HOMD Banner
Taxonomy: V4.3   |  16S rRNA RefSeq: V16.03   |  Genomic RefSeq: V11.03   |  Viruses: V1.2

BAKTAGenome Explorer: Megasphaera lornae (GCA_946997615.1)

Select a Genome:
BAKTA Annotations for GCA_946997615.1
Genome Selected: Megasphaera lornae
ContigsBases CDSrRNA tmRNAtRNA
14 1649515 1521 0 1 44
[Table]   [AA Fasta]      [Browser]   [Text]   [Excel]  
Search & Sort all 3170 Records
Search These Records: Clear
Sort Column:   Molecule   PID   NA   AA   Gene  Gene Product  Reverse
Annotation Table [page:6]    |    Number of Records Found: 3170 [7 Pages]    |    Previous Page <==> Next Page    |    Jump to Page: [ 1  2  3  4  5  6  7  ]
Notes:   1- Column headers only sort the current page. 2- Select [NA] or [AA] links to show sequences.
Region Protein-ID Type Genome
Viewer		 Range
(bp)		 Show Sequences
(length) NA / AA		 BAKTA
Gene		 BAKTA
GeneProduct
2501 CAMPVW010000008.1 GCA946997615_01208 gene open 13696-14703 araC
2502 CAMPVW010000008.1 GCA946997615_01209 gene open 14775-15599
2503 CAMPVW010000008.1 GCA946997615_01210 gene open 15674-17182
2504 CAMPVW010000008.1 GCA946997615_01211 gene open 17570-18481 lysR
2505 CAMPVW010000008.1 GCA946997615_01212 gene open 18927-22448 nifJ
2506 CAMPVW010000008.1 GCA946997615_01213 gene open 22618-23088
2507 CAMPVW010000008.1 GCA946997615_01214 gene open 23167-23712
2508 CAMPVW010000008.1 GCA946997615_01215 gene open 23997-25469
2509 CAMPVW010000008.1 GCA946997615_01216 gene open 25453-26862
2510 CAMPVW010000008.1 GCA946997615_01217 gene open 27428-28003
2511 CAMPVW010000008.1 GCA946997615_01218 gene open 28061-29305
2512 CAMPVW010000008.1 GCA946997615_01219 gene open 29318-29545
2513 CAMPVW010000008.1 GCA946997615_01220 gene open 29623-29829
2514 CAMPVW010000008.1 GCA946997615_01221 gene open 30071-30502
2515 CAMPVW010000008.1 GCA946997615_01222 gene open 30502-32166 argS
2516 CAMPVW010000008.1 GCA946997615_01223 gene open 32229-33842
2517 CAMPVW010000008.1 GCA946997615_01224 gene open 34460-35800 rsxC
2518 CAMPVW010000008.1 GCA946997615_01225 gene open 35829-36854
2519 CAMPVW010000008.1 GCA946997615_01226 gene open 36856-37410
2520 CAMPVW010000008.1 GCA946997615_01227 gene open 37410-38033
2521 CAMPVW010000008.1 GCA946997615_01228 gene open 38033-38608
2522 CAMPVW010000008.1 GCA946997615_01229 gene open 38633-39481 rnfB
2523 CAMPVW010000008.1 GCA946997615_01230 gene open 39486-40547
2524 CAMPVW010000008.1 GCA946997615_01231 gene open 40694-41134 asnC
2525 CAMPVW010000008.1 GCA946997615_01232 gene open 41272-43173 abc-f
2526 CAMPVW010000008.1 GCA946997615_01233 gene open 43328-44737 glcD
2527 CAMPVW010000008.1 GCA946997615_01234 gene open 45057-46577
2528 CAMPVW010000008.1 GCA946997615_01235 gene open 46594-47973 fumC
2529 CAMPVW010000008.1 GCA946997615_01236 gene open 48183-48947
2530 CAMPVW010000008.1 GCA946997615_01237 gene open 48934-50103
2531 CAMPVW010000008.1 GCA946997615_01238 gene open 50091-50630 bioX
2532 CAMPVW010000008.1 GCA946997615_01239 gene open 50845-51330
2533 CAMPVW010000008.1 GCA946997615_01240 gene open 51346-51693 ylbF
2534 CAMPVW010000008.1 GCA946997615_01241 gene open 51683-52606 murB
2535 CAMPVW010000008.1 GCA946997615_01242 gene open 52757-54562 typA
2536 CAMPVW010000008.1 GCA946997615_01243 gene open 54696-54962
2537 CAMPVW010000008.1 GCA946997615_01244 gene open 55394-56818
2538 CAMPVW010000008.1 GCA946997615_01245 gene open 57143-58024
2539 CAMPVW010000008.1 GCA946997615_01246 gene open 58021-60075
2540 CAMPVW010000008.1 GCA946997615_01247 gene open 60370-61569 alr
2541 CAMPVW010000008.1 GCA946997615_01248 gene open 61834-63012
2542 CAMPVW010000008.1 GCA946997615_01249 gene open 63560-63961
2543 CAMPVW010000008.1 GCA946997615_01250 gene open 63977-64399 yhaI
2544 CAMPVW010000008.1 GCA946997615_01251 gene open 64709-64861
2545 CAMPVW010000008.1 GCA946997615_01252 gene open 64901-65461 araC
2546 CAMPVW010000008.1 GCA946997615_01253 gene open 65733-65948 feoA
2547 CAMPVW010000008.1 GCA946997615_01254 gene open 65966-66187 feoA
2548 CAMPVW010000008.1 GCA946997615_01255 gene open 66204-68387 feoB
2549 CAMPVW010000008.1 GCA946997615_01256 gene open 68415-68543
2550 CAMPVW010000008.1 GCA946997615_01257 gene open 68703-69977
2551 CAMPVW010000008.1 GCA946997615_01258 gene open 70038-72254 pcrA
2552 CAMPVW010000008.1 GCA946997615_01259 gene open 72274-74280 ligA
2553 CAMPVW010000008.1 GCA946997615_01260 gene open 74351-74641 gatC
2554 CAMPVW010000008.1 GCA946997615_01261 gene open 74653-76119 gatA
2555 CAMPVW010000008.1 GCA946997615_01262 gene open 76116-77558 gatB
2556 CAMPVW010000008.1 GCA946997615_01263 gene open 77763-79220 sdcS
2557 CAMPVW010000008.1 GCA946997615_01264 gene open 79239-79811
2558 CAMPVW010000008.1 GCA946997615_01265 gene open 79828-81327
2559 CAMPVW010000008.1 GCA946997615_01266 gene open 81749-82426
2560 CAMPVW010000008.1 GCA946997615_01267 gene open 82864-87750
2561 CAMPVW010000008.1 GCA946997615_01268 gene open 87689-87886
2562 CAMPVW010000008.1 GCA946997615_01269 gene open 87922-90063 uvrB
2563 CAMPVW010000008.1 GCA946997615_01270 gene open 90069-92933 uvrA
2564 CAMPVW010000008.1 GCA946997615_01271 gene open 92923-94761 uvrC
2565 CAMPVW010000008.1 GCA946997615_01272 gene open 94830-95465
2566 CAMPVW010000008.1 GCA946997615_01273 gene open 95819-95980
2567 CAMPVW010000008.1 GCA946997615_01274 gene open 96248-97441
2568 CAMPVW010000008.1 GCA946997615_01275 gene open 97735-102660
2569 CAMPVW010000008.1 GCA946997615_01276 gene open 104428-105414
2570 CAMPVW010000009.1 GCA946997615_01284 gene open 7072-7108 abiF
2571 CAMPVW010000009.1 GCA946997615_01284 ncRNA open 7072-7108 abiF abiF RNA
2572 CAMPVW010000009.1 regulatory_region open 15006-15107 SAM riboswitch aptamer (S box leader)
2573 CAMPVW010000009.1 regulatory_region open 27059-27192 FMN riboswitch aptamer (RFN element)
2574 CAMPVW010000009.1 GCA946997615_01277 CDS open 556-1401 _na     281_aa Phosphate-binding protein
2575 CAMPVW010000009.1 GCA946997615_01278 CDS open 1466-2332 _na     288_aa pstC phosphate ABC transporter permease subunit PstC
2576 CAMPVW010000009.1 GCA946997615_01279 CDS open 2384-3196 _na     270_aa pstA phosphate ABC transporter permease PstA
2577 CAMPVW010000009.1 GCA946997615_01280 CDS open 3197-3973 _na     258_aa pstB phosphate ABC transporter ATP-binding protein PstB
2578 CAMPVW010000009.1 GCA946997615_01281 CDS open 3973-4644 _na     223_aa phoU phosphate signaling complex protein PhoU
2579 CAMPVW010000009.1 GCA946997615_01282 CDS open 4619-5299 _na     226_aa Stage 0 sporulation A-like protein
2580 CAMPVW010000009.1 GCA946997615_01283 CDS open 5289-6953 _na     554_aa histidine kinase
2581 CAMPVW010000009.1 GCA946997615_01285 CDS open 7509-9641 _na     710_aa Hep/Hag repeat protein
2582 CAMPVW010000009.1 GCA946997615_01286 CDS open 10048-11442 _na     464_aa Permease
2583 CAMPVW010000009.1 GCA946997615_01287 CDS open 11671-12561 _na     296_aa TIGR00255-like family protein
2584 CAMPVW010000009.1 GCA946997615_01288 CDS open 12571-12855 _na     94_aa remA extracellular matrix/biofilm regulator RemA
2585 CAMPVW010000009.1 GCA946997615_01289 CDS open 12825-13475 _na     216_aa gmk guanylate kinase
2586 CAMPVW010000009.1 GCA946997615_01290 CDS open 13493-13702 _na     69_aa rpoZ DNA-directed RNA polymerase subunit omega
2587 CAMPVW010000009.1 GCA946997615_01291 CDS open 13720-14949 _na     409_aa coaBC bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC
2588 CAMPVW010000009.1 GCA946997615_01292 CDS open 15160-16353 _na     397_aa metK methionine adenosyltransferase
2589 CAMPVW010000009.1 GCA946997615_01293 CDS open 16464-18824 _na     786_aa priA primosomal protein N'
2590 CAMPVW010000009.1 GCA946997615_01294 CDS open 18850-19365 _na     171_aa def peptide deformylase
2591 CAMPVW010000009.1 GCA946997615_01295 CDS open 19362-20300 _na     312_aa fmt methionyl-tRNA formyltransferase
2592 CAMPVW010000009.1 GCA946997615_01296 CDS open 20375-21703 _na     442_aa rsmB 16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB
2593 CAMPVW010000009.1 GCA946997615_01297 CDS open 21705-22742 _na     345_aa rlmN 23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN
2594 CAMPVW010000009.1 GCA946997615_01298 CDS open 22800-23510 _na     236_aa Stp1/IreP family PP2C-type Ser/Thr phosphatase
2595 CAMPVW010000009.1 GCA946997615_01299 CDS open 23521-25461 _na     646_aa pknB Stk1 family PASTA domain-containing Ser/Thr kinase
2596 CAMPVW010000009.1 GCA946997615_01300 CDS open 25481-26338 _na     285_aa rsgA ribosome small subunit-dependent GTPase A
2597 CAMPVW010000009.1 GCA946997615_01301 CDS open 26340-26987 _na     215_aa rpe ribulose-phosphate 3-epimerase
2598 CAMPVW010000009.1 GCA946997615_01302 CDS open 27146-28417 _na     423_aa ribD bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD
2599 CAMPVW010000009.1 GCA946997615_01303 CDS open 28398-29048 _na     216_aa ribE riboflavin synthase
2600 CAMPVW010000009.1 GCA946997615_01304 CDS open 29076-29540 _na     154_aa ribE 6%2C7-dimethyl-8-ribityllumazine synthase
2601 CAMPVW010000009.1 GCA946997615_01305 CDS open 29836-30699 _na     287_aa ylqF ribosome biogenesis GTPase YlqF
2602 CAMPVW010000009.1 GCA946997615_01306 CDS open 30696-31490 _na     264_aa ribonuclease HII
2603 CAMPVW010000009.1 GCA946997615_01307 CDS open 31561-31956 _na     131_aa Amidohydrolase
2604 CAMPVW010000009.1 GCA946997615_01308 CDS open 31953-32690 _na     245_aa Amidohydrolase
2605 CAMPVW010000009.1 GCA946997615_01309 CDS open 32900-34798 _na     632_aa Glutamine-dependent NAD(+) synthetase
2606 CAMPVW010000009.1 GCA946997615_01310 CDS open 34910-35473 _na     187_aa Flavin reductase
2607 CAMPVW010000009.1 GCA946997615_01311 CDS open 35693-36148 _na     151_aa Firmicute transcriptional repressor of class III stress
2608 CAMPVW010000009.1 GCA946997615_01312 CDS open 36162-36611 _na     149_aa UVR domain-containing protein
2609 CAMPVW010000009.1 GCA946997615_01313 CDS open 36624-37667 _na     347_aa ATP:guanido phosphotransferase%2C catalytic domain protein
2610 CAMPVW010000009.1 GCA946997615_01314 CDS open 37654-39045 _na     463_aa radA DNA repair protein RadA
2611 CAMPVW010000009.1 GCA946997615_01315 CDS open 39137-40321 _na     394_aa PIN domain protein
2612 CAMPVW010000009.1 GCA946997615_01316 CDS open 40329-41510 _na     393_aa Bifunctional enzyme IspD/IspF
2613 CAMPVW010000009.1 GCA946997615_01317 CDS open 41533-42990 _na     485_aa gltX glutamate--tRNA ligase
2614 CAMPVW010000009.1 GCA946997615_01318 CDS open 43305-44750 _na     481_aa cysS cysteine--tRNA ligase
2615 CAMPVW010000009.1 GCA946997615_01319 CDS open 44747-45223 _na     158_aa Mini-ribonuclease 3
2616 CAMPVW010000009.1 GCA946997615_01320 CDS open 45232-45984 _na     250_aa rlmB 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB
2617 CAMPVW010000009.1 GCA946997615_01321 CDS open 45981-46520 _na     179_aa YacP-like NYN domain protein
2618 CAMPVW010000009.1 GCA946997615_01322 CDS open 46527-47216 _na     229_aa sigH RNA polymerase sporulation sigma factor SigH
2619 CAMPVW010000009.1 GCA946997615_01323 CDS open 47261-47497 _na     78_aa secG preprotein translocase subunit SecG
2620 CAMPVW010000009.1 GCA946997615_01324 CDS open 47550-49853 _na     767_aa rnr ribonuclease R
2621 CAMPVW010000009.1 GCA946997615_01325 CDS open 49866-50336 _na     156_aa smpB SsrA-binding protein SmpB
2622 CAMPVW010000009.1 GCA946997615_01326 CDS open 50347-50694 _na     115_aa arsC ArsC family protein
2623 CAMPVW010000009.1 GCA946997615_01327 CDS open 50953-51837 _na     294_aa hslO Hsp33 family molecular chaperone HslO
2624 CAMPVW010000009.1 GCA946997615_01328 CDS open 51840-52634 _na     264_aa mtnP S-methyl-5'-thioadenosine phosphorylase
2625 CAMPVW010000009.1 GCA946997615_01329 CDS open 52689-53699 _na     336_aa mtnA S-methyl-5-thioribose-1-phosphate isomerase
2626 CAMPVW010000009.1 GCA946997615_01330 CDS open 53720-54961 _na     413_aa adenosylhomocysteinase
2627 CAMPVW010000009.1 GCA946997615_01331 CDS open 54978-56261 _na     427_aa 5-methylthioadenosine/S-adenosylhomocysteine deaminase
2628 CAMPVW010000009.1 GCA946997615_01332 CDS open 56432-57049 _na     205_aa lexA transcriptional repressor LexA
2629 CAMPVW010000009.1 GCA946997615_01333 CDS open 57219-57578 _na     119_aa lysM LysM domain protein
2630 CAMPVW010000009.1 GCA946997615_01334 CDS open 57805-58857 _na     350_aa Endolytic murein transglycosylase
2631 CAMPVW010000009.1 GCA946997615_01335 CDS open 58854-59444 _na     196_aa O-methyltransferase
2632 CAMPVW010000009.1 GCA946997615_01336 CDS open 59448-60677 _na     409_aa Peptidase%2C U32 family
2633 CAMPVW010000009.1 GCA946997615_01337 CDS open 60674-60925 _na     83_aa DUF4911 domain-containing protein
2634 CAMPVW010000009.1 GCA946997615_01338 CDS open 61017-62693 _na     558_aa ATP-dependent endonuclease
2635 CAMPVW010000009.1 GCA946997615_01339 CDS open 62690-64834 _na     714_aa DNA topoisomerase
2636 CAMPVW010000009.1 GCA946997615_01340 CDS open 64821-66095 _na     424_aa Tetratricopeptide repeat protein
2637 CAMPVW010000009.1 GCA946997615_01341 CDS open 66092-66616 _na     174_aa dcd dCTP deaminase
2638 CAMPVW010000009.1 GCA946997615_01342 CDS open 66629-67606 _na     325_aa Peptidase family T4
2639 CAMPVW010000009.1 GCA946997615_01343 CDS open 67710-68252 _na     180_aa hypothetical protein
2640 CAMPVW010000009.1 GCA946997615_01344 CDS open 68446-68850 _na     134_aa Cupin type-2 domain-containing protein
2641 CAMPVW010000009.1 GCA946997615_01345 CDS open 69030-70046 _na     338_aa gap type I glyceraldehyde-3-phosphate dehydrogenase
2642 CAMPVW010000009.1 GCA946997615_01346 CDS open 70204-71229 _na     341_aa Glyceraldehyde 3-phosphate dehydrogenase domain protein
2643 CAMPVW010000009.1 GCA946997615_01347 CDS open 71278-72459 _na     393_aa Phosphoglycerate kinase
2644 CAMPVW010000009.1 GCA946997615_01348 CDS open 72477-73235 _na     252_aa tpiA triose-phosphate isomerase
2645 CAMPVW010000009.1 GCA946997615_01349 CDS open 75171-75359 _na     62_aa hypothetical protein
2646 CAMPVW010000009.1 GCA946997615_01277 gene open 556-1401
2647 CAMPVW010000009.1 GCA946997615_01278 gene open 1466-2332 pstC
2648 CAMPVW010000009.1 GCA946997615_01279 gene open 2384-3196 pstA
2649 CAMPVW010000009.1 GCA946997615_01280 gene open 3197-3973 pstB
2650 CAMPVW010000009.1 GCA946997615_01281 gene open 3973-4644 phoU
2651 CAMPVW010000009.1 GCA946997615_01282 gene open 4619-5299
2652 CAMPVW010000009.1 GCA946997615_01283 gene open 5289-6953
2653 CAMPVW010000009.1 GCA946997615_01285 gene open 7509-9641
2654 CAMPVW010000009.1 GCA946997615_01286 gene open 10048-11442
2655 CAMPVW010000009.1 GCA946997615_01287 gene open 11671-12561
2656 CAMPVW010000009.1 GCA946997615_01288 gene open 12571-12855 remA
2657 CAMPVW010000009.1 GCA946997615_01289 gene open 12825-13475 gmk
2658 CAMPVW010000009.1 GCA946997615_01290 gene open 13493-13702 rpoZ
2659 CAMPVW010000009.1 GCA946997615_01291 gene open 13720-14949 coaBC
2660 CAMPVW010000009.1 GCA946997615_01292 gene open 15160-16353 metK
2661 CAMPVW010000009.1 GCA946997615_01293 gene open 16464-18824 priA
2662 CAMPVW010000009.1 GCA946997615_01294 gene open 18850-19365 def
2663 CAMPVW010000009.1 GCA946997615_01295 gene open 19362-20300 fmt
2664 CAMPVW010000009.1 GCA946997615_01296 gene open 20375-21703 rsmB
2665 CAMPVW010000009.1 GCA946997615_01297 gene open 21705-22742 rlmN
2666 CAMPVW010000009.1 GCA946997615_01298 gene open 22800-23510
2667 CAMPVW010000009.1 GCA946997615_01299 gene open 23521-25461 pknB
2668 CAMPVW010000009.1 GCA946997615_01300 gene open 25481-26338 rsgA
2669 CAMPVW010000009.1 GCA946997615_01301 gene open 26340-26987 rpe
2670 CAMPVW010000009.1 GCA946997615_01302 gene open 27146-28417 ribD
2671 CAMPVW010000009.1 GCA946997615_01303 gene open 28398-29048 ribE
2672 CAMPVW010000009.1 GCA946997615_01304 gene open 29076-29540 ribE
2673 CAMPVW010000009.1 GCA946997615_01305 gene open 29836-30699 ylqF
2674 CAMPVW010000009.1 GCA946997615_01306 gene open 30696-31490
2675 CAMPVW010000009.1 GCA946997615_01307 gene open 31561-31956
2676 CAMPVW010000009.1 GCA946997615_01308 gene open 31953-32690
2677 CAMPVW010000009.1 GCA946997615_01309 gene open 32900-34798
2678 CAMPVW010000009.1 GCA946997615_01310 gene open 34910-35473
2679 CAMPVW010000009.1 GCA946997615_01311 gene open 35693-36148
2680 CAMPVW010000009.1 GCA946997615_01312 gene open 36162-36611
2681 CAMPVW010000009.1 GCA946997615_01313 gene open 36624-37667
2682 CAMPVW010000009.1 GCA946997615_01314 gene open 37654-39045 radA
2683 CAMPVW010000009.1 GCA946997615_01315 gene open 39137-40321
2684 CAMPVW010000009.1 GCA946997615_01316 gene open 40329-41510
2685 CAMPVW010000009.1 GCA946997615_01317 gene open 41533-42990 gltX
2686 CAMPVW010000009.1 GCA946997615_01318 gene open 43305-44750 cysS
2687 CAMPVW010000009.1 GCA946997615_01319 gene open 44747-45223
2688 CAMPVW010000009.1 GCA946997615_01320 gene open 45232-45984 rlmB
2689 CAMPVW010000009.1 GCA946997615_01321 gene open 45981-46520
2690 CAMPVW010000009.1 GCA946997615_01322 gene open 46527-47216 sigH
2691 CAMPVW010000009.1 GCA946997615_01323 gene open 47261-47497 secG
2692 CAMPVW010000009.1 GCA946997615_01324 gene open 47550-49853 rnr
2693 CAMPVW010000009.1 GCA946997615_01325 gene open 49866-50336 smpB
2694 CAMPVW010000009.1 GCA946997615_01326 gene open 50347-50694 arsC
2695 CAMPVW010000009.1 GCA946997615_01327 gene open 50953-51837 hslO
2696 CAMPVW010000009.1 GCA946997615_01328 gene open 51840-52634 mtnP
2697 CAMPVW010000009.1 GCA946997615_01329 gene open 52689-53699 mtnA
2698 CAMPVW010000009.1 GCA946997615_01330 gene open 53720-54961
2699 CAMPVW010000009.1 GCA946997615_01331 gene open 54978-56261
2700 CAMPVW010000009.1 GCA946997615_01332 gene open 56432-57049 lexA
2701 CAMPVW010000009.1 GCA946997615_01333 gene open 57219-57578 lysM
2702 CAMPVW010000009.1 GCA946997615_01334 gene open 57805-58857
2703 CAMPVW010000009.1 GCA946997615_01335 gene open 58854-59444
2704 CAMPVW010000009.1 GCA946997615_01336 gene open 59448-60677
2705 CAMPVW010000009.1 GCA946997615_01337 gene open 60674-60925
2706 CAMPVW010000009.1 GCA946997615_01338 gene open 61017-62693
2707 CAMPVW010000009.1 GCA946997615_01339 gene open 62690-64834
2708 CAMPVW010000009.1 GCA946997615_01340 gene open 64821-66095
2709 CAMPVW010000009.1 GCA946997615_01341 gene open 66092-66616 dcd
2710 CAMPVW010000009.1 GCA946997615_01342 gene open 66629-67606
2711 CAMPVW010000009.1 GCA946997615_01343 gene open 67710-68252
2712 CAMPVW010000009.1 GCA946997615_01344 gene open 68446-68850
2713 CAMPVW010000009.1 GCA946997615_01345 gene open 69030-70046 gap
2714 CAMPVW010000009.1 GCA946997615_01346 gene open 70204-71229
2715 CAMPVW010000009.1 GCA946997615_01347 gene open 71278-72459
2716 CAMPVW010000009.1 GCA946997615_01348 gene open 72477-73235 tpiA
2717 CAMPVW010000009.1 GCA946997615_01349 gene open 75171-75359
2718 CAMPVW010000010.1 GCA946997615_01380 gene open 32971-33180 Bacteria_large_SRP
2719 CAMPVW010000010.1 GCA946997615_01381 gene open 33010-33109 Bacteria_small_SRP
2720 CAMPVW010000010.1 GCA946997615_01380 ncRNA open 32971-33180 Bacterial large signal recognition particle RNA
2721 CAMPVW010000010.1 GCA946997615_01381 ncRNA open 33010-33109 Bacterial small signal recognition particle RNA
2722 CAMPVW010000010.1 GCA946997615_01350 CDS open 704-1357 _na     217_aa hypothetical protein
2723 CAMPVW010000010.1 GCA946997615_01351 CDS open 1583-2155 _na     190_aa hypothetical protein
2724 CAMPVW010000010.1 GCA946997615_01352 CDS open 5162-5545 _na     127_aa panD aspartate 1-decarboxylase
2725 CAMPVW010000010.1 GCA946997615_01353 CDS open 5548-6402 _na     284_aa panC pantoate--beta-alanine ligase
2726 CAMPVW010000010.1 GCA946997615_01354 CDS open 6793-8520 _na     575_aa proline--tRNA ligase
2727 CAMPVW010000010.1 GCA946997615_01355 CDS open 8708-9646 _na     312_aa Cobalt chelatase
2728 CAMPVW010000010.1 GCA946997615_01356 CDS open 9743-10945 _na     400_aa hydF [FeFe] hydrogenase H-cluster maturation GTPase HydF
2729 CAMPVW010000010.1 GCA946997615_01357 CDS open 10970-12157 _na     395_aa Oxidoreductase%2C nitrogenase component 1
2730 CAMPVW010000010.1 GCA946997615_01358 CDS open 12148-13473 _na     441_aa Nitrogenase/oxidoreductase component 1 domain-containing protein
2731 CAMPVW010000010.1 GCA946997615_01359 CDS open 13478-14233 _na     251_aa Nitrogenase iron protein
2732 CAMPVW010000010.1 GCA946997615_01360 CDS open 14270-15274 _na     334_aa hypE hydrogenase expression/formation protein HypE
2733 CAMPVW010000010.1 GCA946997615_01361 CDS open 15271-16326 _na     351_aa hypD hydrogenase formation protein HypD
2734 CAMPVW010000010.1 GCA946997615_01362 CDS open 16328-16534 _na     68_aa Hydrogenase assembly chaperone HypC/HupF
2735 CAMPVW010000010.1 GCA946997615_01363 CDS open 16621-18918 _na     765_aa hypF carbamoyltransferase HypF
2736 CAMPVW010000010.1 GCA946997615_01364 CDS open 18921-19952 _na     343_aa Nitrogenase/oxidoreductase component 1 domain-containing protein
2737 CAMPVW010000010.1 GCA946997615_01365 CDS open 19949-21253 _na     434_aa Oxidoreductase%2C nitrogenase component 1
2738 CAMPVW010000010.1 GCA946997615_01366 CDS open 21253-22005 _na     250_aa Nitrogenase iron protein
2739 CAMPVW010000010.1 GCA946997615_01367 CDS open 22014-22265 _na     83_aa TM1266 family iron-only hydrogenase system putative regulator
2740 CAMPVW010000010.1 GCA946997615_01368 CDS open 22443-23711 _na     422_aa gltT Proton/sodium-glutamate symport protein GltT
2741 CAMPVW010000010.1 GCA946997615_01369 CDS open 23904-24107 _na     67_aa Zinc-ribbon domain-containing protein
2742 CAMPVW010000010.1 GCA946997615_01370 CDS open 24197-25132 _na     311_aa Beta-lactamase class A catalytic domain-containing protein
2743 CAMPVW010000010.1 GCA946997615_01371 CDS open 25223-26386 _na     387_aa N-acetyltransferase domain-containing protein
2744 CAMPVW010000010.1 GCA946997615_01372 CDS open 26464-27384 _na     306_aa Phosphatidylglycerol lysyltransferase C-terminal domain-containing protein
2745 CAMPVW010000010.1 GCA946997615_01373 CDS open 27394-28002 _na     202_aa Putative 3-methyladenine DNA glycosylase
2746 CAMPVW010000010.1 GCA946997615_01374 CDS open 28006-28743 _na     245_aa iclR IclR helix-turn-helix domain protein
2747 CAMPVW010000010.1 GCA946997615_01375 CDS open 28765-29844 _na     359_aa Efflux transporter%2C RND family%2C MFP subunit
2748 CAMPVW010000010.1 GCA946997615_01376 CDS open 29864-30112 _na     82_aa bofA Pro-sigmaK processing inhibitor BofA
2749 CAMPVW010000010.1 GCA946997615_01377 CDS open 30123-30713 _na     196_aa recR recombination mediator RecR
2750 CAMPVW010000010.1 GCA946997615_01378 CDS open 30713-31030 _na     105_aa YbaB/EbfC family nucleoid-associated protein
2751 CAMPVW010000010.1 GCA946997615_01379 CDS open 31049-32935 _na     628_aa dnaX DNA polymerase III subunit gamma/tau
2752 CAMPVW010000010.1 GCA946997615_01382 CDS open 33257-34576 _na     439_aa Serine transporter
2753 CAMPVW010000010.1 GCA946997615_01383 CDS open 34792-35631 _na     279_aa dapF diaminopimelate epimerase
2754 CAMPVW010000010.1 GCA946997615_01384 CDS open 35759-36601 _na     280_aa araC Transcriptional regulator%2C AraC family
2755 CAMPVW010000010.1 GCA946997615_01385 CDS open 36663-37430 _na     255_aa Tat pathway signal sequence domain protein
2756 CAMPVW010000010.1 GCA946997615_01386 CDS open 37570-39870 _na     766_aa hydratase
2757 CAMPVW010000010.1 GCA946997615_01387 CDS open 40155-41498 _na     447_aa citrate synthase (unknown stereospecificity)
2758 CAMPVW010000010.1 GCA946997615_01388 CDS open 41498-42496 _na     332_aa Isocitrate dehydrogenase%2C NAD-dependent
2759 CAMPVW010000010.1 GCA946997615_01389 CDS open 42541-43338 _na     265_aa O-methyltransferase domain protein
2760 CAMPVW010000010.1 GCA946997615_01390 CDS open 43434-43871 _na     145_aa DNA protection during starvation protein 1
2761 CAMPVW010000010.1 GCA946997615_01391 CDS open 44028-45392 _na     454_aa CBS domain protein
2762 CAMPVW010000010.1 GCA946997615_01392 CDS open 45503-47425 _na     640_aa gyrB DNA topoisomerase (ATP-hydrolyzing) subunit B
2763 CAMPVW010000010.1 GCA946997615_01393 CDS open 47494-47754 _na     86_aa DUF370 domain-containing protein
2764 CAMPVW010000010.1 GCA946997615_01394 CDS open 47757-48650 _na     297_aa DUF721 domain-containing protein
2765 CAMPVW010000010.1 GCA946997615_01395 CDS open 48640-49743 _na     367_aa recF DNA replication/repair protein RecF
2766 CAMPVW010000010.1 GCA946997615_01396 CDS open 49740-49961 _na     73_aa S4 domain protein
2767 CAMPVW010000010.1 GCA946997615_01397 CDS open 49961-51076 _na     371_aa dnaN DNA polymerase III subunit beta
2768 CAMPVW010000010.1 GCA946997615_01398 CDS open 51302-52798 _na     498_aa dnaA chromosomal replication initiator protein DnaA
2769 CAMPVW010000010.1 GCA946997615_01399 CDS open 53308-53442 _na     44_aa rpmH 50S ribosomal protein L34
2770 CAMPVW010000010.1 GCA946997615_01400 CDS open 53517-53873 _na     118_aa rnpA ribonuclease P protein component
2771 CAMPVW010000010.1 GCA946997615_01401 CDS open 54143-54814 _na     223_aa Membrane insertase YidC/Oxa/ALB C-terminal domain-containing protein
2772 CAMPVW010000010.1 GCA946997615_01402 CDS open 54817-55566 _na     249_aa jag RNA-binding cell elongation regulator Jag/EloR
2773 CAMPVW010000010.1 GCA946997615_01403 CDS open 55625-57004 _na     459_aa mnmE tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE
2774 CAMPVW010000010.1 GCA946997615_01404 CDS open 57021-58910 _na     629_aa mnmG tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG
2775 CAMPVW010000010.1 GCA946997615_01405 CDS open 58897-59610 _na     237_aa rsmG 16S rRNA (guanine(527)-N(7))-methyltransferase RsmG
2776 CAMPVW010000010.1 GCA946997615_01406 CDS open 59723-60379 _na     218_aa YheO-like protein
2777 CAMPVW010000010.1 GCA946997615_01407 CDS open 60409-61704 _na     431_aa UPF0597 protein HMPREF3033_00285
2778 CAMPVW010000010.1 GCA946997615_01408 CDS open 61875-62060 _na     61_aa hypothetical protein
2779 CAMPVW010000010.1 GCA946997615_01409 CDS open 62328-63287 _na     319_aa Lactate/malate dehydrogenase%2C NAD binding domain protein
2780 CAMPVW010000010.1 GCA946997615_01410 CDS open 63315-64337 _na     340_aa ErfK/YbiS/YcfS/YnhG
2781 CAMPVW010000010.1 GCA946997615_01411 CDS open 64510-64992 _na     160_aa hypothetical protein
2782 CAMPVW010000010.1 GCA946997615_01412 CDS open 65084-65419 _na     111_aa Dinitrogenase iron-molybdenum cofactor
2783 CAMPVW010000010.1 GCA946997615_01413 CDS open 65482-65766 _na     94_aa Glutaredoxin
2784 CAMPVW010000010.1 GCA946997615_01414 CDS open 65763-67115 _na     450_aa bioA adenosylmethionine--8-amino-7-oxononanoate transaminase
2785 CAMPVW010000010.1 GCA946997615_01415 CDS open 67119-67793 _na     224_aa bioD dethiobiotin synthase
2786 CAMPVW010000010.1 GCA946997615_01416 CDS open 67736-68380 _na     214_aa Biotin transporter
2787 CAMPVW010000010.1 GCA946997615_01417 CDS open 68538-68984 _na     148_aa Positive regulator of sigma(E)%2C RseC/MucC
2788 CAMPVW010000010.1 GCA946997615_01419 CDS open 69445-69594 _na     49_aa rpmG 50S ribosomal protein L33
2789 CAMPVW010000010.1 GCA946997615_01420 CDS open 69632-69862 _na     76_aa secE preprotein translocase subunit SecE
2790 CAMPVW010000010.1 GCA946997615_01421 CDS open 69878-70417 _na     179_aa nusG transcription termination/antitermination protein NusG
2791 CAMPVW010000010.1 GCA946997615_01422 CDS open 70509-70934 _na     141_aa rplK 50S ribosomal protein L11
2792 CAMPVW010000010.1 GCA946997615_01423 CDS open 70993-71709 _na     238_aa rplA 50S ribosomal protein L1
2793 CAMPVW010000010.1 GCA946997615_01424 CDS open 71884-72441 _na     185_aa rplJ 50S ribosomal protein L10
2794 CAMPVW010000010.1 GCA946997615_01425 CDS open 72489-72857 _na     122_aa rplL 50S ribosomal protein L7/L12
2795 CAMPVW010000010.1 GCA946997615_01426 CDS open 72991-73518 _na     175_aa Nitroreductase family protein
2796 CAMPVW010000010.1 GCA946997615_01350 gene open 704-1357
2797 CAMPVW010000010.1 GCA946997615_01351 gene open 1583-2155
2798 CAMPVW010000010.1 GCA946997615_01352 gene open 5162-5545 panD
2799 CAMPVW010000010.1 GCA946997615_01353 gene open 5548-6402 panC
2800 CAMPVW010000010.1 GCA946997615_01354 gene open 6793-8520
2801 CAMPVW010000010.1 GCA946997615_01355 gene open 8708-9646
2802 CAMPVW010000010.1 GCA946997615_01356 gene open 9743-10945 hydF
2803 CAMPVW010000010.1 GCA946997615_01357 gene open 10970-12157
2804 CAMPVW010000010.1 GCA946997615_01358 gene open 12148-13473
2805 CAMPVW010000010.1 GCA946997615_01359 gene open 13478-14233
2806 CAMPVW010000010.1 GCA946997615_01360 gene open 14270-15274 hypE
2807 CAMPVW010000010.1 GCA946997615_01361 gene open 15271-16326 hypD
2808 CAMPVW010000010.1 GCA946997615_01362 gene open 16328-16534
2809 CAMPVW010000010.1 GCA946997615_01363 gene open 16621-18918 hypF
2810 CAMPVW010000010.1 GCA946997615_01364 gene open 18921-19952
2811 CAMPVW010000010.1 GCA946997615_01365 gene open 19949-21253
2812 CAMPVW010000010.1 GCA946997615_01366 gene open 21253-22005
2813 CAMPVW010000010.1 GCA946997615_01367 gene open 22014-22265
2814 CAMPVW010000010.1 GCA946997615_01368 gene open 22443-23711 gltT
2815 CAMPVW010000010.1 GCA946997615_01369 gene open 23904-24107
2816 CAMPVW010000010.1 GCA946997615_01370 gene open 24197-25132
2817 CAMPVW010000010.1 GCA946997615_01371 gene open 25223-26386
2818 CAMPVW010000010.1 GCA946997615_01372 gene open 26464-27384
2819 CAMPVW010000010.1 GCA946997615_01373 gene open 27394-28002
2820 CAMPVW010000010.1 GCA946997615_01374 gene open 28006-28743 iclR
2821 CAMPVW010000010.1 GCA946997615_01375 gene open 28765-29844
2822 CAMPVW010000010.1 GCA946997615_01376 gene open 29864-30112 bofA
2823 CAMPVW010000010.1 GCA946997615_01377 gene open 30123-30713 recR
2824 CAMPVW010000010.1 GCA946997615_01378 gene open 30713-31030
2825 CAMPVW010000010.1 GCA946997615_01379 gene open 31049-32935 dnaX
2826 CAMPVW010000010.1 GCA946997615_01382 gene open 33257-34576
2827 CAMPVW010000010.1 GCA946997615_01383 gene open 34792-35631 dapF
2828 CAMPVW010000010.1 GCA946997615_01384 gene open 35759-36601 araC
2829 CAMPVW010000010.1 GCA946997615_01385 gene open 36663-37430
2830 CAMPVW010000010.1 GCA946997615_01386 gene open 37570-39870
2831 CAMPVW010000010.1 GCA946997615_01387 gene open 40155-41498
2832 CAMPVW010000010.1 GCA946997615_01388 gene open 41498-42496
2833 CAMPVW010000010.1 GCA946997615_01389 gene open 42541-43338
2834 CAMPVW010000010.1 GCA946997615_01390 gene open 43434-43871
2835 CAMPVW010000010.1 GCA946997615_01391 gene open 44028-45392
2836 CAMPVW010000010.1 GCA946997615_01392 gene open 45503-47425 gyrB
2837 CAMPVW010000010.1 GCA946997615_01393 gene open 47494-47754
2838 CAMPVW010000010.1 GCA946997615_01394 gene open 47757-48650
2839 CAMPVW010000010.1 GCA946997615_01395 gene open 48640-49743 recF
2840 CAMPVW010000010.1 GCA946997615_01396 gene open 49740-49961
2841 CAMPVW010000010.1 GCA946997615_01397 gene open 49961-51076 dnaN
2842 CAMPVW010000010.1 GCA946997615_01398 gene open 51302-52798 dnaA
2843 CAMPVW010000010.1 GCA946997615_01399 gene open 53308-53442 rpmH
2844 CAMPVW010000010.1 GCA946997615_01400 gene open 53517-53873 rnpA
2845 CAMPVW010000010.1 GCA946997615_01401 gene open 54143-54814
2846 CAMPVW010000010.1 GCA946997615_01402 gene open 54817-55566 jag
2847 CAMPVW010000010.1 GCA946997615_01403 gene open 55625-57004 mnmE
2848 CAMPVW010000010.1 GCA946997615_01404 gene open 57021-58910 mnmG
2849 CAMPVW010000010.1 GCA946997615_01405 gene open 58897-59610 rsmG
2850 CAMPVW010000010.1 GCA946997615_01406 gene open 59723-60379
2851 CAMPVW010000010.1 GCA946997615_01407 gene open 60409-61704
2852 CAMPVW010000010.1 GCA946997615_01408 gene open 61875-62060
2853 CAMPVW010000010.1 GCA946997615_01409 gene open 62328-63287
2854 CAMPVW010000010.1 GCA946997615_01410 gene open 63315-64337
2855 CAMPVW010000010.1 GCA946997615_01411 gene open 64510-64992
2856 CAMPVW010000010.1 GCA946997615_01412 gene open 65084-65419
2857 CAMPVW010000010.1 GCA946997615_01413 gene open 65482-65766
2858 CAMPVW010000010.1 GCA946997615_01414 gene open 65763-67115 bioA
2859 CAMPVW010000010.1 GCA946997615_01415 gene open 67119-67793 bioD
2860 CAMPVW010000010.1 GCA946997615_01416 gene open 67736-68380
2861 CAMPVW010000010.1 GCA946997615_01417 gene open 68538-68984
2862 CAMPVW010000010.1 GCA946997615_01419 gene open 69445-69594 rpmG
2863 CAMPVW010000010.1 GCA946997615_01420 gene open 69632-69862 secE
2864 CAMPVW010000010.1 GCA946997615_01421 gene open 69878-70417 nusG
2865 CAMPVW010000010.1 GCA946997615_01422 gene open 70509-70934 rplK
2866 CAMPVW010000010.1 GCA946997615_01423 gene open 70993-71709 rplA
2867 CAMPVW010000010.1 GCA946997615_01424 gene open 71884-72441 rplJ
2868 CAMPVW010000010.1 GCA946997615_01425 gene open 72489-72857 rplL
2869 CAMPVW010000010.1 GCA946997615_01426 gene open 72991-73518
2870 CAMPVW010000010.1 GCA946997615_01418 gene open 69025-69100 trnT
2871 CAMPVW010000010.1 GCA946997615_01418 tRNA open 69025-69100 trnT tRNA-Thr(cgt)
2872 CAMPVW010000011.1 regulatory_region open 32979-33223 T-box leader
2873 CAMPVW010000011.1 GCA946997615_01427 CDS open 2558-3070 _na     170_aa 6-O-methylguanine DNA methyltransferase%2C DNA binding domain protein
2874 CAMPVW010000011.1 GCA946997615_01428 CDS open 3070-3273 _na     67_aa tatA Sec-independent protein translocase protein TatA
2875 CAMPVW010000011.1 GCA946997615_01429 CDS open 3342-4085 _na     247_aa TIGR03943 family putative permease subunit
2876 CAMPVW010000011.1 GCA946997615_01430 CDS open 4086-5681 _na     531_aa Permease
2877 CAMPVW010000011.1 GCA946997615_01431 CDS open 5678-6604 _na     308_aa CobW/P47K family protein
2878 CAMPVW010000011.1 GCA946997615_01432 CDS open 6765-8198 _na     477_aa SLH domain-containing protein
2879 CAMPVW010000011.1 GCA946997615_01433 CDS open 8543-10024 _na     493_aa S-layer-like y domain-containing protein
2880 CAMPVW010000011.1 GCA946997615_01434 CDS open 10355-11770 _na     471_aa SLH domain-containing protein
2881 CAMPVW010000011.1 GCA946997615_01438 CDS open 12559-13530 _na     323_aa 3D domain protein
2882 CAMPVW010000011.1 GCA946997615_01439 CDS open 14215-16224 _na     669_aa Arylsulfatase
2883 CAMPVW010000011.1 GCA946997615_01440 CDS open 16224-16454 _na     76_aa hypothetical protein
2884 CAMPVW010000011.1 GCA946997615_01441 CDS open 16417-17460 _na     347_aa Glycosyltransferase%2C group 2 family protein
2885 CAMPVW010000011.1 GCA946997615_01442 CDS open 17493-18455 _na     320_aa Heptosyltransferase
2886 CAMPVW010000011.1 GCA946997615_01443 CDS open 18625-19497 _na     290_aa ABC transporter%2C ATP-binding protein
2887 CAMPVW010000011.1 GCA946997615_01444 CDS open 19490-20506 _na     338_aa ABC transporter%2C ATP-binding protein
2888 CAMPVW010000011.1 GCA946997615_01445 CDS open 20499-22067 _na     522_aa ABC transporter%2C substrate-binding protein%2C family 5
2889 CAMPVW010000011.1 GCA946997615_01446 CDS open 22091-22993 _na     300_aa ABC transporter%2C permease protein
2890 CAMPVW010000011.1 GCA946997615_01447 CDS open 22960-23970 _na     336_aa ABC transporter%2C permease protein
2891 CAMPVW010000011.1 GCA946997615_01448 CDS open 24219-24308 _na     29_aa hypothetical protein
2892 CAMPVW010000011.1 GCA946997615_01449 CDS open 24328-25179 _na     283_aa Sel1 repeat protein
2893 CAMPVW010000011.1 GCA946997615_01450 CDS open 25395-27980 _na     861_aa clpB ATP-dependent chaperone ClpB
2894 CAMPVW010000011.1 GCA946997615_01451 CDS open 28141-28296 _na     51_aa hypothetical protein
2895 CAMPVW010000011.1 GCA946997615_01452 CDS open 28378-29442 _na     354_aa leuB 3-isopropylmalate dehydrogenase
2896 CAMPVW010000011.1 GCA946997615_01453 CDS open 29414-29932 _na     172_aa 3-isopropylmalate dehydratase small subunit
2897 CAMPVW010000011.1 GCA946997615_01454 CDS open 29935-31191 _na     418_aa leuC 3-isopropylmalate dehydratase large subunit
2898 CAMPVW010000011.1 GCA946997615_01455 CDS open 31204-32925 _na     573_aa 2-isopropylmalate synthase
2899 CAMPVW010000011.1 GCA946997615_01456 CDS open 33426-35147 _na     573_aa Fibronectin-binding protein A domain protein
2900 CAMPVW010000011.1 GCA946997615_01457 CDS open 35175-36086 _na     303_aa lysR Transcriptional regulator%2C LysR family
2901 CAMPVW010000011.1 GCA946997615_01458 CDS open 36197-38479 _na     760_aa metE 5-methyltetrahydropteroyltriglutamate--homocysteine S-methyltransferase
2902 CAMPVW010000011.1 GCA946997615_01459 CDS open 38649-39017 _na     122_aa yraN YraN family protein
2903 CAMPVW010000011.1 GCA946997615_01460 CDS open 39026-40543 _na     505_aa Mg chelatase-like protein
2904 CAMPVW010000011.1 GCA946997615_01461 CDS open 40564-41655 _na     363_aa dprA DNA-processing protein DprA
2905 CAMPVW010000011.1 GCA946997615_01462 CDS open 41676-42911 _na     411_aa Tat pathway signal sequence domain protein
2906 CAMPVW010000011.1 GCA946997615_01463 CDS open 42908-43975 _na     355_aa mutY A/G-specific adenine glycosylase
2907 CAMPVW010000011.1 GCA946997615_01464 CDS open 44081-44866 _na     261_aa Galactose-1-phosphate uridylyltransferase
2908 CAMPVW010000011.1 GCA946997615_01465 CDS open 44879-45619 _na     246_aa Ser/Thr phosphatase family protein
2909 CAMPVW010000011.1 GCA946997615_01466 CDS open 45603-45833 _na     76_aa Nudix hydrolase domain-containing protein
2910 CAMPVW010000011.1 GCA946997615_01467 CDS open 45924-50687 _na     1587_aa TonB-dependent siderophore receptor
2911 CAMPVW010000011.1 GCA946997615_01469 CDS open 51162-52724 _na     520_aa DEAD/DEAH box helicase
2912 CAMPVW010000011.1 GCA946997615_01470 CDS open 52888-53772 _na     294_aa Asp23/Gls24 family envelope stress response protein
2913 CAMPVW010000011.1 GCA946997615_01471 CDS open 53769-54584 _na     271_aa PHP domain protein
2914 CAMPVW010000011.1 GCA946997615_01472 CDS open 54574-56028 _na     484_aa putative cytosol aminopeptidase
2915 CAMPVW010000011.1 GCA946997615_01473 CDS open 56230-56979 _na     249_aa pflA pyruvate formate-lyase-activating protein
2916 CAMPVW010000011.1 GCA946997615_01474 CDS open 57065-57745 _na     226_aa glycine radical domain-containing protein
2917 CAMPVW010000011.1 GCA946997615_01475 CDS open 58011-58445 _na     144_aa sufU Fe-S cluster assembly sulfur transfer protein SufU
2918 CAMPVW010000011.1 GCA946997615_01476 CDS open 58463-59683 _na     406_aa Cysteine desulfurase
2919 CAMPVW010000011.1 GCA946997615_01477 CDS open 59676-60773 _na     365_aa SufB/sufD domain protein
2920 CAMPVW010000011.1 GCA946997615_01478 CDS open 60791-62218 _na     475_aa sufB Fe-S cluster assembly protein SufB
2921 CAMPVW010000011.1 GCA946997615_01479 CDS open 62233-62979 _na     248_aa sufC Fe-S cluster assembly ATPase SufC
2922 CAMPVW010000011.1 GCA946997615_01480 CDS open 63201-63398 _na     65_aa hypothetical protein
2923 CAMPVW010000011.1 GCA946997615_01481 CDS open 63395-64807 _na     470_aa scfB thioether cross-link-forming SCIFF peptide maturase
2924 CAMPVW010000011.1 GCA946997615_01482 CDS open 65137-66183 _na     348_aa L-lactate oxidase
2925 CAMPVW010000011.1 GCA946997615_01483 CDS open 66343-67032 _na     229_aa radC DNA repair protein RadC
2926 CAMPVW010000011.1 GCA946997615_01484 CDS open 67029-67523 _na     164_aa Nucleoside triphosphate pyrophosphatase
2927 CAMPVW010000011.1 GCA946997615_01485 CDS open 67602-67874 _na     90_aa DUF4321 domain-containing protein
2928 CAMPVW010000011.1 GCA946997615_01486 CDS open 68015-69688 _na     557_aa glutamine--tRNA ligase/YqeY domain fusion protein
2929 CAMPVW010000011.1 GCA946997615_01487 CDS open 69846-70748 _na     300_aa FAH family protein
2930 CAMPVW010000011.1 GCA946997615_01488 CDS open 70846-73230 _na     794_aa Putative Hep/Hag repeat protein
2931 CAMPVW010000011.1 GCA946997615_01427 gene open 2558-3070
2932 CAMPVW010000011.1 GCA946997615_01428 gene open 3070-3273 tatA
2933 CAMPVW010000011.1 GCA946997615_01429 gene open 3342-4085
2934 CAMPVW010000011.1 GCA946997615_01430 gene open 4086-5681
2935 CAMPVW010000011.1 GCA946997615_01431 gene open 5678-6604
2936 CAMPVW010000011.1 GCA946997615_01432 gene open 6765-8198
2937 CAMPVW010000011.1 GCA946997615_01433 gene open 8543-10024
2938 CAMPVW010000011.1 GCA946997615_01434 gene open 10355-11770
2939 CAMPVW010000011.1 GCA946997615_01438 gene open 12559-13530
2940 CAMPVW010000011.1 GCA946997615_01439 gene open 14215-16224
2941 CAMPVW010000011.1 GCA946997615_01440 gene open 16224-16454
2942 CAMPVW010000011.1 GCA946997615_01441 gene open 16417-17460
2943 CAMPVW010000011.1 GCA946997615_01442 gene open 17493-18455
2944 CAMPVW010000011.1 GCA946997615_01443 gene open 18625-19497
2945 CAMPVW010000011.1 GCA946997615_01444 gene open 19490-20506
2946 CAMPVW010000011.1 GCA946997615_01445 gene open 20499-22067
2947 CAMPVW010000011.1 GCA946997615_01446 gene open 22091-22993
2948 CAMPVW010000011.1 GCA946997615_01447 gene open 22960-23970
2949 CAMPVW010000011.1 GCA946997615_01448 gene open 24219-24308
2950 CAMPVW010000011.1 GCA946997615_01449 gene open 24328-25179
2951 CAMPVW010000011.1 GCA946997615_01450 gene open 25395-27980 clpB
2952 CAMPVW010000011.1 GCA946997615_01451 gene open 28141-28296
2953 CAMPVW010000011.1 GCA946997615_01452 gene open 28378-29442 leuB
2954 CAMPVW010000011.1 GCA946997615_01453 gene open 29414-29932
2955 CAMPVW010000011.1 GCA946997615_01454 gene open 29935-31191 leuC
2956 CAMPVW010000011.1 GCA946997615_01455 gene open 31204-32925
2957 CAMPVW010000011.1 GCA946997615_01456 gene open 33426-35147
2958 CAMPVW010000011.1 GCA946997615_01457 gene open 35175-36086 lysR
2959 CAMPVW010000011.1 GCA946997615_01458 gene open 36197-38479 metE
2960 CAMPVW010000011.1 GCA946997615_01459 gene open 38649-39017 yraN
2961 CAMPVW010000011.1 GCA946997615_01460 gene open 39026-40543
2962 CAMPVW010000011.1 GCA946997615_01461 gene open 40564-41655 dprA
2963 CAMPVW010000011.1 GCA946997615_01462 gene open 41676-42911
2964 CAMPVW010000011.1 GCA946997615_01463 gene open 42908-43975 mutY
2965 CAMPVW010000011.1 GCA946997615_01464 gene open 44081-44866
2966 CAMPVW010000011.1 GCA946997615_01465 gene open 44879-45619
2967 CAMPVW010000011.1 GCA946997615_01466 gene open 45603-45833
2968 CAMPVW010000011.1 GCA946997615_01467 gene open 45924-50687
2969 CAMPVW010000011.1 GCA946997615_01469 gene open 51162-52724
2970 CAMPVW010000011.1 GCA946997615_01470 gene open 52888-53772
2971 CAMPVW010000011.1 GCA946997615_01471 gene open 53769-54584
2972 CAMPVW010000011.1 GCA946997615_01472 gene open 54574-56028
2973 CAMPVW010000011.1 GCA946997615_01473 gene open 56230-56979 pflA
2974 CAMPVW010000011.1 GCA946997615_01474 gene open 57065-57745
2975 CAMPVW010000011.1 GCA946997615_01475 gene open 58011-58445 sufU
2976 CAMPVW010000011.1 GCA946997615_01476 gene open 58463-59683
2977 CAMPVW010000011.1 GCA946997615_01477 gene open 59676-60773
2978 CAMPVW010000011.1 GCA946997615_01478 gene open 60791-62218 sufB
2979 CAMPVW010000011.1 GCA946997615_01479 gene open 62233-62979 sufC
2980 CAMPVW010000011.1 GCA946997615_01480 gene open 63201-63398
2981 CAMPVW010000011.1 GCA946997615_01481 gene open 63395-64807 scfB
2982 CAMPVW010000011.1 GCA946997615_01482 gene open 65137-66183
2983 CAMPVW010000011.1 GCA946997615_01483 gene open 66343-67032 radC
2984 CAMPVW010000011.1 GCA946997615_01484 gene open 67029-67523
2985 CAMPVW010000011.1 GCA946997615_01485 gene open 67602-67874
2986 CAMPVW010000011.1 GCA946997615_01486 gene open 68015-69688
2987 CAMPVW010000011.1 GCA946997615_01487 gene open 69846-70748
2988 CAMPVW010000011.1 GCA946997615_01488 gene open 70846-73230
2989 CAMPVW010000011.1 GCA946997615_01435 gene open 12162-12238 trnP
2990 CAMPVW010000011.1 GCA946997615_01436 gene open 12249-12322 trnG
2991 CAMPVW010000011.1 GCA946997615_01437 gene open 12331-12407 trnR
2992 CAMPVW010000011.1 GCA946997615_01468 gene open 50881-50956 trnK
2993 CAMPVW010000011.1 GCA946997615_01435 tRNA open 12162-12238 trnP tRNA-Pro(tgg)
2994 CAMPVW010000011.1 GCA946997615_01436 tRNA open 12249-12322 trnG tRNA-Gly(tcc)
2995 CAMPVW010000011.1 GCA946997615_01437 tRNA open 12331-12407 trnR tRNA-Arg(tct)
2996 CAMPVW010000011.1 GCA946997615_01468 tRNA open 50881-50956 trnK tRNA-Lys(ctt)
2997 CAMPVW010000012.1 regulatory_region open 39929-40171 T-box leader
2998 CAMPVW010000012.1 repeat_region open 47020-48206 CRISPR array with 20 repeats of length 28%2C consensus sequence GGATCACCCCCGCGTGTGCGGGAAGAAC and spacer length 33
2999 CAMPVW010000012.1 GCA946997615_01489 CDS open 286-1602 _na     438_aa Transporter%2C major facilitator family protein
3000 CAMPVW010000012.1 GCA946997615_01490 CDS open 1696-2211 _na     171_aa HTH domain protein