HOMD Banner
Taxonomy: V4.3   |  16S rRNA RefSeq: V16.03   |  Genomic RefSeq: V11.03   |  Viruses: V1.2

BAKTAGenome Explorer: Fusobacterium gonidiaformans (GCA_946997625.1)

Select a Genome:
BAKTA Annotations for GCA_946997625.1
Genome Selected: Fusobacterium gonidiaformans
ContigsBases CDSrRNA tmRNAtRNA
199 1615346 1609 0 1 15
[Table]   [AA Fasta]      [Browser]   [Text]   [Excel]  
Search & Sort all 3272 Records
Search These Records: Clear
Sort Column:   Molecule   PID   NA   AA   Gene  Gene Product  Reverse
Annotation Table [page:4]    |    Number of Records Found: 3272 [7 Pages]    |    Previous Page <==> Next Page    |    Jump to Page: [ 1  2  3  4  5  6  7  ]
Notes:   1- Column headers only sort the current page. 2- Select [NA] or [AA] links to show sequences.
Region Protein-ID Type Genome
Viewer		 Range
(bp)		 Show Sequences
(length) NA / AA		 BAKTA
Gene		 BAKTA
GeneProduct
1501 CAMPVV010000039.1 GCA946997625_00747 gene open 8434-9060
1502 CAMPVV010000039.1 GCA946997625_00748 gene open 9189-9581
1503 CAMPVV010000040.1 GCA946997625_00749 CDS open 152-1696 _na     514_aa Carbohydrate kinase%2C FGGY family protein
1504 CAMPVV010000040.1 GCA946997625_00750 CDS open 1851-2834 _na     327_aa asnA aspartate--ammonia ligase
1505 CAMPVV010000040.1 GCA946997625_00751 CDS open 3124-3798 _na     224_aa artQ Arginine ABC transporter%2C permease protein ArtQ
1506 CAMPVV010000040.1 GCA946997625_00752 CDS open 3791-4519 _na     242_aa glnQ Glutamine ABC transporter%2C ATP-binding protein GlnQ
1507 CAMPVV010000040.1 GCA946997625_00753 CDS open 4541-5257 _na     238_aa artJ Putative arginine ABC transporter%2C periplasmic arginine-binding protein ArtJ
1508 CAMPVV010000040.1 GCA946997625_00754 CDS open 5271-5984 _na     237_aa putative 2-phosphosulfolactate phosphatase
1509 CAMPVV010000040.1 GCA946997625_00755 CDS open 6052-6387 _na     111_aa DUF937 domain-containing protein
1510 CAMPVV010000040.1 GCA946997625_00756 CDS open 6353-7354 _na     333_aa Site-specific recombinase%2C phage integrase family
1511 CAMPVV010000040.1 GCA946997625_00757 CDS open 7509-8054 _na     181_aa hypothetical protein
1512 CAMPVV010000040.1 GCA946997625_00758 CDS open 8064-8987 _na     307_aa hypothetical protein
1513 CAMPVV010000040.1 GCA946997625_00759 CDS open 9035-9832 _na     265_aa nikM Nickel transport complex%2C NikM subunit%2C transmembrane
1514 CAMPVV010000040.1 GCA946997625_00760 CDS open 9865-10284 _na     139_aa Lipoprotein
1515 CAMPVV010000040.1 GCA946997625_00761 CDS open 10313-10771 _na     152_aa hypothetical protein
1516 CAMPVV010000040.1 GCA946997625_00749 gene open 152-1696
1517 CAMPVV010000040.1 GCA946997625_00750 gene open 1851-2834 asnA
1518 CAMPVV010000040.1 GCA946997625_00751 gene open 3124-3798 artQ
1519 CAMPVV010000040.1 GCA946997625_00752 gene open 3791-4519 glnQ
1520 CAMPVV010000040.1 GCA946997625_00753 gene open 4541-5257 artJ
1521 CAMPVV010000040.1 GCA946997625_00754 gene open 5271-5984
1522 CAMPVV010000040.1 GCA946997625_00755 gene open 6052-6387
1523 CAMPVV010000040.1 GCA946997625_00756 gene open 6353-7354
1524 CAMPVV010000040.1 GCA946997625_00757 gene open 7509-8054
1525 CAMPVV010000040.1 GCA946997625_00758 gene open 8064-8987
1526 CAMPVV010000040.1 GCA946997625_00759 gene open 9035-9832 nikM
1527 CAMPVV010000040.1 GCA946997625_00760 gene open 9865-10284
1528 CAMPVV010000040.1 GCA946997625_00761 gene open 10313-10771
1529 CAMPVV010000041.1 GCA946997625_00762 CDS open 96-821 _na     241_aa hypothetical protein
1530 CAMPVV010000041.1 GCA946997625_00763 CDS open 814-1458 _na     214_aa cbiE Precorrin-6y C5%2C15-methyltransferase (Decarboxylating)%2C CbiE subunit
1531 CAMPVV010000041.1 GCA946997625_00764 CDS open 1445-2026 _na     193_aa cbiT Precorrin-6Y C5%2C15-methyltransferase (Decarboxylating)%2C CbiT subunit
1532 CAMPVV010000041.1 GCA946997625_00765 CDS open 2016-2738 _na     240_aa cobI precorrin-2 C(20)-methyltransferase
1533 CAMPVV010000041.1 GCA946997625_00766 CDS open 2717-3478 _na     253_aa cobM precorrin-4 C(11)-methyltransferase
1534 CAMPVV010000041.1 GCA946997625_00767 CDS open 3494-4513 _na     339_aa cbiG cobalt-precorrin 5A hydrolase
1535 CAMPVV010000041.1 GCA946997625_00768 CDS open 4506-5249 _na     247_aa Precorrin-3B C(17)-methyltransferase
1536 CAMPVV010000041.1 GCA946997625_00769 CDS open 5264-6019 _na     251_aa cobK precorrin-6A reductase
1537 CAMPVV010000041.1 GCA946997625_00770 CDS open 6047-8311 _na     754_aa Surface antigen variable number repeat protein
1538 CAMPVV010000041.1 GCA946997625_00771 CDS open 8413-10311 _na     632_aa abc-f ribosomal protection-like ABC-F family protein
1539 CAMPVV010000041.1 GCA946997625_00762 gene open 96-821
1540 CAMPVV010000041.1 GCA946997625_00763 gene open 814-1458 cbiE
1541 CAMPVV010000041.1 GCA946997625_00764 gene open 1445-2026 cbiT
1542 CAMPVV010000041.1 GCA946997625_00765 gene open 2016-2738 cobI
1543 CAMPVV010000041.1 GCA946997625_00766 gene open 2717-3478 cobM
1544 CAMPVV010000041.1 GCA946997625_00767 gene open 3494-4513 cbiG
1545 CAMPVV010000041.1 GCA946997625_00768 gene open 4506-5249
1546 CAMPVV010000041.1 GCA946997625_00769 gene open 5264-6019 cobK
1547 CAMPVV010000041.1 GCA946997625_00770 gene open 6047-8311
1548 CAMPVV010000041.1 GCA946997625_00771 gene open 8413-10311 abc-f
1549 CAMPVV010000042.1 GCA946997625_00772 CDS open 10-2889 _na     959_aa DNA polymerase III PolC-type
1550 CAMPVV010000042.1 GCA946997625_00773 CDS open 2899-4200 _na     433_aa Serine/threonine protein kinase
1551 CAMPVV010000042.1 GCA946997625_00774 CDS open 4190-4924 _na     244_aa VacJ-like protein
1552 CAMPVV010000042.1 GCA946997625_00775 CDS open 4925-6283 _na     452_aa pepV dipeptidase PepV
1553 CAMPVV010000042.1 GCA946997625_00776 CDS open 6303-7178 _na     291_aa Phosphatidylglycerol lysyltransferase C-terminal domain-containing protein
1554 CAMPVV010000042.1 GCA946997625_00777 CDS open 7195-8397 _na     400_aa ilvA threonine ammonia-lyase
1555 CAMPVV010000042.1 GCA946997625_00778 CDS open 8418-10052 _na     544_aa Na/Pi-cotransporter II-like protein
1556 CAMPVV010000042.1 GCA946997625_00772 gene open 10-2889
1557 CAMPVV010000042.1 GCA946997625_00773 gene open 2899-4200
1558 CAMPVV010000042.1 GCA946997625_00774 gene open 4190-4924
1559 CAMPVV010000042.1 GCA946997625_00775 gene open 4925-6283 pepV
1560 CAMPVV010000042.1 GCA946997625_00776 gene open 6303-7178
1561 CAMPVV010000042.1 GCA946997625_00777 gene open 7195-8397 ilvA
1562 CAMPVV010000042.1 GCA946997625_00778 gene open 8418-10052
1563 CAMPVV010000043.1 GCA946997625_00779 CDS open 427-897 _na     156_aa D-glycero-beta-D-manno-heptose 1-phosphate adenylyltransferase
1564 CAMPVV010000043.1 GCA946997625_00780 CDS open 900-1367 _na     155_aa tsaE tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE
1565 CAMPVV010000043.1 GCA946997625_00781 CDS open 1348-2016 _na     222_aa tsaB tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB
1566 CAMPVV010000043.1 GCA946997625_00782 CDS open 2080-2439 _na     119_aa Thioredoxin
1567 CAMPVV010000043.1 GCA946997625_00783 CDS open 2534-6148 _na     1204_aa OstA-like protein
1568 CAMPVV010000043.1 GCA946997625_00784 CDS open 6162-8075 _na     637_aa thrS threonine--tRNA ligase
1569 CAMPVV010000043.1 GCA946997625_00785 CDS open 8162-9394 _na     410_aa Radical SAM domain protein
1570 CAMPVV010000043.1 GCA946997625_00786 CDS open 9410-10210 _na     266_aa ABC transporter%2C ATP-binding protein
1571 CAMPVV010000043.1 GCA946997625_00787 CDS open 10207-10473 _na     88_aa hypothetical protein
1572 CAMPVV010000043.1 GCA946997625_00779 gene open 427-897
1573 CAMPVV010000043.1 GCA946997625_00780 gene open 900-1367 tsaE
1574 CAMPVV010000043.1 GCA946997625_00781 gene open 1348-2016 tsaB
1575 CAMPVV010000043.1 GCA946997625_00782 gene open 2080-2439
1576 CAMPVV010000043.1 GCA946997625_00783 gene open 2534-6148
1577 CAMPVV010000043.1 GCA946997625_00784 gene open 6162-8075 thrS
1578 CAMPVV010000043.1 GCA946997625_00785 gene open 8162-9394
1579 CAMPVV010000043.1 GCA946997625_00786 gene open 9410-10210
1580 CAMPVV010000043.1 GCA946997625_00787 gene open 10207-10473
1581 CAMPVV010000044.1 GCA946997625_00788 CDS open 20-1066 _na     348_aa hydF [FeFe] hydrogenase H-cluster maturation GTPase HydF
1582 CAMPVV010000044.1 GCA946997625_00789 CDS open 1077-1829 _na     250_aa exodeoxyribonuclease III
1583 CAMPVV010000044.1 GCA946997625_00790 CDS open 1843-2658 _na     271_aa Putative sirohydrochlorin cobaltochelatase
1584 CAMPVV010000044.1 GCA946997625_00791 CDS open 2686-5952 _na     1088_aa hsdR type I restriction-modification system endonuclease
1585 CAMPVV010000044.1 GCA946997625_00792 CDS open 5965-7392 _na     475_aa site-specific DNA-methyltransferase (adenine-specific)
1586 CAMPVV010000044.1 GCA946997625_00793 CDS open 7404-8945 _na     513_aa Type I restriction modification DNA specificity domain-containing protein
1587 CAMPVV010000044.1 GCA946997625_00794 CDS open 8948-9211 _na     87_aa DUF4926 domain-containing protein
1588 CAMPVV010000044.1 GCA946997625_00795 CDS open 9225-9593 _na     122_aa hypothetical protein
1589 CAMPVV010000044.1 GCA946997625_00788 gene open 20-1066 hydF
1590 CAMPVV010000044.1 GCA946997625_00789 gene open 1077-1829
1591 CAMPVV010000044.1 GCA946997625_00790 gene open 1843-2658
1592 CAMPVV010000044.1 GCA946997625_00791 gene open 2686-5952 hsdR
1593 CAMPVV010000044.1 GCA946997625_00792 gene open 5965-7392
1594 CAMPVV010000044.1 GCA946997625_00793 gene open 7404-8945
1595 CAMPVV010000044.1 GCA946997625_00794 gene open 8948-9211
1596 CAMPVV010000044.1 GCA946997625_00795 gene open 9225-9593
1597 CAMPVV010000045.1 GCA946997625_00796 CDS open 14-277 _na     87_aa D-tyrosyl-tRNA(Tyr) deacylase
1598 CAMPVV010000045.1 GCA946997625_00797 CDS open 316-1704 _na     462_aa nhaC Na+/H+ antiporter NhaC
1599 CAMPVV010000045.1 GCA946997625_00798 CDS open 1860-2582 _na     240_aa LrgB-like protein
1600 CAMPVV010000045.1 GCA946997625_00799 CDS open 2579-2959 _na     126_aa lrgA LrgA family protein
1601 CAMPVV010000045.1 GCA946997625_00800 CDS open 3023-3997 _na     324_aa Electron transfer flavoprotein FAD-binding domain protein
1602 CAMPVV010000045.1 GCA946997625_00801 CDS open 4011-4787 _na     258_aa Electron transfer flavoprotein domain protein
1603 CAMPVV010000045.1 GCA946997625_00802 CDS open 4805-5941 _na     378_aa Butyryl-CoA dehydrogenase
1604 CAMPVV010000045.1 GCA946997625_00803 CDS open 6092-7519 _na     475_aa glcD Putative glycolate oxidase%2C subunit GlcD
1605 CAMPVV010000045.1 GCA946997625_00804 CDS open 7682-8359 _na     225_aa gntR Transcriptional regulator%2C GntR family
1606 CAMPVV010000045.1 GCA946997625_00805 CDS open 8508-8795 _na     95_aa fixX Ferredoxin-like protein FixX family protein
1607 CAMPVV010000045.1 GCA946997625_00806 CDS open 8795-10138 _na     447_aa fixC ETF-QO/FixC ubiquinone-binding domain-containing protein
1608 CAMPVV010000045.1 GCA946997625_00807 CDS open 10108-10308 _na     66_aa hypothetical protein
1609 CAMPVV010000045.1 GCA946997625_00796 gene open 14-277
1610 CAMPVV010000045.1 GCA946997625_00797 gene open 316-1704 nhaC
1611 CAMPVV010000045.1 GCA946997625_00798 gene open 1860-2582
1612 CAMPVV010000045.1 GCA946997625_00799 gene open 2579-2959 lrgA
1613 CAMPVV010000045.1 GCA946997625_00800 gene open 3023-3997
1614 CAMPVV010000045.1 GCA946997625_00801 gene open 4011-4787
1615 CAMPVV010000045.1 GCA946997625_00802 gene open 4805-5941
1616 CAMPVV010000045.1 GCA946997625_00803 gene open 6092-7519 glcD
1617 CAMPVV010000045.1 GCA946997625_00804 gene open 7682-8359 gntR
1618 CAMPVV010000045.1 GCA946997625_00805 gene open 8508-8795 fixX
1619 CAMPVV010000045.1 GCA946997625_00806 gene open 8795-10138 fixC
1620 CAMPVV010000045.1 GCA946997625_00807 gene open 10108-10308
1621 CAMPVV010000046.1 GCA946997625_00808 CDS open 32-283 _na     83_aa hypothetical protein
1622 CAMPVV010000046.1 GCA946997625_00809 CDS open 292-468 _na     58_aa hypothetical protein
1623 CAMPVV010000046.1 GCA946997625_00810 CDS open 460-1968 _na     502_aa ABC transporter%2C substrate-binding protein%2C family 5
1624 CAMPVV010000046.1 GCA946997625_00811 CDS open 1989-3134 _na     381_aa Triacylglycerol lipase
1625 CAMPVV010000046.1 GCA946997625_00812 CDS open 3141-3875 _na     244_aa PAP2 family protein
1626 CAMPVV010000046.1 GCA946997625_00813 CDS open 3878-4372 _na     164_aa ybeY rRNA maturation RNase YbeY
1627 CAMPVV010000046.1 GCA946997625_00814 CDS open 4384-6483 _na     699_aa Phosphohydrolase
1628 CAMPVV010000046.1 GCA946997625_00815 CDS open 6494-8590 _na     698_aa DNA 5'-3' helicase
1629 CAMPVV010000046.1 GCA946997625_00816 CDS open 8812-8967 _na     51_aa hypothetical protein
1630 CAMPVV010000046.1 GCA946997625_00808 gene open 32-283
1631 CAMPVV010000046.1 GCA946997625_00809 gene open 292-468
1632 CAMPVV010000046.1 GCA946997625_00810 gene open 460-1968
1633 CAMPVV010000046.1 GCA946997625_00811 gene open 1989-3134
1634 CAMPVV010000046.1 GCA946997625_00812 gene open 3141-3875
1635 CAMPVV010000046.1 GCA946997625_00813 gene open 3878-4372 ybeY
1636 CAMPVV010000046.1 GCA946997625_00814 gene open 4384-6483
1637 CAMPVV010000046.1 GCA946997625_00815 gene open 6494-8590
1638 CAMPVV010000046.1 GCA946997625_00816 gene open 8812-8967
1639 CAMPVV010000047.1 GCA946997625_00817 gene open 128-474 ssrA
1640 CAMPVV010000047.1 GCA946997625_00817 tmRNA open 128-474 ssrA transfer-messenger RNA%2C SsrA
1641 CAMPVV010000047.1 GCA946997625_00818 CDS open 766-876 _na     36_aa hypothetical protein
1642 CAMPVV010000047.1 GCA946997625_00819 CDS open 977-1243 _na     88_aa Addiction module toxin%2C RelE/StbE family
1643 CAMPVV010000047.1 GCA946997625_00820 CDS open 1240-1470 _na     76_aa relB type II toxin-antitoxin system RelB family antitoxin
1644 CAMPVV010000047.1 GCA946997625_00821 CDS open 1681-1887 _na     68_aa hypothetical protein
1645 CAMPVV010000047.1 GCA946997625_00822 CDS open 2400-2918 _na     172_aa Putative cob(I)yrinic acid a%2Cc-diamide adenosyltransferase
1646 CAMPVV010000047.1 GCA946997625_00823 CDS open 2992-3966 _na     324_aa Bifunctional protein RfaE%2C domain I
1647 CAMPVV010000047.1 GCA946997625_00824 CDS open 3977-4453 _na     158_aa 2-C-methyl-D-erythritol 2%2C4-cyclodiphosphate synthase
1648 CAMPVV010000047.1 GCA946997625_00825 CDS open 4455-5813 _na     452_aa MATE efflux family protein
1649 CAMPVV010000047.1 GCA946997625_00826 CDS open 5777-7171 _na     464_aa Putative butyryl-CoA:acetate CoA-transferase
1650 CAMPVV010000047.1 GCA946997625_00827 CDS open 7216-7593 _na     125_aa rplU 50S ribosomal protein L21
1651 CAMPVV010000047.1 GCA946997625_00828 CDS open 7606-7941 _na     111_aa ribosomal-processing cysteine protease Prp
1652 CAMPVV010000047.1 GCA946997625_00829 CDS open 7942-8226 _na     94_aa rpmA 50S ribosomal protein L27
1653 CAMPVV010000047.1 GCA946997625_00830 CDS open 8318-9244 _na     308_aa Peptidase%2C M48 family
1654 CAMPVV010000047.1 GCA946997625_00831 CDS open 9323-9970 _na     215_aa PAP2 family protein
1655 CAMPVV010000047.1 GCA946997625_00818 gene open 766-876
1656 CAMPVV010000047.1 GCA946997625_00819 gene open 977-1243
1657 CAMPVV010000047.1 GCA946997625_00820 gene open 1240-1470 relB
1658 CAMPVV010000047.1 GCA946997625_00821 gene open 1681-1887
1659 CAMPVV010000047.1 GCA946997625_00822 gene open 2400-2918
1660 CAMPVV010000047.1 GCA946997625_00823 gene open 2992-3966
1661 CAMPVV010000047.1 GCA946997625_00824 gene open 3977-4453
1662 CAMPVV010000047.1 GCA946997625_00825 gene open 4455-5813
1663 CAMPVV010000047.1 GCA946997625_00826 gene open 5777-7171
1664 CAMPVV010000047.1 GCA946997625_00827 gene open 7216-7593 rplU
1665 CAMPVV010000047.1 GCA946997625_00828 gene open 7606-7941
1666 CAMPVV010000047.1 GCA946997625_00829 gene open 7942-8226 rpmA
1667 CAMPVV010000047.1 GCA946997625_00830 gene open 8318-9244
1668 CAMPVV010000047.1 GCA946997625_00831 gene open 9323-9970
1669 CAMPVV010000048.1 GCA946997625_00832 CDS open 192-416 _na     74_aa hypothetical protein
1670 CAMPVV010000048.1 GCA946997625_00833 CDS open 457-840 _na     127_aa Peptidase M15C domain-containing protein
1671 CAMPVV010000048.1 GCA946997625_00834 CDS open 852-1037 _na     61_aa Helix-turn-helix type 11 domain-containing protein
1672 CAMPVV010000048.1 GCA946997625_00835 CDS open 1043-1405 _na     120_aa DUF1353 domain-containing protein
1673 CAMPVV010000048.1 GCA946997625_00836 CDS open 1566-1787 _na     73_aa Helix-turn-helix type 11 domain-containing protein
1674 CAMPVV010000048.1 GCA946997625_00837 CDS open 1899-2192 _na     97_aa hypothetical protein
1675 CAMPVV010000048.1 GCA946997625_00838 CDS open 2456-3157 _na     233_aa DUF6941 domain-containing protein
1676 CAMPVV010000048.1 GCA946997625_00839 CDS open 3357-3869 _na     170_aa infC translation initiation factor IF-3
1677 CAMPVV010000048.1 GCA946997625_00840 CDS open 3915-4121 _na     68_aa rpmI 50S ribosomal protein L35
1678 CAMPVV010000048.1 GCA946997625_00841 CDS open 4139-4489 _na     116_aa rplT 50S ribosomal protein L20
1679 CAMPVV010000048.1 GCA946997625_00842 CDS open 4582-5748 _na     388_aa Arsenite-activated ATPase (ArsA)
1680 CAMPVV010000048.1 GCA946997625_00843 CDS open 5745-6932 _na     395_aa Arsenite-activated ATPase (ArsA)
1681 CAMPVV010000048.1 GCA946997625_00844 CDS open 7208-7759 _na     183_aa LUD domain-containing protein
1682 CAMPVV010000048.1 GCA946997625_00845 CDS open 8696-8869 _na     57_aa hypothetical protein
1683 CAMPVV010000048.1 GCA946997625_00846 CDS open 9293-9439 _na     48_aa hypothetical protein
1684 CAMPVV010000048.1 GCA946997625_00832 gene open 192-416
1685 CAMPVV010000048.1 GCA946997625_00833 gene open 457-840
1686 CAMPVV010000048.1 GCA946997625_00834 gene open 852-1037
1687 CAMPVV010000048.1 GCA946997625_00835 gene open 1043-1405
1688 CAMPVV010000048.1 GCA946997625_00836 gene open 1566-1787
1689 CAMPVV010000048.1 GCA946997625_00837 gene open 1899-2192
1690 CAMPVV010000048.1 GCA946997625_00838 gene open 2456-3157
1691 CAMPVV010000048.1 GCA946997625_00839 gene open 3357-3869 infC
1692 CAMPVV010000048.1 GCA946997625_00840 gene open 3915-4121 rpmI
1693 CAMPVV010000048.1 GCA946997625_00841 gene open 4139-4489 rplT
1694 CAMPVV010000048.1 GCA946997625_00842 gene open 4582-5748
1695 CAMPVV010000048.1 GCA946997625_00843 gene open 5745-6932
1696 CAMPVV010000048.1 GCA946997625_00844 gene open 7208-7759
1697 CAMPVV010000048.1 GCA946997625_00845 gene open 8696-8869
1698 CAMPVV010000048.1 GCA946997625_00846 gene open 9293-9439
1699 CAMPVV010000049.1 regulatory_region open 6320-6420 Purine riboswitch aptamer
1700 CAMPVV010000049.1 GCA946997625_00847 CDS open 29-1354 _na     441_aa Sodium:neurotransmitter symporter family protein
1701 CAMPVV010000049.1 GCA946997625_00848 CDS open 1460-2263 _na     267_aa Rhodanese-like protein
1702 CAMPVV010000049.1 GCA946997625_00849 CDS open 2276-3052 _na     258_aa Cof-like hydrolase
1703 CAMPVV010000049.1 GCA946997625_00850 CDS open 3119-4627 _na     502_aa DNA-binding protein
1704 CAMPVV010000049.1 GCA946997625_00851 CDS open 4642-5715 _na     357_aa M42 glutamyl aminopeptidase
1705 CAMPVV010000049.1 GCA946997625_00852 CDS open 5866-6147 _na     93_aa DNA-binding protein HU
1706 CAMPVV010000049.1 GCA946997625_00853 CDS open 6487-6600 _na     37_aa Transposase
1707 CAMPVV010000049.1 GCA946997625_00847 gene open 29-1354
1708 CAMPVV010000049.1 GCA946997625_00848 gene open 1460-2263
1709 CAMPVV010000049.1 GCA946997625_00849 gene open 2276-3052
1710 CAMPVV010000049.1 GCA946997625_00850 gene open 3119-4627
1711 CAMPVV010000049.1 GCA946997625_00851 gene open 4642-5715
1712 CAMPVV010000049.1 GCA946997625_00852 gene open 5866-6147
1713 CAMPVV010000049.1 GCA946997625_00853 gene open 6487-6600
1714 CAMPVV010000050.1 GCA946997625_00854 CDS open 13-1104 _na     363_aa Transporter%2C major facilitator family protein
1715 CAMPVV010000050.1 GCA946997625_00855 CDS open 1107-2261 _na     384_aa ComEC/Rec2-like protein
1716 CAMPVV010000050.1 GCA946997625_00856 CDS open 2423-2989 _na     188_aa yigZ Putative YigZ family protein
1717 CAMPVV010000050.1 GCA946997625_00857 CDS open 3016-4083 _na     355_aa mutY A/G-specific adenine glycosylase
1718 CAMPVV010000050.1 GCA946997625_00858 CDS open 4145-4369 _na     74_aa secG preprotein translocase subunit SecG
1719 CAMPVV010000050.1 GCA946997625_00859 CDS open 4470-5702 _na     410_aa Replication-associated recombination protein A
1720 CAMPVV010000050.1 GCA946997625_00860 CDS open 5704-6945 _na     413_aa hisS histidine--tRNA ligase
1721 CAMPVV010000050.1 GCA946997625_00861 CDS open 6949-8733 _na     594_aa aspS aspartate--tRNA ligase
1722 CAMPVV010000050.1 GCA946997625_00862 CDS open 8835-9410 _na     191_aa nadD nicotinate (nicotinamide) nucleotide adenylyltransferase
1723 CAMPVV010000050.1 GCA946997625_00854 gene open 13-1104
1724 CAMPVV010000050.1 GCA946997625_00855 gene open 1107-2261
1725 CAMPVV010000050.1 GCA946997625_00856 gene open 2423-2989 yigZ
1726 CAMPVV010000050.1 GCA946997625_00857 gene open 3016-4083 mutY
1727 CAMPVV010000050.1 GCA946997625_00858 gene open 4145-4369 secG
1728 CAMPVV010000050.1 GCA946997625_00859 gene open 4470-5702
1729 CAMPVV010000050.1 GCA946997625_00860 gene open 5704-6945 hisS
1730 CAMPVV010000050.1 GCA946997625_00861 gene open 6949-8733 aspS
1731 CAMPVV010000050.1 GCA946997625_00862 gene open 8835-9410 nadD
1732 CAMPVV010000051.1 GCA946997625_00863 CDS open 1861-2529 _na     222_aa DUF374 domain-containing protein
1733 CAMPVV010000051.1 GCA946997625_00864 CDS open 2607-2966 _na     119_aa YbaB/EbfC family nucleoid-associated protein
1734 CAMPVV010000051.1 GCA946997625_00865 CDS open 3034-4728 _na     564_aa Signal peptide peptidase SppA%2C 36K type
1735 CAMPVV010000051.1 GCA946997625_00866 CDS open 4738-5949 _na     403_aa Oligoendopeptidase F
1736 CAMPVV010000051.1 GCA946997625_00867 CDS open 5971-6513 _na     180_aa hypothetical protein
1737 CAMPVV010000051.1 GCA946997625_00868 CDS open 6542-7804 _na     420_aa Uracil permease
1738 CAMPVV010000051.1 GCA946997625_00869 CDS open 7851-8234 _na     127_aa Thioesterase family protein
1739 CAMPVV010000051.1 GCA946997625_00870 CDS open 8381-8938 _na     185_aa DUF1007 domain-containing protein
1740 CAMPVV010000051.1 GCA946997625_00871 CDS open 8935-9702 _na     255_aa Nickel/cobalt efflux system
1741 CAMPVV010000051.1 GCA946997625_00863 gene open 1861-2529
1742 CAMPVV010000051.1 GCA946997625_00864 gene open 2607-2966
1743 CAMPVV010000051.1 GCA946997625_00865 gene open 3034-4728
1744 CAMPVV010000051.1 GCA946997625_00866 gene open 4738-5949
1745 CAMPVV010000051.1 GCA946997625_00867 gene open 5971-6513
1746 CAMPVV010000051.1 GCA946997625_00868 gene open 6542-7804
1747 CAMPVV010000051.1 GCA946997625_00869 gene open 7851-8234
1748 CAMPVV010000051.1 GCA946997625_00870 gene open 8381-8938
1749 CAMPVV010000051.1 GCA946997625_00871 gene open 8935-9702
1750 CAMPVV010000052.1 GCA946997625_00872 CDS open 1634-2032 _na     132_aa Acyl-CoA thioester hydrolase%2C YbgC/YbaW family
1751 CAMPVV010000052.1 GCA946997625_00873 CDS open 2101-3309 _na     402_aa tyrS tyrosine--tRNA ligase
1752 CAMPVV010000052.1 GCA946997625_00874 CDS open 3341-3781 _na     146_aa Acetyltransferase%2C GNAT family
1753 CAMPVV010000052.1 GCA946997625_00875 CDS open 3774-4415 _na     213_aa nth endonuclease III
1754 CAMPVV010000052.1 GCA946997625_00876 CDS open 4476-5648 _na     390_aa nifS cysteine desulfurase NifS
1755 CAMPVV010000052.1 GCA946997625_00877 CDS open 5693-6070 _na     125_aa nifU Fe-S cluster assembly scaffold protein NifU
1756 CAMPVV010000052.1 GCA946997625_00878 CDS open 6166-7338 _na     390_aa Serine-type D-Ala-D-Ala carboxypeptidase
1757 CAMPVV010000052.1 GCA946997625_00879 CDS open 7355-7894 _na     179_aa Outer membrane protein
1758 CAMPVV010000052.1 GCA946997625_00880 CDS open 8053-9162 _na     369_aa Cyclically-permuted mutarotase family protein
1759 CAMPVV010000052.1 GCA946997625_00872 gene open 1634-2032
1760 CAMPVV010000052.1 GCA946997625_00873 gene open 2101-3309 tyrS
1761 CAMPVV010000052.1 GCA946997625_00874 gene open 3341-3781
1762 CAMPVV010000052.1 GCA946997625_00875 gene open 3774-4415 nth
1763 CAMPVV010000052.1 GCA946997625_00876 gene open 4476-5648 nifS
1764 CAMPVV010000052.1 GCA946997625_00877 gene open 5693-6070 nifU
1765 CAMPVV010000052.1 GCA946997625_00878 gene open 6166-7338
1766 CAMPVV010000052.1 GCA946997625_00879 gene open 7355-7894
1767 CAMPVV010000052.1 GCA946997625_00880 gene open 8053-9162
1768 CAMPVV010000053.1 GCA946997625_00881 CDS open 100-981 _na     293_aa CP-type G domain-containing protein
1769 CAMPVV010000053.1 GCA946997625_00882 CDS open 978-1370 _na     130_aa Prepilin-type cleavage/methylation N-terminal domain protein
1770 CAMPVV010000053.1 GCA946997625_00883 CDS open 1398-2804 _na     468_aa FAD-dependent protein C-terminal domain-containing protein
1771 CAMPVV010000053.1 GCA946997625_00884 CDS open 2806-3810 _na     334_aa ftsY signal recognition particle-docking protein FtsY
1772 CAMPVV010000053.1 GCA946997625_00885 CDS open 3905-4918 _na     337_aa pta phosphate acetyltransferase
1773 CAMPVV010000053.1 GCA946997625_00886 CDS open 4943-6145 _na     400_aa Acetate kinase
1774 CAMPVV010000053.1 GCA946997625_00887 CDS open 6348-6557 _na     69_aa hypothetical protein
1775 CAMPVV010000053.1 GCA946997625_00881 gene open 100-981
1776 CAMPVV010000053.1 GCA946997625_00882 gene open 978-1370
1777 CAMPVV010000053.1 GCA946997625_00883 gene open 1398-2804
1778 CAMPVV010000053.1 GCA946997625_00884 gene open 2806-3810 ftsY
1779 CAMPVV010000053.1 GCA946997625_00885 gene open 3905-4918 pta
1780 CAMPVV010000053.1 GCA946997625_00886 gene open 4943-6145
1781 CAMPVV010000053.1 GCA946997625_00887 gene open 6348-6557
1782 CAMPVV010000054.1 GCA946997625_00888 CDS open 283-561 _na     92_aa N-acetyltransferase domain-containing protein
1783 CAMPVV010000054.1 GCA946997625_00889 CDS open 715-2256 _na     513_aa abgT AbgT transporter family
1784 CAMPVV010000054.1 GCA946997625_00890 CDS open 2660-3232 _na     190_aa 4Fe-4S ferredoxin-type domain-containing protein
1785 CAMPVV010000054.1 GCA946997625_00891 CDS open 3360-5678 _na     772_aa pflB formate C-acetyltransferase
1786 CAMPVV010000054.1 GCA946997625_00892 CDS open 5706-6431 _na     241_aa pflA pyruvate formate-lyase-activating protein
1787 CAMPVV010000054.1 GCA946997625_00893 CDS open 6499-7059 _na     186_aa Exonuclease
1788 CAMPVV010000054.1 GCA946997625_00894 CDS open 7088-7702 _na     204_aa cutC PF03932 family protein CutC
1789 CAMPVV010000054.1 GCA946997625_00895 CDS open 7695-9110 _na     471_aa Aspartate ammonia-lyase
1790 CAMPVV010000054.1 GCA946997625_00888 gene open 283-561
1791 CAMPVV010000054.1 GCA946997625_00889 gene open 715-2256 abgT
1792 CAMPVV010000054.1 GCA946997625_00890 gene open 2660-3232
1793 CAMPVV010000054.1 GCA946997625_00891 gene open 3360-5678 pflB
1794 CAMPVV010000054.1 GCA946997625_00892 gene open 5706-6431 pflA
1795 CAMPVV010000054.1 GCA946997625_00893 gene open 6499-7059
1796 CAMPVV010000054.1 GCA946997625_00894 gene open 7088-7702 cutC
1797 CAMPVV010000054.1 GCA946997625_00895 gene open 7695-9110
1798 CAMPVV010000055.1 GCA946997625_00896 CDS open 10-744 _na     244_aa Glycosyltransferase%2C group 2 family protein
1799 CAMPVV010000055.1 GCA946997625_00897 CDS open 732-1763 _na     343_aa Heptosyltransferase
1800 CAMPVV010000055.1 GCA946997625_00898 CDS open 1760-2767 _na     335_aa Heptosyltransferase
1801 CAMPVV010000055.1 GCA946997625_00899 CDS open 2764-3453 _na     229_aa rfaY Lipopolysaccharide core heptose(II) kinase RfaY
1802 CAMPVV010000055.1 GCA946997625_00900 CDS open 3393-4481 _na     362_aa Putative lipopolysaccharide heptosyltransferase II
1803 CAMPVV010000055.1 GCA946997625_00901 CDS open 4453-5532 _na     359_aa recA recombinase RecA
1804 CAMPVV010000055.1 GCA946997625_00902 CDS open 5510-6058 _na     182_aa recX Regulatory protein RecX
1805 CAMPVV010000055.1 GCA946997625_00903 CDS open 6071-7078 _na     335_aa tsaD tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD
1806 CAMPVV010000055.1 GCA946997625_00904 CDS open 7166-7912 _na     248_aa Cna protein B-type domain protein
1807 CAMPVV010000055.1 GCA946997625_00905 CDS open 7945-9213 _na     422_aa murA UDP-N-acetylglucosamine 1-carboxyvinyltransferase
1808 CAMPVV010000055.1 GCA946997625_00896 gene open 10-744
1809 CAMPVV010000055.1 GCA946997625_00897 gene open 732-1763
1810 CAMPVV010000055.1 GCA946997625_00898 gene open 1760-2767
1811 CAMPVV010000055.1 GCA946997625_00899 gene open 2764-3453 rfaY
1812 CAMPVV010000055.1 GCA946997625_00900 gene open 3393-4481
1813 CAMPVV010000055.1 GCA946997625_00901 gene open 4453-5532 recA
1814 CAMPVV010000055.1 GCA946997625_00902 gene open 5510-6058 recX
1815 CAMPVV010000055.1 GCA946997625_00903 gene open 6071-7078 tsaD
1816 CAMPVV010000055.1 GCA946997625_00904 gene open 7166-7912
1817 CAMPVV010000055.1 GCA946997625_00905 gene open 7945-9213 murA
1818 CAMPVV010000056.1 GCA946997625_00906 CDS open 37-525 _na     162_aa hypothetical protein
1819 CAMPVV010000056.1 GCA946997625_00907 CDS open 821-1306 _na     161_aa TRAP transporter%2C DctQ-like membrane protein
1820 CAMPVV010000056.1 GCA946997625_00908 CDS open 1374-2417 _na     347_aa Bacterial extracellular solute-binding protein%2C family 7
1821 CAMPVV010000056.1 GCA946997625_00910 CDS open 2822-3889 _na     355_aa corA Magnesium transport protein CorA
1822 CAMPVV010000056.1 GCA946997625_00911 CDS open 3891-4601 _na     236_aa MgtC/SapB family protein
1823 CAMPVV010000056.1 GCA946997625_00912 CDS open 4982-6406 _na     474_aa putP sodium/proline symporter PutP
1824 CAMPVV010000056.1 GCA946997625_00913 CDS open 6438-9107 _na     889_aa Hep/Hag repeat protein
1825 CAMPVV010000056.1 GCA946997625_00906 gene open 37-525
1826 CAMPVV010000056.1 GCA946997625_00907 gene open 821-1306
1827 CAMPVV010000056.1 GCA946997625_00908 gene open 1374-2417
1828 CAMPVV010000056.1 GCA946997625_00910 gene open 2822-3889 corA
1829 CAMPVV010000056.1 GCA946997625_00911 gene open 3891-4601
1830 CAMPVV010000056.1 GCA946997625_00912 gene open 4982-6406 putP
1831 CAMPVV010000056.1 GCA946997625_00913 gene open 6438-9107
1832 CAMPVV010000056.1 GCA946997625_00909 gene open 2684-2770 trnL
1833 CAMPVV010000056.1 GCA946997625_00909 tRNA open 2684-2770 trnL tRNA-Leu(caa)
1834 CAMPVV010000057.1 GCA946997625_00914 CDS open 51-1673 _na     540_aa hypothetical protein
1835 CAMPVV010000057.1 GCA946997625_00915 CDS open 1690-2736 _na     348_aa mreB Cell shape-determining protein MreB
1836 CAMPVV010000057.1 GCA946997625_00916 CDS open 2752-3582 _na     276_aa MFS transporter
1837 CAMPVV010000057.1 GCA946997625_00917 CDS open 3749-4195 _na     148_aa Positive regulator of sigma(E)%2C RseC/MucC
1838 CAMPVV010000057.1 GCA946997625_00918 CDS open 4236-4874 _na     212_aa Formimidoyltetrahydrofolate cyclodeaminase
1839 CAMPVV010000057.1 GCA946997625_00919 CDS open 4884-6110 _na     408_aa hutI imidazolonepropionase
1840 CAMPVV010000057.1 GCA946997625_00920 CDS open 6121-7017 _na     298_aa ftcD glutamate formimidoyltransferase
1841 CAMPVV010000057.1 GCA946997625_00921 CDS open 7065-8372 _na     435_aa Na+/H+ antiporter family protein
1842 CAMPVV010000057.1 GCA946997625_00922 CDS open 8394-9056 _na     220_aa fliJ Flagellar FliJ protein
1843 CAMPVV010000057.1 GCA946997625_00914 gene open 51-1673
1844 CAMPVV010000057.1 GCA946997625_00915 gene open 1690-2736 mreB
1845 CAMPVV010000057.1 GCA946997625_00916 gene open 2752-3582
1846 CAMPVV010000057.1 GCA946997625_00917 gene open 3749-4195
1847 CAMPVV010000057.1 GCA946997625_00918 gene open 4236-4874
1848 CAMPVV010000057.1 GCA946997625_00919 gene open 4884-6110 hutI
1849 CAMPVV010000057.1 GCA946997625_00920 gene open 6121-7017 ftcD
1850 CAMPVV010000057.1 GCA946997625_00921 gene open 7065-8372
1851 CAMPVV010000057.1 GCA946997625_00922 gene open 8394-9056 fliJ
1852 CAMPVV010000058.1 GCA946997625_00923 CDS open 44-595 _na     183_aa Alpha-1%2C4 glucan phosphorylase
1853 CAMPVV010000058.1 GCA946997625_00924 CDS open 601-2433 _na     610_aa glgB 1%2C4-alpha-glucan branching protein GlgB
1854 CAMPVV010000058.1 GCA946997625_00925 CDS open 2454-3599 _na     381_aa glucose-1-phosphate adenylyltransferase
1855 CAMPVV010000058.1 GCA946997625_00926 CDS open 3620-4783 _na     387_aa glgD glucose-1-phosphate adenylyltransferase subunit GlgD
1856 CAMPVV010000058.1 GCA946997625_00927 CDS open 4794-6203 _na     469_aa Glycogen synthase
1857 CAMPVV010000058.1 GCA946997625_00928 CDS open 6245-8164 _na     639_aa glgX Putative glycogen debranching enzyme GlgX
1858 CAMPVV010000058.1 GCA946997625_00929 CDS open 8319-8636 _na     105_aa DNA-binding protein HU-beta
1859 CAMPVV010000058.1 GCA946997625_00923 gene open 44-595
1860 CAMPVV010000058.1 GCA946997625_00924 gene open 601-2433 glgB
1861 CAMPVV010000058.1 GCA946997625_00925 gene open 2454-3599
1862 CAMPVV010000058.1 GCA946997625_00926 gene open 3620-4783 glgD
1863 CAMPVV010000058.1 GCA946997625_00927 gene open 4794-6203
1864 CAMPVV010000058.1 GCA946997625_00928 gene open 6245-8164 glgX
1865 CAMPVV010000058.1 GCA946997625_00929 gene open 8319-8636
1866 CAMPVV010000059.1 GCA946997625_00930 CDS open 133-1071 _na     312_aa trbB P-type conjugative transfer ATPase TrbB
1867 CAMPVV010000059.1 GCA946997625_00931 CDS open 1114-1365 _na     83_aa virB3 VirB3 family type IV secretion system protein
1868 CAMPVV010000059.1 GCA946997625_00932 CDS open 1375-1908 _na     177_aa hypothetical protein
1869 CAMPVV010000059.1 GCA946997625_00933 CDS open 2076-3980 _na     634_aa trbE conjugal transfer protein TrbE
1870 CAMPVV010000059.1 GCA946997625_00934 CDS open 3977-4705 _na     242_aa MipA/OmpV family protein
1871 CAMPVV010000059.1 GCA946997625_00935 CDS open 4728-5048 _na     106_aa single-stranded DNA-binding protein
1872 CAMPVV010000059.1 GCA946997625_00936 CDS open 5055-7958 _na     967_aa Outer membrane insertion signal domain protein
1873 CAMPVV010000059.1 GCA946997625_00937 CDS open 8025-8204 _na     59_aa DNA-binding protein
1874 CAMPVV010000059.1 GCA946997625_00930 gene open 133-1071 trbB
1875 CAMPVV010000059.1 GCA946997625_00931 gene open 1114-1365 virB3
1876 CAMPVV010000059.1 GCA946997625_00932 gene open 1375-1908
1877 CAMPVV010000059.1 GCA946997625_00933 gene open 2076-3980 trbE
1878 CAMPVV010000059.1 GCA946997625_00934 gene open 3977-4705
1879 CAMPVV010000059.1 GCA946997625_00935 gene open 4728-5048
1880 CAMPVV010000059.1 GCA946997625_00936 gene open 5055-7958
1881 CAMPVV010000059.1 GCA946997625_00937 gene open 8025-8204
1882 CAMPVV010000060.1 GCA946997625_00938 CDS open 936-2201 _na     421_aa Membrane iron-sulfur containing protein FtrD-like domain-containing protein
1883 CAMPVV010000060.1 GCA946997625_00939 CDS open 2251-3483 _na     410_aa ABC transporter permease
1884 CAMPVV010000060.1 GCA946997625_00940 CDS open 3493-4695 _na     400_aa Efflux ABC transporter%2C permease protein
1885 CAMPVV010000060.1 GCA946997625_00941 CDS open 4699-5373 _na     224_aa ABC transporter%2C ATP-binding protein
1886 CAMPVV010000060.1 GCA946997625_00942 CDS open 5391-5813 _na     140_aa FMN-binding domain protein
1887 CAMPVV010000060.1 GCA946997625_00943 CDS open 5883-6326 _na     147_aa DUF4418 domain-containing protein
1888 CAMPVV010000060.1 GCA946997625_00944 CDS open 6330-7535 _na     401_aa Efflux ABC transporter%2C permease protein
1889 CAMPVV010000060.1 GCA946997625_00945 CDS open 7544-8227 _na     227_aa ABC transporter%2C ATP-binding protein
1890 CAMPVV010000060.1 GCA946997625_00938 gene open 936-2201
1891 CAMPVV010000060.1 GCA946997625_00939 gene open 2251-3483
1892 CAMPVV010000060.1 GCA946997625_00940 gene open 3493-4695
1893 CAMPVV010000060.1 GCA946997625_00941 gene open 4699-5373
1894 CAMPVV010000060.1 GCA946997625_00942 gene open 5391-5813
1895 CAMPVV010000060.1 GCA946997625_00943 gene open 5883-6326
1896 CAMPVV010000060.1 GCA946997625_00944 gene open 6330-7535
1897 CAMPVV010000060.1 GCA946997625_00945 gene open 7544-8227
1898 CAMPVV010000061.1 GCA946997625_00946 CDS open 70-267 _na     65_aa Metal-sensitive transcriptional repressor
1899 CAMPVV010000061.1 GCA946997625_00947 CDS open 356-904 _na     182_aa MORN repeat protein
1900 CAMPVV010000061.1 GCA946997625_00948 CDS open 957-1724 _na     255_aa Methyltransferase domain protein
1901 CAMPVV010000061.1 GCA946997625_00949 CDS open 1752-2102 _na     116_aa Transcriptional regulator%2C Fur family
1902 CAMPVV010000061.1 GCA946997625_00950 CDS open 2151-2456 _na     101_aa ABC transporter domain-containing protein
1903 CAMPVV010000061.1 GCA946997625_00951 CDS open 2740-4416 _na     558_aa nikD nickel import ATP-binding protein NikD
1904 CAMPVV010000061.1 GCA946997625_00952 CDS open 4429-5229 _na     266_aa Peptide ABC transporter permease
1905 CAMPVV010000061.1 GCA946997625_00953 CDS open 5233-6201 _na     322_aa ABC transporter%2C permease protein
1906 CAMPVV010000061.1 GCA946997625_00954 CDS open 6205-7749 _na     514_aa ABC transporter%2C substrate-binding protein%2C family 5
1907 CAMPVV010000061.1 GCA946997625_00955 CDS open 7869-8207 _na     112_aa IS30 family transposase
1908 CAMPVV010000061.1 GCA946997625_00946 gene open 70-267
1909 CAMPVV010000061.1 GCA946997625_00947 gene open 356-904
1910 CAMPVV010000061.1 GCA946997625_00948 gene open 957-1724
1911 CAMPVV010000061.1 GCA946997625_00949 gene open 1752-2102
1912 CAMPVV010000061.1 GCA946997625_00950 gene open 2151-2456
1913 CAMPVV010000061.1 GCA946997625_00951 gene open 2740-4416 nikD
1914 CAMPVV010000061.1 GCA946997625_00952 gene open 4429-5229
1915 CAMPVV010000061.1 GCA946997625_00953 gene open 5233-6201
1916 CAMPVV010000061.1 GCA946997625_00954 gene open 6205-7749
1917 CAMPVV010000061.1 GCA946997625_00955 gene open 7869-8207
1918 CAMPVV010000062.1 GCA946997625_00956 CDS open 170-991 _na     273_aa mreC rod shape-determining protein MreC
1919 CAMPVV010000062.1 GCA946997625_00957 CDS open 981-1556 _na     191_aa lolA Outer membrane lipoprotein carrier protein LolA
1920 CAMPVV010000062.1 GCA946997625_00958 CDS open 1553-2212 _na     219_aa recO DNA repair protein RecO
1921 CAMPVV010000062.1 GCA946997625_00959 CDS open 2212-2691 _na     159_aa Phosphoenolpyruvate-dependent sugar phosphotransferase system%2C EIIA 2
1922 CAMPVV010000062.1 GCA946997625_00960 CDS open 2688-3146 _na     152_aa nrdR transcriptional regulator NrdR
1923 CAMPVV010000062.1 GCA946997625_00961 CDS open 3148-4080 _na     310_aa fmt methionyl-tRNA formyltransferase
1924 CAMPVV010000062.1 GCA946997625_00962 CDS open 4077-4937 _na     286_aa folD Bifunctional protein FolD
1925 CAMPVV010000062.1 GCA946997625_00963 CDS open 4930-5409 _na     159_aa ACT domain-containing protein
1926 CAMPVV010000062.1 GCA946997625_00964 CDS open 5422-5865 _na     147_aa Biotin carboxyl carrier protein of acetyl-CoA carboxylase
1927 CAMPVV010000062.1 GCA946997625_00965 CDS open 5913-7172 _na     419_aa CBS domain protein
1928 CAMPVV010000062.1 GCA946997625_00966 CDS open 7169-7492 _na     107_aa Tetratricopeptide repeat protein
1929 CAMPVV010000062.1 GCA946997625_00967 CDS open 7503-8015 _na     170_aa adenine phosphoribosyltransferase
1930 CAMPVV010000062.1 GCA946997625_00956 gene open 170-991 mreC
1931 CAMPVV010000062.1 GCA946997625_00957 gene open 981-1556 lolA
1932 CAMPVV010000062.1 GCA946997625_00958 gene open 1553-2212 recO
1933 CAMPVV010000062.1 GCA946997625_00959 gene open 2212-2691
1934 CAMPVV010000062.1 GCA946997625_00960 gene open 2688-3146 nrdR
1935 CAMPVV010000062.1 GCA946997625_00961 gene open 3148-4080 fmt
1936 CAMPVV010000062.1 GCA946997625_00962 gene open 4077-4937 folD
1937 CAMPVV010000062.1 GCA946997625_00963 gene open 4930-5409
1938 CAMPVV010000062.1 GCA946997625_00964 gene open 5422-5865
1939 CAMPVV010000062.1 GCA946997625_00965 gene open 5913-7172
1940 CAMPVV010000062.1 GCA946997625_00966 gene open 7169-7492
1941 CAMPVV010000062.1 GCA946997625_00967 gene open 7503-8015
1942 CAMPVV010000063.1 GCA946997625_00968 CDS open 13-672 _na     219_aa M24 family metallopeptidase
1943 CAMPVV010000063.1 GCA946997625_00969 CDS open 685-1158 _na     157_aa hypothetical protein
1944 CAMPVV010000063.1 GCA946997625_00970 CDS open 1188-1811 _na     207_aa Channel protein%2C hemolysin III family
1945 CAMPVV010000063.1 GCA946997625_00971 CDS open 1885-3960 _na     691_aa Cadmium-exporting ATPase
1946 CAMPVV010000063.1 GCA946997625_00972 CDS open 4090-5307 _na     405_aa Aminotransferase
1947 CAMPVV010000063.1 GCA946997625_00973 CDS open 5359-6702 _na     447_aa MATE efflux family protein
1948 CAMPVV010000063.1 GCA946997625_00974 CDS open 6712-7533 _na     273_aa undecaprenyl-diphosphate phosphatase
1949 CAMPVV010000063.1 GCA946997625_00975 CDS open 7546-8394 _na     282_aa rfaD ADP-glyceromanno-heptose 6-epimerase
1950 CAMPVV010000063.1 GCA946997625_00968 gene open 13-672
1951 CAMPVV010000063.1 GCA946997625_00969 gene open 685-1158
1952 CAMPVV010000063.1 GCA946997625_00970 gene open 1188-1811
1953 CAMPVV010000063.1 GCA946997625_00971 gene open 1885-3960
1954 CAMPVV010000063.1 GCA946997625_00972 gene open 4090-5307
1955 CAMPVV010000063.1 GCA946997625_00973 gene open 5359-6702
1956 CAMPVV010000063.1 GCA946997625_00974 gene open 6712-7533
1957 CAMPVV010000063.1 GCA946997625_00975 gene open 7546-8394 rfaD
1958 CAMPVV010000064.1 GCA946997625_00976 CDS open 23-175 _na     50_aa hypothetical protein
1959 CAMPVV010000064.1 GCA946997625_00977 CDS open 163-723 _na     186_aa purN phosphoribosylglycinamide formyltransferase
1960 CAMPVV010000064.1 GCA946997625_00978 CDS open 725-2203 _na     492_aa purH bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase
1961 CAMPVV010000064.1 GCA946997625_00979 CDS open 2220-3446 _na     408_aa Phosphoribosylamine--glycine ligase
1962 CAMPVV010000064.1 GCA946997625_00980 CDS open 3492-4094 _na     200_aa Metallo-beta-lactamase domain protein
1963 CAMPVV010000064.1 GCA946997625_00981 CDS open 4106-4891 _na     261_aa murI glutamate racemase
1964 CAMPVV010000064.1 GCA946997625_00982 CDS open 5028-6722 _na     564_aa ggt gamma-glutamyltransferase
1965 CAMPVV010000064.1 GCA946997625_00983 CDS open 6831-7448 _na     205_aa lysE Translocator protein%2C LysE family
1966 CAMPVV010000064.1 GCA946997625_00984 CDS open 7448-7588 _na     46_aa hypothetical protein
1967 CAMPVV010000064.1 GCA946997625_00985 CDS open 7709-8284 _na     191_aa DNA-deoxyinosine glycosylase
1968 CAMPVV010000064.1 GCA946997625_00976 gene open 23-175
1969 CAMPVV010000064.1 GCA946997625_00977 gene open 163-723 purN
1970 CAMPVV010000064.1 GCA946997625_00978 gene open 725-2203 purH
1971 CAMPVV010000064.1 GCA946997625_00979 gene open 2220-3446
1972 CAMPVV010000064.1 GCA946997625_00980 gene open 3492-4094
1973 CAMPVV010000064.1 GCA946997625_00981 gene open 4106-4891 murI
1974 CAMPVV010000064.1 GCA946997625_00982 gene open 5028-6722 ggt
1975 CAMPVV010000064.1 GCA946997625_00983 gene open 6831-7448 lysE
1976 CAMPVV010000064.1 GCA946997625_00984 gene open 7448-7588
1977 CAMPVV010000064.1 GCA946997625_00985 gene open 7709-8284
1978 CAMPVV010000065.1 repeat_region open 4971-5712 CRISPR array with 10 repeats of length 37%2C consensus sequence ATTAAGAAAGTATCCAGTAAAAAATAAGGATTGAAAC and spacer length 37
1979 CAMPVV010000065.1 GCA946997625_00986 CDS open 74-1015 _na     313_aa Pyruvate kinase
1980 CAMPVV010000065.1 GCA946997625_00987 CDS open 1049-2356 _na     435_aa eno phosphopyruvate hydratase
1981 CAMPVV010000065.1 GCA946997625_00988 CDS open 2484-2705 _na     73_aa relB type II toxin-antitoxin system RelB family antitoxin
1982 CAMPVV010000065.1 GCA946997625_00989 CDS open 2706-2975 _na     89_aa Addiction module toxin%2C RelE/StbE family
1983 CAMPVV010000065.1 GCA946997625_00990 CDS open 3092-3373 _na     93_aa relE Toxin-antitoxin system%2C toxin component%2C RelE domain protein
1984 CAMPVV010000065.1 GCA946997625_00991 CDS open 3370-3633 _na     87_aa Toxin-antitoxin system%2C antitoxin component%2C ribbon-helix-helix domain protein
1985 CAMPVV010000065.1 GCA946997625_00992 CDS open 4110-4748 _na     212_aa hypothetical protein
1986 CAMPVV010000065.1 GCA946997625_00993 CDS open 5841-6080 _na     79_aa Antitoxin
1987 CAMPVV010000065.1 GCA946997625_00994 CDS open 6074-6349 _na     91_aa Txe/YoeB family addiction module toxin
1988 CAMPVV010000065.1 GCA946997625_00995 CDS open 6447-7160 _na     237_aa VWFA domain-containing protein
1989 CAMPVV010000065.1 GCA946997625_00996 CDS open 7204-8133 _na     309_aa PhoH-like protein domain-containing protein
1990 CAMPVV010000065.1 GCA946997625_00986 gene open 74-1015
1991 CAMPVV010000065.1 GCA946997625_00987 gene open 1049-2356 eno
1992 CAMPVV010000065.1 GCA946997625_00988 gene open 2484-2705 relB
1993 CAMPVV010000065.1 GCA946997625_00989 gene open 2706-2975
1994 CAMPVV010000065.1 GCA946997625_00990 gene open 3092-3373 relE
1995 CAMPVV010000065.1 GCA946997625_00991 gene open 3370-3633
1996 CAMPVV010000065.1 GCA946997625_00992 gene open 4110-4748
1997 CAMPVV010000065.1 GCA946997625_00993 gene open 5841-6080
1998 CAMPVV010000065.1 GCA946997625_00994 gene open 6074-6349
1999 CAMPVV010000065.1 GCA946997625_00995 gene open 6447-7160
2000 CAMPVV010000065.1 GCA946997625_00996 gene open 7204-8133