1 GCA946997265_00516 gene open 22580-23440 panC
1050 CAMPUJ010000010.1 GCA946997265_00517 gene open 23445-23594
1051 CAMPUJ010000010.1 GCA946997265_00518 gene open 23717-24922 gldN
1052 CAMPUJ010000010.1 GCA946997265_00519 gene open 24961-26511 gldM
1053 CAMPUJ010000010.1 GCA946997265_00520 gene open 26566-27600 gldL
1054 CAMPUJ010000010.1 GCA946997265_00521 gene open 27654-29168
1055 CAMPUJ010000010.1 GCA946997265_00522 gene open 29216-30262
1056 CAMPUJ010000010.1 GCA946997265_00523 gene open 30348-30569
1057 CAMPUJ010000010.1 GCA946997265_00524 gene open 31366-32583
1058 CAMPUJ010000010.1 GCA946997265_00525 gene open 32886-33383
1059 CAMPUJ010000010.1 GCA946997265_00526 gene open 33405-34694
1060 CAMPUJ010000010.1 GCA946997265_00527 gene open 34684-36003
1061 CAMPUJ010000010.1 GCA946997265_00528 gene open 36107-37471
1062 CAMPUJ010000010.1 GCA946997265_00529 gene open 37654-38361 tonB
1063 CAMPUJ010000010.1 GCA946997265_00530 gene open 38477-39481
1064 CAMPUJ010000010.1 GCA946997265_00531 gene open 39556-40347 tatD
1065 CAMPUJ010000010.1 GCA946997265_00533 gene open 40676-41509
1066 CAMPUJ010000010.1 GCA946997265_00534 gene open 41519-41989
1067 CAMPUJ010000010.1 GCA946997265_00535 gene open 42059-42619
1068 CAMPUJ010000010.1 GCA946997265_00536 gene open 42676-43119
1069 CAMPUJ010000010.1 GCA946997265_00503 gene open 8616-8699 trnL
1070 CAMPUJ010000010.1 GCA946997265_00532 gene open 40540-40627 trnS
1071 CAMPUJ010000010.1 GCA946997265_00503 tRNA open 8616-8699 trnL tRNA-Leu(caa)
1072 CAMPUJ010000010.1 GCA946997265_00532 tRNA open 40540-40627 trnS tRNA-Ser(gga)
1073 CAMPUJ010000011.1 GCA946997265_00538 CDS open 706-1311 _na     201_aa grpE Protein GrpE
1074 CAMPUJ010000011.1 GCA946997265_00539 CDS open 1347-2507 _na     386_aa dnaJ molecular chaperone DnaJ
1075 CAMPUJ010000011.1 GCA946997265_00540 CDS open 2563-3801 _na     412_aa DUF4105 domain-containing protein
1076 CAMPUJ010000011.1 GCA946997265_00541 CDS open 3798-5351 _na     517_aa Type I phosphodiesterase / nucleotide pyrophosphatase
1077 CAMPUJ010000011.1 GCA946997265_00542 CDS open 5363-8695 _na     1110_aa secA preprotein translocase subunit SecA
1078 CAMPUJ010000011.1 GCA946997265_00543 CDS open 8780-9721 _na     313_aa YicC-like domain-containing protein
1079 CAMPUJ010000011.1 GCA946997265_00544 CDS open 9741-10307 _na     188_aa gmk guanylate kinase
1080 CAMPUJ010000011.1 GCA946997265_00545 CDS open 10480-11706 _na     408_aa THUMP-like domain-containing protein
1081 CAMPUJ010000011.1 GCA946997265_00547 CDS open 12792-13505 _na     237_aa dihydrouracil dehydrogenase (NAD(+))
1082 CAMPUJ010000011.1 GCA946997265_00548 CDS open 13700-14521 _na     273_aa Oxidoreductase NAD-binding domain protein
1083 CAMPUJ010000011.1 GCA946997265_00549 CDS open 14841-17705 _na     954_aa uvrA excinuclease ABC subunit UvrA
1084 CAMPUJ010000011.1 GCA946997265_00550 CDS open 17728-19113 _na     461_aa SWIM zinc finger domain protein
1085 CAMPUJ010000011.1 GCA946997265_00551 CDS open 19115-21451 _na     778_aa DNA 3'-5' helicase
1086 CAMPUJ010000011.1 GCA946997265_00552 CDS open 21610-22566 _na     318_aa 2-nitropropane dioxygenase NPD
1087 CAMPUJ010000011.1 GCA946997265_00553 CDS open 22585-23529 _na     314_aa dapA 4-hydroxy-tetrahydrodipicolinate synthase
1088 CAMPUJ010000011.1 GCA946997265_00554 CDS open 23526-24644 _na     372_aa recF DNA replication/repair protein RecF
1089 CAMPUJ010000011.1 GCA946997265_00555 CDS open 24876-25958 _na     360_aa serC 3-phosphoserine/phosphohydroxythreonine transaminase
1090 CAMPUJ010000011.1 GCA946997265_00556 CDS open 26063-26983 _na     306_aa 4-phosphoerythronate dehydrogenase
1091 CAMPUJ010000011.1 GCA946997265_00557 CDS open 27200-28321 _na     373_aa DUF1015 domain-containing protein
1092 CAMPUJ010000011.1 GCA946997265_00558 CDS open 28546-29238 _na     230_aa L-threonylcarbamoyladenylate synthase
1093 CAMPUJ010000011.1 GCA946997265_00559 CDS open 29301-30686 _na     461_aa Exopolysaccharide biosynthesis polyprenyl glycosylphosphotransferase
1094 CAMPUJ010000011.1 GCA946997265_00560 CDS open 30697-32493 _na     598_aa Cl-channel voltage-gated family protein
1095 CAMPUJ010000011.1 GCA946997265_00561 CDS open 32504-33478 _na     324_aa fmt methionyl-tRNA formyltransferase
1096 CAMPUJ010000011.1 GCA946997265_00562 CDS open 33511-34797 _na     428_aa 3-phosphoshikimate 1-carboxyvinyltransferase
1097 CAMPUJ010000011.1 GCA946997265_00563 CDS open 34816-36477 _na     553_aa DEAD/DEAH box helicase domain protein
1098 CAMPUJ010000011.1 GCA946997265_00564 CDS open 36755-38911 _na     718_aa tetQ Tetracycline resistance protein TetQ
1099 CAMPUJ010000011.1 GCA946997265_00565 CDS open 39321-40823 _na     500_aa mepA Multidrug export protein MepA
1100 CAMPUJ010000011.1 GCA946997265_00566 CDS open 40835-41986 _na     383_aa Metallophosphoesterase
1101 CAMPUJ010000011.1 GCA946997265_00567 CDS open 41991-42980 _na     329_aa hemH ferrochelatase
1102 CAMPUJ010000011.1 GCA946997265_00538 gene open 706-1311 grpE
1103 CAMPUJ010000011.1 GCA946997265_00539 gene open 1347-2507 dnaJ
1104 CAMPUJ010000011.1 GCA946997265_00540 gene open 2563-3801
1105 CAMPUJ010000011.1 GCA946997265_00541 gene open 3798-5351
1106 CAMPUJ010000011.1 GCA946997265_00542 gene open 5363-8695 secA
1107 CAMPUJ010000011.1 GCA946997265_00543 gene open 8780-9721
1108 CAMPUJ010000011.1 GCA946997265_00544 gene open 9741-10307 gmk
1109 CAMPUJ010000011.1 GCA946997265_00545 gene open 10480-11706
1110 CAMPUJ010000011.1 GCA946997265_00547 gene open 12792-13505
1111 CAMPUJ010000011.1 GCA946997265_00548 gene open 13700-14521
1112 CAMPUJ010000011.1 GCA946997265_00549 gene open 14841-17705 uvrA
1113 CAMPUJ010000011.1 GCA946997265_00550 gene open 17728-19113
1114 CAMPUJ010000011.1 GCA946997265_00551 gene open 19115-21451
1115 CAMPUJ010000011.1 GCA946997265_00552 gene open 21610-22566
1116 CAMPUJ010000011.1 GCA946997265_00553 gene open 22585-23529 dapA
1117 CAMPUJ010000011.1 GCA946997265_00554 gene open 23526-24644 recF
1118 CAMPUJ010000011.1 GCA946997265_00555 gene open 24876-25958 serC
1119 CAMPUJ010000011.1 GCA946997265_00556 gene open 26063-26983
1120 CAMPUJ010000011.1 GCA946997265_00557 gene open 27200-28321
1121 CAMPUJ010000011.1 GCA946997265_00558 gene open 28546-29238
1122 CAMPUJ010000011.1 GCA946997265_00559 gene open 29301-30686
1123 CAMPUJ010000011.1 GCA946997265_00560 gene open 30697-32493
1124 CAMPUJ010000011.1 GCA946997265_00561 gene open 32504-33478 fmt
1125 CAMPUJ010000011.1 GCA946997265_00562 gene open 33511-34797
1126 CAMPUJ010000011.1 GCA946997265_00563 gene open 34816-36477
1127 CAMPUJ010000011.1 GCA946997265_00564 gene open 36755-38911 tetQ
1128 CAMPUJ010000011.1 GCA946997265_00565 gene open 39321-40823 mepA
1129 CAMPUJ010000011.1 GCA946997265_00566 gene open 40835-41986
1130 CAMPUJ010000011.1 GCA946997265_00567 gene open 41991-42980 hemH
1131 CAMPUJ010000011.1 GCA946997265_00537 gene open 108-195 trnS
1132 CAMPUJ010000011.1 GCA946997265_00546 gene open 11973-12043 trnC
1133 CAMPUJ010000011.1 GCA946997265_00537 tRNA open 108-195 trnS tRNA-Ser(cga)
1134 CAMPUJ010000011.1 GCA946997265_00546 tRNA open 11973-12043 trnC tRNA-Cys(gca)
1135 CAMPUJ010000012.1 regulatory_region open 10498-10602 SAM-I/IV (S-adenosyl methionine) riboswitch aptamer
1136 CAMPUJ010000012.1 GCA946997265_00568 CDS open 108-1799 _na     563_aa ATPase dynein-related AAA domain-containing protein
1137 CAMPUJ010000012.1 GCA946997265_00569 CDS open 1799-3085 _na     428_aa mcrC 5-methylcytosine restriction system specificity protein McrC
1138 CAMPUJ010000012.1 GCA946997265_00570 CDS open 3240-3536 _na     98_aa hypothetical protein
1139 CAMPUJ010000012.1 GCA946997265_00571 CDS open 3639-4640 _na     333_aa Ig-like domain-containing protein
1140 CAMPUJ010000012.1 GCA946997265_00572 CDS open 4713-6266 _na     517_aa ahpF alkyl hydroperoxide reductase subunit F
1141 CAMPUJ010000012.1 GCA946997265_00573 CDS open 6536-7105 _na     189_aa ahpC alkyl hydroperoxide reductase subunit C
1142 CAMPUJ010000012.1 GCA946997265_00574 CDS open 7502-9814 _na     770_aa TonB-dependent receptor
1143 CAMPUJ010000012.1 GCA946997265_00575 CDS open 10619-11839 _na     406_aa hypothetical protein
1144 CAMPUJ010000012.1 GCA946997265_00576 CDS open 11909-12340 _na     143_aa SprT-like domain-containing protein
1145 CAMPUJ010000012.1 GCA946997265_00577 CDS open 12432-15179 _na     915_aa PD-(D/E)XK nuclease family protein
1146 CAMPUJ010000012.1 GCA946997265_00578 CDS open 15186-18371 _na     1061_aa UvrD-helicase domain-containing protein
1147 CAMPUJ010000012.1 GCA946997265_00579 CDS open 18792-22421 _na     1209_aa nifJ pyruvate:ferredoxin (flavodoxin) oxidoreductase
1148 CAMPUJ010000012.1 GCA946997265_00580 CDS open 22467-23651 _na     394_aa AAA domain-containing protein
1149 CAMPUJ010000012.1 GCA946997265_00581 CDS open 24372-27035 _na     887_aa valine--tRNA ligase
1150 CAMPUJ010000012.1 GCA946997265_00582 CDS open 27079-27468 _na     129_aa Thioesterase superfamily protein
1151 CAMPUJ010000012.1 GCA946997265_00583 CDS open 27476-28081 _na     201_aa Transferase hexapeptide repeat containing protein
1152 CAMPUJ010000012.1 GCA946997265_00584 CDS open 28102-29529 _na     475_aa dnaA chromosomal replication initiator protein DnaA
1153 CAMPUJ010000012.1 GCA946997265_00585 CDS open 30321-33428 _na     1035_aa czcA Heavy metal efflux pump%2C CzcA family
1154 CAMPUJ010000012.1 GCA946997265_00586 CDS open 33445-34506 _na     353_aa Efflux transporter%2C RND family%2C MFP subunit
1155 CAMPUJ010000012.1 GCA946997265_00587 CDS open 34540-35922 _na     460_aa Outer membrane efflux protein
1156 CAMPUJ010000012.1 GCA946997265_00588 CDS open 35909-36520 _na     203_aa tetR Transcriptional regulator%2C TetR family
1157 CAMPUJ010000012.1 GCA946997265_00589 CDS open 37061-38401 _na     446_aa rseP RIP metalloprotease RseP
1158 CAMPUJ010000012.1 GCA946997265_00568 gene open 108-1799
1159 CAMPUJ010000012.1 GCA946997265_00569 gene open 1799-3085 mcrC
1160 CAMPUJ010000012.1 GCA946997265_00570 gene open 3240-3536
1161 CAMPUJ010000012.1 GCA946997265_00571 gene open 3639-4640
1162 CAMPUJ010000012.1 GCA946997265_00572 gene open 4713-6266 ahpF
1163 CAMPUJ010000012.1 GCA946997265_00573 gene open 6536-7105 ahpC
1164 CAMPUJ010000012.1 GCA946997265_00574 gene open 7502-9814
1165 CAMPUJ010000012.1 GCA946997265_00575 gene open 10619-11839
1166 CAMPUJ010000012.1 GCA946997265_00576 gene open 11909-12340
1167 CAMPUJ010000012.1 GCA946997265_00577 gene open 12432-15179
1168 CAMPUJ010000012.1 GCA946997265_00578 gene open 15186-18371
1169 CAMPUJ010000012.1 GCA946997265_00579 gene open 18792-22421 nifJ
1170 CAMPUJ010000012.1 GCA946997265_00580 gene open 22467-23651
1171 CAMPUJ010000012.1 GCA946997265_00581 gene open 24372-27035
1172 CAMPUJ010000012.1 GCA946997265_00582 gene open 27079-27468
1173 CAMPUJ010000012.1 GCA946997265_00583 gene open 27476-28081
1174 CAMPUJ010000012.1 GCA946997265_00584 gene open 28102-29529 dnaA
1175 CAMPUJ010000012.1 GCA946997265_00585 gene open 30321-33428 czcA
1176 CAMPUJ010000012.1 GCA946997265_00586 gene open 33445-34506
1177 CAMPUJ010000012.1 GCA946997265_00587 gene open 34540-35922
1178 CAMPUJ010000012.1 GCA946997265_00588 gene open 35909-36520 tetR
1179 CAMPUJ010000012.1 GCA946997265_00589 gene open 37061-38401 rseP
1180 CAMPUJ010000013.1 regulatory_region open 36752-36811 SAM-II riboswitch aptamer (SAM-II long loop)
1181 CAMPUJ010000013.1 GCA946997265_00590 CDS open 401-1513 _na     370_aa murG undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase
1182 CAMPUJ010000013.1 GCA946997265_00591 CDS open 1549-2922 _na     457_aa murC UDP-N-acetylmuramate--L-alanine ligase
1183 CAMPUJ010000013.1 GCA946997265_00592 CDS open 2926-3705 _na     259_aa ftsQ Cell division protein FtsQ
1184 CAMPUJ010000013.1 GCA946997265_00593 CDS open 3739-5202 _na     487_aa ftsA Cell division protein FtsA
1185 CAMPUJ010000013.1 GCA946997265_00594 CDS open 5254-6675 _na     473_aa ftsZ cell division protein FtsZ
1186 CAMPUJ010000013.1 GCA946997265_00595 CDS open 6691-7443 _na     250_aa mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase
1187 CAMPUJ010000013.1 GCA946997265_00596 CDS open 7513-8679 _na     388_aa PQQ enzyme repeat protein
1188 CAMPUJ010000013.1 GCA946997265_00597 CDS open 8796-10820 _na     674_aa TonB-dependent receptor
1189 CAMPUJ010000013.1 GCA946997265_00598 CDS open 11278-12534 _na     418_aa MATE efflux family protein
1190 CAMPUJ010000013.1 GCA946997265_00599 CDS open 12542-13459 _na     305_aa prmA 50S ribosomal protein L11 methyltransferase
1191 CAMPUJ010000013.1 GCA946997265_00600 CDS open 13580-15553 _na     657_aa gyrB DNA topoisomerase (ATP-hydrolyzing) subunit B
1192 CAMPUJ010000013.1 GCA946997265_00601 CDS open 15563-16408 _na     281_aa Glycosyl transferase family 2
1193 CAMPUJ010000013.1 GCA946997265_00602 CDS open 16432-17448 _na     338_aa Glycosyltransferase%2C group 2 family protein
1194 CAMPUJ010000013.1 GCA946997265_00603 CDS open 17470-18579 _na     369_aa Glycosyltransferase%2C group 1 family protein
1195 CAMPUJ010000013.1 GCA946997265_00604 CDS open 18635-20635 _na     666_aa Arylsulfatase
1196 CAMPUJ010000013.1 GCA946997265_00605 CDS open 21436-24018 _na     860_aa gyrA DNA gyrase subunit A
1197 CAMPUJ010000013.1 GCA946997265_00606 CDS open 24083-25258 _na     391_aa Tetratricopeptide repeat protein
1198 CAMPUJ010000013.1 GCA946997265_00607 CDS open 25422-26693 _na     423_aa Type 9 secretion system plug protein N-terminal domain-containing protein
1199 CAMPUJ010000013.1 GCA946997265_00608 CDS open 26711-28222 _na     503_aa GH3 auxin-responsive promoter
1200 CAMPUJ010000013.1 GCA946997265_00609 CDS open 28603-28905 _na     100_aa PG0541 family transporter-associated protein
1201 CAMPUJ010000013.1 GCA946997265_00610 CDS open 28909-31986 _na     1025_aa czcA Heavy metal efflux pump%2C CzcA family
1202 CAMPUJ010000013.1 GCA946997265_00611 CDS open 32065-33117 _na     350_aa Efflux transporter%2C RND family%2C MFP subunit
1203 CAMPUJ010000013.1 GCA946997265_00612 CDS open 33153-34604 _na     483_aa Outer membrane efflux protein
1204 CAMPUJ010000013.1 GCA946997265_00613 CDS open 34810-35268 _na     152_aa Transcriptional regulator%2C Fur family
1205 CAMPUJ010000013.1 GCA946997265_00614 CDS open 35283-36572 _na     429_aa metK methionine adenosyltransferase
1206 CAMPUJ010000013.1 GCA946997265_00615 CDS open 37019-37489 _na     156_aa Dps family protein
1207 CAMPUJ010000013.1 GCA946997265_00590 gene open 401-1513 murG
1208 CAMPUJ010000013.1 GCA946997265_00591 gene open 1549-2922 murC
1209 CAMPUJ010000013.1 GCA946997265_00592 gene open 2926-3705 ftsQ
1210 CAMPUJ010000013.1 GCA946997265_00593 gene open 3739-5202 ftsA
1211 CAMPUJ010000013.1 GCA946997265_00594 gene open 5254-6675 ftsZ
1212 CAMPUJ010000013.1 GCA946997265_00595 gene open 6691-7443 mtnN
1213 CAMPUJ010000013.1 GCA946997265_00596 gene open 7513-8679
1214 CAMPUJ010000013.1 GCA946997265_00597 gene open 8796-10820
1215 CAMPUJ010000013.1 GCA946997265_00598 gene open 11278-12534
1216 CAMPUJ010000013.1 GCA946997265_00599 gene open 12542-13459 prmA
1217 CAMPUJ010000013.1 GCA946997265_00600 gene open 13580-15553 gyrB
1218 CAMPUJ010000013.1 GCA946997265_00601 gene open 15563-16408
1219 CAMPUJ010000013.1 GCA946997265_00602 gene open 16432-17448
1220 CAMPUJ010000013.1 GCA946997265_00603 gene open 17470-18579
1221 CAMPUJ010000013.1 GCA946997265_00604 gene open 18635-20635
1222 CAMPUJ010000013.1 GCA946997265_00605 gene open 21436-24018 gyrA
1223 CAMPUJ010000013.1 GCA946997265_00606 gene open 24083-25258
1224 CAMPUJ010000013.1 GCA946997265_00607 gene open 25422-26693
1225 CAMPUJ010000013.1 GCA946997265_00608 gene open 26711-28222
1226 CAMPUJ010000013.1 GCA946997265_00609 gene open 28603-28905
1227 CAMPUJ010000013.1 GCA946997265_00610 gene open 28909-31986 czcA
1228 CAMPUJ010000013.1 GCA946997265_00611 gene open 32065-33117
1229 CAMPUJ010000013.1 GCA946997265_00612 gene open 33153-34604
1230 CAMPUJ010000013.1 GCA946997265_00613 gene open 34810-35268
1231 CAMPUJ010000013.1 GCA946997265_00614 gene open 35283-36572 metK
1232 CAMPUJ010000013.1 GCA946997265_00615 gene open 37019-37489
1233 CAMPUJ010000014.1 GCA946997265_00616 CDS open 171-401 _na     76_aa hypothetical protein
1234 CAMPUJ010000014.1 GCA946997265_00617 CDS open 484-1518 _na     344_aa thiL thiamine-phosphate kinase
1235 CAMPUJ010000014.1 GCA946997265_00618 CDS open 1522-2655 _na     377_aa lpxK tetraacyldisaccharide 4'-kinase
1236 CAMPUJ010000014.1 GCA946997265_00619 CDS open 2701-4485 _na     594_aa sppA signal peptide peptidase SppA
1237 CAMPUJ010000014.1 GCA946997265_00620 CDS open 4750-5481 _na     243_aa rsmI 16S rRNA (cytidine(1402)-2'-O)-methyltransferase
1238 CAMPUJ010000014.1 GCA946997265_00621 CDS open 5478-6329 _na     283_aa Lipoprotein
1239 CAMPUJ010000014.1 GCA946997265_00622 CDS open 6429-7157 _na     242_aa yjjG YjjG family noncanonical pyrimidine nucleotidase
1240 CAMPUJ010000014.1 GCA946997265_00623 CDS open 7154-7885 _na     243_aa recO DNA replication/recombination mediator RecO N-terminal domain-containing protein
1241 CAMPUJ010000014.1 GCA946997265_00624 CDS open 8490-9281 _na     263_aa mazG nucleoside triphosphate pyrophosphohydrolase
1242 CAMPUJ010000014.1 GCA946997265_00625 CDS open 9292-10221 _na     309_aa Methyltransferase type 12
1243 CAMPUJ010000014.1 GCA946997265_00626 CDS open 10221-11411 _na     396_aa Phosphate-selective porin O and P
1244 CAMPUJ010000014.1 GCA946997265_00627 CDS open 11508-12023 _na     171_aa helix-turn-helix domain-containing protein
1245 CAMPUJ010000014.1 GCA946997265_00628 CDS open 12781-14262 _na     493_aa fimbria major subunit
1246 CAMPUJ010000014.1 GCA946997265_00629 CDS open 14495-16030 _na     511_aa potassium/proton antiporter
1247 CAMPUJ010000014.1 GCA946997265_00630 CDS open 16702-18441 _na     579_aa lysS lysine--tRNA ligase
1248 CAMPUJ010000014.1 GCA946997265_00631 CDS open 18503-19510 _na     335_aa Glycerol-3-phosphate dehydrogenase
1249 CAMPUJ010000014.1 GCA946997265_00632 CDS open 19546-20913 _na     455_aa glucose-6-phosphate isomerase
1250 CAMPUJ010000014.1 GCA946997265_00633 CDS open 20910-21620 _na     236_aa DUF4290 domain-containing protein
1251 CAMPUJ010000014.1 GCA946997265_00634 CDS open 21665-22975 _na     436_aa murA UDP-N-acetylglucosamine 1-carboxyvinyltransferase
1252 CAMPUJ010000014.1 GCA946997265_00635 CDS open 22968-23513 _na     181_aa rimM ribosome maturation factor RimM
1253 CAMPUJ010000014.1 GCA946997265_00636 CDS open 23545-24690 _na     381_aa dxr 1-deoxy-D-xylulose-5-phosphate reductoisomerase
1254 CAMPUJ010000014.1 GCA946997265_00637 CDS open 24664-24912 _na     82_aa hypothetical protein
1255 CAMPUJ010000014.1 GCA946997265_00638 CDS open 25024-26547 _na     507_aa lysM LysM domain protein
1256 CAMPUJ010000014.1 GCA946997265_00639 CDS open 26557-27234 _na     225_aa Outer membrane protein beta-barrel domain-containing protein
1257 CAMPUJ010000014.1 GCA946997265_00640 CDS open 27234-27923 _na     229_aa CAAX amino terminal protease family protein
1258 CAMPUJ010000014.1 GCA946997265_00641 CDS open 27913-30918 _na     1001_aa PD-(D/E)XK endonuclease-like domain-containing protein
1259 CAMPUJ010000014.1 GCA946997265_00642 CDS open 30957-32366 _na     469_aa Gliding motility-associated C-terminal domain-containing protein
1260 CAMPUJ010000014.1 GCA946997265_00643 CDS open 32385-32999 _na     204_aa putative protein family UPF0029%2C Impact%2C N-terminal protein
1261 CAMPUJ010000014.1 GCA946997265_00644 CDS open 33227-35863 _na     878_aa TonB-dependent receptor
1262 CAMPUJ010000014.1 GCA946997265_00645 CDS open 36442-37722 _na     426_aa ltrA group II intron reverse transcriptase/maturase
1263 CAMPUJ010000014.1 GCA946997265_00616 gene open 171-401
1264 CAMPUJ010000014.1 GCA946997265_00617 gene open 484-1518 thiL
1265 CAMPUJ010000014.1 GCA946997265_00618 gene open 1522-2655 lpxK
1266 CAMPUJ010000014.1 GCA946997265_00619 gene open 2701-4485 sppA
1267 CAMPUJ010000014.1 GCA946997265_00620 gene open 4750-5481 rsmI
1268 CAMPUJ010000014.1 GCA946997265_00621 gene open 5478-6329
1269 CAMPUJ010000014.1 GCA946997265_00622 gene open 6429-7157 yjjG
1270 CAMPUJ010000014.1 GCA946997265_00623 gene open 7154-7885 recO
1271 CAMPUJ010000014.1 GCA946997265_00624 gene open 8490-9281 mazG
1272 CAMPUJ010000014.1 GCA946997265_00625 gene open 9292-10221
1273 CAMPUJ010000014.1 GCA946997265_00626 gene open 10221-11411
1274 CAMPUJ010000014.1 GCA946997265_00627 gene open 11508-12023
1275 CAMPUJ010000014.1 GCA946997265_00628 gene open 12781-14262
1276 CAMPUJ010000014.1 GCA946997265_00629 gene open 14495-16030
1277 CAMPUJ010000014.1 GCA946997265_00630 gene open 16702-18441 lysS
1278 CAMPUJ010000014.1 GCA946997265_00631 gene open 18503-19510
1279 CAMPUJ010000014.1 GCA946997265_00632 gene open 19546-20913
1280 CAMPUJ010000014.1 GCA946997265_00633 gene open 20910-21620
1281 CAMPUJ010000014.1 GCA946997265_00634 gene open 21665-22975 murA
1282 CAMPUJ010000014.1 GCA946997265_00635 gene open 22968-23513 rimM
1283 CAMPUJ010000014.1 GCA946997265_00636 gene open 23545-24690 dxr
1284 CAMPUJ010000014.1 GCA946997265_00637 gene open 24664-24912
1285 CAMPUJ010000014.1 GCA946997265_00638 gene open 25024-26547 lysM
1286 CAMPUJ010000014.1 GCA946997265_00639 gene open 26557-27234
1287 CAMPUJ010000014.1 GCA946997265_00640 gene open 27234-27923
1288 CAMPUJ010000014.1 GCA946997265_00641 gene open 27913-30918
1289 CAMPUJ010000014.1 GCA946997265_00642 gene open 30957-32366
1290 CAMPUJ010000014.1 GCA946997265_00643 gene open 32385-32999
1291 CAMPUJ010000014.1 GCA946997265_00644 gene open 33227-35863
1292 CAMPUJ010000014.1 GCA946997265_00645 gene open 36442-37722 ltrA
1293 CAMPUJ010000015.1 GCA946997265_00646 CDS open 355-1002 _na     215_aa neuD Sugar O-acyltransferase%2C sialic acid O-acetyltransferase NeuD family
1294 CAMPUJ010000015.1 GCA946997265_00647 CDS open 1010-1615 _na     201_aa Bacterial sugar transferase
1295 CAMPUJ010000015.1 GCA946997265_00648 CDS open 1605-3323 _na     572_aa RNA-binding domain-containing protein
1296 CAMPUJ010000015.1 GCA946997265_00649 CDS open 3467-4639 _na     390_aa glycosyltransferase family 4 protein
1297 CAMPUJ010000015.1 GCA946997265_00650 CDS open 4670-5794 _na     374_aa glycosyltransferase
1298 CAMPUJ010000015.1 GCA946997265_00651 CDS open 5922-7109 _na     395_aa glycosyltransferase
1299 CAMPUJ010000015.1 GCA946997265_00652 CDS open 7054-7788 _na     244_aa DUF2334 domain-containing protein
1300 CAMPUJ010000015.1 GCA946997265_00653 CDS open 7872-9053 _na     393_aa hypothetical protein
1301 CAMPUJ010000015.1 GCA946997265_00654 CDS open 9181-10356 _na     391_aa capA CapA family protein
1302 CAMPUJ010000015.1 GCA946997265_00655 CDS open 10353-11621 _na     422_aa oligosaccharide flippase family protein
1303 CAMPUJ010000015.1 GCA946997265_00656 CDS open 11625-12524 _na     299_aa arginase
1304 CAMPUJ010000015.1 GCA946997265_00657 CDS open 12521-13564 _na     347_aa rimK RimK family alpha-L-glutamate ligase
1305 CAMPUJ010000015.1 GCA946997265_00658 CDS open 13629-14696 _na     355_aa acyltransferase
1306 CAMPUJ010000015.1 GCA946997265_00659 CDS open 14727-15260 _na     177_aa hypothetical protein
1307 CAMPUJ010000015.1 GCA946997265_00660 CDS open 15262-16578 _na     438_aa AAA family ATPase
1308 CAMPUJ010000015.1 GCA946997265_00661 CDS open 16642-17919 _na     425_aa nucleotide sugar dehydrogenase
1309 CAMPUJ010000015.1 GCA946997265_00662 CDS open 17928-18458 _na     176_aa Transposase
1310 CAMPUJ010000015.1 GCA946997265_00663 CDS open 18455-19474 _na     339_aa ATPase AAA-type core domain-containing protein
1311 CAMPUJ010000015.1 GCA946997265_00664 CDS open 19520-20488 _na     322_aa NAD-dependent epimerase/dehydratase family protein
1312 CAMPUJ010000015.1 GCA946997265_00665 CDS open 20607-20819 _na     70_aa hypothetical protein
1313 CAMPUJ010000015.1 GCA946997265_00666 CDS open 20962-21543 _na     193_aa dTTP/UTP pyrophosphatase
1314 CAMPUJ010000015.1 GCA946997265_00667 CDS open 21540-22322 _na     260_aa DUF2520 domain-containing protein
1315 CAMPUJ010000015.1 GCA946997265_00668 CDS open 22528-25629 _na     1033_aa pntB Re/Si-specific NAD(P)(+) transhydrogenase subunit beta
1316 CAMPUJ010000015.1 GCA946997265_00669 CDS open 25626-25934 _na     102_aa proton-translocating NAD(P)(+) transhydrogenase
1317 CAMPUJ010000015.1 GCA946997265_00670 CDS open 26082-27248 _na     388_aa proton-translocating NAD(P)(+) transhydrogenase
1318 CAMPUJ010000015.1 GCA946997265_00671 CDS open 27417-27848 _na     143_aa hypothetical protein
1319 CAMPUJ010000015.1 GCA946997265_00672 CDS open 27681-29294 _na     537_aa pckA phosphoenolpyruvate carboxykinase (ATP)
1320 CAMPUJ010000015.1 GCA946997265_00673 CDS open 29445-29624 _na     59_aa hypothetical protein
1321 CAMPUJ010000015.1 GCA946997265_00674 CDS open 29902-30630 _na     242_aa Transmembrane protein
1322 CAMPUJ010000015.1 GCA946997265_00675 CDS open 30646-31140 _na     164_aa thrE Threonine/Serine exporter ThrE domain-containing protein
1323 CAMPUJ010000015.1 GCA946997265_00676 CDS open 31137-31913 _na     258_aa Threonine/serine exporter-like N-terminal domain-containing protein
1324 CAMPUJ010000015.1 GCA946997265_00677 CDS open 32147-32575 _na     142_aa Ferric uptake regulator%2C Fur family
1325 CAMPUJ010000015.1 GCA946997265_00678 CDS open 32806-34725 _na     639_aa dnaK molecular chaperone DnaK
1326 CAMPUJ010000015.1 GCA946997265_00679 CDS open 34916-37387 _na     823_aa TonB-dependent receptor
1327 CAMPUJ010000015.1 GCA946997265_00646 gene open 355-1002 neuD
1328 CAMPUJ010000015.1 GCA946997265_00647 gene open 1010-1615
1329 CAMPUJ010000015.1 GCA946997265_00648 gene open 1605-3323
1330 CAMPUJ010000015.1 GCA946997265_00649 gene open 3467-4639
1331 CAMPUJ010000015.1 GCA946997265_00650 gene open 4670-5794
1332 CAMPUJ010000015.1 GCA946997265_00651 gene open 5922-7109
1333 CAMPUJ010000015.1 GCA946997265_00652 gene open 7054-7788
1334 CAMPUJ010000015.1 GCA946997265_00653 gene open 7872-9053
1335 CAMPUJ010000015.1 GCA946997265_00654 gene open 9181-10356 capA
1336 CAMPUJ010000015.1 GCA946997265_00655 gene open 10353-11621
1337 CAMPUJ010000015.1 GCA946997265_00656 gene open 11625-12524
1338 CAMPUJ010000015.1 GCA946997265_00657 gene open 12521-13564 rimK
1339 CAMPUJ010000015.1 GCA946997265_00658 gene open 13629-14696
1340 CAMPUJ010000015.1 GCA946997265_00659 gene open 14727-15260
1341 CAMPUJ010000015.1 GCA946997265_00660 gene open 15262-16578
1342 CAMPUJ010000015.1 GCA946997265_00661 gene open 16642-17919
1343 CAMPUJ010000015.1 GCA946997265_00662 gene open 17928-18458
1344 CAMPUJ010000015.1 GCA946997265_00663 gene open 18455-19474
1345 CAMPUJ010000015.1 GCA946997265_00664 gene open 19520-20488
1346 CAMPUJ010000015.1 GCA946997265_00665 gene open 20607-20819
1347 CAMPUJ010000015.1 GCA946997265_00666 gene open 20962-21543
1348 CAMPUJ010000015.1 GCA946997265_00667 gene open 21540-22322
1349 CAMPUJ010000015.1 GCA946997265_00668 gene open 22528-25629 pntB
1350 CAMPUJ010000015.1 GCA946997265_00669 gene open 25626-25934
1351 CAMPUJ010000015.1 GCA946997265_00670 gene open 26082-27248
1352 CAMPUJ010000015.1 GCA946997265_00671 gene open 27417-27848
1353 CAMPUJ010000015.1 GCA946997265_00672 gene open 27681-29294 pckA
1354 CAMPUJ010000015.1 GCA946997265_00673 gene open 29445-29624
1355 CAMPUJ010000015.1 GCA946997265_00674 gene open 29902-30630
1356 CAMPUJ010000015.1 GCA946997265_00675 gene open 30646-31140 thrE
1357 CAMPUJ010000015.1 GCA946997265_00676 gene open 31137-31913
1358 CAMPUJ010000015.1 GCA946997265_00677 gene open 32147-32575
1359 CAMPUJ010000015.1 GCA946997265_00678 gene open 32806-34725 dnaK
1360 CAMPUJ010000015.1 GCA946997265_00679 gene open 34916-37387
1361 CAMPUJ010000016.1 regulatory_region open 6530-6567 DUF805b RNA
1362 CAMPUJ010000016.1 GCA946997265_00680 CDS open 290-688 _na     132_aa hypothetical protein
1363 CAMPUJ010000016.1 GCA946997265_00681 CDS open 693-1049 _na     118_aa DUF4339 domain-containing protein
1364 CAMPUJ010000016.1 GCA946997265_00682 CDS open 1070-2401 _na     443_aa SPFH domain-containing protein
1365 CAMPUJ010000016.1 GCA946997265_00683 CDS open 2479-2904 _na     141_aa hypothetical protein
1366 CAMPUJ010000016.1 GCA946997265_00684 CDS open 2908-3087 _na     59_aa hypothetical protein
1367 CAMPUJ010000016.1 GCA946997265_00685 CDS open 3101-3850 _na     249_aa hypothetical protein
1368 CAMPUJ010000016.1 GCA946997265_00686 CDS open 3863-5017 _na     384_aa asparagine synthase-related protein
1369 CAMPUJ010000016.1 GCA946997265_00687 CDS open 5014-5559 _na     181_aa lasso peptide biosynthesis protein
1370 CAMPUJ010000016.1 GCA946997265_00688 CDS open 5556-6269 _na     237_aa hypothetical protein
1371 CAMPUJ010000016.1 GCA946997265_00689 CDS open 6673-7011 _na     112_aa hypothetical protein
1372 CAMPUJ010000016.1 GCA946997265_00690 CDS open 7068-7778 _na     236_aa hypothetical protein
1373 CAMPUJ010000016.1 GCA946997265_00691 CDS open 8673-9143 _na     156_aa hypothetical protein
1374 CAMPUJ010000016.1 GCA946997265_00692 CDS open 9423-10448 _na     341_aa pheS phenylalanine--tRNA ligase subunit alpha
1375 CAMPUJ010000016.1 GCA946997265_00693 CDS open 10461-11105 _na     214_aa nth endonuclease III
1376 CAMPUJ010000016.1 GCA946997265_00694 CDS open 11130-12947 _na     605_aa DNA topoisomerase
1377 CAMPUJ010000016.1 GCA946997265_00695 CDS open 12961-13926 _na     321_aa prfB peptide chain release factor 2
1378 CAMPUJ010000016.1 GCA946997265_00696 CDS open 14162-15973 _na     603_aa AMP-binding enzyme
1379 CAMPUJ010000016.1 GCA946997265_00697 CDS open 16029-16697 _na     222_aa marR Transcriptional regulator%2C MarR family
1380 CAMPUJ010000016.1 GCA946997265_00698 CDS open 18093-18977 _na     294_aa araC Transcriptional regulator%2C AraC family
1381 CAMPUJ010000016.1 GCA946997265_00699 CDS open 19318-22281 _na     987_aa lptD LPS-assembly protein LptD central domain-containing protein
1382 CAMPUJ010000016.1 GCA946997265_00700 CDS open 22317-23039 _na     240_aa Peptidase%2C S54 family
1383 CAMPUJ010000016.1 GCA946997265_00701 CDS open 23008-23814 _na     268_aa Peptidase%2C S54 family
1384 CAMPUJ010000016.1 GCA946997265_00702 CDS open 23826-25007 _na     393_aa Endonuclease/exonuclease/phosphatase family protein
1385 CAMPUJ010000016.1 GCA946997265_00703 CDS open 25469-27679 _na     736_aa polyribonucleotide nucleotidyltransferase
1386 CAMPUJ010000016.1 GCA946997265_00704 CDS open 27861-29132 _na     423_aa Major facilitator superfamily MFS_1
1387 CAMPUJ010000016.1 GCA946997265_00705 CDS open 29173-29589 _na     138_aa C-type lysozyme inhibitor domain-containing protein
1388 CAMPUJ010000016.1 GCA946997265_00706 CDS open 29691-30140 _na     149_aa hypothetical protein
1389 CAMPUJ010000016.1 GCA946997265_00707 CDS open 30173-30742 _na     189_aa Corrinoid adenosyltransferase
1390 CAMPUJ010000016.1 GCA946997265_00708 CDS open 30935-31540 _na     201_aa luxR Transcriptional regulator%2C LuxR family
1391 CAMPUJ010000016.1 GCA946997265_00709 CDS open 31555-32277 _na     240_aa Hemerythrin-like domain-containing protein
1392 CAMPUJ010000016.1 GCA946997265_00710 CDS open 32959-33663 _na     234_aa Succinate dehydrogenase cytochrome B subunit%2C b558 family
1393 CAMPUJ010000016.1 GCA946997265_00711 CDS open 33693-35636 _na     647_aa Succinate dehydrogenase flavoprotein subunit
1394 CAMPUJ010000016.1 GCA946997265_00712 CDS open 35661-36416 _na     251_aa Succinate dehydrogenase/fumarate reductase iron-sulfur subunit
1395 CAMPUJ010000016.1 GCA946997265_00713 CDS open 36546-36917 _na     123_aa crcB fluoride efflux transporter CrcB
1396 CAMPUJ010000016.1 GCA946997265_00680 gene open 290-688
1397 CAMPUJ010000016.1 GCA946997265_00681 gene open 693-1049
1398 CAMPUJ010000016.1 GCA946997265_00682 gene open 1070-2401
1399 CAMPUJ010000016.1 GCA946997265_00683 gene open 2479-2904
1400 CAMPUJ010000016.1 GCA946997265_00684 gene open 2908-3087
1401 CAMPUJ010000016.1 GCA946997265_00685 gene open 3101-3850
1402 CAMPUJ010000016.1 GCA946997265_00686 gene open 3863-5017
1403 CAMPUJ010000016.1 GCA946997265_00687 gene open 5014-5559
1404 CAMPUJ010000016.1 GCA946997265_00688 gene open 5556-6269
1405 CAMPUJ010000016.1 GCA946997265_00689 gene open 6673-7011
1406 CAMPUJ010000016.1 GCA946997265_00690 gene open 7068-7778
1407 CAMPUJ010000016.1 GCA946997265_00691 gene open 8673-9143
1408 CAMPUJ010000016.1 GCA946997265_00692 gene open 9423-10448 pheS
1409 CAMPUJ010000016.1 GCA946997265_00693 gene open 10461-11105 nth
1410 CAMPUJ010000016.1 GCA946997265_00694 gene open 11130-12947
1411 CAMPUJ010000016.1 GCA946997265_00695 gene open 12961-13926 prfB
1412 CAMPUJ010000016.1 GCA946997265_00696 gene open 14162-15973
1413 CAMPUJ010000016.1 GCA946997265_00697 gene open 16029-16697 marR
1414 CAMPUJ010000016.1 GCA946997265_00698 gene open 18093-18977 araC
1415 CAMPUJ010000016.1 GCA946997265_00699 gene open 19318-22281 lptD
1416 CAMPUJ010000016.1 GCA946997265_00700 gene open 22317-23039
1417 CAMPUJ010000016.1 GCA946997265_00701 gene open 23008-23814
1418 CAMPUJ010000016.1 GCA946997265_00702 gene open 23826-25007
1419 CAMPUJ010000016.1 GCA946997265_00703 gene open 25469-27679
1420 CAMPUJ010000016.1 GCA946997265_00704 gene open 27861-29132
1421 CAMPUJ010000016.1 GCA946997265_00705 gene open 29173-29589
1422 CAMPUJ010000016.1 GCA946997265_00706 gene open 29691-30140
1423 CAMPUJ010000016.1 GCA946997265_00707 gene open 30173-30742
1424 CAMPUJ010000016.1 GCA946997265_00708 gene open 30935-31540 luxR
1425 CAMPUJ010000016.1 GCA946997265_00709 gene open 31555-32277
1426 CAMPUJ010000016.1 GCA946997265_00710 gene open 32959-33663
1427 CAMPUJ010000016.1 GCA946997265_00711 gene open 33693-35636
1428 CAMPUJ010000016.1 GCA946997265_00712 gene open 35661-36416
1429 CAMPUJ010000016.1 GCA946997265_00713 gene open 36546-36917 crcB
1430 CAMPUJ010000017.1 GCA946997265_00714 CDS open 315-767 _na     150_aa FHA domain-containing protein
1431 CAMPUJ010000017.1 GCA946997265_00715 CDS open 790-2103 _na     437_aa UPF0597 protein Poras_0072
1432 CAMPUJ010000017.1 GCA946997265_00716 CDS open 2189-3604 _na     471_aa asnS asparagine--tRNA ligase
1433 CAMPUJ010000017.1 GCA946997265_00717 CDS open 3633-5051 _na     472_aa Pseudouridine synthase
1434 CAMPUJ010000017.1 GCA946997265_00718 CDS open 5224-6558 _na     444_aa purB adenylosuccinate lyase
1435 CAMPUJ010000017.1 GCA946997265_00719 CDS open 6740-7087 _na     115_aa rplT 50S ribosomal protein L20
1436 CAMPUJ010000017.1 GCA946997265_00720 CDS open 7147-7341 _na     64_aa rpmI 50S ribosomal protein L35
1437 CAMPUJ010000017.1 GCA946997265_00721 CDS open 7501-8130 _na     209_aa infC translation initiation factor IF-3
1438 CAMPUJ010000017.1 GCA946997265_00722 CDS open 8233-10227 _na     664_aa thrS threonine--tRNA ligase
1439 CAMPUJ010000017.1 GCA946997265_00723 CDS open 10687-13116 _na     809_aa Lipoprotein
1440 CAMPUJ010000017.1 GCA946997265_00724 CDS open 13127-14068 _na     313_aa FimB/Mfa2 family fimbrial subunit
1441 CAMPUJ010000017.1 GCA946997265_00725 CDS open 14212-15324 _na     370_aa Major fimbrial subunit protein N-terminal domain-containing protein
1442 CAMPUJ010000017.1 GCA946997265_00726 CDS open 15371-16495 _na     374_aa DUF1735 domain-containing protein
1443 CAMPUJ010000017.1 GCA946997265_00727 CDS open 17238-17516 _na     92_aa Txe/YoeB family addiction module toxin
1444 CAMPUJ010000017.1 GCA946997265_00728 CDS open 17521-17778 _na     85_aa hypothetical protein
1445 CAMPUJ010000017.1 GCA946997265_00729 CDS open 17970-18545 _na     191_aa Glutamine amidotransferase%2C class I
1446 CAMPUJ010000017.1 GCA946997265_00730 CDS open 18613-19581 _na     322_aa aminodeoxychorismate synthase component I
1447 CAMPUJ010000017.1 GCA946997265_00731 CDS open 19578-20183 _na     201_aa Aminotransferase%2C class IV
1448 CAMPUJ010000017.1 GCA946997265_00732 CDS open 20910-21167 _na     85_aa hypothetical protein
1449 CAMPUJ010000017.1 GCA946997265_00733 CDS open 21472-22473 _na     333_aa Ig-like domain-containing protein
1450 CAMPUJ010000017.1 GCA946997265_00734 CDS open 22498-22713 _na     71_aa hypothetical protein
1451 CAMPUJ010000017.1 GCA946997265_00735 CDS open 22612-23409 _na     265_aa thymidylate synthase
1452 CAMPUJ010000017.1 GCA946997265_00736 CDS open 23716-25446 _na     576_aa Butyryl-CoA dehydrogenase
1453 CAMPUJ010000017.1 GCA946997265_00737 CDS open 25468-26481 _na     337_aa Electron transfer flavoprotein FAD-binding domain protein
1454 CAMPUJ010000017.1 GCA946997265_00738 CDS open 26522-27406 _na     294_aa Electron transfer flavoprotein domain protein
1455 CAMPUJ010000017.1 GCA946997265_00739 CDS open 27427-28140 _na     237_aa tsaB tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB
1456 CAMPUJ010000017.1 GCA946997265_00740 CDS open 28113-28760 _na     215_aa pdxH pyridoxamine 5'-phosphate oxidase
1457 CAMPUJ010000017.1 GCA946997265_00741 CDS open 29121-31967 _na     948_aa polA DNA polymerase I
1458 CAMPUJ010000017.1 GCA946997265_00742 CDS open 31994-32599 _na     201_aa Maltose O-acetyltransferase
1459 CAMPUJ010000017.1 GCA946997265_00743 CDS open 32825-33604 _na     259_aa Two component transcriptional regulator%2C LytTR family
1460 CAMPUJ010000017.1 GCA946997265_00744 CDS open 33609-36647 _na     1012_aa Signal transduction histidine kinase
1461 CAMPUJ010000017.1 GCA946997265_00714 gene open 315-767
1462 CAMPUJ010000017.1 GCA946997265_00715 gene open 790-2103
1463 CAMPUJ010000017.1 GCA946997265_00716 gene open 2189-3604 asnS
1464 CAMPUJ010000017.1 GCA946997265_00717 gene open 3633-5051
1465 CAMPUJ010000017.1 GCA946997265_00718 gene open 5224-6558 purB
1466 CAMPUJ010000017.1 GCA946997265_00719 gene open 6740-7087 rplT
1467 CAMPUJ010000017.1 GCA946997265_00720 gene open 7147-7341 rpmI
1468 CAMPUJ010000017.1 GCA946997265_00721 gene open 7501-8130 infC
1469 CAMPUJ010000017.1 GCA946997265_00722 gene open 8233-10227 thrS
1470 CAMPUJ010000017.1 GCA946997265_00723 gene open 10687-13116
1471 CAMPUJ010000017.1 GCA946997265_00724 gene open 13127-14068
1472 CAMPUJ010000017.1 GCA946997265_00725 gene open 14212-15324
1473 CAMPUJ010000017.1 GCA946997265_00726 gene open 15371-16495
1474 CAMPUJ010000017.1 GCA946997265_00727 gene open 17238-17516
1475 CAMPUJ010000017.1 GCA946997265_00728 gene open 17521-17778
1476 CAMPUJ010000017.1 GCA946997265_00729 gene open 17970-18545
1477 CAMPUJ010000017.1 GCA946997265_00730 gene open 18613-19581
1478 CAMPUJ010000017.1 GCA946997265_00731 gene open 19578-20183
1479 CAMPUJ010000017.1 GCA946997265_00732 gene open 20910-21167
1480 CAMPUJ010000017.1 GCA946997265_00733 gene open 21472-22473
1481 CAMPUJ010000017.1 GCA946997265_00734 gene open 22498-22713
1482 CAMPUJ010000017.1 GCA946997265_00735 gene open 22612-23409
1483 CAMPUJ010000017.1 GCA946997265_00736 gene open 23716-25446
1484 CAMPUJ010000017.1 GCA946997265_00737 gene open 25468-26481
1485 CAMPUJ010000017.1 GCA946997265_00738 gene open 26522-27406
1486 CAMPUJ010000017.1 GCA946997265_00739 gene open 27427-28140 tsaB
1487 CAMPUJ010000017.1 GCA946997265_00740 gene open 28113-28760 pdxH
1488 CAMPUJ010000017.1 GCA946997265_00741 gene open 29121-31967 polA
1489 CAMPUJ010000017.1 GCA946997265_00742 gene open 31994-32599
1490 CAMPUJ010000017.1 GCA946997265_00743 gene open 32825-33604
1491 CAMPUJ010000017.1 GCA946997265_00744 gene open 33609-36647
1492 CAMPUJ010000018.1 repeat_region open 35304-36219 CRISPR array with 14 repeats of length 33%2C consensus sequence GTCGCACCCCGCACGGGGTGCGTGAATTGAAAC and spacer length 34
1493 CAMPUJ010000018.1 GCA946997265_00745 CDS open 272-1444 _na     390_aa Putative cytochrome d ubiquinol oxidase%2C subunit II
1494 CAMPUJ010000018.1 GCA946997265_00746 CDS open 1473-3104 _na     543_aa Bacterial cytochrome ubiquinol oxidase
1495 CAMPUJ010000018.1 GCA946997265_00747 CDS open 3122-3403 _na     93_aa DUF4492 domain-containing protein
1496 CAMPUJ010000018.1 GCA946997265_00748 CDS open 3500-4042 _na     180_aa Arginine repressor
1497 CAMPUJ010000018.1 GCA946997265_00749 CDS open 4573-5511 _na     312_aa Ribose-phosphate pyrophosphokinase
1498 CAMPUJ010000018.1 GCA946997265_00750 CDS open 5657-6472 _na     271_aa yfiO Outer membrane assembly lipoprotein YfiO
1499 CAMPUJ010000018.1 GCA946997265_00751 CDS open 6531-6866 _na     111_aa DNA-directed RNA polymerase
1500 CAMPUJ010000018.1 GCA946997265_00752 CDS open 6899-7360 _na     153_aa DUF4293 domain-containing protein