HOMD Banner
Taxonomy: V4.3   |  16S rRNA RefSeq: V16.03   |  Genomic RefSeq: V11.03   |  Viruses: V1.2

BAKTAGenome Explorer: Fusobacterium gonidiaformans (GCA_946997625.1)

Select a Genome:
BAKTA Annotations for GCA_946997625.1
Genome Selected: Fusobacterium gonidiaformans
ContigsBases CDSrRNA tmRNAtRNA
199 1615346 1609 0 1 15
[Table]   [AA Fasta]      [Browser]   [Text]   [Excel]  
Search & Sort all 3272 Records
Search These Records: Clear
Sort Column:   Molecule   PID   NA   AA   Gene  Gene Product  Reverse
Annotation Table [page:6]    |    Number of Records Found: 3272 [7 Pages]    |    Previous Page <==> Next Page    |    Jump to Page: [ 1  2  3  4  5  6  7  ]
Notes:   1- Column headers only sort the current page. 2- Select [NA] or [AA] links to show sequences.
Region Protein-ID Type Genome
Viewer		 Range
(bp)		 Show Sequences
(length) NA / AA		 BAKTA
Gene		 BAKTA
GeneProduct
2501 CAMPVV010000099.1 GCA946997625_01245 gene open 5343-5684
2502 CAMPVV010000100.1 GCA946997625_01246 CDS open 217-1386 _na     389_aa Transporter%2C major facilitator family protein
2503 CAMPVV010000100.1 GCA946997625_01247 CDS open 1416-2042 _na     208_aa tRNA 5-hydroxyuridine methyltransferase
2504 CAMPVV010000100.1 GCA946997625_01248 CDS open 2049-2942 _na     297_aa DMT family transporter
2505 CAMPVV010000100.1 GCA946997625_01249 CDS open 2967-4040 _na     357_aa mgtE Magnesium transporter MgtE
2506 CAMPVV010000100.1 GCA946997625_01250 CDS open 4080-4304 _na     74_aa hypothetical protein
2507 CAMPVV010000100.1 GCA946997625_01251 CDS open 4439-5761 _na     440_aa rsmB 16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB
2508 CAMPVV010000100.1 GCA946997625_01246 gene open 217-1386
2509 CAMPVV010000100.1 GCA946997625_01247 gene open 1416-2042
2510 CAMPVV010000100.1 GCA946997625_01248 gene open 2049-2942
2511 CAMPVV010000100.1 GCA946997625_01249 gene open 2967-4040 mgtE
2512 CAMPVV010000100.1 GCA946997625_01250 gene open 4080-4304
2513 CAMPVV010000100.1 GCA946997625_01251 gene open 4439-5761 rsmB
2514 CAMPVV010000101.1 GCA946997625_01252 CDS open 959-1528 _na     189_aa Porin
2515 CAMPVV010000101.1 GCA946997625_01253 CDS open 1541-2695 _na     384_aa L%2CD-TPase catalytic domain-containing protein
2516 CAMPVV010000101.1 GCA946997625_01254 CDS open 2853-3650 _na     265_aa B12 binding domain protein
2517 CAMPVV010000101.1 GCA946997625_01255 CDS open 3650-5212 _na     520_aa D-Lysine 5%2C6-aminomutase alpha subunit
2518 CAMPVV010000101.1 GCA946997625_01256 CDS open 5219-5659 _na     146_aa hypothetical protein
2519 CAMPVV010000101.1 GCA946997625_01252 gene open 959-1528
2520 CAMPVV010000101.1 GCA946997625_01253 gene open 1541-2695
2521 CAMPVV010000101.1 GCA946997625_01254 gene open 2853-3650
2522 CAMPVV010000101.1 GCA946997625_01255 gene open 3650-5212
2523 CAMPVV010000101.1 GCA946997625_01256 gene open 5219-5659
2524 CAMPVV010000102.1 GCA946997625_01257 CDS open 84-1139 _na     351_aa Smr/MutS family protein
2525 CAMPVV010000102.1 GCA946997625_01258 CDS open 1148-1813 _na     221_aa 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase
2526 CAMPVV010000102.1 GCA946997625_01259 CDS open 1875-3296 _na     473_aa cysS cysteine--tRNA ligase
2527 CAMPVV010000102.1 GCA946997625_01260 CDS open 3284-3661 _na     125_aa Mini-ribonuclease 3
2528 CAMPVV010000102.1 GCA946997625_01261 CDS open 3674-4696 _na     340_aa mreB Cell shape-determining protein MreB
2529 CAMPVV010000102.1 GCA946997625_01262 CDS open 4696-5568 _na     290_aa DNA polymerase III%2C delta' subunit family protein
2530 CAMPVV010000102.1 GCA946997625_01257 gene open 84-1139
2531 CAMPVV010000102.1 GCA946997625_01258 gene open 1148-1813
2532 CAMPVV010000102.1 GCA946997625_01259 gene open 1875-3296 cysS
2533 CAMPVV010000102.1 GCA946997625_01260 gene open 3284-3661
2534 CAMPVV010000102.1 GCA946997625_01261 gene open 3674-4696 mreB
2535 CAMPVV010000102.1 GCA946997625_01262 gene open 4696-5568
2536 CAMPVV010000103.1 GCA946997625_01263 CDS open 10-468 _na     152_aa Ribose/galactose/methyl galactoside import ATP-binding protein
2537 CAMPVV010000103.1 GCA946997625_01264 CDS open 488-1507 _na     339_aa mglC galactose/methyl galactoside ABC transporter permease MglC
2538 CAMPVV010000103.1 GCA946997625_01265 CDS open 1570-1740 _na     56_aa Rubredoxin
2539 CAMPVV010000103.1 GCA946997625_01266 CDS open 1845-2456 _na     203_aa Peptidase C39-like domain-containing protein
2540 CAMPVV010000103.1 GCA946997625_01267 CDS open 2558-3118 _na     186_aa ahpC alkyl hydroperoxide reductase subunit C
2541 CAMPVV010000103.1 GCA946997625_01268 CDS open 3198-3401 _na     67_aa FAD-dependent oxidoreductase
2542 CAMPVV010000103.1 GCA946997625_01269 CDS open 3450-4844 _na     464_aa Putative alkyl hydroperoxide reductase F subunit
2543 CAMPVV010000103.1 GCA946997625_01263 gene open 10-468
2544 CAMPVV010000103.1 GCA946997625_01264 gene open 488-1507 mglC
2545 CAMPVV010000103.1 GCA946997625_01265 gene open 1570-1740
2546 CAMPVV010000103.1 GCA946997625_01266 gene open 1845-2456
2547 CAMPVV010000103.1 GCA946997625_01267 gene open 2558-3118 ahpC
2548 CAMPVV010000103.1 GCA946997625_01268 gene open 3198-3401
2549 CAMPVV010000103.1 GCA946997625_01269 gene open 3450-4844
2550 CAMPVV010000104.1 GCA946997625_01270 CDS open 47-190 _na     47_aa hypothetical protein
2551 CAMPVV010000104.1 GCA946997625_01271 CDS open 162-1106 _na     314_aa Glycosyltransferase%2C group 2 family protein
2552 CAMPVV010000104.1 GCA946997625_01272 CDS open 1103-1615 _na     170_aa Glycosyltransferase%2C group 2 family protein
2553 CAMPVV010000104.1 GCA946997625_01273 CDS open 1792-2061 _na     89_aa Glycosyltransferase family 2 protein
2554 CAMPVV010000104.1 GCA946997625_01274 CDS open 2186-3373 _na     395_aa Glycosyltransferase%2C group 1 family protein
2555 CAMPVV010000104.1 GCA946997625_01275 CDS open 3410-4159 _na     249_aa rfaY Lipopolysaccharide core biosynthesis protein RfaY
2556 CAMPVV010000104.1 GCA946997625_01276 CDS open 4135-4893 _na     252_aa Polysaccharide deacetylase
2557 CAMPVV010000104.1 GCA946997625_01277 CDS open 5298-5486 _na     62_aa hypothetical protein
2558 CAMPVV010000104.1 GCA946997625_01270 gene open 47-190
2559 CAMPVV010000104.1 GCA946997625_01271 gene open 162-1106
2560 CAMPVV010000104.1 GCA946997625_01272 gene open 1103-1615
2561 CAMPVV010000104.1 GCA946997625_01273 gene open 1792-2061
2562 CAMPVV010000104.1 GCA946997625_01274 gene open 2186-3373
2563 CAMPVV010000104.1 GCA946997625_01275 gene open 3410-4159 rfaY
2564 CAMPVV010000104.1 GCA946997625_01276 gene open 4135-4893
2565 CAMPVV010000104.1 GCA946997625_01277 gene open 5298-5486
2566 CAMPVV010000105.1 GCA946997625_01278 CDS open 402-1301 _na     299_aa ABC 3 transport family protein
2567 CAMPVV010000105.1 GCA946997625_01279 CDS open 1316-2032 _na     238_aa ABC transporter%2C ATP-binding protein
2568 CAMPVV010000105.1 GCA946997625_01280 CDS open 2033-2944 _na     303_aa ABC transporter%2C substrate-binding protein
2569 CAMPVV010000105.1 GCA946997625_01281 CDS open 2956-3531 _na     191_aa DUF6162 domain-containing protein
2570 CAMPVV010000105.1 GCA946997625_01282 CDS open 3769-5220 _na     483_aa Elongation factor 4
2571 CAMPVV010000105.1 GCA946997625_01278 gene open 402-1301
2572 CAMPVV010000105.1 GCA946997625_01279 gene open 1316-2032
2573 CAMPVV010000105.1 GCA946997625_01280 gene open 2033-2944
2574 CAMPVV010000105.1 GCA946997625_01281 gene open 2956-3531
2575 CAMPVV010000105.1 GCA946997625_01282 gene open 3769-5220
2576 CAMPVV010000106.1 GCA946997625_01283 CDS open 962-2083 _na     373_aa ATP synthase F0%2C A subunit
2577 CAMPVV010000106.1 GCA946997625_01284 CDS open 2088-2489 _na     133_aa nusG NusG domain-containing protein
2578 CAMPVV010000106.1 GCA946997625_01285 CDS open 2464-3378 _na     304_aa phosphatidylserine decarboxylase
2579 CAMPVV010000106.1 GCA946997625_01286 CDS open 3387-4895 _na     502_aa nicotinate phosphoribosyltransferase
2580 CAMPVV010000106.1 GCA946997625_01283 gene open 962-2083
2581 CAMPVV010000106.1 GCA946997625_01284 gene open 2088-2489 nusG
2582 CAMPVV010000106.1 GCA946997625_01285 gene open 2464-3378
2583 CAMPVV010000106.1 GCA946997625_01286 gene open 3387-4895
2584 CAMPVV010000107.1 GCA946997625_01287 CDS open 348-1274 _na     308_aa Pyridine nucleotide-disulfide oxidoreductase
2585 CAMPVV010000107.1 GCA946997625_01288 CDS open 1299-1919 _na     206_aa Metallo-beta-lactamase domain protein
2586 CAMPVV010000107.1 GCA946997625_01289 CDS open 2079-2537 _na     152_aa Putative tRNA (cytidine(34)-2'-O)-methyltransferase
2587 CAMPVV010000107.1 GCA946997625_01290 CDS open 2541-3110 _na     189_aa ruvC crossover junction endodeoxyribonuclease RuvC
2588 CAMPVV010000107.1 GCA946997625_01291 CDS open 3121-4149 _na     342_aa Beta-eliminating lyase
2589 CAMPVV010000107.1 GCA946997625_01287 gene open 348-1274
2590 CAMPVV010000107.1 GCA946997625_01288 gene open 1299-1919
2591 CAMPVV010000107.1 GCA946997625_01289 gene open 2079-2537
2592 CAMPVV010000107.1 GCA946997625_01290 gene open 2541-3110 ruvC
2593 CAMPVV010000107.1 GCA946997625_01291 gene open 3121-4149
2594 CAMPVV010000108.1 GCA946997625_01292 CDS open 35-547 _na     170_aa hypothetical protein
2595 CAMPVV010000108.1 GCA946997625_01293 CDS open 598-1263 _na     221_aa YgjP-like metallopeptidase domain-containing protein
2596 CAMPVV010000108.1 GCA946997625_01294 CDS open 1380-2921 _na     513_aa citF citrate lyase subunit alpha
2597 CAMPVV010000108.1 GCA946997625_01295 CDS open 2923-3825 _na     300_aa Putative citrate (Pro-3S)-lyase%2C beta subunit
2598 CAMPVV010000108.1 GCA946997625_01296 CDS open 3836-4120 _na     94_aa citD citrate lyase acyl carrier protein
2599 CAMPVV010000108.1 GCA946997625_01297 CDS open 4134-5078 _na     314_aa Glutaconyl-CoA decarboxylase subunit beta
2600 CAMPVV010000108.1 GCA946997625_01292 gene open 35-547
2601 CAMPVV010000108.1 GCA946997625_01293 gene open 598-1263
2602 CAMPVV010000108.1 GCA946997625_01294 gene open 1380-2921 citF
2603 CAMPVV010000108.1 GCA946997625_01295 gene open 2923-3825
2604 CAMPVV010000108.1 GCA946997625_01296 gene open 3836-4120 citD
2605 CAMPVV010000108.1 GCA946997625_01297 gene open 4134-5078
2606 CAMPVV010000109.1 GCA946997625_01298 CDS open 32-1285 _na     417_aa phage portal protein
2607 CAMPVV010000109.1 GCA946997625_01299 CDS open 1275-2543 _na     422_aa PBSX family phage terminase large subunit
2608 CAMPVV010000109.1 GCA946997625_01300 CDS open 2506-2910 _na     134_aa helix-turn-helix domain-containing protein
2609 CAMPVV010000109.1 GCA946997625_01301 CDS open 3056-3274 _na     72_aa hypothetical protein
2610 CAMPVV010000109.1 GCA946997625_01302 CDS open 3295-3783 _na     162_aa hypothetical protein
2611 CAMPVV010000109.1 GCA946997625_01303 CDS open 3785-3994 _na     69_aa hypothetical protein
2612 CAMPVV010000109.1 GCA946997625_01304 CDS open 4068-4247 _na     59_aa hypothetical protein
2613 CAMPVV010000109.1 GCA946997625_01305 CDS open 4428-4664 _na     78_aa helix-turn-helix domain-containing protein
2614 CAMPVV010000109.1 GCA946997625_01306 CDS open 4678-5046 _na     122_aa ASCH domain-containing protein
2615 CAMPVV010000109.1 GCA946997625_01298 gene open 32-1285
2616 CAMPVV010000109.1 GCA946997625_01299 gene open 1275-2543
2617 CAMPVV010000109.1 GCA946997625_01300 gene open 2506-2910
2618 CAMPVV010000109.1 GCA946997625_01301 gene open 3056-3274
2619 CAMPVV010000109.1 GCA946997625_01302 gene open 3295-3783
2620 CAMPVV010000109.1 GCA946997625_01303 gene open 3785-3994
2621 CAMPVV010000109.1 GCA946997625_01304 gene open 4068-4247
2622 CAMPVV010000109.1 GCA946997625_01305 gene open 4428-4664
2623 CAMPVV010000109.1 GCA946997625_01306 gene open 4678-5046
2624 CAMPVV010000110.1 GCA946997625_01307 CDS open 268-1077 _na     269_aa Peptidyl-prolyl cis-trans isomerase
2625 CAMPVV010000110.1 GCA946997625_01308 CDS open 1166-1942 _na     258_aa Spermidine/putrescine ABC transporter permease
2626 CAMPVV010000110.1 GCA946997625_01309 CDS open 1932-2777 _na     281_aa ABC transporter%2C permease protein
2627 CAMPVV010000110.1 GCA946997625_01310 CDS open 2779-3918 _na     379_aa potA Spermidine/putrescine import ATP-binding protein PotA
2628 CAMPVV010000110.1 GCA946997625_01311 CDS open 4037-5059 _na     340_aa Dehydrogenase%2C FMN-dependent
2629 CAMPVV010000110.1 GCA946997625_01307 gene open 268-1077
2630 CAMPVV010000110.1 GCA946997625_01308 gene open 1166-1942
2631 CAMPVV010000110.1 GCA946997625_01309 gene open 1932-2777
2632 CAMPVV010000110.1 GCA946997625_01310 gene open 2779-3918 potA
2633 CAMPVV010000110.1 GCA946997625_01311 gene open 4037-5059
2634 CAMPVV010000111.1 GCA946997625_01312 CDS open 91-1518 _na     475_aa hypothetical protein
2635 CAMPVV010000111.1 GCA946997625_01313 CDS open 1841-2386 _na     181_aa TetR/AcrR family transcriptional regulator
2636 CAMPVV010000111.1 GCA946997625_01314 CDS open 2411-2953 _na     180_aa TetR/AcrR family transcriptional regulator
2637 CAMPVV010000111.1 GCA946997625_01315 CDS open 2993-3544 _na     183_aa DHFR domain-containing protein
2638 CAMPVV010000111.1 GCA946997625_01316 CDS open 3557-4780 _na     407_aa Transporter%2C dicarboxylate/amino acid:cation Na+/H+ symporter family protein
2639 CAMPVV010000111.1 GCA946997625_01317 CDS open 4824-5027 _na     67_aa cspB Cold shock protein CspB
2640 CAMPVV010000111.1 GCA946997625_01312 gene open 91-1518
2641 CAMPVV010000111.1 GCA946997625_01313 gene open 1841-2386
2642 CAMPVV010000111.1 GCA946997625_01314 gene open 2411-2953
2643 CAMPVV010000111.1 GCA946997625_01315 gene open 2993-3544
2644 CAMPVV010000111.1 GCA946997625_01316 gene open 3557-4780
2645 CAMPVV010000111.1 GCA946997625_01317 gene open 4824-5027 cspB
2646 CAMPVV010000112.1 GCA946997625_01318 CDS open 112-645 _na     177_aa hypothetical protein
2647 CAMPVV010000112.1 GCA946997625_01319 CDS open 742-2178 _na     478_aa Outer membrane efflux protein
2648 CAMPVV010000112.1 GCA946997625_01320 CDS open 2198-3271 _na     357_aa Efflux transporter%2C RND family%2C MFP subunit
2649 CAMPVV010000112.1 GCA946997625_01318 gene open 112-645
2650 CAMPVV010000112.1 GCA946997625_01319 gene open 742-2178
2651 CAMPVV010000112.1 GCA946997625_01320 gene open 2198-3271
2652 CAMPVV010000113.1 GCA946997625_01321 CDS open 163-507 _na     114_aa Biotin-requiring enzyme
2653 CAMPVV010000113.1 GCA946997625_01322 CDS open 516-851 _na     111_aa Sodium pump decarboxylase%2C gamma subunit
2654 CAMPVV010000113.1 GCA946997625_01323 CDS open 860-2248 _na     462_aa oxaloacetate decarboxylase subunit alpha
2655 CAMPVV010000113.1 GCA946997625_01324 CDS open 2276-3625 _na     449_aa Citrate-sodium symporter
2656 CAMPVV010000113.1 GCA946997625_01325 CDS open 3785-4438 _na     217_aa gntR Transcriptional regulator%2C GntR family
2657 CAMPVV010000113.1 GCA946997625_01326 CDS open 4441-4563 _na     40_aa relE Toxin-antitoxin system%2C toxin component%2C RelE domain protein
2658 CAMPVV010000113.1 GCA946997625_01327 CDS open 4669-4947 _na     92_aa hypothetical protein
2659 CAMPVV010000113.1 GCA946997625_01321 gene open 163-507
2660 CAMPVV010000113.1 GCA946997625_01322 gene open 516-851
2661 CAMPVV010000113.1 GCA946997625_01323 gene open 860-2248
2662 CAMPVV010000113.1 GCA946997625_01324 gene open 2276-3625
2663 CAMPVV010000113.1 GCA946997625_01325 gene open 3785-4438 gntR
2664 CAMPVV010000113.1 GCA946997625_01326 gene open 4441-4563 relE
2665 CAMPVV010000113.1 GCA946997625_01327 gene open 4669-4947
2666 CAMPVV010000114.1 GCA946997625_01328 CDS open 61-282 _na     73_aa hypothetical protein
2667 CAMPVV010000114.1 GCA946997625_01329 CDS open 410-1033 _na     207_aa Orotate phosphoribosyltransferase
2668 CAMPVV010000114.1 GCA946997625_01330 CDS open 1026-2243 _na     405_aa Amidohydrolase family protein
2669 CAMPVV010000114.1 GCA946997625_01331 CDS open 2237-2953 _na     238_aa pyrF orotidine-5'-phosphate decarboxylase
2670 CAMPVV010000114.1 GCA946997625_01332 CDS open 2956-3876 _na     306_aa dihydroorotate dehydrogenase
2671 CAMPVV010000114.1 GCA946997625_01333 CDS open 3886-4686 _na     266_aa Putative dihydroorotate oxidase%2C electron transfer subunit
2672 CAMPVV010000114.1 GCA946997625_01334 CDS open 4696-4839 _na     47_aa hypothetical protein
2673 CAMPVV010000114.1 GCA946997625_01328 gene open 61-282
2674 CAMPVV010000114.1 GCA946997625_01329 gene open 410-1033
2675 CAMPVV010000114.1 GCA946997625_01330 gene open 1026-2243
2676 CAMPVV010000114.1 GCA946997625_01331 gene open 2237-2953 pyrF
2677 CAMPVV010000114.1 GCA946997625_01332 gene open 2956-3876
2678 CAMPVV010000114.1 GCA946997625_01333 gene open 3886-4686
2679 CAMPVV010000114.1 GCA946997625_01334 gene open 4696-4839
2680 CAMPVV010000115.1 GCA946997625_01335 CDS open 2133-2996 _na     287_aa hypothetical protein
2681 CAMPVV010000115.1 GCA946997625_01336 CDS open 3030-3770 _na     246_aa hypothetical protein
2682 CAMPVV010000115.1 GCA946997625_01335 gene open 2133-2996
2683 CAMPVV010000115.1 GCA946997625_01336 gene open 3030-3770
2684 CAMPVV010000116.1 GCA946997625_01337 CDS open 253-573 _na     106_aa Osmosensory transporter coiled coil domain-containing protein
2685 CAMPVV010000116.1 GCA946997625_01338 CDS open 684-1052 _na     122_aa DUF3021 domain-containing protein
2686 CAMPVV010000116.1 GCA946997625_01339 CDS open 1151-1333 _na     60_aa tnpW Transposon-encoded protein TnpW
2687 CAMPVV010000116.1 GCA946997625_01340 CDS open 1415-3253 _na     612_aa spoIVCA Recombinase domain-containing protein
2688 CAMPVV010000116.1 GCA946997625_01341 CDS open 3305-3652 _na     115_aa traG TraG family protein
2689 CAMPVV010000116.1 GCA946997625_01342 CDS open 3645-4379 _na     244_aa kilAC Bro-N domain-containing protein
2690 CAMPVV010000116.1 GCA946997625_01343 CDS open 4376-4738 _na     120_aa pcfB PcfB family protein
2691 CAMPVV010000116.1 GCA946997625_01337 gene open 253-573
2692 CAMPVV010000116.1 GCA946997625_01338 gene open 684-1052
2693 CAMPVV010000116.1 GCA946997625_01339 gene open 1151-1333 tnpW
2694 CAMPVV010000116.1 GCA946997625_01340 gene open 1415-3253 spoIVCA
2695 CAMPVV010000116.1 GCA946997625_01341 gene open 3305-3652 traG
2696 CAMPVV010000116.1 GCA946997625_01342 gene open 3645-4379 kilAC
2697 CAMPVV010000116.1 GCA946997625_01343 gene open 4376-4738 pcfB
2698 CAMPVV010000117.1 GCA946997625_01344 CDS open 119-757 _na     212_aa hypothetical protein
2699 CAMPVV010000117.1 GCA946997625_01345 CDS open 761-2824 _na     687_aa Glycine--tRNA ligase beta subunit
2700 CAMPVV010000117.1 GCA946997625_01346 CDS open 2833-3387 _na     184_aa folE GTP cyclohydrolase I FolE
2701 CAMPVV010000117.1 GCA946997625_01347 CDS open 3397-4224 _na     275_aa folK 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase
2702 CAMPVV010000117.1 GCA946997625_01344 gene open 119-757
2703 CAMPVV010000117.1 GCA946997625_01345 gene open 761-2824
2704 CAMPVV010000117.1 GCA946997625_01346 gene open 2833-3387 folE
2705 CAMPVV010000117.1 GCA946997625_01347 gene open 3397-4224 folK
2706 CAMPVV010000118.1 GCA946997625_01348 CDS open 29-955 _na     308_aa tolC TolC family protein
2707 CAMPVV010000118.1 GCA946997625_01349 CDS open 928-2025 _na     365_aa Efflux transporter%2C RND family%2C MFP subunit
2708 CAMPVV010000118.1 GCA946997625_01350 CDS open 2000-2674 _na     224_aa ABC transporter%2C ATP-binding protein
2709 CAMPVV010000118.1 GCA946997625_01351 CDS open 2671-3897 _na     408_aa Efflux ABC transporter%2C permease protein
2710 CAMPVV010000118.1 GCA946997625_01348 gene open 29-955 tolC
2711 CAMPVV010000118.1 GCA946997625_01349 gene open 928-2025
2712 CAMPVV010000118.1 GCA946997625_01350 gene open 2000-2674
2713 CAMPVV010000118.1 GCA946997625_01351 gene open 2671-3897
2714 CAMPVV010000119.1 GCA946997625_01352 CDS open 106-969 _na     287_aa type III toxin-antitoxin system ToxN/AbiQ family toxin
2715 CAMPVV010000119.1 GCA946997625_01353 CDS open 996-1235 _na     79_aa hypothetical protein
2716 CAMPVV010000119.1 GCA946997625_01354 CDS open 1778-2386 _na     202_aa Site-specific recombinase%2C phage integrase family
2717 CAMPVV010000119.1 GCA946997625_01352 gene open 106-969
2718 CAMPVV010000119.1 GCA946997625_01353 gene open 996-1235
2719 CAMPVV010000119.1 GCA946997625_01354 gene open 1778-2386
2720 CAMPVV010000120.1 GCA946997625_01355 CDS open 34-1086 _na     350_aa hypothetical protein
2721 CAMPVV010000120.1 GCA946997625_01356 CDS open 1130-1297 _na     55_aa hypothetical protein
2722 CAMPVV010000120.1 GCA946997625_01357 CDS open 1716-2186 _na     156_aa Pyridoxamine 5'-phosphate oxidase family protein
2723 CAMPVV010000120.1 GCA946997625_01358 CDS open 2302-3840 _na     512_aa guaA glutamine-hydrolyzing GMP synthase
2724 CAMPVV010000120.1 GCA946997625_01359 CDS open 4065-4652 _na     195_aa hypothetical protein
2725 CAMPVV010000120.1 GCA946997625_01355 gene open 34-1086
2726 CAMPVV010000120.1 GCA946997625_01356 gene open 1130-1297
2727 CAMPVV010000120.1 GCA946997625_01357 gene open 1716-2186
2728 CAMPVV010000120.1 GCA946997625_01358 gene open 2302-3840 guaA
2729 CAMPVV010000120.1 GCA946997625_01359 gene open 4065-4652
2730 CAMPVV010000121.1 GCA946997625_01360 CDS open 1329-2732 _na     467_aa Aldose 1-epimerase
2731 CAMPVV010000121.1 GCA946997625_01361 CDS open 2820-3617 _na     265_aa putative membrane transporter protein
2732 CAMPVV010000121.1 GCA946997625_01362 CDS open 3614-4600 _na     328_aa hypothetical protein
2733 CAMPVV010000121.1 GCA946997625_01360 gene open 1329-2732
2734 CAMPVV010000121.1 GCA946997625_01361 gene open 2820-3617
2735 CAMPVV010000121.1 GCA946997625_01362 gene open 3614-4600
2736 CAMPVV010000122.1 GCA946997625_01363 CDS open 12-737 _na     241_aa Thil AANH domain-containing protein
2737 CAMPVV010000122.1 GCA946997625_01364 CDS open 796-1404 _na     202_aa plsY glycerol-3-phosphate 1-O-acyltransferase PlsY
2738 CAMPVV010000122.1 GCA946997625_01365 CDS open 1416-2417 _na     333_aa NAD(P)H-dependent glycerol-3-phosphate dehydrogenase
2739 CAMPVV010000122.1 GCA946997625_01366 CDS open 2443-3261 _na     272_aa RNA polymerase sigma factor
2740 CAMPVV010000122.1 GCA946997625_01367 CDS open 3277-4398 _na     373_aa dnaN DNA polymerase III subunit beta
2741 CAMPVV010000122.1 GCA946997625_01363 gene open 12-737
2742 CAMPVV010000122.1 GCA946997625_01364 gene open 796-1404 plsY
2743 CAMPVV010000122.1 GCA946997625_01365 gene open 1416-2417
2744 CAMPVV010000122.1 GCA946997625_01366 gene open 2443-3261
2745 CAMPVV010000122.1 GCA946997625_01367 gene open 3277-4398 dnaN
2746 CAMPVV010000123.1 GCA946997625_01368 CDS open 235-1278 _na     347_aa mnmA tRNA 2-thiouridine(34) synthase MnmA
2747 CAMPVV010000123.1 GCA946997625_01369 CDS open 1296-1694 _na     132_aa mscL large-conductance mechanosensitive channel protein MscL
2748 CAMPVV010000123.1 GCA946997625_01370 CDS open 1734-1985 _na     83_aa hypothetical protein
2749 CAMPVV010000123.1 GCA946997625_01371 CDS open 2014-4497 _na     827_aa Hemin receptor
2750 CAMPVV010000123.1 GCA946997625_01368 gene open 235-1278 mnmA
2751 CAMPVV010000123.1 GCA946997625_01369 gene open 1296-1694 mscL
2752 CAMPVV010000123.1 GCA946997625_01370 gene open 1734-1985
2753 CAMPVV010000123.1 GCA946997625_01371 gene open 2014-4497
2754 CAMPVV010000124.1 GCA946997625_01372 CDS open 43-2037 _na     664_aa Phage tail tape measure protein
2755 CAMPVV010000124.1 GCA946997625_01373 CDS open 2060-2635 _na     191_aa phage baseplate protein
2756 CAMPVV010000124.1 GCA946997625_01374 CDS open 2638-2964 _na     108_aa phage baseplate plug protein
2757 CAMPVV010000124.1 GCA946997625_01375 CDS open 2966-3877 _na     303_aa hypothetical protein
2758 CAMPVV010000124.1 GCA946997625_01376 CDS open 3874-4440 _na     188_aa Phage protein Gp138 N-terminal domain-containing protein
2759 CAMPVV010000124.1 GCA946997625_01372 gene open 43-2037
2760 CAMPVV010000124.1 GCA946997625_01373 gene open 2060-2635
2761 CAMPVV010000124.1 GCA946997625_01374 gene open 2638-2964
2762 CAMPVV010000124.1 GCA946997625_01375 gene open 2966-3877
2763 CAMPVV010000124.1 GCA946997625_01376 gene open 3874-4440
2764 CAMPVV010000125.1 GCA946997625_01377 CDS open 19-1074 _na     351_aa FTR1 family protein
2765 CAMPVV010000125.1 GCA946997625_01378 CDS open 1119-1790 _na     223_aa Fe2+ transport protein
2766 CAMPVV010000125.1 GCA946997625_01379 CDS open 1900-2118 _na     72_aa hypothetical protein
2767 CAMPVV010000125.1 GCA946997625_01380 CDS open 2170-2559 _na     129_aa hypothetical protein
2768 CAMPVV010000125.1 GCA946997625_01381 CDS open 2576-3364 _na     262_aa hypothetical protein
2769 CAMPVV010000125.1 GCA946997625_01382 CDS open 3438-3890 _na     150_aa hypothetical protein
2770 CAMPVV010000125.1 GCA946997625_01383 CDS open 3906-4151 _na     81_aa hypothetical protein
2771 CAMPVV010000125.1 GCA946997625_01384 CDS open 4173-4325 _na     50_aa hypothetical protein
2772 CAMPVV010000125.1 GCA946997625_01377 gene open 19-1074
2773 CAMPVV010000125.1 GCA946997625_01378 gene open 1119-1790
2774 CAMPVV010000125.1 GCA946997625_01379 gene open 1900-2118
2775 CAMPVV010000125.1 GCA946997625_01380 gene open 2170-2559
2776 CAMPVV010000125.1 GCA946997625_01381 gene open 2576-3364
2777 CAMPVV010000125.1 GCA946997625_01382 gene open 3438-3890
2778 CAMPVV010000125.1 GCA946997625_01383 gene open 3906-4151
2779 CAMPVV010000125.1 GCA946997625_01384 gene open 4173-4325
2780 CAMPVV010000126.1 GCA946997625_01385 CDS open 661-1005 _na     114_aa hypothetical protein
2781 CAMPVV010000126.1 GCA946997625_01386 CDS open 1934-2749 _na     271_aa Ferredoxin
2782 CAMPVV010000126.1 GCA946997625_01387 CDS open 2761-4104 _na     447_aa bioA adenosylmethionine--8-amino-7-oxononanoate transaminase
2783 CAMPVV010000126.1 GCA946997625_01388 CDS open 4088-4576 _na     162_aa hypothetical protein
2784 CAMPVV010000126.1 GCA946997625_01385 gene open 661-1005
2785 CAMPVV010000126.1 GCA946997625_01386 gene open 1934-2749
2786 CAMPVV010000126.1 GCA946997625_01387 gene open 2761-4104 bioA
2787 CAMPVV010000126.1 GCA946997625_01388 gene open 4088-4576
2788 CAMPVV010000127.1 GCA946997625_01389 CDS open 236-478 _na     80_aa acyl-CoA thioester hydrolase/BAAT C-terminal domain-containing protein
2789 CAMPVV010000127.1 GCA946997625_01390 CDS open 968-2431 _na     487_aa thsA NAD(+) hydrolase ThsA
2790 CAMPVV010000127.1 GCA946997625_01391 CDS open 2433-2924 _na     163_aa thsB Thoeris protein ThsB TIR-like domain-containing protein
2791 CAMPVV010000127.1 GCA946997625_01392 CDS open 2962-3531 _na     189_aa TIR domain-containing protein
2792 CAMPVV010000127.1 GCA946997625_01389 gene open 236-478
2793 CAMPVV010000127.1 GCA946997625_01390 gene open 968-2431 thsA
2794 CAMPVV010000127.1 GCA946997625_01391 gene open 2433-2924 thsB
2795 CAMPVV010000127.1 GCA946997625_01392 gene open 2962-3531
2796 CAMPVV010000128.1 GCA946997625_01393 CDS open 41-1357 _na     438_aa RND transporter%2C HAE1/HME family%2C permease protein
2797 CAMPVV010000128.1 GCA946997625_01394 CDS open 1368-2555 _na     395_aa cysteine-S-conjugate beta-lyase
2798 CAMPVV010000128.1 GCA946997625_01395 CDS open 2598-3419 _na     273_aa truB tRNA pseudouridine(55) synthase TruB
2799 CAMPVV010000128.1 GCA946997625_01393 gene open 41-1357
2800 CAMPVV010000128.1 GCA946997625_01394 gene open 1368-2555
2801 CAMPVV010000128.1 GCA946997625_01395 gene open 2598-3419 truB
2802 CAMPVV010000129.1 GCA946997625_01396 CDS open 31-231 _na     66_aa hypothetical protein
2803 CAMPVV010000129.1 GCA946997625_01397 CDS open 672-1433 _na     253_aa type I site-specific deoxyribonuclease
2804 CAMPVV010000129.1 GCA946997625_01398 CDS open 1445-2155 _na     236_aa restriction endonuclease subunit S
2805 CAMPVV010000129.1 GCA946997625_01399 CDS open 2106-3335 _na     409_aa Type I restriction modification DNA specificity domain protein
2806 CAMPVV010000129.1 GCA946997625_01400 CDS open 3519-4487 _na     322_aa type I restriction-modification system subunit M
2807 CAMPVV010000129.1 GCA946997625_01396 gene open 31-231
2808 CAMPVV010000129.1 GCA946997625_01397 gene open 672-1433
2809 CAMPVV010000129.1 GCA946997625_01398 gene open 1445-2155
2810 CAMPVV010000129.1 GCA946997625_01399 gene open 2106-3335
2811 CAMPVV010000129.1 GCA946997625_01400 gene open 3519-4487
2812 CAMPVV010000130.1 GCA946997625_01401 CDS open 123-401 _na     92_aa cas2 CRISPR-associated endonuclease Cas2
2813 CAMPVV010000130.1 GCA946997625_01402 CDS open 408-1400 _na     330_aa cas1b type I-B CRISPR-associated endonuclease Cas1b
2814 CAMPVV010000130.1 GCA946997625_01403 CDS open 1411-1905 _na     164_aa cas4 CRISPR-associated protein Cas4
2815 CAMPVV010000130.1 GCA946997625_01404 CDS open 1925-4126 _na     733_aa CRISPR-associated helicase Cas3
2816 CAMPVV010000130.1 GCA946997625_01405 CDS open 4136-4450 _na     104_aa hypothetical protein
2817 CAMPVV010000130.1 GCA946997625_01401 gene open 123-401 cas2
2818 CAMPVV010000130.1 GCA946997625_01402 gene open 408-1400 cas1b
2819 CAMPVV010000130.1 GCA946997625_01403 gene open 1411-1905 cas4
2820 CAMPVV010000130.1 GCA946997625_01404 gene open 1925-4126
2821 CAMPVV010000130.1 GCA946997625_01405 gene open 4136-4450
2822 CAMPVV010000131.1 GCA946997625_01406 CDS open 120-542 _na     140_aa HD domain-containing protein
2823 CAMPVV010000131.1 GCA946997625_01407 CDS open 561-2321 _na     586_aa Radical SAM domain protein
2824 CAMPVV010000131.1 GCA946997625_01408 CDS open 2334-3005 _na     223_aa ung uracil-DNA glycosylase
2825 CAMPVV010000131.1 GCA946997625_01409 CDS open 3017-4456 _na     479_aa UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2%2C6-diaminopimelate ligase
2826 CAMPVV010000131.1 GCA946997625_01406 gene open 120-542
2827 CAMPVV010000131.1 GCA946997625_01407 gene open 561-2321
2828 CAMPVV010000131.1 GCA946997625_01408 gene open 2334-3005 ung
2829 CAMPVV010000131.1 GCA946997625_01409 gene open 3017-4456
2830 CAMPVV010000132.1 GCA946997625_01410 CDS open 362-1336 _na     324_aa NLPA lipoprotein
2831 CAMPVV010000132.1 GCA946997625_01411 CDS open 1456-3048 _na     530_aa potassium/proton antiporter
2832 CAMPVV010000132.1 GCA946997625_01412 CDS open 3072-4388 _na     438_aa HDIG domain protein
2833 CAMPVV010000132.1 GCA946997625_01410 gene open 362-1336
2834 CAMPVV010000132.1 GCA946997625_01411 gene open 1456-3048
2835 CAMPVV010000132.1 GCA946997625_01412 gene open 3072-4388
2836 CAMPVV010000133.1 GCA946997625_01413 CDS open 538-2073 _na     511_aa ABC transporter%2C permease protein
2837 CAMPVV010000133.1 GCA946997625_01414 CDS open 2060-3562 _na     500_aa cobyric acid synthase
2838 CAMPVV010000133.1 GCA946997625_01413 gene open 538-2073
2839 CAMPVV010000133.1 GCA946997625_01414 gene open 2060-3562
2840 CAMPVV010000134.1 regulatory_region open 3302-3388 SAM riboswitch aptamer (S box leader)
2841 CAMPVV010000134.1 GCA946997625_01415 CDS open 705-2021 _na     438_aa Na+/H+ antiporter family protein
2842 CAMPVV010000134.1 GCA946997625_01416 CDS open 2066-3214 _na     382_aa metK methionine adenosyltransferase
2843 CAMPVV010000134.1 GCA946997625_01417 CDS open 3416-4300 _na     294_aa galU UTP--glucose-1-phosphate uridylyltransferase GalU
2844 CAMPVV010000134.1 GCA946997625_01415 gene open 705-2021
2845 CAMPVV010000134.1 GCA946997625_01416 gene open 2066-3214 metK
2846 CAMPVV010000134.1 GCA946997625_01417 gene open 3416-4300 galU
2847 CAMPVV010000135.1 GCA946997625_01418 CDS open 79-1494 _na     471_aa recJ single-stranded-DNA-specific exonuclease RecJ
2848 CAMPVV010000135.1 GCA946997625_01419 CDS open 1472-2794 _na     440_aa tig trigger factor
2849 CAMPVV010000135.1 GCA946997625_01420 CDS open 2928-3515 _na     195_aa ATP-dependent Clp protease proteolytic subunit
2850 CAMPVV010000135.1 GCA946997625_01418 gene open 79-1494 recJ
2851 CAMPVV010000135.1 GCA946997625_01419 gene open 1472-2794 tig
2852 CAMPVV010000135.1 GCA946997625_01420 gene open 2928-3515
2853 CAMPVV010000136.1 GCA946997625_01421 CDS open 80-1585 _na     501_aa hypothetical protein
2854 CAMPVV010000136.1 GCA946997625_01422 CDS open 1569-3290 _na     573_aa casA type I-E CRISPR-associated protein Cse1/CasA
2855 CAMPVV010000136.1 GCA946997625_01423 CDS open 3283-3867 _na     194_aa casB type I-E CRISPR-associated protein Cse2/CasB
2856 CAMPVV010000136.1 GCA946997625_01421 gene open 80-1585
2857 CAMPVV010000136.1 GCA946997625_01422 gene open 1569-3290 casA
2858 CAMPVV010000136.1 GCA946997625_01423 gene open 3283-3867 casB
2859 CAMPVV010000137.1 GCA946997625_01424 CDS open 47-838 _na     263_aa Acyltransferase
2860 CAMPVV010000137.1 GCA946997625_01425 CDS open 861-1697 _na     278_aa Outer membrane insertion signal domain protein
2861 CAMPVV010000137.1 GCA946997625_01426 CDS open 1720-2418 _na     232_aa ybhL Inner membrane protein YbhL
2862 CAMPVV010000137.1 GCA946997625_01427 CDS open 2419-3600 _na     393_aa NADH-dependent butanol dehydrogenase A
2863 CAMPVV010000137.1 GCA946997625_01428 CDS open 3639-4271 _na     210_aa hypothetical protein
2864 CAMPVV010000137.1 GCA946997625_01424 gene open 47-838
2865 CAMPVV010000137.1 GCA946997625_01425 gene open 861-1697
2866 CAMPVV010000137.1 GCA946997625_01426 gene open 1720-2418 ybhL
2867 CAMPVV010000137.1 GCA946997625_01427 gene open 2419-3600
2868 CAMPVV010000137.1 GCA946997625_01428 gene open 3639-4271
2869 CAMPVV010000138.1 GCA946997625_01429 CDS open 1061-1747 _na     228_aa Response regulator receiver domain protein
2870 CAMPVV010000138.1 GCA946997625_01430 CDS open 1757-2503 _na     248_aa PP-loop family protein
2871 CAMPVV010000138.1 GCA946997625_01431 CDS open 2493-3281 _na     262_aa PP-loop family protein
2872 CAMPVV010000138.1 GCA946997625_01432 CDS open 3318-4178 _na     286_aa FAD/NAD(P)-binding domain-containing protein
2873 CAMPVV010000138.1 GCA946997625_01429 gene open 1061-1747
2874 CAMPVV010000138.1 GCA946997625_01430 gene open 1757-2503
2875 CAMPVV010000138.1 GCA946997625_01431 gene open 2493-3281
2876 CAMPVV010000138.1 GCA946997625_01432 gene open 3318-4178
2877 CAMPVV010000139.1 GCA946997625_01433 CDS open 180-917 _na     245_aa hypothetical protein
2878 CAMPVV010000139.1 GCA946997625_01434 CDS open 1086-1715 _na     209_aa hypothetical protein
2879 CAMPVV010000139.1 GCA946997625_01433 gene open 180-917
2880 CAMPVV010000139.1 GCA946997625_01434 gene open 1086-1715
2881 CAMPVV010000140.1 GCA946997625_01435 CDS open 1078-2355 _na     425_aa adenylosuccinate synthase
2882 CAMPVV010000140.1 GCA946997625_01436 CDS open 2367-3071 _na     234_aa trmB tRNA (guanosine(46)-N7)-methyltransferase TrmB
2883 CAMPVV010000140.1 GCA946997625_01437 CDS open 3047-4090 _na     347_aa 3-deoxy-D-manno-octulosonic acid transferase
2884 CAMPVV010000140.1 GCA946997625_01435 gene open 1078-2355
2885 CAMPVV010000140.1 GCA946997625_01436 gene open 2367-3071 trmB
2886 CAMPVV010000140.1 GCA946997625_01437 gene open 3047-4090
2887 CAMPVV010000141.1 GCA946997625_01438 CDS open 116-1114 _na     332_aa hypothetical protein
2888 CAMPVV010000141.1 GCA946997625_01439 CDS open 1127-2101 _na     324_aa AAA domain protein
2889 CAMPVV010000141.1 GCA946997625_01440 CDS open 2114-2305 _na     63_aa hypothetical protein
2890 CAMPVV010000141.1 GCA946997625_01441 CDS open 2315-2542 _na     75_aa hypothetical protein
2891 CAMPVV010000141.1 GCA946997625_01442 CDS open 2593-3222 _na     209_aa PF08960 domain protein
2892 CAMPVV010000141.1 GCA946997625_01443 CDS open 3224-3430 _na     68_aa hypothetical protein
2893 CAMPVV010000141.1 GCA946997625_01444 CDS open 3427-4074 _na     215_aa DUF3164 domain-containing protein
2894 CAMPVV010000141.1 GCA946997625_01438 gene open 116-1114
2895 CAMPVV010000141.1 GCA946997625_01439 gene open 1127-2101
2896 CAMPVV010000141.1 GCA946997625_01440 gene open 2114-2305
2897 CAMPVV010000141.1 GCA946997625_01441 gene open 2315-2542
2898 CAMPVV010000141.1 GCA946997625_01442 gene open 2593-3222
2899 CAMPVV010000141.1 GCA946997625_01443 gene open 3224-3430
2900 CAMPVV010000141.1 GCA946997625_01444 gene open 3427-4074
2901 CAMPVV010000142.1 GCA946997625_01445 CDS open 234-3977 _na     1247_aa Autotransporter outer membrane beta-barrel domain-containing protein
2902 CAMPVV010000142.1 GCA946997625_01445 gene open 234-3977
2903 CAMPVV010000143.1 repeat_region open 3151-3987 CRISPR array with 13 repeats of length 30%2C consensus sequence ATTTACATTCTACTTTAGTTTTACTCTAAT and spacer length 36
2904 CAMPVV010000143.1 GCA946997625_01446 CDS open 828-2540 _na     570_aa argS arginine--tRNA ligase
2905 CAMPVV010000143.1 GCA946997625_01446 gene open 828-2540 argS
2906 CAMPVV010000143.1 GCA946997625_01447 gene open 2898-2974 trnR
2907 CAMPVV010000143.1 GCA946997625_01447 tRNA open 2898-2974 trnR tRNA-Arg(tcg)
2908 CAMPVV010000144.1 GCA946997625_01448 CDS open 184-768 _na     194_aa Phage protein Gp138 N-terminal domain-containing protein
2909 CAMPVV010000144.1 GCA946997625_01449 CDS open 765-1676 _na     303_aa hypothetical protein
2910 CAMPVV010000144.1 GCA946997625_01450 CDS open 1678-2004 _na     108_aa phage baseplate plug protein
2911 CAMPVV010000144.1 GCA946997625_01451 CDS open 2007-2606 _na     199_aa phage baseplate protein
2912 CAMPVV010000144.1 GCA946997625_01452 CDS open 2608-3975 _na     455_aa hypothetical protein
2913 CAMPVV010000144.1 GCA946997625_01448 gene open 184-768
2914 CAMPVV010000144.1 GCA946997625_01449 gene open 765-1676
2915 CAMPVV010000144.1 GCA946997625_01450 gene open 1678-2004
2916 CAMPVV010000144.1 GCA946997625_01451 gene open 2007-2606
2917 CAMPVV010000144.1 GCA946997625_01452 gene open 2608-3975
2918 CAMPVV010000145.1 GCA946997625_01453 CDS open 20-838 _na     272_aa polyribonucleotide nucleotidyltransferase
2919 CAMPVV010000145.1 GCA946997625_01454 CDS open 855-2189 _na     444_aa rimO 30S ribosomal protein S12 methylthiotransferase RimO
2920 CAMPVV010000145.1 GCA946997625_01455 CDS open 2202-2756 _na     184_aa pgsA CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase
2921 CAMPVV010000145.1 GCA946997625_01456 CDS open 2766-3038 _na     90_aa YGGT family protein
2922 CAMPVV010000145.1 GCA946997625_01457 CDS open 3055-3996 _na     313_aa rsmH 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH
2923 CAMPVV010000145.1 GCA946997625_01453 gene open 20-838
2924 CAMPVV010000145.1 GCA946997625_01454 gene open 855-2189 rimO
2925 CAMPVV010000145.1 GCA946997625_01455 gene open 2202-2756 pgsA
2926 CAMPVV010000145.1 GCA946997625_01456 gene open 2766-3038
2927 CAMPVV010000145.1 GCA946997625_01457 gene open 3055-3996 rsmH
2928 CAMPVV010000146.1 GCA946997625_01458 CDS open 12-1529 _na     505_aa CRISPR-associated helicase Cas3
2929 CAMPVV010000146.1 GCA946997625_01459 CDS open 1587-2339 _na     250_aa CRISPR-associated protein Cas5%2C Tneap subtype
2930 CAMPVV010000146.1 GCA946997625_01460 CDS open 2326-3198 _na     290_aa cas7i type I-B CRISPR-associated protein Cas7/Cst2/DevR
2931 CAMPVV010000146.1 GCA946997625_01461 CDS open 3217-3891 _na     224_aa type I-B CRISPR-associated protein Cas8b1/Cst1
2932 CAMPVV010000146.1 GCA946997625_01458 gene open 12-1529
2933 CAMPVV010000146.1 GCA946997625_01459 gene open 1587-2339
2934 CAMPVV010000146.1 GCA946997625_01460 gene open 2326-3198 cas7i
2935 CAMPVV010000146.1 GCA946997625_01461 gene open 3217-3891
2936 CAMPVV010000147.1 GCA946997625_01462 CDS open 125-277 _na     50_aa hypothetical protein
2937 CAMPVV010000147.1 GCA946997625_01463 CDS open 363-653 _na     96_aa Lipoprotein
2938 CAMPVV010000147.1 GCA946997625_01464 CDS open 650-1474 _na     274_aa Toxin-antitoxin system%2C toxin component%2C Fic family
2939 CAMPVV010000147.1 GCA946997625_01465 CDS open 1505-2137 _na     210_aa Resolvase%2C N-terminal domain protein
2940 CAMPVV010000147.1 GCA946997625_01466 CDS open 2155-3123 _na     322_aa HipA-like C-terminal domain-containing protein
2941 CAMPVV010000147.1 GCA946997625_01467 CDS open 3104-3331 _na     75_aa hypothetical protein
2942 CAMPVV010000147.1 GCA946997625_01468 CDS open 3578-3895 _na     105_aa Fido domain-containing protein
2943 CAMPVV010000147.1 GCA946997625_01462 gene open 125-277
2944 CAMPVV010000147.1 GCA946997625_01463 gene open 363-653
2945 CAMPVV010000147.1 GCA946997625_01464 gene open 650-1474
2946 CAMPVV010000147.1 GCA946997625_01465 gene open 1505-2137
2947 CAMPVV010000147.1 GCA946997625_01466 gene open 2155-3123
2948 CAMPVV010000147.1 GCA946997625_01467 gene open 3104-3331
2949 CAMPVV010000147.1 GCA946997625_01468 gene open 3578-3895
2950 CAMPVV010000148.1 GCA946997625_01469 CDS open 199-726 _na     175_aa Signal peptidase I
2951 CAMPVV010000148.1 GCA946997625_01470 CDS open 746-1909 _na     387_aa Streptococcal pilin isopeptide linker domain-containing protein
2952 CAMPVV010000148.1 GCA946997625_01471 CDS open 1930-2952 _na     340_aa srtB SrtB family sortase
2953 CAMPVV010000148.1 GCA946997625_01472 CDS open 2903-3664 _na     253_aa Streptococcal pilin isopeptide linkage domain-containing protein
2954 CAMPVV010000148.1 GCA946997625_01469 gene open 199-726
2955 CAMPVV010000148.1 GCA946997625_01470 gene open 746-1909
2956 CAMPVV010000148.1 GCA946997625_01471 gene open 1930-2952 srtB
2957 CAMPVV010000148.1 GCA946997625_01472 gene open 2903-3664
2958 CAMPVV010000149.1 GCA946997625_01473 CDS open 726-2000 _na     424_aa Citrate transporter
2959 CAMPVV010000149.1 GCA946997625_01474 CDS open 2029-3306 _na     425_aa Citrate transporter
2960 CAMPVV010000149.1 GCA946997625_01475 CDS open 3321-3572 _na     83_aa hypothetical protein
2961 CAMPVV010000149.1 GCA946997625_01473 gene open 726-2000
2962 CAMPVV010000149.1 GCA946997625_01474 gene open 2029-3306
2963 CAMPVV010000149.1 GCA946997625_01475 gene open 3321-3572
2964 CAMPVV010000150.1 GCA946997625_01476 CDS open 137-1126 _na     329_aa siaP Sialic acid-binding periplasmic protein SiaP
2965 CAMPVV010000150.1 GCA946997625_01477 CDS open 1144-2997 _na     617_aa dctM TRAP C4-dicarboxylate transport system permease DctM subunit domain-containing protein
2966 CAMPVV010000150.1 GCA946997625_01476 gene open 137-1126 siaP
2967 CAMPVV010000150.1 GCA946997625_01477 gene open 1144-2997 dctM
2968 CAMPVV010000151.1 GCA946997625_01478 CDS open 61-387 _na     108_aa hypothetical protein
2969 CAMPVV010000151.1 GCA946997625_01479 CDS open 390-728 _na     112_aa Head-tail adaptor protein
2970 CAMPVV010000151.1 GCA946997625_01480 CDS open 718-1221 _na     167_aa LIC_12616 family protein
2971 CAMPVV010000151.1 GCA946997625_01481 CDS open 1235-2278 _na     347_aa hypothetical protein
2972 CAMPVV010000151.1 GCA946997625_01482 CDS open 2278-2670 _na     130_aa Phage protein
2973 CAMPVV010000151.1 GCA946997625_01483 CDS open 2672-3046 _na     124_aa Phage protein
2974 CAMPVV010000151.1 GCA946997625_01478 gene open 61-387
2975 CAMPVV010000151.1 GCA946997625_01479 gene open 390-728
2976 CAMPVV010000151.1 GCA946997625_01480 gene open 718-1221
2977 CAMPVV010000151.1 GCA946997625_01481 gene open 1235-2278
2978 CAMPVV010000151.1 GCA946997625_01482 gene open 2278-2670
2979 CAMPVV010000151.1 GCA946997625_01483 gene open 2672-3046
2980 CAMPVV010000152.1 GCA946997625_01484 CDS open 1939-2478 _na     179_aa rbr rubrerythrin
2981 CAMPVV010000152.1 GCA946997625_01485 CDS open 2690-3064 _na     124_aa HVO_2922 family protein
2982 CAMPVV010000152.1 GCA946997625_01484 gene open 1939-2478 rbr
2983 CAMPVV010000152.1 GCA946997625_01485 gene open 2690-3064
2984 CAMPVV010000153.1 GCA946997625_01486 CDS open 18-269 _na     83_aa hypothetical protein
2985 CAMPVV010000153.1 GCA946997625_01487 CDS open 241-1038 _na     265_aa Endonuclease/exonuclease/phosphatase family protein
2986 CAMPVV010000153.1 GCA946997625_01488 CDS open 1053-2627 _na     524_aa PTS system maltose-specific EIICB component
2987 CAMPVV010000153.1 GCA946997625_01489 CDS open 2683-3231 _na     182_aa Corrinoid adenosyltransferase
2988 CAMPVV010000153.1 GCA946997625_01490 CDS open 3255-3710 _na     151_aa Single-stranded DNA-binding protein
2989 CAMPVV010000153.1 GCA946997625_01486 gene open 18-269
2990 CAMPVV010000153.1 GCA946997625_01487 gene open 241-1038
2991 CAMPVV010000153.1 GCA946997625_01488 gene open 1053-2627
2992 CAMPVV010000153.1 GCA946997625_01489 gene open 2683-3231
2993 CAMPVV010000153.1 GCA946997625_01490 gene open 3255-3710
2994 CAMPVV010000154.1 GCA946997625_01491 CDS open 294-2363 _na     689_aa fusA elongation factor G
2995 CAMPVV010000154.1 GCA946997625_01491 gene open 294-2363 fusA
2996 CAMPVV010000155.1 GCA946997625_01492 CDS open 1471-2037 _na     188_aa tRNA (guanine-N(1)-)-methyltransferase C-terminal domain-containing protein
2997 CAMPVV010000155.1 GCA946997625_01493 CDS open 2034-2744 _na     236_aa trmD tRNA (guanosine(37)-N1)-methyltransferase TrmD
2998 CAMPVV010000155.1 GCA946997625_01494 CDS open 2746-3264 _na     172_aa rimM ribosome maturation factor RimM
2999 CAMPVV010000155.1 GCA946997625_01495 CDS open 3275-3514 _na     79_aa khpA RNA-binding protein KhpA
3000 CAMPVV010000155.1 GCA946997625_01492 gene open 1471-2037