HOMD Banner
Taxonomy: V4.3   |  16S rRNA RefSeq: V16.03   |  Genomic RefSeq: V11.03   |  Viruses: V1.2

BAKTAGenome Explorer: Fusobacterium gonidiaformans (GCA_946997625.1)

Select a Genome:
BAKTA Annotations for GCA_946997625.1
Genome Selected: Fusobacterium gonidiaformans
ContigsBases CDSrRNA tmRNAtRNA
199 1615346 1609 0 1 15
[Table]   [AA Fasta]      [Browser]   [Text]   [Excel]  
Search & Sort all 3272 Records
Search These Records: Clear
Sort Column:   Molecule   PID   NA   AA   Gene  Gene Product  Reverse
Annotation Table [page:3]    |    Number of Records Found: 3272 [7 Pages]    |    Previous Page <==> Next Page    |    Jump to Page: [ 1  2  3  4  5  6  7  ]
Notes:   1- Column headers only sort the current page. 2- Select [NA] or [AA] links to show sequences.
Region Protein-ID Type Genome
Viewer		 Range
(bp)		 Show Sequences
(length) NA / AA		 BAKTA
Gene		 BAKTA
GeneProduct
1001 CAMPVV010000021.1 GCA946997625_00502 CDS open 5235-6341 _na     368_aa prmC peptide chain release factor N(5)-glutamine methyltransferase
1002 CAMPVV010000021.1 GCA946997625_00503 CDS open 6338-6886 _na     182_aa rsmD 16S rRNA (guanine(966)-N(2))-methyltransferase RsmD
1003 CAMPVV010000021.1 GCA946997625_00504 CDS open 6901-7419 _na     172_aa Peptidyl-prolyl cis-trans isomerase
1004 CAMPVV010000021.1 GCA946997625_00505 CDS open 7385-7621 _na     78_aa Exodeoxyribonuclease 7 small subunit
1005 CAMPVV010000021.1 GCA946997625_00506 CDS open 7680-8480 _na     266_aa Geranyltranstransferase
1006 CAMPVV010000021.1 GCA946997625_00507 CDS open 8480-9511 _na     343_aa queA tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA
1007 CAMPVV010000021.1 GCA946997625_00508 CDS open 9521-11497 _na     658_aa Peptidase%2C S9A/B/C family%2C catalytic domain protein
1008 CAMPVV010000021.1 GCA946997625_00509 CDS open 11506-12459 _na     317_aa NADH:flavin oxidoreductase/NADH oxidase N-terminal domain-containing protein
1009 CAMPVV010000021.1 GCA946997625_00510 CDS open 12449-13156 _na     235_aa Pseudouridine synthase
1010 CAMPVV010000021.1 GCA946997625_00511 CDS open 13169-13369 _na     66_aa Lipoprotein
1011 CAMPVV010000021.1 GCA946997625_00512 CDS open 13377-14405 _na     342_aa Protein-arginine rhamnosyltransferase
1012 CAMPVV010000021.1 GCA946997625_00513 CDS open 14419-14982 _na     187_aa efp elongation factor P
1013 CAMPVV010000021.1 GCA946997625_00514 CDS open 15099-15410 _na     103_aa ylxM YlxM family DNA-binding protein
1014 CAMPVV010000021.1 GCA946997625_00496 gene open 66-1190
1015 CAMPVV010000021.1 GCA946997625_00497 gene open 1197-2216 lpxK
1016 CAMPVV010000021.1 GCA946997625_00498 gene open 2201-2773
1017 CAMPVV010000021.1 GCA946997625_00499 gene open 2782-3393
1018 CAMPVV010000021.1 GCA946997625_00500 gene open 3406-4083
1019 CAMPVV010000021.1 GCA946997625_00501 gene open 4154-5233 prfA
1020 CAMPVV010000021.1 GCA946997625_00502 gene open 5235-6341 prmC
1021 CAMPVV010000021.1 GCA946997625_00503 gene open 6338-6886 rsmD
1022 CAMPVV010000021.1 GCA946997625_00504 gene open 6901-7419
1023 CAMPVV010000021.1 GCA946997625_00505 gene open 7385-7621
1024 CAMPVV010000021.1 GCA946997625_00506 gene open 7680-8480
1025 CAMPVV010000021.1 GCA946997625_00507 gene open 8480-9511 queA
1026 CAMPVV010000021.1 GCA946997625_00508 gene open 9521-11497
1027 CAMPVV010000021.1 GCA946997625_00509 gene open 11506-12459
1028 CAMPVV010000021.1 GCA946997625_00510 gene open 12449-13156
1029 CAMPVV010000021.1 GCA946997625_00511 gene open 13169-13369
1030 CAMPVV010000021.1 GCA946997625_00512 gene open 13377-14405
1031 CAMPVV010000021.1 GCA946997625_00513 gene open 14419-14982 efp
1032 CAMPVV010000021.1 GCA946997625_00514 gene open 15099-15410 ylxM
1033 CAMPVV010000022.1 GCA946997625_00515 CDS open 91-1902 _na     603_aa hypothetical protein
1034 CAMPVV010000022.1 GCA946997625_00516 CDS open 1905-2465 _na     186_aa pth aminoacyl-tRNA hydrolase
1035 CAMPVV010000022.1 GCA946997625_00517 CDS open 2717-4027 _na     436_aa rsxC electron transport complex subunit RsxC
1036 CAMPVV010000022.1 GCA946997625_00518 CDS open 4051-5004 _na     317_aa Ion-translocating oxidoreductase complex subunit D
1037 CAMPVV010000022.1 GCA946997625_00519 CDS open 4994-5527 _na     177_aa Ion-translocating oxidoreductase complex subunit G
1038 CAMPVV010000022.1 GCA946997625_00520 CDS open 5527-6132 _na     201_aa Ion-translocating oxidoreductase complex subunit E
1039 CAMPVV010000022.1 GCA946997625_00521 CDS open 6129-6713 _na     194_aa rsxA electron transport complex subunit RsxA
1040 CAMPVV010000022.1 GCA946997625_00522 CDS open 6739-7677 _na     312_aa Ion-translocating oxidoreductase complex subunit B
1041 CAMPVV010000022.1 GCA946997625_00523 CDS open 7730-8869 _na     379_aa ROK family protein
1042 CAMPVV010000022.1 GCA946997625_00524 CDS open 9005-10537 _na     510_aa hutH histidine ammonia-lyase
1043 CAMPVV010000022.1 GCA946997625_00525 CDS open 10539-12569 _na     676_aa urocanate hydratase
1044 CAMPVV010000022.1 GCA946997625_00526 CDS open 12642-13295 _na     217_aa ompA OmpA family
1045 CAMPVV010000022.1 GCA946997625_00527 CDS open 13536-14939 _na     467_aa Amino acid carrier protein
1046 CAMPVV010000022.1 GCA946997625_00515 gene open 91-1902
1047 CAMPVV010000022.1 GCA946997625_00516 gene open 1905-2465 pth
1048 CAMPVV010000022.1 GCA946997625_00517 gene open 2717-4027 rsxC
1049 CAMPVV010000022.1 GCA946997625_00518 gene open 4051-5004
1050 CAMPVV010000022.1 GCA946997625_00519 gene open 4994-5527
1051 CAMPVV010000022.1 GCA946997625_00520 gene open 5527-6132
1052 CAMPVV010000022.1 GCA946997625_00521 gene open 6129-6713 rsxA
1053 CAMPVV010000022.1 GCA946997625_00522 gene open 6739-7677
1054 CAMPVV010000022.1 GCA946997625_00523 gene open 7730-8869
1055 CAMPVV010000022.1 GCA946997625_00524 gene open 9005-10537 hutH
1056 CAMPVV010000022.1 GCA946997625_00525 gene open 10539-12569
1057 CAMPVV010000022.1 GCA946997625_00526 gene open 12642-13295 ompA
1058 CAMPVV010000022.1 GCA946997625_00527 gene open 13536-14939
1059 CAMPVV010000022.1 GCA946997625_00528 gene open 15097-15173 trnP
1060 CAMPVV010000022.1 GCA946997625_00529 gene open 15177-15251 trnQ
1061 CAMPVV010000022.1 GCA946997625_00528 tRNA open 15097-15173 trnP tRNA-Pro(tgg)
1062 CAMPVV010000022.1 GCA946997625_00529 tRNA open 15177-15251 trnQ tRNA-Gln(ttg)
1063 CAMPVV010000023.1 GCA946997625_00530 CDS open 226-1041 _na     271_aa Putative small-conductance mechanosensitive channel
1064 CAMPVV010000023.1 GCA946997625_00531 CDS open 1063-2523 _na     486_aa guaB IMP dehydrogenase
1065 CAMPVV010000023.1 GCA946997625_00532 CDS open 2534-3283 _na     249_aa MORN repeat protein
1066 CAMPVV010000023.1 GCA946997625_00533 CDS open 3271-3750 _na     159_aa hypothetical protein
1067 CAMPVV010000023.1 GCA946997625_00534 CDS open 3907-4920 _na     337_aa hrcA heat-inducible transcriptional repressor HrcA
1068 CAMPVV010000023.1 GCA946997625_00535 CDS open 4917-5477 _na     186_aa grpE nucleotide exchange factor GrpE
1069 CAMPVV010000023.1 GCA946997625_00536 CDS open 5515-7332 _na     605_aa dnaK molecular chaperone DnaK
1070 CAMPVV010000023.1 GCA946997625_00537 CDS open 7517-13702 _na     2061_aa hypothetical protein
1071 CAMPVV010000023.1 GCA946997625_00538 CDS open 13792-14397 _na     201_aa Lipoprotein
1072 CAMPVV010000023.1 GCA946997625_00539 CDS open 14683-15960 _na     425_aa ISL3 family transposase
1073 CAMPVV010000023.1 GCA946997625_00530 gene open 226-1041
1074 CAMPVV010000023.1 GCA946997625_00531 gene open 1063-2523 guaB
1075 CAMPVV010000023.1 GCA946997625_00532 gene open 2534-3283
1076 CAMPVV010000023.1 GCA946997625_00533 gene open 3271-3750
1077 CAMPVV010000023.1 GCA946997625_00534 gene open 3907-4920 hrcA
1078 CAMPVV010000023.1 GCA946997625_00535 gene open 4917-5477 grpE
1079 CAMPVV010000023.1 GCA946997625_00536 gene open 5515-7332 dnaK
1080 CAMPVV010000023.1 GCA946997625_00537 gene open 7517-13702
1081 CAMPVV010000023.1 GCA946997625_00538 gene open 13792-14397
1082 CAMPVV010000023.1 GCA946997625_00539 gene open 14683-15960
1083 CAMPVV010000024.1 GCA946997625_00540 CDS open 713-1594 _na     293_aa Lipid kinase%2C YegS/Rv2252/BmrU family
1084 CAMPVV010000024.1 GCA946997625_00541 CDS open 1639-1944 _na     101_aa Filamentation induced by cAMP protein Fic-like C-terminal domain-containing protein
1085 CAMPVV010000024.1 GCA946997625_00542 CDS open 1985-3283 _na     432_aa M18 family aminopeptidase
1086 CAMPVV010000024.1 GCA946997625_00543 CDS open 3440-5257 _na     605_aa htpG molecular chaperone HtpG
1087 CAMPVV010000024.1 GCA946997625_00544 CDS open 5414-6922 _na     502_aa gltX glutamate--tRNA ligase
1088 CAMPVV010000024.1 GCA946997625_00545 CDS open 7084-7947 _na     287_aa Hydrolase%2C alpha/beta domain protein
1089 CAMPVV010000024.1 GCA946997625_00546 CDS open 8000-8980 _na     326_aa prfB peptide chain release factor 2
1090 CAMPVV010000024.1 GCA946997625_00547 CDS open 9111-9320 _na     69_aa (2Fe-2S) ferredoxin domain-containing protein
1091 CAMPVV010000024.1 GCA946997625_00548 CDS open 9330-9674 _na     114_aa Holo-[acyl-carrier-protein] synthase
1092 CAMPVV010000024.1 GCA946997625_00549 CDS open 9671-10456 _na     261_aa tatD Hydrolase%2C TatD family
1093 CAMPVV010000024.1 GCA946997625_00550 CDS open 10416-11276 _na     286_aa hslO Chaperonin HslO
1094 CAMPVV010000024.1 GCA946997625_00551 CDS open 11288-11833 _na     181_aa Competence protein ComEA helix-hairpin-helix repeat region
1095 CAMPVV010000024.1 GCA946997625_00552 CDS open 11799-13154 _na     451_aa coproporphyrinogen III oxidase
1096 CAMPVV010000024.1 GCA946997625_00553 CDS open 13184-14152 _na     322_aa Twitching motility protein
1097 CAMPVV010000024.1 GCA946997625_00554 CDS open 14199-15701 _na     500_aa Magnesium chelatase
1098 CAMPVV010000024.1 GCA946997625_00540 gene open 713-1594
1099 CAMPVV010000024.1 GCA946997625_00541 gene open 1639-1944
1100 CAMPVV010000024.1 GCA946997625_00542 gene open 1985-3283
1101 CAMPVV010000024.1 GCA946997625_00543 gene open 3440-5257 htpG
1102 CAMPVV010000024.1 GCA946997625_00544 gene open 5414-6922 gltX
1103 CAMPVV010000024.1 GCA946997625_00545 gene open 7084-7947
1104 CAMPVV010000024.1 GCA946997625_00546 gene open 8000-8980 prfB
1105 CAMPVV010000024.1 GCA946997625_00547 gene open 9111-9320
1106 CAMPVV010000024.1 GCA946997625_00548 gene open 9330-9674
1107 CAMPVV010000024.1 GCA946997625_00549 gene open 9671-10456 tatD
1108 CAMPVV010000024.1 GCA946997625_00550 gene open 10416-11276 hslO
1109 CAMPVV010000024.1 GCA946997625_00551 gene open 11288-11833
1110 CAMPVV010000024.1 GCA946997625_00552 gene open 11799-13154
1111 CAMPVV010000024.1 GCA946997625_00553 gene open 13184-14152
1112 CAMPVV010000024.1 GCA946997625_00554 gene open 14199-15701
1113 CAMPVV010000025.1 GCA946997625_00555 CDS open 444-1598 _na     384_aa ROK family protein
1114 CAMPVV010000025.1 GCA946997625_00556 CDS open 1774-3207 _na     477_aa Putative dGTPase
1115 CAMPVV010000025.1 GCA946997625_00557 CDS open 3189-4844 _na     551_aa Dynamin N-terminal domain-containing protein
1116 CAMPVV010000025.1 GCA946997625_00558 CDS open 4961-5293 _na     110_aa feoC Transcriptional regulator HTH-type FeoC domain-containing protein
1117 CAMPVV010000025.1 GCA946997625_00559 CDS open 5277-6038 _na     253_aa Threonine/serine exporter-like N-terminal domain-containing protein
1118 CAMPVV010000025.1 GCA946997625_00560 CDS open 6049-6489 _na     146_aa thrE Threonine/Serine exporter ThrE domain-containing protein
1119 CAMPVV010000025.1 GCA946997625_00561 CDS open 6457-7350 _na     297_aa DUF535 domain-containing protein
1120 CAMPVV010000025.1 GCA946997625_00562 CDS open 7366-8274 _na     302_aa DUF535 domain-containing protein
1121 CAMPVV010000025.1 GCA946997625_00563 CDS open 8279-9502 _na     407_aa L-serine ammonia-lyase
1122 CAMPVV010000025.1 GCA946997625_00564 CDS open 9580-11145 _na     521_aa rny ribonuclease Y
1123 CAMPVV010000025.1 GCA946997625_00565 CDS open 11170-11520 _na     116_aa Anti-sigma factor antagonist
1124 CAMPVV010000025.1 GCA946997625_00566 CDS open 11525-11920 _na     131_aa ATP-binding protein
1125 CAMPVV010000025.1 GCA946997625_00567 CDS open 11925-12311 _na     128_aa Lipoprotein
1126 CAMPVV010000025.1 GCA946997625_00568 CDS open 12346-13254 _na     302_aa miaA tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA
1127 CAMPVV010000025.1 GCA946997625_00569 CDS open 13264-14550 _na     428_aa obgE GTPase ObgE
1128 CAMPVV010000025.1 GCA946997625_00570 CDS open 14568-15083 _na     171_aa hypothetical protein
1129 CAMPVV010000025.1 GCA946997625_00555 gene open 444-1598
1130 CAMPVV010000025.1 GCA946997625_00556 gene open 1774-3207
1131 CAMPVV010000025.1 GCA946997625_00557 gene open 3189-4844
1132 CAMPVV010000025.1 GCA946997625_00558 gene open 4961-5293 feoC
1133 CAMPVV010000025.1 GCA946997625_00559 gene open 5277-6038
1134 CAMPVV010000025.1 GCA946997625_00560 gene open 6049-6489 thrE
1135 CAMPVV010000025.1 GCA946997625_00561 gene open 6457-7350
1136 CAMPVV010000025.1 GCA946997625_00562 gene open 7366-8274
1137 CAMPVV010000025.1 GCA946997625_00563 gene open 8279-9502
1138 CAMPVV010000025.1 GCA946997625_00564 gene open 9580-11145 rny
1139 CAMPVV010000025.1 GCA946997625_00565 gene open 11170-11520
1140 CAMPVV010000025.1 GCA946997625_00566 gene open 11525-11920
1141 CAMPVV010000025.1 GCA946997625_00567 gene open 11925-12311
1142 CAMPVV010000025.1 GCA946997625_00568 gene open 12346-13254 miaA
1143 CAMPVV010000025.1 GCA946997625_00569 gene open 13264-14550 obgE
1144 CAMPVV010000025.1 GCA946997625_00570 gene open 14568-15083
1145 CAMPVV010000026.1 GCA946997625_00571 CDS open 26-199 _na     57_aa hypothetical protein
1146 CAMPVV010000026.1 GCA946997625_00572 CDS open 196-2724 _na     842_aa recJ single-stranded-DNA-specific exonuclease RecJ
1147 CAMPVV010000026.1 GCA946997625_00573 CDS open 2732-4024 _na     430_aa nhaC Putative Na+/H+ antiporter NhaC
1148 CAMPVV010000026.1 GCA946997625_00574 CDS open 4018-4893 _na     291_aa lgt prolipoprotein diacylglyceryl transferase
1149 CAMPVV010000026.1 GCA946997625_00575 CDS open 4942-6645 _na     567_aa Putative ferredoxin hydrogenase
1150 CAMPVV010000026.1 GCA946997625_00576 CDS open 6663-8405 _na     580_aa hymB Protein HymB
1151 CAMPVV010000026.1 GCA946997625_00577 CDS open 8460-8942 _na     160_aa nuoE NADH-quinone oxidoreductase subunit NuoE
1152 CAMPVV010000026.1 GCA946997625_00578 CDS open 9091-10746 _na     551_aa ATPase/histidine kinase/DNA gyrase B/HSP90 domain protein
1153 CAMPVV010000026.1 GCA946997625_00579 CDS open 10736-11509 _na     257_aa Response regulator receiver domain protein
1154 CAMPVV010000026.1 GCA946997625_00580 CDS open 11522-12448 _na     308_aa msrB bifunctional peptide-methionine (S)-S-oxide reductase MsrA/peptide-methionine (R)-S-oxide reductase MsrB
1155 CAMPVV010000026.1 GCA946997625_00581 CDS open 12475-13098 _na     207_aa Redoxin family protein
1156 CAMPVV010000026.1 GCA946997625_00582 CDS open 13118-13771 _na     217_aa ccdA Putative cytochrome C-type biogenesis protein CcdA
1157 CAMPVV010000026.1 GCA946997625_00583 CDS open 13931-14602 _na     223_aa phosphoserine phosphatase
1158 CAMPVV010000026.1 GCA946997625_00571 gene open 26-199
1159 CAMPVV010000026.1 GCA946997625_00572 gene open 196-2724 recJ
1160 CAMPVV010000026.1 GCA946997625_00573 gene open 2732-4024 nhaC
1161 CAMPVV010000026.1 GCA946997625_00574 gene open 4018-4893 lgt
1162 CAMPVV010000026.1 GCA946997625_00575 gene open 4942-6645
1163 CAMPVV010000026.1 GCA946997625_00576 gene open 6663-8405 hymB
1164 CAMPVV010000026.1 GCA946997625_00577 gene open 8460-8942 nuoE
1165 CAMPVV010000026.1 GCA946997625_00578 gene open 9091-10746
1166 CAMPVV010000026.1 GCA946997625_00579 gene open 10736-11509
1167 CAMPVV010000026.1 GCA946997625_00580 gene open 11522-12448 msrB
1168 CAMPVV010000026.1 GCA946997625_00581 gene open 12475-13098
1169 CAMPVV010000026.1 GCA946997625_00582 gene open 13118-13771 ccdA
1170 CAMPVV010000026.1 GCA946997625_00583 gene open 13931-14602
1171 CAMPVV010000027.1 GCA946997625_00584 CDS open 476-1456 _na     326_aa Biotin--[acetyl-CoA-carboxylase] ligase
1172 CAMPVV010000027.1 GCA946997625_00585 CDS open 1535-2125 _na     196_aa Leucine Rich Repeat protein
1173 CAMPVV010000027.1 GCA946997625_00586 CDS open 2143-3291 _na     382_aa (R)-2-hydroxyglutaryl-CoA dehydratase subunit beta
1174 CAMPVV010000027.1 GCA946997625_00587 CDS open 3303-4628 _na     441_aa hgdB R-phenyllactate dehydratase%2C medium subunit
1175 CAMPVV010000027.1 GCA946997625_00588 CDS open 4707-5501 _na     264_aa (R)-2-hydroxyglutaryl-CoA dehydratase activator
1176 CAMPVV010000027.1 GCA946997625_00589 CDS open 5530-6768 _na     412_aa Sodium/glutamate symporter
1177 CAMPVV010000027.1 GCA946997625_00590 CDS open 6790-8547 _na     585_aa Glutaconyl-CoA decarboxylase subunit alpha
1178 CAMPVV010000027.1 GCA946997625_00591 CDS open 8570-9367 _na     265_aa Glutaconate CoA-transferase subunit B
1179 CAMPVV010000027.1 GCA946997625_00592 CDS open 9369-10334 _na     321_aa Glutaconate CoA-transferase subunit A
1180 CAMPVV010000027.1 GCA946997625_00593 CDS open 10393-11535 _na     380_aa Glutaconyl-CoA decarboxylase subunit beta
1181 CAMPVV010000027.1 GCA946997625_00594 CDS open 11553-11969 _na     138_aa Glutaconyl-CoA decarboxylase subunit gamma
1182 CAMPVV010000027.1 GCA946997625_00595 CDS open 12013-12318 _na     101_aa Sodium pump decarboxylase%2C gamma subunit
1183 CAMPVV010000027.1 GCA946997625_00596 CDS open 12339-14324 _na     661_aa Ascorbate-specific PTS system EIIA component
1184 CAMPVV010000027.1 GCA946997625_00584 gene open 476-1456
1185 CAMPVV010000027.1 GCA946997625_00585 gene open 1535-2125
1186 CAMPVV010000027.1 GCA946997625_00586 gene open 2143-3291
1187 CAMPVV010000027.1 GCA946997625_00587 gene open 3303-4628 hgdB
1188 CAMPVV010000027.1 GCA946997625_00588 gene open 4707-5501
1189 CAMPVV010000027.1 GCA946997625_00589 gene open 5530-6768
1190 CAMPVV010000027.1 GCA946997625_00590 gene open 6790-8547
1191 CAMPVV010000027.1 GCA946997625_00591 gene open 8570-9367
1192 CAMPVV010000027.1 GCA946997625_00592 gene open 9369-10334
1193 CAMPVV010000027.1 GCA946997625_00593 gene open 10393-11535
1194 CAMPVV010000027.1 GCA946997625_00594 gene open 11553-11969
1195 CAMPVV010000027.1 GCA946997625_00595 gene open 12013-12318
1196 CAMPVV010000027.1 GCA946997625_00596 gene open 12339-14324
1197 CAMPVV010000028.1 GCA946997625_00597 CDS open 635-1402 _na     255_aa pssA CDP-diacylglycerol--serine O-phosphatidyltransferase
1198 CAMPVV010000028.1 GCA946997625_00598 CDS open 1389-2495 _na     368_aa Heptosyltransferase
1199 CAMPVV010000028.1 GCA946997625_00599 CDS open 2485-3171 _na     228_aa Cyclic nucleotide-binding domain protein
1200 CAMPVV010000028.1 GCA946997625_00600 CDS open 3267-4274 _na     335_aa asrA anaerobic sulfite reductase subunit AsrA
1201 CAMPVV010000028.1 GCA946997625_00601 CDS open 4302-5105 _na     267_aa asrB anaerobic sulfite reductase subunit AsrB
1202 CAMPVV010000028.1 GCA946997625_00602 CDS open 5115-6092 _na     325_aa asrC sulfite reductase subunit C
1203 CAMPVV010000028.1 GCA946997625_00603 CDS open 6120-6884 _na     254_aa nirC Putative nitrite transporter NirC
1204 CAMPVV010000028.1 GCA946997625_00604 CDS open 6956-7417 _na     153_aa DUF340 domain-containing protein
1205 CAMPVV010000028.1 GCA946997625_00605 CDS open 7419-8195 _na     258_aa DUF3100 domain-containing protein
1206 CAMPVV010000028.1 GCA946997625_00606 CDS open 8198-9394 _na     398_aa Amidohydrolase
1207 CAMPVV010000028.1 GCA946997625_00607 CDS open 9471-10013 _na     180_aa hpf ribosome hibernation-promoting factor%2C HPF/YfiA family
1208 CAMPVV010000028.1 GCA946997625_00608 CDS open 10090-10773 _na     227_aa Lipoprotein releasing system%2C ATP-binding protein
1209 CAMPVV010000028.1 GCA946997625_00609 CDS open 10766-11935 _na     389_aa Lipoprotein releasing system%2C transmembrane protein%2C LolC/E family
1210 CAMPVV010000028.1 GCA946997625_00610 CDS open 11932-13713 _na     593_aa recQ DNA helicase RecQ
1211 CAMPVV010000028.1 GCA946997625_00611 CDS open 13735-14103 _na     122_aa hypothetical protein
1212 CAMPVV010000028.1 GCA946997625_00597 gene open 635-1402 pssA
1213 CAMPVV010000028.1 GCA946997625_00598 gene open 1389-2495
1214 CAMPVV010000028.1 GCA946997625_00599 gene open 2485-3171
1215 CAMPVV010000028.1 GCA946997625_00600 gene open 3267-4274 asrA
1216 CAMPVV010000028.1 GCA946997625_00601 gene open 4302-5105 asrB
1217 CAMPVV010000028.1 GCA946997625_00602 gene open 5115-6092 asrC
1218 CAMPVV010000028.1 GCA946997625_00603 gene open 6120-6884 nirC
1219 CAMPVV010000028.1 GCA946997625_00604 gene open 6956-7417
1220 CAMPVV010000028.1 GCA946997625_00605 gene open 7419-8195
1221 CAMPVV010000028.1 GCA946997625_00606 gene open 8198-9394
1222 CAMPVV010000028.1 GCA946997625_00607 gene open 9471-10013 hpf
1223 CAMPVV010000028.1 GCA946997625_00608 gene open 10090-10773
1224 CAMPVV010000028.1 GCA946997625_00609 gene open 10766-11935
1225 CAMPVV010000028.1 GCA946997625_00610 gene open 11932-13713 recQ
1226 CAMPVV010000028.1 GCA946997625_00611 gene open 13735-14103
1227 CAMPVV010000029.1 GCA946997625_00612 CDS open 47-427 _na     126_aa FMN-binding domain protein
1228 CAMPVV010000029.1 GCA946997625_00613 CDS open 473-1438 _na     321_aa Transporter%2C auxin efflux carrier (AEC) family protein
1229 CAMPVV010000029.1 GCA946997625_00614 CDS open 1609-2394 _na     261_aa deoR Transcriptional regulator%2C DeoR family
1230 CAMPVV010000029.1 GCA946997625_00615 CDS open 2404-3681 _na     425_aa ygbK YgbK domain protein
1231 CAMPVV010000029.1 GCA946997625_00616 CDS open 3696-4694 _na     332_aa pdxA 4-hydroxythreonine-4-phosphate dehydrogenase PdxA
1232 CAMPVV010000029.1 GCA946997625_00617 CDS open 4669-6084 _na     471_aa Transporter%2C gluconate:H+ symporter family
1233 CAMPVV010000029.1 GCA946997625_00618 CDS open 6033-7088 _na     351_aa Sugar isomerase%2C KpsF/GutQ family
1234 CAMPVV010000029.1 GCA946997625_00619 CDS open 7154-7636 _na     160_aa queF preQ(1) synthase
1235 CAMPVV010000029.1 GCA946997625_00620 CDS open 7637-8332 _na     231_aa queC 7-cyano-7-deazaguanine synthase QueC
1236 CAMPVV010000029.1 GCA946997625_00621 CDS open 8341-8916 _na     191_aa folE GTP cyclohydrolase I FolE
1237 CAMPVV010000029.1 GCA946997625_00622 CDS open 8917-9585 _na     222_aa queE putative 7-carboxy-7-deazaguanine synthase QueE
1238 CAMPVV010000029.1 GCA946997625_00623 CDS open 9587-10015 _na     142_aa queD 6-carboxytetrahydropterin synthase QueD
1239 CAMPVV010000029.1 GCA946997625_00624 CDS open 10213-11007 _na     264_aa Peptidase%2C M48 family
1240 CAMPVV010000029.1 GCA946997625_00625 CDS open 11129-11383 _na     84_aa Lipoprotein
1241 CAMPVV010000029.1 GCA946997625_00626 CDS open 11669-12235 _na     188_aa cobU bifunctional adenosylcobinamide kinase/adenosylcobinamide-phosphate guanylyltransferase
1242 CAMPVV010000029.1 GCA946997625_00627 CDS open 12255-13061 _na     268_aa cobS adenosylcobinamide-GDP ribazoletransferase
1243 CAMPVV010000029.1 GCA946997625_00628 CDS open 13076-13657 _na     193_aa Phosphoglycerate mutase family protein
1244 CAMPVV010000029.1 GCA946997625_00612 gene open 47-427
1245 CAMPVV010000029.1 GCA946997625_00613 gene open 473-1438
1246 CAMPVV010000029.1 GCA946997625_00614 gene open 1609-2394 deoR
1247 CAMPVV010000029.1 GCA946997625_00615 gene open 2404-3681 ygbK
1248 CAMPVV010000029.1 GCA946997625_00616 gene open 3696-4694 pdxA
1249 CAMPVV010000029.1 GCA946997625_00617 gene open 4669-6084
1250 CAMPVV010000029.1 GCA946997625_00618 gene open 6033-7088
1251 CAMPVV010000029.1 GCA946997625_00619 gene open 7154-7636 queF
1252 CAMPVV010000029.1 GCA946997625_00620 gene open 7637-8332 queC
1253 CAMPVV010000029.1 GCA946997625_00621 gene open 8341-8916 folE
1254 CAMPVV010000029.1 GCA946997625_00622 gene open 8917-9585 queE
1255 CAMPVV010000029.1 GCA946997625_00623 gene open 9587-10015 queD
1256 CAMPVV010000029.1 GCA946997625_00624 gene open 10213-11007
1257 CAMPVV010000029.1 GCA946997625_00625 gene open 11129-11383
1258 CAMPVV010000029.1 GCA946997625_00626 gene open 11669-12235 cobU
1259 CAMPVV010000029.1 GCA946997625_00627 gene open 12255-13061 cobS
1260 CAMPVV010000029.1 GCA946997625_00628 gene open 13076-13657
1261 CAMPVV010000030.1 GCA946997625_00629 CDS open 21-809 _na     262_aa hypothetical protein
1262 CAMPVV010000030.1 GCA946997625_00630 CDS open 827-1510 _na     227_aa radC DNA repair protein RadC
1263 CAMPVV010000030.1 GCA946997625_00631 CDS open 1511-2428 _na     305_aa PSP1 C-terminal domain-containing protein
1264 CAMPVV010000030.1 GCA946997625_00632 CDS open 2428-3093 _na     221_aa Methyltransferase small domain protein
1265 CAMPVV010000030.1 GCA946997625_00633 CDS open 3141-3485 _na     114_aa DUF2023 domain-containing protein
1266 CAMPVV010000030.1 GCA946997625_00634 CDS open 3505-4002 _na     165_aa flavodoxin
1267 CAMPVV010000030.1 GCA946997625_00635 CDS open 4199-6181 _na     660_aa uvrB excinuclease ABC subunit UvrB
1268 CAMPVV010000030.1 GCA946997625_00636 CDS open 6190-7404 _na     404_aa xseA exodeoxyribonuclease VII large subunit
1269 CAMPVV010000030.1 GCA946997625_00637 CDS open 7385-8059 _na     224_aa Tetratricopeptide repeat protein
1270 CAMPVV010000030.1 GCA946997625_00638 CDS open 8078-8929 _na     283_aa dprA DNA-processing protein DprA
1271 CAMPVV010000030.1 GCA946997625_00639 CDS open 8926-11193 _na     755_aa topA type I DNA topoisomerase
1272 CAMPVV010000030.1 GCA946997625_00640 CDS open 11215-12522 _na     435_aa trmFO methylenetetrahydrofolate--tRNA-(uracil(54)-C(5))-methyltransferase (FADH(2)-oxidizing) TrmFO
1273 CAMPVV010000030.1 GCA946997625_00641 CDS open 12544-13332 _na     262_aa Phage integrase SAM-like domain protein
1274 CAMPVV010000030.1 GCA946997625_00629 gene open 21-809
1275 CAMPVV010000030.1 GCA946997625_00630 gene open 827-1510 radC
1276 CAMPVV010000030.1 GCA946997625_00631 gene open 1511-2428
1277 CAMPVV010000030.1 GCA946997625_00632 gene open 2428-3093
1278 CAMPVV010000030.1 GCA946997625_00633 gene open 3141-3485
1279 CAMPVV010000030.1 GCA946997625_00634 gene open 3505-4002
1280 CAMPVV010000030.1 GCA946997625_00635 gene open 4199-6181 uvrB
1281 CAMPVV010000030.1 GCA946997625_00636 gene open 6190-7404 xseA
1282 CAMPVV010000030.1 GCA946997625_00637 gene open 7385-8059
1283 CAMPVV010000030.1 GCA946997625_00638 gene open 8078-8929 dprA
1284 CAMPVV010000030.1 GCA946997625_00639 gene open 8926-11193 topA
1285 CAMPVV010000030.1 GCA946997625_00640 gene open 11215-12522 trmFO
1286 CAMPVV010000030.1 GCA946997625_00641 gene open 12544-13332
1287 CAMPVV010000031.1 GCA946997625_00642 CDS open 1258-2991 _na     577_aa Phosphoenolpyruvate carboxykinase (ATP)
1288 CAMPVV010000031.1 GCA946997625_00643 CDS open 2999-3334 _na     111_aa Lipoprotein
1289 CAMPVV010000031.1 GCA946997625_00644 CDS open 3452-5215 _na     587_aa msbA Putative lipid A export ATP-binding/permease protein MsbA
1290 CAMPVV010000031.1 GCA946997625_00645 CDS open 5244-5615 _na     123_aa Aldoketomutase
1291 CAMPVV010000031.1 GCA946997625_00646 CDS open 5660-7213 _na     517_aa Pyridine nucleotide-disulfide oxidoreductase
1292 CAMPVV010000031.1 GCA946997625_00647 CDS open 7336-7605 _na     89_aa Glutaredoxin
1293 CAMPVV010000031.1 GCA946997625_00648 CDS open 7642-8688 _na     348_aa 3-hydroxyisobutyryl-CoA hydrolase
1294 CAMPVV010000031.1 GCA946997625_00649 CDS open 8709-9860 _na     383_aa iadA beta-aspartyl-peptidase
1295 CAMPVV010000031.1 GCA946997625_00650 CDS open 9869-10642 _na     257_aa S4 domain protein
1296 CAMPVV010000031.1 GCA946997625_00651 CDS open 10764-11396 _na     210_aa yaaA Peroxide stress protein YaaA
1297 CAMPVV010000031.1 GCA946997625_00652 CDS open 11409-12548 _na     379_aa nagA N-acetylglucosamine-6-phosphate deacetylase
1298 CAMPVV010000031.1 GCA946997625_00653 CDS open 12772-13329 _na     185_aa Sodium:alanine symporter family protein
1299 CAMPVV010000031.1 GCA946997625_00642 gene open 1258-2991
1300 CAMPVV010000031.1 GCA946997625_00643 gene open 2999-3334
1301 CAMPVV010000031.1 GCA946997625_00644 gene open 3452-5215 msbA
1302 CAMPVV010000031.1 GCA946997625_00645 gene open 5244-5615
1303 CAMPVV010000031.1 GCA946997625_00646 gene open 5660-7213
1304 CAMPVV010000031.1 GCA946997625_00647 gene open 7336-7605
1305 CAMPVV010000031.1 GCA946997625_00648 gene open 7642-8688
1306 CAMPVV010000031.1 GCA946997625_00649 gene open 8709-9860 iadA
1307 CAMPVV010000031.1 GCA946997625_00650 gene open 9869-10642
1308 CAMPVV010000031.1 GCA946997625_00651 gene open 10764-11396 yaaA
1309 CAMPVV010000031.1 GCA946997625_00652 gene open 11409-12548 nagA
1310 CAMPVV010000031.1 GCA946997625_00653 gene open 12772-13329
1311 CAMPVV010000032.1 GCA946997625_00654 CDS open 9-764 _na     251_aa lpxC UDP-3-O-acyl-N-acetylglucosamine deacetylase
1312 CAMPVV010000032.1 GCA946997625_00655 CDS open 777-1202 _na     141_aa fabZ 3-hydroxyacyl-ACP dehydratase FabZ
1313 CAMPVV010000032.1 GCA946997625_00656 CDS open 1218-1991 _na     257_aa lpxA acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase
1314 CAMPVV010000032.1 GCA946997625_00657 CDS open 1991-2794 _na     267_aa minC Septum site-determining protein MinC
1315 CAMPVV010000032.1 GCA946997625_00658 CDS open 2805-3878 _na     357_aa lpxB lipid-A-disaccharide synthase
1316 CAMPVV010000032.1 GCA946997625_00659 CDS open 3875-5644 _na     589_aa ABC transporter%2C ATP-binding protein
1317 CAMPVV010000032.1 GCA946997625_00660 CDS open 5644-6393 _na     249_aa rph ribonuclease PH
1318 CAMPVV010000032.1 GCA946997625_00661 CDS open 6365-6949 _na     194_aa XTP/dITP diphosphatase
1319 CAMPVV010000032.1 GCA946997625_00662 CDS open 6963-7811 _na     282_aa SIS domain protein
1320 CAMPVV010000032.1 GCA946997625_00663 CDS open 8046-8774 _na     242_aa Peptidase C26
1321 CAMPVV010000032.1 GCA946997625_00664 CDS open 8802-10358 _na     518_aa abgT AbgT transporter family
1322 CAMPVV010000032.1 GCA946997625_00665 CDS open 10441-12282 _na     613_aa ABC transporter
1323 CAMPVV010000032.1 GCA946997625_00654 gene open 9-764 lpxC
1324 CAMPVV010000032.1 GCA946997625_00655 gene open 777-1202 fabZ
1325 CAMPVV010000032.1 GCA946997625_00656 gene open 1218-1991 lpxA
1326 CAMPVV010000032.1 GCA946997625_00657 gene open 1991-2794 minC
1327 CAMPVV010000032.1 GCA946997625_00658 gene open 2805-3878 lpxB
1328 CAMPVV010000032.1 GCA946997625_00659 gene open 3875-5644
1329 CAMPVV010000032.1 GCA946997625_00660 gene open 5644-6393 rph
1330 CAMPVV010000032.1 GCA946997625_00661 gene open 6365-6949
1331 CAMPVV010000032.1 GCA946997625_00662 gene open 6963-7811
1332 CAMPVV010000032.1 GCA946997625_00663 gene open 8046-8774
1333 CAMPVV010000032.1 GCA946997625_00664 gene open 8802-10358 abgT
1334 CAMPVV010000032.1 GCA946997625_00665 gene open 10441-12282
1335 CAMPVV010000033.1 GCA946997625_00666 CDS open 39-659 _na     206_aa hypothetical protein
1336 CAMPVV010000033.1 GCA946997625_00667 CDS open 625-2145 _na     506_aa Amino acid carrier protein
1337 CAMPVV010000033.1 GCA946997625_00668 CDS open 2287-2598 _na     103_aa arsR Transcriptional regulator%2C ArsR family
1338 CAMPVV010000033.1 GCA946997625_00669 CDS open 2558-5005 _na     815_aa Pyridine nucleotide-disulfide oxidoreductase
1339 CAMPVV010000033.1 GCA946997625_00670 CDS open 5080-5883 _na     267_aa Histidinol-phosphatase
1340 CAMPVV010000033.1 GCA946997625_00671 CDS open 5984-7288 _na     434_aa Suppressor of fused-like domain-containing protein
1341 CAMPVV010000033.1 GCA946997625_00672 CDS open 7293-7874 _na     193_aa DJ-1/PfpI family protein
1342 CAMPVV010000033.1 GCA946997625_00673 CDS open 7902-8387 _na     161_aa peptidylprolyl isomerase
1343 CAMPVV010000033.1 GCA946997625_00674 CDS open 8399-8842 _na     147_aa rpiB ribose 5-phosphate isomerase B
1344 CAMPVV010000033.1 GCA946997625_00675 CDS open 8870-9208 _na     112_aa Histidine triad domain protein
1345 CAMPVV010000033.1 GCA946997625_00676 CDS open 9252-9941 _na     229_aa YheO-like protein
1346 CAMPVV010000033.1 GCA946997625_00677 CDS open 10185-11822 _na     545_aa tnaA Aromatic amino acid beta-eliminating lyase/threonine aldolase domain-containing protein
1347 CAMPVV010000033.1 GCA946997625_00678 CDS open 12088-12228 _na     46_aa hypothetical protein
1348 CAMPVV010000033.1 GCA946997625_00666 gene open 39-659
1349 CAMPVV010000033.1 GCA946997625_00667 gene open 625-2145
1350 CAMPVV010000033.1 GCA946997625_00668 gene open 2287-2598 arsR
1351 CAMPVV010000033.1 GCA946997625_00669 gene open 2558-5005
1352 CAMPVV010000033.1 GCA946997625_00670 gene open 5080-5883
1353 CAMPVV010000033.1 GCA946997625_00671 gene open 5984-7288
1354 CAMPVV010000033.1 GCA946997625_00672 gene open 7293-7874
1355 CAMPVV010000033.1 GCA946997625_00673 gene open 7902-8387
1356 CAMPVV010000033.1 GCA946997625_00674 gene open 8399-8842 rpiB
1357 CAMPVV010000033.1 GCA946997625_00675 gene open 8870-9208
1358 CAMPVV010000033.1 GCA946997625_00676 gene open 9252-9941
1359 CAMPVV010000033.1 GCA946997625_00677 gene open 10185-11822 tnaA
1360 CAMPVV010000033.1 GCA946997625_00678 gene open 12088-12228
1361 CAMPVV010000034.1 GCA946997625_00679 CDS open 778-1215 _na     145_aa hypothetical protein
1362 CAMPVV010000034.1 GCA946997625_00680 CDS open 1259-2899 _na     546_aa AAA-ATPase-like domain-containing protein
1363 CAMPVV010000034.1 GCA946997625_00681 CDS open 3016-4176 _na     386_aa Outer membrane insertion signal domain protein
1364 CAMPVV010000034.1 GCA946997625_00682 CDS open 4603-4764 _na     53_aa hypothetical protein
1365 CAMPVV010000034.1 GCA946997625_00683 CDS open 4793-6889 _na     698_aa feoB ferrous iron transport protein B
1366 CAMPVV010000034.1 GCA946997625_00684 CDS open 7289-7804 _na     171_aa nrdG anaerobic ribonucleoside-triphosphate reductase activating protein
1367 CAMPVV010000034.1 GCA946997625_00685 CDS open 7820-10024 _na     734_aa nrdD anaerobic ribonucleoside-triphosphate reductase
1368 CAMPVV010000034.1 GCA946997625_00686 CDS open 10204-11193 _na     329_aa fba class II fructose-1%2C6-bisphosphate aldolase
1369 CAMPVV010000034.1 GCA946997625_00687 CDS open 11212-11697 _na     161_aa Cobalt transport protein
1370 CAMPVV010000034.1 GCA946997625_00688 CDS open 11684-12958 _na     424_aa serS serine--tRNA ligase
1371 CAMPVV010000034.1 GCA946997625_00679 gene open 778-1215
1372 CAMPVV010000034.1 GCA946997625_00680 gene open 1259-2899
1373 CAMPVV010000034.1 GCA946997625_00681 gene open 3016-4176
1374 CAMPVV010000034.1 GCA946997625_00682 gene open 4603-4764
1375 CAMPVV010000034.1 GCA946997625_00683 gene open 4793-6889 feoB
1376 CAMPVV010000034.1 GCA946997625_00684 gene open 7289-7804 nrdG
1377 CAMPVV010000034.1 GCA946997625_00685 gene open 7820-10024 nrdD
1378 CAMPVV010000034.1 GCA946997625_00686 gene open 10204-11193 fba
1379 CAMPVV010000034.1 GCA946997625_00687 gene open 11212-11697
1380 CAMPVV010000034.1 GCA946997625_00688 gene open 11684-12958 serS
1381 CAMPVV010000035.1 GCA946997625_00689 gene open 87-422 RNaseP_bact_a
1382 CAMPVV010000035.1 GCA946997625_00689 ncRNA open 87-422 Bacterial RNase P class A
1383 CAMPVV010000035.1 GCA946997625_00690 CDS open 429-1001 _na     190_aa TPM domain-containing protein
1384 CAMPVV010000035.1 GCA946997625_00691 CDS open 1012-1788 _na     258_aa Nif3-like dinuclear metal center hexameric protein
1385 CAMPVV010000035.1 GCA946997625_00692 CDS open 1785-2660 _na     291_aa RNA polymerase sigma-70 domain-containing protein
1386 CAMPVV010000035.1 GCA946997625_00693 CDS open 2702-4012 _na     436_aa sigA RNA polymerase sigma factor SigA
1387 CAMPVV010000035.1 GCA946997625_00694 CDS open 4022-5848 _na     608_aa DNA primase
1388 CAMPVV010000035.1 GCA946997625_00695 CDS open 5969-7591 _na     540_aa peptidylprolyl isomerase
1389 CAMPVV010000035.1 GCA946997625_00696 CDS open 7634-9019 _na     461_aa Sigma-54 interaction domain protein
1390 CAMPVV010000035.1 GCA946997625_00697 CDS open 9117-10118 _na     333_aa rseP RIP metalloprotease RseP
1391 CAMPVV010000035.1 GCA946997625_00698 CDS open 10115-10783 _na     222_aa Thymidylate kinase-like domain-containing protein
1392 CAMPVV010000035.1 GCA946997625_00699 CDS open 10765-11919 _na     384_aa dxr 1-deoxy-D-xylulose-5-phosphate reductoisomerase
1393 CAMPVV010000035.1 GCA946997625_00700 CDS open 11916-12569 _na     217_aa hypothetical protein
1394 CAMPVV010000035.1 GCA946997625_00690 gene open 429-1001
1395 CAMPVV010000035.1 GCA946997625_00691 gene open 1012-1788
1396 CAMPVV010000035.1 GCA946997625_00692 gene open 1785-2660
1397 CAMPVV010000035.1 GCA946997625_00693 gene open 2702-4012 sigA
1398 CAMPVV010000035.1 GCA946997625_00694 gene open 4022-5848
1399 CAMPVV010000035.1 GCA946997625_00695 gene open 5969-7591
1400 CAMPVV010000035.1 GCA946997625_00696 gene open 7634-9019
1401 CAMPVV010000035.1 GCA946997625_00697 gene open 9117-10118 rseP
1402 CAMPVV010000035.1 GCA946997625_00698 gene open 10115-10783
1403 CAMPVV010000035.1 GCA946997625_00699 gene open 10765-11919 dxr
1404 CAMPVV010000035.1 GCA946997625_00700 gene open 11916-12569
1405 CAMPVV010000036.1 GCA946997625_00701 CDS open 14-1213 _na     399_aa Phosphoglycerate kinase
1406 CAMPVV010000036.1 GCA946997625_00702 CDS open 1277-2281 _na     334_aa gap type I glyceraldehyde-3-phosphate dehydrogenase
1407 CAMPVV010000036.1 GCA946997625_00703 CDS open 2431-3285 _na     284_aa Pseudouridine synthase
1408 CAMPVV010000036.1 GCA946997625_00704 CDS open 3469-4461 _na     330_aa Glutamyl-tRNA reductase
1409 CAMPVV010000036.1 GCA946997625_00705 CDS open 4473-5372 _na     299_aa hemC hydroxymethylbilane synthase
1410 CAMPVV010000036.1 GCA946997625_00706 CDS open 5391-6869 _na     492_aa uroporphyrinogen-III C-methyltransferase
1411 CAMPVV010000036.1 GCA946997625_00707 CDS open 6853-7830 _na     325_aa hemB porphobilinogen synthase
1412 CAMPVV010000036.1 GCA946997625_00708 CDS open 7806-9128 _na     440_aa hemL glutamate-1-semialdehyde 2%2C1-aminomutase
1413 CAMPVV010000036.1 GCA946997625_00709 CDS open 9130-9963 _na     277_aa precorrin-2 dehydrogenase
1414 CAMPVV010000036.1 GCA946997625_00710 CDS open 10000-11697 _na     565_aa AAA-ATPase-like domain-containing protein
1415 CAMPVV010000036.1 GCA946997625_00711 CDS open 11723-12265 _na     180_aa helix-turn-helix domain-containing protein
1416 CAMPVV010000036.1 GCA946997625_00701 gene open 14-1213
1417 CAMPVV010000036.1 GCA946997625_00702 gene open 1277-2281 gap
1418 CAMPVV010000036.1 GCA946997625_00703 gene open 2431-3285
1419 CAMPVV010000036.1 GCA946997625_00704 gene open 3469-4461
1420 CAMPVV010000036.1 GCA946997625_00705 gene open 4473-5372 hemC
1421 CAMPVV010000036.1 GCA946997625_00706 gene open 5391-6869
1422 CAMPVV010000036.1 GCA946997625_00707 gene open 6853-7830 hemB
1423 CAMPVV010000036.1 GCA946997625_00708 gene open 7806-9128 hemL
1424 CAMPVV010000036.1 GCA946997625_00709 gene open 9130-9963
1425 CAMPVV010000036.1 GCA946997625_00710 gene open 10000-11697
1426 CAMPVV010000036.1 GCA946997625_00711 gene open 11723-12265
1427 CAMPVV010000037.1 regulatory_region open 10261-10358 Purine riboswitch aptamer
1428 CAMPVV010000037.1 GCA946997625_00712 CDS open 339-1013 _na     224_aa Putative alpha-ribazole phosphatase
1429 CAMPVV010000037.1 GCA946997625_00713 CDS open 953-1534 _na     193_aa ruvA Holliday junction branch migration protein RuvA
1430 CAMPVV010000037.1 GCA946997625_00714 CDS open 1543-4389 _na     948_aa uvrA excinuclease ABC subunit UvrA
1431 CAMPVV010000037.1 GCA946997625_00715 CDS open 4408-5934 _na     508_aa SpoIID/LytB domain protein
1432 CAMPVV010000037.1 GCA946997625_00716 CDS open 5921-6664 _na     247_aa kdsB 3-deoxy-manno-octulosonate cytidylyltransferase
1433 CAMPVV010000037.1 GCA946997625_00717 CDS open 6972-8210 _na     412_aa Amidohydrolase
1434 CAMPVV010000037.1 GCA946997625_00718 CDS open 8300-8866 _na     188_aa xanthine phosphoribosyltransferase
1435 CAMPVV010000037.1 GCA946997625_00719 CDS open 8885-10210 _na     441_aa Xanthine permease
1436 CAMPVV010000037.1 GCA946997625_00720 CDS open 10430-11185 _na     251_aa ABC transporter%2C permease protein
1437 CAMPVV010000037.1 GCA946997625_00721 CDS open 11169-11474 _na     101_aa hypothetical protein
1438 CAMPVV010000037.1 GCA946997625_00712 gene open 339-1013
1439 CAMPVV010000037.1 GCA946997625_00713 gene open 953-1534 ruvA
1440 CAMPVV010000037.1 GCA946997625_00714 gene open 1543-4389 uvrA
1441 CAMPVV010000037.1 GCA946997625_00715 gene open 4408-5934
1442 CAMPVV010000037.1 GCA946997625_00716 gene open 5921-6664 kdsB
1443 CAMPVV010000037.1 GCA946997625_00717 gene open 6972-8210
1444 CAMPVV010000037.1 GCA946997625_00718 gene open 8300-8866
1445 CAMPVV010000037.1 GCA946997625_00719 gene open 8885-10210
1446 CAMPVV010000037.1 GCA946997625_00720 gene open 10430-11185
1447 CAMPVV010000037.1 GCA946997625_00721 gene open 11169-11474
1448 CAMPVV010000038.1 GCA946997625_00722 CDS open 49-657 _na     202_aa hypothetical protein
1449 CAMPVV010000038.1 GCA946997625_00723 CDS open 693-1544 _na     283_aa rapZ RNase adapter RapZ
1450 CAMPVV010000038.1 GCA946997625_00724 CDS open 1531-3303 _na     590_aa uvrC excinuclease ABC subunit UvrC
1451 CAMPVV010000038.1 GCA946997625_00725 CDS open 3308-4825 _na     505_aa Stage II sporulation protein E
1452 CAMPVV010000038.1 GCA946997625_00726 CDS open 4844-5752 _na     302_aa DUF1385 domain-containing protein
1453 CAMPVV010000038.1 GCA946997625_00727 CDS open 5781-6194 _na     137_aa Transcriptional regulator%2C Rrf2 family
1454 CAMPVV010000038.1 GCA946997625_00728 CDS open 6255-6782 _na     175_aa Lipoprotein
1455 CAMPVV010000038.1 GCA946997625_00729 CDS open 6955-7875 _na     306_aa accD acetyl-CoA carboxylase%2C carboxyltransferase subunit beta
1456 CAMPVV010000038.1 GCA946997625_00730 CDS open 7865-8821 _na     318_aa acetyl-CoA carboxylase carboxyltransferase subunit alpha
1457 CAMPVV010000038.1 GCA946997625_00731 CDS open 8826-9797 _na     323_aa pfkA 6-phosphofructokinase
1458 CAMPVV010000038.1 GCA946997625_00732 CDS open 9817-10119 _na     100_aa DUF496 domain-containing protein
1459 CAMPVV010000038.1 GCA946997625_00733 CDS open 10121-10714 _na     197_aa recR recombination mediator RecR
1460 CAMPVV010000038.1 GCA946997625_00722 gene open 49-657
1461 CAMPVV010000038.1 GCA946997625_00723 gene open 693-1544 rapZ
1462 CAMPVV010000038.1 GCA946997625_00724 gene open 1531-3303 uvrC
1463 CAMPVV010000038.1 GCA946997625_00725 gene open 3308-4825
1464 CAMPVV010000038.1 GCA946997625_00726 gene open 4844-5752
1465 CAMPVV010000038.1 GCA946997625_00727 gene open 5781-6194
1466 CAMPVV010000038.1 GCA946997625_00728 gene open 6255-6782
1467 CAMPVV010000038.1 GCA946997625_00729 gene open 6955-7875 accD
1468 CAMPVV010000038.1 GCA946997625_00730 gene open 7865-8821
1469 CAMPVV010000038.1 GCA946997625_00731 gene open 8826-9797 pfkA
1470 CAMPVV010000038.1 GCA946997625_00732 gene open 9817-10119
1471 CAMPVV010000038.1 GCA946997625_00733 gene open 10121-10714 recR
1472 CAMPVV010000039.1 repeat_region open 9619-10780 CRISPR array with 18 repeats of length 30%2C consensus sequence ATTTACATTCTACTTTAGTTTTACTCTAAT and spacer length 36
1473 CAMPVV010000039.1 GCA946997625_00734 CDS open 959-2845 _na     628_aa Mu transposase C-terminal domain-containing protein
1474 CAMPVV010000039.1 GCA946997625_00735 CDS open 2855-3256 _na     133_aa HTH cro/C1-type domain-containing protein
1475 CAMPVV010000039.1 GCA946997625_00736 CDS open 3257-3358 _na     33_aa hypothetical protein
1476 CAMPVV010000039.1 GCA946997625_00737 CDS open 3446-4210 _na     254_aa phage integrase N-terminal SAM-like domain-containing protein
1477 CAMPVV010000039.1 GCA946997625_00738 CDS open 4215-4814 _na     199_aa BRO family protein
1478 CAMPVV010000039.1 GCA946997625_00739 CDS open 4857-5111 _na     84_aa hypothetical protein
1479 CAMPVV010000039.1 GCA946997625_00740 CDS open 5190-5678 _na     162_aa hypothetical protein
1480 CAMPVV010000039.1 GCA946997625_00741 CDS open 5647-5766 _na     39_aa hypothetical protein
1481 CAMPVV010000039.1 GCA946997625_00742 CDS open 6241-6837 _na     198_aa lexA LexA family transcriptional regulator
1482 CAMPVV010000039.1 GCA946997625_00743 CDS open 7331-7465 _na     44_aa hypothetical protein
1483 CAMPVV010000039.1 GCA946997625_00744 CDS open 7505-7783 _na     92_aa hypothetical protein
1484 CAMPVV010000039.1 GCA946997625_00745 CDS open 7813-7986 _na     57_aa yopX YopX protein domain-containing protein
1485 CAMPVV010000039.1 GCA946997625_00746 CDS open 8102-8203 _na     33_aa hypothetical protein
1486 CAMPVV010000039.1 GCA946997625_00747 CDS open 8434-9060 _na     208_aa Peptidase S24-like protein
1487 CAMPVV010000039.1 GCA946997625_00748 CDS open 9189-9581 _na     130_aa hypothetical protein
1488 CAMPVV010000039.1 GCA946997625_00734 gene open 959-2845
1489 CAMPVV010000039.1 GCA946997625_00735 gene open 2855-3256
1490 CAMPVV010000039.1 GCA946997625_00736 gene open 3257-3358
1491 CAMPVV010000039.1 GCA946997625_00737 gene open 3446-4210
1492 CAMPVV010000039.1 GCA946997625_00738 gene open 4215-4814
1493 CAMPVV010000039.1 GCA946997625_00739 gene open 4857-5111
1494 CAMPVV010000039.1 GCA946997625_00740 gene open 5190-5678
1495 CAMPVV010000039.1 GCA946997625_00741 gene open 5647-5766
1496 CAMPVV010000039.1 GCA946997625_00742 gene open 6241-6837 lexA
1497 CAMPVV010000039.1 GCA946997625_00743 gene open 7331-7465
1498 CAMPVV010000039.1 GCA946997625_00744 gene open 7505-7783
1499 CAMPVV010000039.1 GCA946997625_00745 gene open 7813-7986 yopX
1500 CAMPVV010000039.1 GCA946997625_00746 gene open 8102-8203