HOMD Banner
Taxonomy: V4.3   |  16S rRNA RefSeq: V16.03   |  Genomic RefSeq: V11.03   |  Viruses: V1.2

BAKTAGenome Explorer: Lachnocurva vaginae (GCA_946997855.1)

Select a Genome:
BAKTA Annotations for GCA_946997855.1
Genome Selected: Lachnocurva vaginae
ContigsBases CDSrRNA tmRNAtRNA
24 1734492 1610 0 1 40
[Table]   [AA Fasta]      [Browser]   [Text]   [Excel]  
Search & Sort all 3337 Records
Search These Records: Clear
Sort Column:   Molecule   PID   NA   AA   Gene  Gene Product  Reverse
Annotation Table [page:6]    |    Number of Records Found: 3337 [7 Pages]    |    Previous Page <==> Next Page    |    Jump to Page: [ 1  2  3  4  5  6  7  ]
Notes:   1- Column headers only sort the current page. 2- Select [NA] or [AA] links to show sequences.
Region Protein-ID Type Genome
Viewer		 Range
(bp)		 Show Sequences
(length) NA / AA		 BAKTA
Gene		 BAKTA
GeneProduct
2501 CAMPWW010000008.1 GCA946997855_01237 gene open 52267-53334 hrcA
2502 CAMPWW010000008.1 GCA946997855_01238 gene open 53342-54001
2503 CAMPWW010000008.1 GCA946997855_01239 gene open 54093-55979 dnaK
2504 CAMPWW010000008.1 GCA946997855_01240 gene open 56007-57179 dnaJ
2505 CAMPWW010000008.1 GCA946997855_01241 gene open 57389-58543
2506 CAMPWW010000008.1 GCA946997855_01242 gene open 58589-59779
2507 CAMPWW010000008.1 GCA946997855_01243 gene open 60088-60321
2508 CAMPWW010000008.1 GCA946997855_01244 gene open 60407-61735 miaB
2509 CAMPWW010000008.1 GCA946997855_01245 gene open 61769-62035
2510 CAMPWW010000008.1 GCA946997855_01246 gene open 62035-62466
2511 CAMPWW010000008.1 GCA946997855_01247 gene open 62469-62720
2512 CAMPWW010000008.1 GCA946997855_01248 gene open 62748-64412
2513 CAMPWW010000008.1 GCA946997855_01249 gene open 64414-65055
2514 CAMPWW010000008.1 GCA946997855_01250 gene open 65140-66366 yhbU
2515 CAMPWW010000008.1 GCA946997855_01251 gene open 66376-67461
2516 CAMPWW010000008.1 GCA946997855_01252 gene open 67578-68732
2517 CAMPWW010000008.1 GCA946997855_01253 gene open 68847-69194 yajC
2518 CAMPWW010000008.1 GCA946997855_01254 gene open 69315-70685
2519 CAMPWW010000008.1 GCA946997855_01255 gene open 70863-73085
2520 CAMPWW010000008.1 GCA946997855_01256 gene open 73101-75593 clpC
2521 CAMPWW010000008.1 GCA946997855_01257 gene open 75663-76070
2522 CAMPWW010000008.1 GCA946997855_01258 gene open 76070-77434 radA
2523 CAMPWW010000008.1 GCA946997855_01205 gene open 11647-11720 trnR
2524 CAMPWW010000008.1 GCA946997855_01205 tRNA open 11647-11720 trnR tRNA-Arg(ccg)
2525 CAMPWW010000009.1 GCA946997855_01259 CDS open 376-1512 _na     378_aa GTPase
2526 CAMPWW010000009.1 GCA946997855_01260 CDS open 1512-1727 _na     71_aa hypothetical protein
2527 CAMPWW010000009.1 GCA946997855_01261 CDS open 1770-3488 _na     572_aa GmrSD restriction endonucleases N-terminal domain-containing protein
2528 CAMPWW010000009.1 GCA946997855_01262 CDS open 3497-3721 _na     74_aa HTH cro/C1-type domain-containing protein
2529 CAMPWW010000009.1 GCA946997855_01263 CDS open 3777-4280 _na     167_aa hypothetical protein
2530 CAMPWW010000009.1 GCA946997855_01264 CDS open 4404-5714 _na     436_aa histidine kinase
2531 CAMPWW010000009.1 GCA946997855_01265 CDS open 5711-6364 _na     217_aa Stage 0 sporulation A-like protein
2532 CAMPWW010000009.1 GCA946997855_01266 CDS open 6417-7793 _na     458_aa lolE ABC3 transporter permease C-terminal domain-containing protein
2533 CAMPWW010000009.1 GCA946997855_01267 CDS open 7793-8449 _na     218_aa lolD ABC transporter domain-containing protein
2534 CAMPWW010000009.1 GCA946997855_01268 CDS open 8459-9736 _na     425_aa Efflux ABC transporter%2C permease protein
2535 CAMPWW010000009.1 GCA946997855_01269 CDS open 10516-11031 _na     171_aa helix-turn-helix domain-containing protein
2536 CAMPWW010000009.1 GCA946997855_01270 CDS open 11210-11713 _na     167_aa GIY-YIG nuclease family protein
2537 CAMPWW010000009.1 GCA946997855_01271 CDS open 12494-13441 _na     315_aa dacC Serine-type D-Ala-D-Ala carboxypeptidase
2538 CAMPWW010000009.1 GCA946997855_01272 CDS open 14642-15223 _na     193_aa TIGR02185 family protein
2539 CAMPWW010000009.1 GCA946997855_01273 CDS open 15241-15942 _na     233_aa ecfT Cobalt transport protein
2540 CAMPWW010000009.1 GCA946997855_01274 CDS open 15939-17447 _na     502_aa ccmA heme ABC exporter ATP-binding protein CcmA
2541 CAMPWW010000009.1 GCA946997855_01275 CDS open 17456-19180 _na     574_aa mdlB ABC transporter
2542 CAMPWW010000009.1 GCA946997855_01276 CDS open 19181-20932 _na     583_aa Multidrug ABC transporter permease
2543 CAMPWW010000009.1 GCA946997855_01277 CDS open 20993-21631 _na     212_aa tetR Transcriptional regulator%2C TetR family
2544 CAMPWW010000009.1 GCA946997855_01278 CDS open 21668-21904 _na     78_aa hypothetical protein
2545 CAMPWW010000009.1 GCA946997855_01279 CDS open 22173-22508 _na     111_aa Type III toxin-antitoxin system ToxN/AbiQ family toxin
2546 CAMPWW010000009.1 GCA946997855_01280 CDS open 22605-22730 _na     41_aa type III toxin-antitoxin system ToxN/AbiQ family toxin
2547 CAMPWW010000009.1 GCA946997855_01281 CDS open 23098-23268 _na     56_aa hypothetical protein
2548 CAMPWW010000009.1 GCA946997855_01282 CDS open 23698-24336 _na     212_aa hypothetical protein
2549 CAMPWW010000009.1 GCA946997855_01283 CDS open 24450-26351 _na     633_aa hypothetical protein
2550 CAMPWW010000009.1 GCA946997855_01284 CDS open 26652-28211 _na     519_aa Recombinase family protein
2551 CAMPWW010000009.1 GCA946997855_01285 CDS open 28171-28380 _na     69_aa hypothetical protein
2552 CAMPWW010000009.1 GCA946997855_01286 CDS open 29158-29346 _na     62_aa hypothetical protein
2553 CAMPWW010000009.1 GCA946997855_01287 CDS open 29333-29509 _na     58_aa hypothetical protein
2554 CAMPWW010000009.1 GCA946997855_01288 CDS open 29745-30596 _na     283_aa Adenosyl-chloride synthase
2555 CAMPWW010000009.1 GCA946997855_01289 CDS open 30596-31147 _na     183_aa UPF0397 protein LJ_1703
2556 CAMPWW010000009.1 GCA946997855_01290 CDS open 31170-32882 _na     570_aa Putative ABC transporter ATP-binding protein BC_2655
2557 CAMPWW010000009.1 GCA946997855_01291 CDS open 32872-33705 _na     277_aa Cobalt transport protein
2558 CAMPWW010000009.1 GCA946997855_01292 CDS open 33840-35735 _na     631_aa hypothetical protein
2559 CAMPWW010000009.1 GCA946997855_01293 CDS open 35815-36879 _na     354_aa EIIBCA-Man
2560 CAMPWW010000009.1 GCA946997855_01294 CDS open 36903-37211 _na     102_aa fructose PTS transporter subunit IIB
2561 CAMPWW010000009.1 GCA946997855_01295 CDS open 37240-37692 _na     150_aa hypothetical protein
2562 CAMPWW010000009.1 GCA946997855_01296 CDS open 37772-38308 _na     178_aa hypothetical protein
2563 CAMPWW010000009.1 GCA946997855_01297 CDS open 38410-41415 _na     1001_aa hypothetical protein
2564 CAMPWW010000009.1 GCA946997855_01298 CDS open 41525-44032 _na     835_aa hypothetical protein
2565 CAMPWW010000009.1 GCA946997855_01299 CDS open 44074-45603 _na     509_aa UDP-N-acetylmuramyl-tripeptide synthetase
2566 CAMPWW010000009.1 GCA946997855_01300 CDS open 45908-46597 _na     229_aa Pseudouridine synthase
2567 CAMPWW010000009.1 GCA946997855_01301 CDS open 46636-47709 _na     357_aa potA Spermidine/putrescine import ATP-binding protein PotA
2568 CAMPWW010000009.1 GCA946997855_01302 CDS open 47702-48523 _na     273_aa potB Spermidine/putrescine transport system permease protein PotB
2569 CAMPWW010000009.1 GCA946997855_01303 CDS open 48520-49323 _na     267_aa ABC transmembrane type-1 domain-containing protein
2570 CAMPWW010000009.1 GCA946997855_01304 CDS open 49323-50414 _na     363_aa Extracellular solute-binding protein
2571 CAMPWW010000009.1 GCA946997855_01305 CDS open 50434-51426 _na     330_aa hypothetical protein
2572 CAMPWW010000009.1 GCA946997855_01306 CDS open 51440-52000 _na     186_aa Thymidine kinase
2573 CAMPWW010000009.1 GCA946997855_01307 CDS open 52172-52942 _na     256_aa hypothetical protein
2574 CAMPWW010000009.1 GCA946997855_01308 CDS open 52950-53717 _na     255_aa Short-chain dehydrogenase
2575 CAMPWW010000009.1 GCA946997855_01309 CDS open 53804-54562 _na     252_aa Type VII secretion system protein EssD-like domain-containing protein
2576 CAMPWW010000009.1 GCA946997855_01310 CDS open 54587-55666 _na     359_aa hypothetical protein
2577 CAMPWW010000009.1 GCA946997855_01311 CDS open 55899-56711 _na     270_aa hypothetical protein
2578 CAMPWW010000009.1 GCA946997855_01312 CDS open 56789-58336 _na     515_aa Ribonuclease Y
2579 CAMPWW010000009.1 GCA946997855_01313 CDS open 58480-59133 _na     217_aa hypothetical protein
2580 CAMPWW010000009.1 GCA946997855_01314 CDS open 59191-60237 _na     348_aa recA Protein RecA
2581 CAMPWW010000009.1 GCA946997855_01315 CDS open 60791-62089 _na     432_aa Enolase
2582 CAMPWW010000009.1 GCA946997855_01316 CDS open 62278-63873 _na     531_aa Peptide chain release factor 3
2583 CAMPWW010000009.1 GCA946997855_01317 CDS open 63945-64121 _na     58_aa rpsU 30S ribosomal protein S21
2584 CAMPWW010000009.1 GCA946997855_01318 CDS open 64327-65379 _na     350_aa Gfo/Idh/MocA-like oxidoreductase N-terminal domain-containing protein
2585 CAMPWW010000009.1 GCA946997855_01319 CDS open 65657-66244 _na     195_aa hypothetical protein
2586 CAMPWW010000009.1 GCA946997855_01320 CDS open 66384-69035 _na     883_aa Alanine--tRNA ligase
2587 CAMPWW010000009.1 GCA946997855_01321 CDS open 69055-69210 _na     51_aa hypothetical protein
2588 CAMPWW010000009.1 GCA946997855_01322 CDS open 69248-70555 _na     435_aa 5-methylthioadenosine/S-adenosylhomocysteine deaminase
2589 CAMPWW010000009.1 GCA946997855_01323 CDS open 70619-72112 _na     497_aa Nicotinate phosphoribosyltransferase
2590 CAMPWW010000009.1 GCA946997855_01259 gene open 376-1512
2591 CAMPWW010000009.1 GCA946997855_01260 gene open 1512-1727
2592 CAMPWW010000009.1 GCA946997855_01261 gene open 1770-3488
2593 CAMPWW010000009.1 GCA946997855_01262 gene open 3497-3721
2594 CAMPWW010000009.1 GCA946997855_01263 gene open 3777-4280
2595 CAMPWW010000009.1 GCA946997855_01264 gene open 4404-5714
2596 CAMPWW010000009.1 GCA946997855_01265 gene open 5711-6364
2597 CAMPWW010000009.1 GCA946997855_01266 gene open 6417-7793 lolE
2598 CAMPWW010000009.1 GCA946997855_01267 gene open 7793-8449 lolD
2599 CAMPWW010000009.1 GCA946997855_01268 gene open 8459-9736
2600 CAMPWW010000009.1 GCA946997855_01269 gene open 10516-11031
2601 CAMPWW010000009.1 GCA946997855_01270 gene open 11210-11713
2602 CAMPWW010000009.1 GCA946997855_01271 gene open 12494-13441 dacC
2603 CAMPWW010000009.1 GCA946997855_01272 gene open 14642-15223
2604 CAMPWW010000009.1 GCA946997855_01273 gene open 15241-15942 ecfT
2605 CAMPWW010000009.1 GCA946997855_01274 gene open 15939-17447 ccmA
2606 CAMPWW010000009.1 GCA946997855_01275 gene open 17456-19180 mdlB
2607 CAMPWW010000009.1 GCA946997855_01276 gene open 19181-20932
2608 CAMPWW010000009.1 GCA946997855_01277 gene open 20993-21631 tetR
2609 CAMPWW010000009.1 GCA946997855_01278 gene open 21668-21904
2610 CAMPWW010000009.1 GCA946997855_01279 gene open 22173-22508
2611 CAMPWW010000009.1 GCA946997855_01280 gene open 22605-22730
2612 CAMPWW010000009.1 GCA946997855_01281 gene open 23098-23268
2613 CAMPWW010000009.1 GCA946997855_01282 gene open 23698-24336
2614 CAMPWW010000009.1 GCA946997855_01283 gene open 24450-26351
2615 CAMPWW010000009.1 GCA946997855_01284 gene open 26652-28211
2616 CAMPWW010000009.1 GCA946997855_01285 gene open 28171-28380
2617 CAMPWW010000009.1 GCA946997855_01286 gene open 29158-29346
2618 CAMPWW010000009.1 GCA946997855_01287 gene open 29333-29509
2619 CAMPWW010000009.1 GCA946997855_01288 gene open 29745-30596
2620 CAMPWW010000009.1 GCA946997855_01289 gene open 30596-31147
2621 CAMPWW010000009.1 GCA946997855_01290 gene open 31170-32882
2622 CAMPWW010000009.1 GCA946997855_01291 gene open 32872-33705
2623 CAMPWW010000009.1 GCA946997855_01292 gene open 33840-35735
2624 CAMPWW010000009.1 GCA946997855_01293 gene open 35815-36879
2625 CAMPWW010000009.1 GCA946997855_01294 gene open 36903-37211
2626 CAMPWW010000009.1 GCA946997855_01295 gene open 37240-37692
2627 CAMPWW010000009.1 GCA946997855_01296 gene open 37772-38308
2628 CAMPWW010000009.1 GCA946997855_01297 gene open 38410-41415
2629 CAMPWW010000009.1 GCA946997855_01298 gene open 41525-44032
2630 CAMPWW010000009.1 GCA946997855_01299 gene open 44074-45603
2631 CAMPWW010000009.1 GCA946997855_01300 gene open 45908-46597
2632 CAMPWW010000009.1 GCA946997855_01301 gene open 46636-47709 potA
2633 CAMPWW010000009.1 GCA946997855_01302 gene open 47702-48523 potB
2634 CAMPWW010000009.1 GCA946997855_01303 gene open 48520-49323
2635 CAMPWW010000009.1 GCA946997855_01304 gene open 49323-50414
2636 CAMPWW010000009.1 GCA946997855_01305 gene open 50434-51426
2637 CAMPWW010000009.1 GCA946997855_01306 gene open 51440-52000
2638 CAMPWW010000009.1 GCA946997855_01307 gene open 52172-52942
2639 CAMPWW010000009.1 GCA946997855_01308 gene open 52950-53717
2640 CAMPWW010000009.1 GCA946997855_01309 gene open 53804-54562
2641 CAMPWW010000009.1 GCA946997855_01310 gene open 54587-55666
2642 CAMPWW010000009.1 GCA946997855_01311 gene open 55899-56711
2643 CAMPWW010000009.1 GCA946997855_01312 gene open 56789-58336
2644 CAMPWW010000009.1 GCA946997855_01313 gene open 58480-59133
2645 CAMPWW010000009.1 GCA946997855_01314 gene open 59191-60237 recA
2646 CAMPWW010000009.1 GCA946997855_01315 gene open 60791-62089
2647 CAMPWW010000009.1 GCA946997855_01316 gene open 62278-63873
2648 CAMPWW010000009.1 GCA946997855_01317 gene open 63945-64121 rpsU
2649 CAMPWW010000009.1 GCA946997855_01318 gene open 64327-65379
2650 CAMPWW010000009.1 GCA946997855_01319 gene open 65657-66244
2651 CAMPWW010000009.1 GCA946997855_01320 gene open 66384-69035
2652 CAMPWW010000009.1 GCA946997855_01321 gene open 69055-69210
2653 CAMPWW010000009.1 GCA946997855_01322 gene open 69248-70555
2654 CAMPWW010000009.1 GCA946997855_01323 gene open 70619-72112
2655 CAMPWW010000010.1 GCA946997855_01347 gene open 9072-9165 tracrRNA
2656 CAMPWW010000010.1 GCA946997855_01347 ncRNA open 9072-9165 Trans-activating crRNA
2657 CAMPWW010000010.1 repeat_region open 15954-16461 CRISPR array with 8 repeats of length 36%2C consensus sequence GTTTTATAACTGTGTTGTTTTGAATAGGACTAAAAC and spacer length 30
2658 CAMPWW010000010.1 GCA946997855_01324 CDS open 281-565 _na     94_aa HTH cro/C1-type domain-containing protein
2659 CAMPWW010000010.1 GCA946997855_01325 CDS open 558-920 _na     120_aa Gp49-like PF05973 family protein
2660 CAMPWW010000010.1 GCA946997855_01326 CDS open 1016-1381 _na     121_aa hypothetical protein
2661 CAMPWW010000010.1 GCA946997855_01327 CDS open 1834-1962 _na     42_aa hypothetical protein
2662 CAMPWW010000010.1 GCA946997855_01328 CDS open 2089-2760 _na     223_aa ADP-ribosyltransferase
2663 CAMPWW010000010.1 GCA946997855_01329 CDS open 2762-2950 _na     62_aa yfhD YfhD family protein
2664 CAMPWW010000010.1 GCA946997855_01330 CDS open 3057-3581 _na     174_aa RadC-like JAB domain-containing protein
2665 CAMPWW010000010.1 GCA946997855_01331 CDS open 3568-3762 _na     64_aa hypothetical protein
2666 CAMPWW010000010.1 GCA946997855_01332 CDS open 3835-3999 _na     54_aa hypothetical protein
2667 CAMPWW010000010.1 GCA946997855_01333 CDS open 4061-4627 _na     188_aa hypothetical protein
2668 CAMPWW010000010.1 GCA946997855_01334 CDS open 4633-4833 _na     66_aa hypothetical protein
2669 CAMPWW010000010.1 GCA946997855_01335 CDS open 4852-5046 _na     64_aa hypothetical protein
2670 CAMPWW010000010.1 GCA946997855_01336 CDS open 5048-5239 _na     63_aa hypothetical protein
2671 CAMPWW010000010.1 GCA946997855_01337 CDS open 5324-5509 _na     61_aa hypothetical protein
2672 CAMPWW010000010.1 GCA946997855_01338 CDS open 5643-5939 _na     98_aa yopX YopX protein domain-containing protein
2673 CAMPWW010000010.1 GCA946997855_01339 CDS open 5959-6135 _na     58_aa hypothetical protein
2674 CAMPWW010000010.1 GCA946997855_01340 CDS open 6152-6337 _na     61_aa Phage protein
2675 CAMPWW010000010.1 GCA946997855_01341 CDS open 6474-6665 _na     63_aa hypothetical protein
2676 CAMPWW010000010.1 GCA946997855_01342 CDS open 7055-7411 _na     118_aa hypothetical protein
2677 CAMPWW010000010.1 GCA946997855_01343 CDS open 7429-7572 _na     47_aa hypothetical protein
2678 CAMPWW010000010.1 GCA946997855_01344 CDS open 7559-7966 _na     135_aa hypothetical protein
2679 CAMPWW010000010.1 GCA946997855_01345 CDS open 8427-8540 _na     37_aa hypothetical protein
2680 CAMPWW010000010.1 GCA946997855_01346 CDS open 8482-8631 _na     49_aa hypothetical protein
2681 CAMPWW010000010.1 GCA946997855_01348 CDS open 9226-13266 _na     1346_aa CRISPR-associated endonuclease Cas9
2682 CAMPWW010000010.1 GCA946997855_01349 CDS open 13267-14133 _na     288_aa CRISPR-associated endonuclease Cas1
2683 CAMPWW010000010.1 GCA946997855_01350 CDS open 14145-14465 _na     106_aa CRISPR-associated endoribonuclease Cas2
2684 CAMPWW010000010.1 GCA946997855_01351 CDS open 14458-15123 _na     221_aa hypothetical protein
2685 CAMPWW010000010.1 GCA946997855_01352 CDS open 17182-17739 _na     185_aa Nicotinamidase
2686 CAMPWW010000010.1 GCA946997855_01353 CDS open 18073-19569 _na     498_aa Flagellin
2687 CAMPWW010000010.1 GCA946997855_01354 CDS open 19741-20394 _na     217_aa Glutamate racemase
2688 CAMPWW010000010.1 GCA946997855_01355 CDS open 20484-22289 _na     601_aa hypothetical protein
2689 CAMPWW010000010.1 GCA946997855_01356 CDS open 22679-23311 _na     210_aa xrtG Exosortase family protein XrtG
2690 CAMPWW010000010.1 GCA946997855_01357 CDS open 23308-24684 _na     458_aa Glycosyltransferase 2-like domain-containing protein
2691 CAMPWW010000010.1 GCA946997855_01358 CDS open 24750-26051 _na     433_aa hypothetical protein
2692 CAMPWW010000010.1 GCA946997855_01359 CDS open 26044-27024 _na     326_aa hypothetical protein
2693 CAMPWW010000010.1 GCA946997855_01360 CDS open 27024-29591 _na     855_aa hypothetical protein
2694 CAMPWW010000010.1 GCA946997855_01361 CDS open 29681-30508 _na     275_aa hypothetical protein
2695 CAMPWW010000010.1 GCA946997855_01362 CDS open 30707-31318 _na     203_aa hypothetical protein
2696 CAMPWW010000010.1 GCA946997855_01363 CDS open 31390-32217 _na     275_aa Transketolase 1
2697 CAMPWW010000010.1 GCA946997855_01364 CDS open 32217-33149 _na     310_aa 1-deoxy-D-xylulose-5-phosphate synthase
2698 CAMPWW010000010.1 GCA946997855_01366 CDS open 33490-34296 _na     268_aa hypothetical protein
2699 CAMPWW010000010.1 GCA946997855_01367 CDS open 34407-34628 _na     73_aa hypothetical protein
2700 CAMPWW010000010.1 GCA946997855_01368 CDS open 34591-37014 _na     807_aa hypothetical protein
2701 CAMPWW010000010.1 GCA946997855_01369 CDS open 37146-38783 _na     545_aa hypothetical protein
2702 CAMPWW010000010.1 GCA946997855_01370 CDS open 38931-39284 _na     117_aa hypothetical protein
2703 CAMPWW010000010.1 GCA946997855_01371 CDS open 39322-39756 _na     144_aa nusB Transcription antitermination protein NusB
2704 CAMPWW010000010.1 GCA946997855_01372 CDS open 39743-41032 _na     429_aa hypothetical protein
2705 CAMPWW010000010.1 GCA946997855_01373 CDS open 41125-41403 _na     92_aa hypothetical protein
2706 CAMPWW010000010.1 GCA946997855_01374 CDS open 41406-42332 _na     308_aa Octaprenyl-diphosphate synthase / Dimethylallyltransferase / Geranyltranstransferase (Farnesyldiphosphate synthase) / Geranylgeranyl pyrophosphate synthetase
2707 CAMPWW010000010.1 GCA946997855_01375 CDS open 42339-44210 _na     623_aa 1-deoxy-D-xylulose-5-phosphate synthase
2708 CAMPWW010000010.1 GCA946997855_01376 CDS open 44288-45091 _na     267_aa RNA-binding S4 domain-containing protein
2709 CAMPWW010000010.1 GCA946997855_01377 CDS open 45088-45987 _na     299_aa hypothetical protein
2710 CAMPWW010000010.1 GCA946997855_01378 CDS open 46048-47721 _na     557_aa hypothetical protein
2711 CAMPWW010000010.1 GCA946997855_01380 CDS open 47907-48257 _na     116_aa hypothetical protein
2712 CAMPWW010000010.1 GCA946997855_01381 CDS open 48305-48973 _na     222_aa queH Epoxyqueuosine reductase QueH
2713 CAMPWW010000010.1 GCA946997855_01382 CDS open 49032-50399 _na     455_aa hypothetical protein
2714 CAMPWW010000010.1 GCA946997855_01383 CDS open 50399-52378 _na     659_aa DNA topoisomerase
2715 CAMPWW010000010.1 GCA946997855_01384 CDS open 52403-53077 _na     224_aa UDP-N-acetylglucosamine pyrophosphorylase
2716 CAMPWW010000010.1 GCA946997855_01385 CDS open 53087-53704 _na     205_aa Cytidylate kinase
2717 CAMPWW010000010.1 GCA946997855_01387 CDS open 54037-55272 _na     411_aa hypothetical protein
2718 CAMPWW010000010.1 GCA946997855_01388 CDS open 55426-56112 _na     228_aa hypothetical protein
2719 CAMPWW010000010.1 GCA946997855_01389 CDS open 56117-56359 _na     80_aa hypothetical protein
2720 CAMPWW010000010.1 GCA946997855_01390 CDS open 56582-57220 _na     212_aa DUF1653 domain-containing protein
2721 CAMPWW010000010.1 GCA946997855_01391 CDS open 57234-57722 _na     162_aa CYTH domain-containing protein
2722 CAMPWW010000010.1 GCA946997855_01392 CDS open 57877-58425 _na     182_aa hypothetical protein
2723 CAMPWW010000010.1 GCA946997855_01393 CDS open 58524-59894 _na     456_aa Trigger factor
2724 CAMPWW010000010.1 GCA946997855_01394 CDS open 59979-60590 _na     203_aa ATP-dependent Clp protease proteolytic subunit 1
2725 CAMPWW010000010.1 GCA946997855_01395 CDS open 60590-61882 _na     430_aa clpX ATP-dependent Clp protease ATP-binding subunit ClpX
2726 CAMPWW010000010.1 GCA946997855_01396 CDS open 61960-62565 _na     201_aa engB putative GTP-binding protein EngB
2727 CAMPWW010000010.1 GCA946997855_01397 CDS open 62611-63933 _na     440_aa Hemolysin
2728 CAMPWW010000010.1 GCA946997855_01398 CDS open 64071-64388 _na     105_aa hypothetical protein
2729 CAMPWW010000010.1 GCA946997855_01399 CDS open 64809-67058 _na     749_aa Anaerobic ribonucleoside-triphosphate reductase
2730 CAMPWW010000010.1 GCA946997855_01400 CDS open 67078-67605 _na     175_aa Anaerobic ribonucleoside-triphosphate reductase-activating protein
2731 CAMPWW010000010.1 GCA946997855_01401 CDS open 67635-68621 _na     328_aa Phosphate acetyltransferase
2732 CAMPWW010000010.1 GCA946997855_01402 CDS open 68572-68703 _na     43_aa hypothetical protein
2733 CAMPWW010000010.1 GCA946997855_01403 CDS open 68725-69327 _na     200_aa NADPH-dependent FMN reductase
2734 CAMPWW010000010.1 GCA946997855_01324 gene open 281-565
2735 CAMPWW010000010.1 GCA946997855_01325 gene open 558-920
2736 CAMPWW010000010.1 GCA946997855_01326 gene open 1016-1381
2737 CAMPWW010000010.1 GCA946997855_01327 gene open 1834-1962
2738 CAMPWW010000010.1 GCA946997855_01328 gene open 2089-2760
2739 CAMPWW010000010.1 GCA946997855_01329 gene open 2762-2950 yfhD
2740 CAMPWW010000010.1 GCA946997855_01330 gene open 3057-3581
2741 CAMPWW010000010.1 GCA946997855_01331 gene open 3568-3762
2742 CAMPWW010000010.1 GCA946997855_01332 gene open 3835-3999
2743 CAMPWW010000010.1 GCA946997855_01333 gene open 4061-4627
2744 CAMPWW010000010.1 GCA946997855_01334 gene open 4633-4833
2745 CAMPWW010000010.1 GCA946997855_01335 gene open 4852-5046
2746 CAMPWW010000010.1 GCA946997855_01336 gene open 5048-5239
2747 CAMPWW010000010.1 GCA946997855_01337 gene open 5324-5509
2748 CAMPWW010000010.1 GCA946997855_01338 gene open 5643-5939 yopX
2749 CAMPWW010000010.1 GCA946997855_01339 gene open 5959-6135
2750 CAMPWW010000010.1 GCA946997855_01340 gene open 6152-6337
2751 CAMPWW010000010.1 GCA946997855_01341 gene open 6474-6665
2752 CAMPWW010000010.1 GCA946997855_01342 gene open 7055-7411
2753 CAMPWW010000010.1 GCA946997855_01343 gene open 7429-7572
2754 CAMPWW010000010.1 GCA946997855_01344 gene open 7559-7966
2755 CAMPWW010000010.1 GCA946997855_01345 gene open 8427-8540
2756 CAMPWW010000010.1 GCA946997855_01346 gene open 8482-8631
2757 CAMPWW010000010.1 GCA946997855_01348 gene open 9226-13266
2758 CAMPWW010000010.1 GCA946997855_01349 gene open 13267-14133
2759 CAMPWW010000010.1 GCA946997855_01350 gene open 14145-14465
2760 CAMPWW010000010.1 GCA946997855_01351 gene open 14458-15123
2761 CAMPWW010000010.1 GCA946997855_01352 gene open 17182-17739
2762 CAMPWW010000010.1 GCA946997855_01353 gene open 18073-19569
2763 CAMPWW010000010.1 GCA946997855_01354 gene open 19741-20394
2764 CAMPWW010000010.1 GCA946997855_01355 gene open 20484-22289
2765 CAMPWW010000010.1 GCA946997855_01356 gene open 22679-23311 xrtG
2766 CAMPWW010000010.1 GCA946997855_01357 gene open 23308-24684
2767 CAMPWW010000010.1 GCA946997855_01358 gene open 24750-26051
2768 CAMPWW010000010.1 GCA946997855_01359 gene open 26044-27024
2769 CAMPWW010000010.1 GCA946997855_01360 gene open 27024-29591
2770 CAMPWW010000010.1 GCA946997855_01361 gene open 29681-30508
2771 CAMPWW010000010.1 GCA946997855_01362 gene open 30707-31318
2772 CAMPWW010000010.1 GCA946997855_01363 gene open 31390-32217
2773 CAMPWW010000010.1 GCA946997855_01364 gene open 32217-33149
2774 CAMPWW010000010.1 GCA946997855_01366 gene open 33490-34296
2775 CAMPWW010000010.1 GCA946997855_01367 gene open 34407-34628
2776 CAMPWW010000010.1 GCA946997855_01368 gene open 34591-37014
2777 CAMPWW010000010.1 GCA946997855_01369 gene open 37146-38783
2778 CAMPWW010000010.1 GCA946997855_01370 gene open 38931-39284
2779 CAMPWW010000010.1 GCA946997855_01371 gene open 39322-39756 nusB
2780 CAMPWW010000010.1 GCA946997855_01372 gene open 39743-41032
2781 CAMPWW010000010.1 GCA946997855_01373 gene open 41125-41403
2782 CAMPWW010000010.1 GCA946997855_01374 gene open 41406-42332
2783 CAMPWW010000010.1 GCA946997855_01375 gene open 42339-44210
2784 CAMPWW010000010.1 GCA946997855_01376 gene open 44288-45091
2785 CAMPWW010000010.1 GCA946997855_01377 gene open 45088-45987
2786 CAMPWW010000010.1 GCA946997855_01378 gene open 46048-47721
2787 CAMPWW010000010.1 GCA946997855_01380 gene open 47907-48257
2788 CAMPWW010000010.1 GCA946997855_01381 gene open 48305-48973 queH
2789 CAMPWW010000010.1 GCA946997855_01382 gene open 49032-50399
2790 CAMPWW010000010.1 GCA946997855_01383 gene open 50399-52378
2791 CAMPWW010000010.1 GCA946997855_01384 gene open 52403-53077
2792 CAMPWW010000010.1 GCA946997855_01385 gene open 53087-53704
2793 CAMPWW010000010.1 GCA946997855_01387 gene open 54037-55272
2794 CAMPWW010000010.1 GCA946997855_01388 gene open 55426-56112
2795 CAMPWW010000010.1 GCA946997855_01389 gene open 56117-56359
2796 CAMPWW010000010.1 GCA946997855_01390 gene open 56582-57220
2797 CAMPWW010000010.1 GCA946997855_01391 gene open 57234-57722
2798 CAMPWW010000010.1 GCA946997855_01392 gene open 57877-58425
2799 CAMPWW010000010.1 GCA946997855_01393 gene open 58524-59894
2800 CAMPWW010000010.1 GCA946997855_01394 gene open 59979-60590
2801 CAMPWW010000010.1 GCA946997855_01395 gene open 60590-61882 clpX
2802 CAMPWW010000010.1 GCA946997855_01396 gene open 61960-62565 engB
2803 CAMPWW010000010.1 GCA946997855_01397 gene open 62611-63933
2804 CAMPWW010000010.1 GCA946997855_01398 gene open 64071-64388
2805 CAMPWW010000010.1 GCA946997855_01399 gene open 64809-67058
2806 CAMPWW010000010.1 GCA946997855_01400 gene open 67078-67605
2807 CAMPWW010000010.1 GCA946997855_01401 gene open 67635-68621
2808 CAMPWW010000010.1 GCA946997855_01402 gene open 68572-68703
2809 CAMPWW010000010.1 GCA946997855_01403 gene open 68725-69327
2810 CAMPWW010000010.1 GCA946997855_01365 gene open 33178-33250 trnT
2811 CAMPWW010000010.1 GCA946997855_01379 gene open 47737-47809 trnT
2812 CAMPWW010000010.1 GCA946997855_01386 gene open 53804-53886 trnL
2813 CAMPWW010000010.1 GCA946997855_01365 tRNA open 33178-33250 trnT tRNA-Thr(ggt)
2814 CAMPWW010000010.1 GCA946997855_01379 tRNA open 47737-47809 trnT tRNA-Thr(cgt)
2815 CAMPWW010000010.1 GCA946997855_01386 tRNA open 53804-53886 trnL tRNA-Leu(tag)
2816 CAMPWW010000011.1 GCA946997855_01424 gene open 20983-21326 ssrA
2817 CAMPWW010000011.1 GCA946997855_01424 tmRNA open 20983-21326 ssrA transfer-messenger RNA%2C SsrA
2818 CAMPWW010000011.1 regulatory_region open 21685-21861 M-box riboswitch aptamer (ykoK leader)
2819 CAMPWW010000011.1 GCA946997855_01404 CDS open 92-1777 _na     561_aa flgE Flagellar hook protein FlgE
2820 CAMPWW010000011.1 GCA946997855_01405 CDS open 1859-2266 _na     135_aa Flagellar operon protein
2821 CAMPWW010000011.1 GCA946997855_01406 CDS open 2344-3096 _na     250_aa hypothetical protein
2822 CAMPWW010000011.1 GCA946997855_01407 CDS open 3157-4770 _na     537_aa hypothetical protein
2823 CAMPWW010000011.1 GCA946997855_01408 CDS open 4796-5671 _na     291_aa hypothetical protein
2824 CAMPWW010000011.1 GCA946997855_01409 CDS open 5716-6159 _na     147_aa fliJ Flagellar FliJ protein
2825 CAMPWW010000011.1 GCA946997855_01410 CDS open 6189-7514 _na     441_aa Type 3 secretion system ATPase
2826 CAMPWW010000011.1 GCA946997855_01411 CDS open 7532-8401 _na     289_aa hypothetical protein
2827 CAMPWW010000011.1 GCA946997855_01412 CDS open 8394-9401 _na     335_aa fliG Flagellar motor switch protein FliG
2828 CAMPWW010000011.1 GCA946997855_01413 CDS open 9405-11021 _na     538_aa fliF Flagellar M-ring protein FliF
2829 CAMPWW010000011.1 GCA946997855_01414 CDS open 11049-11378 _na     109_aa fliE Flagellar hook-basal body complex protein FliE
2830 CAMPWW010000011.1 GCA946997855_01415 CDS open 11427-11876 _na     149_aa flgC Flagellar basal-body rod protein FlgC
2831 CAMPWW010000011.1 GCA946997855_01416 CDS open 11896-12291 _na     131_aa flgB Flagellar basal body rod protein FlgB
2832 CAMPWW010000011.1 GCA946997855_01417 CDS open 12517-13299 _na     260_aa codY Global transcriptional regulator CodY
2833 CAMPWW010000011.1 GCA946997855_01418 CDS open 13369-15453 _na     694_aa DNA topoisomerase 1
2834 CAMPWW010000011.1 GCA946997855_01419 CDS open 15711-17285 _na     524_aa hypothetical protein
2835 CAMPWW010000011.1 GCA946997855_01420 CDS open 17381-18526 _na     381_aa hypothetical protein
2836 CAMPWW010000011.1 GCA946997855_01421 CDS open 18633-19667 _na     344_aa Tryptophan--tRNA ligase
2837 CAMPWW010000011.1 GCA946997855_01422 CDS open 19697-20248 _na     183_aa Catalase
2838 CAMPWW010000011.1 GCA946997855_01423 CDS open 20276-20740 _na     154_aa Nucleoside 2-deoxyribosyltransferase
2839 CAMPWW010000011.1 GCA946997855_01425 CDS open 21448-21609 _na     53_aa hypothetical protein
2840 CAMPWW010000011.1 GCA946997855_01426 CDS open 21946-24633 _na     895_aa mgtA magnesium-translocating P-type ATPase
2841 CAMPWW010000011.1 GCA946997855_01427 CDS open 24767-25528 _na     253_aa Uridine phosphorylase
2842 CAMPWW010000011.1 GCA946997855_01428 CDS open 25869-26342 _na     157_aa SsrA-binding protein
2843 CAMPWW010000011.1 GCA946997855_01429 CDS open 26407-28494 _na     695_aa Ribonuclease R
2844 CAMPWW010000011.1 GCA946997855_01430 CDS open 28566-28820 _na     84_aa secG Protein-export membrane protein SecG
2845 CAMPWW010000011.1 GCA946997855_01431 CDS open 28930-29799 _na     289_aa pyridoxal kinase
2846 CAMPWW010000011.1 GCA946997855_01432 CDS open 29980-30687 _na     235_aa D/L-lactic acid transporter
2847 CAMPWW010000011.1 GCA946997855_01433 CDS open 31126-33576 _na     816_aa hypothetical protein
2848 CAMPWW010000011.1 GCA946997855_01434 CDS open 34108-34233 _na     41_aa hypothetical protein
2849 CAMPWW010000011.1 GCA946997855_01435 CDS open 34261-35733 _na     490_aa Dipeptidase
2850 CAMPWW010000011.1 GCA946997855_01436 CDS open 36007-36438 _na     143_aa hypothetical protein
2851 CAMPWW010000011.1 GCA946997855_01437 CDS open 36596-38062 _na     488_aa Adenylosuccinate lyase
2852 CAMPWW010000011.1 GCA946997855_01438 CDS open 38106-39245 _na     379_aa hypothetical protein
2853 CAMPWW010000011.1 GCA946997855_01439 CDS open 39320-40066 _na     248_aa Triosephosphate isomerase
2854 CAMPWW010000011.1 GCA946997855_01440 CDS open 40087-41358 _na     423_aa Phosphoglycerate kinase
2855 CAMPWW010000011.1 GCA946997855_01441 CDS open 41380-42399 _na     339_aa Glyceraldehyde-3-phosphate dehydrogenase
2856 CAMPWW010000011.1 GCA946997855_01442 CDS open 42536-43684 _na     382_aa hypothetical protein
2857 CAMPWW010000011.1 GCA946997855_01443 CDS open 43993-44733 _na     246_aa Glucosamine-6-phosphate deaminase
2858 CAMPWW010000011.1 GCA946997855_01444 CDS open 44952-46382 _na     476_aa Amino acid permease
2859 CAMPWW010000011.1 GCA946997855_01445 CDS open 46448-47029 _na     193_aa hypothetical protein
2860 CAMPWW010000011.1 GCA946997855_01446 CDS open 47041-47790 _na     249_aa trmH TrmH family tRNA/rRNA methyltransferase
2861 CAMPWW010000011.1 GCA946997855_01447 CDS open 47780-48229 _na     149_aa Mini-ribonuclease 3
2862 CAMPWW010000011.1 GCA946997855_01448 CDS open 48214-49632 _na     472_aa Cysteine--tRNA ligase
2863 CAMPWW010000011.1 GCA946997855_01449 CDS open 49715-50257 _na     180_aa 2-C-methyl-D-erythritol 2%2C4-cyclodiphosphate synthase
2864 CAMPWW010000011.1 GCA946997855_01452 CDS open 50807-51613 _na     268_aa hypothetical protein
2865 CAMPWW010000011.1 GCA946997855_01404 gene open 92-1777 flgE
2866 CAMPWW010000011.1 GCA946997855_01405 gene open 1859-2266
2867 CAMPWW010000011.1 GCA946997855_01406 gene open 2344-3096
2868 CAMPWW010000011.1 GCA946997855_01407 gene open 3157-4770
2869 CAMPWW010000011.1 GCA946997855_01408 gene open 4796-5671
2870 CAMPWW010000011.1 GCA946997855_01409 gene open 5716-6159 fliJ
2871 CAMPWW010000011.1 GCA946997855_01410 gene open 6189-7514
2872 CAMPWW010000011.1 GCA946997855_01411 gene open 7532-8401
2873 CAMPWW010000011.1 GCA946997855_01412 gene open 8394-9401 fliG
2874 CAMPWW010000011.1 GCA946997855_01413 gene open 9405-11021 fliF
2875 CAMPWW010000011.1 GCA946997855_01414 gene open 11049-11378 fliE
2876 CAMPWW010000011.1 GCA946997855_01415 gene open 11427-11876 flgC
2877 CAMPWW010000011.1 GCA946997855_01416 gene open 11896-12291 flgB
2878 CAMPWW010000011.1 GCA946997855_01417 gene open 12517-13299 codY
2879 CAMPWW010000011.1 GCA946997855_01418 gene open 13369-15453
2880 CAMPWW010000011.1 GCA946997855_01419 gene open 15711-17285
2881 CAMPWW010000011.1 GCA946997855_01420 gene open 17381-18526
2882 CAMPWW010000011.1 GCA946997855_01421 gene open 18633-19667
2883 CAMPWW010000011.1 GCA946997855_01422 gene open 19697-20248
2884 CAMPWW010000011.1 GCA946997855_01423 gene open 20276-20740
2885 CAMPWW010000011.1 GCA946997855_01425 gene open 21448-21609
2886 CAMPWW010000011.1 GCA946997855_01426 gene open 21946-24633 mgtA
2887 CAMPWW010000011.1 GCA946997855_01427 gene open 24767-25528
2888 CAMPWW010000011.1 GCA946997855_01428 gene open 25869-26342
2889 CAMPWW010000011.1 GCA946997855_01429 gene open 26407-28494
2890 CAMPWW010000011.1 GCA946997855_01430 gene open 28566-28820 secG
2891 CAMPWW010000011.1 GCA946997855_01431 gene open 28930-29799
2892 CAMPWW010000011.1 GCA946997855_01432 gene open 29980-30687
2893 CAMPWW010000011.1 GCA946997855_01433 gene open 31126-33576
2894 CAMPWW010000011.1 GCA946997855_01434 gene open 34108-34233
2895 CAMPWW010000011.1 GCA946997855_01435 gene open 34261-35733
2896 CAMPWW010000011.1 GCA946997855_01436 gene open 36007-36438
2897 CAMPWW010000011.1 GCA946997855_01437 gene open 36596-38062
2898 CAMPWW010000011.1 GCA946997855_01438 gene open 38106-39245
2899 CAMPWW010000011.1 GCA946997855_01439 gene open 39320-40066
2900 CAMPWW010000011.1 GCA946997855_01440 gene open 40087-41358
2901 CAMPWW010000011.1 GCA946997855_01441 gene open 41380-42399
2902 CAMPWW010000011.1 GCA946997855_01442 gene open 42536-43684
2903 CAMPWW010000011.1 GCA946997855_01443 gene open 43993-44733
2904 CAMPWW010000011.1 GCA946997855_01444 gene open 44952-46382
2905 CAMPWW010000011.1 GCA946997855_01445 gene open 46448-47029
2906 CAMPWW010000011.1 GCA946997855_01446 gene open 47041-47790 trmH
2907 CAMPWW010000011.1 GCA946997855_01447 gene open 47780-48229
2908 CAMPWW010000011.1 GCA946997855_01448 gene open 48214-49632
2909 CAMPWW010000011.1 GCA946997855_01449 gene open 49715-50257
2910 CAMPWW010000011.1 GCA946997855_01452 gene open 50807-51613
2911 CAMPWW010000011.1 GCA946997855_01450 gene open 50567-50640 trnM
2912 CAMPWW010000011.1 GCA946997855_01451 gene open 50649-50721 trnV
2913 CAMPWW010000011.1 GCA946997855_01453 gene open 51840-51912 trnW
2914 CAMPWW010000011.1 GCA946997855_01450 tRNA open 50567-50640 trnM tRNA-Met(cat)
2915 CAMPWW010000011.1 GCA946997855_01451 tRNA open 50649-50721 trnV tRNA-Val(tac)
2916 CAMPWW010000011.1 GCA946997855_01453 tRNA open 51840-51912 trnW tRNA-Trp(cca)
2917 CAMPWW010000012.1 GCA946997855_01454 gene open 53-185 SpR18_sRNA
2918 CAMPWW010000012.1 GCA946997855_01468 gene open 9504-9636 SpR18_sRNA
2919 CAMPWW010000012.1 GCA946997855_01474 gene open 17827-17957 SpR18_sRNA
2920 CAMPWW010000012.1 GCA946997855_01454 ncRNA open 53-185 Streptococcus sRNA SpR18
2921 CAMPWW010000012.1 GCA946997855_01468 ncRNA open 9504-9636 Streptococcus sRNA SpR18
2922 CAMPWW010000012.1 GCA946997855_01474 ncRNA open 17827-17957 Streptococcus sRNA SpR18
2923 CAMPWW010000012.1 GCA946997855_01455 CDS open 377-694 _na     105_aa hypothetical protein
2924 CAMPWW010000012.1 GCA946997855_01456 CDS open 718-1497 _na     259_aa site-specific DNA-methyltransferase (adenine-specific)
2925 CAMPWW010000012.1 GCA946997855_01457 CDS open 1513-2196 _na     227_aa ImmA/IrrE family metallo-endopeptidase
2926 CAMPWW010000012.1 GCA946997855_01458 CDS open 2193-2573 _na     126_aa helix-turn-helix domain-containing protein
2927 CAMPWW010000012.1 GCA946997855_01459 CDS open 2710-2985 _na     91_aa hypothetical protein
2928 CAMPWW010000012.1 GCA946997855_01460 CDS open 2979-3167 _na     62_aa hypothetical protein
2929 CAMPWW010000012.1 GCA946997855_01461 CDS open 3277-3378 _na     33_aa RNA helicase
2930 CAMPWW010000012.1 GCA946997855_01462 CDS open 3619-5706 _na     695_aa ATP-binding protein
2931 CAMPWW010000012.1 GCA946997855_01463 CDS open 5716-6966 _na     416_aa DNA methylase N-4/N-6 domain-containing protein
2932 CAMPWW010000012.1 GCA946997855_01464 CDS open 6975-7931 _na     318_aa Restriction endonuclease HaeIII
2933 CAMPWW010000012.1 GCA946997855_01465 CDS open 7941-8963 _na     340_aa Cytosine-specific methyltransferase
2934 CAMPWW010000012.1 GCA946997855_01466 CDS open 8950-9186 _na     78_aa HTH cro/C1-type domain-containing protein
2935 CAMPWW010000012.1 GCA946997855_01467 CDS open 9283-9483 _na     66_aa hypothetical protein
2936 CAMPWW010000012.1 GCA946997855_01469 CDS open 9662-9841 _na     59_aa hypothetical protein
2937 CAMPWW010000012.1 GCA946997855_01470 CDS open 9808-12342 _na     844_aa DEAD/DEAH box helicase
2938 CAMPWW010000012.1 GCA946997855_01471 CDS open 12362-13276 _na     304_aa DUF1837 domain-containing protein
2939 CAMPWW010000012.1 GCA946997855_01472 CDS open 13312-15294 _na     660_aa alwI AlwI restriction endonuclease
2940 CAMPWW010000012.1 GCA946997855_01473 CDS open 15295-17505 _na     736_aa Site-specific DNA-methyltransferase (adenine-specific)
2941 CAMPWW010000012.1 GCA946997855_01475 CDS open 17985-19547 _na     520_aa GMP synthase [glutamine-hydrolyzing]
2942 CAMPWW010000012.1 GCA946997855_01476 CDS open 19837-20352 _na     171_aa hypothetical protein
2943 CAMPWW010000012.1 GCA946997855_01477 CDS open 20472-21863 _na     463_aa Uracil-xanthine permease
2944 CAMPWW010000012.1 GCA946997855_01478 CDS open 22064-22702 _na     212_aa hypothetical protein
2945 CAMPWW010000012.1 GCA946997855_01479 CDS open 22794-23474 _na     226_aa hypothetical protein
2946 CAMPWW010000012.1 GCA946997855_01480 CDS open 23677-24273 _na     198_aa Cytidylate kinase
2947 CAMPWW010000012.1 GCA946997855_01481 CDS open 24320-25276 _na     318_aa licD1 Lipopolysaccharide cholinephosphotransferase LicD1
2948 CAMPWW010000012.1 GCA946997855_01482 CDS open 25344-26891 _na     515_aa Betaine/carnitine/choline transporter
2949 CAMPWW010000012.1 GCA946997855_01483 CDS open 26881-27783 _na     300_aa MobA-like NTP transferase domain-containing protein
2950 CAMPWW010000012.1 GCA946997855_01484 CDS open 27877-29685 _na     602_aa glmU Bifunctional protein GlmU
2951 CAMPWW010000012.1 GCA946997855_01485 CDS open 30061-31422 _na     453_aa hypothetical protein
2952 CAMPWW010000012.1 GCA946997855_01486 CDS open 31432-32703 _na     423_aa Peptidase C14
2953 CAMPWW010000012.1 GCA946997855_01487 CDS open 32832-33971 _na     379_aa hypothetical protein
2954 CAMPWW010000012.1 GCA946997855_01488 CDS open 34034-35011 _na     325_aa BD-FAE-like domain-containing protein
2955 CAMPWW010000012.1 GCA946997855_01489 CDS open 35054-35323 _na     89_aa Fatty acid kinase subunit A-like middle domain-containing protein
2956 CAMPWW010000012.1 GCA946997855_01490 CDS open 35336-36928 _na     530_aa hypothetical protein
2957 CAMPWW010000012.1 GCA946997855_01491 CDS open 37124-38014 _na     296_aa hypothetical protein
2958 CAMPWW010000012.1 GCA946997855_01455 gene open 377-694
2959 CAMPWW010000012.1 GCA946997855_01456 gene open 718-1497
2960 CAMPWW010000012.1 GCA946997855_01457 gene open 1513-2196
2961 CAMPWW010000012.1 GCA946997855_01458 gene open 2193-2573
2962 CAMPWW010000012.1 GCA946997855_01459 gene open 2710-2985
2963 CAMPWW010000012.1 GCA946997855_01460 gene open 2979-3167
2964 CAMPWW010000012.1 GCA946997855_01461 gene open 3277-3378
2965 CAMPWW010000012.1 GCA946997855_01462 gene open 3619-5706
2966 CAMPWW010000012.1 GCA946997855_01463 gene open 5716-6966
2967 CAMPWW010000012.1 GCA946997855_01464 gene open 6975-7931
2968 CAMPWW010000012.1 GCA946997855_01465 gene open 7941-8963
2969 CAMPWW010000012.1 GCA946997855_01466 gene open 8950-9186
2970 CAMPWW010000012.1 GCA946997855_01467 gene open 9283-9483
2971 CAMPWW010000012.1 GCA946997855_01469 gene open 9662-9841
2972 CAMPWW010000012.1 GCA946997855_01470 gene open 9808-12342
2973 CAMPWW010000012.1 GCA946997855_01471 gene open 12362-13276
2974 CAMPWW010000012.1 GCA946997855_01472 gene open 13312-15294 alwI
2975 CAMPWW010000012.1 GCA946997855_01473 gene open 15295-17505
2976 CAMPWW010000012.1 GCA946997855_01475 gene open 17985-19547
2977 CAMPWW010000012.1 GCA946997855_01476 gene open 19837-20352
2978 CAMPWW010000012.1 GCA946997855_01477 gene open 20472-21863
2979 CAMPWW010000012.1 GCA946997855_01478 gene open 22064-22702
2980 CAMPWW010000012.1 GCA946997855_01479 gene open 22794-23474
2981 CAMPWW010000012.1 GCA946997855_01480 gene open 23677-24273
2982 CAMPWW010000012.1 GCA946997855_01481 gene open 24320-25276 licD1
2983 CAMPWW010000012.1 GCA946997855_01482 gene open 25344-26891
2984 CAMPWW010000012.1 GCA946997855_01483 gene open 26881-27783
2985 CAMPWW010000012.1 GCA946997855_01484 gene open 27877-29685 glmU
2986 CAMPWW010000012.1 GCA946997855_01485 gene open 30061-31422
2987 CAMPWW010000012.1 GCA946997855_01486 gene open 31432-32703
2988 CAMPWW010000012.1 GCA946997855_01487 gene open 32832-33971
2989 CAMPWW010000012.1 GCA946997855_01488 gene open 34034-35011
2990 CAMPWW010000012.1 GCA946997855_01489 gene open 35054-35323
2991 CAMPWW010000012.1 GCA946997855_01490 gene open 35336-36928
2992 CAMPWW010000012.1 GCA946997855_01491 gene open 37124-38014
2993 CAMPWW010000013.1 regulatory_region open 19738-19868 Ribosomal protein L10 leader
2994 CAMPWW010000013.1 GCA946997855_01492 CDS open 546-2384 _na     612_aa spoIVCA Recombinase domain-containing protein
2995 CAMPWW010000013.1 GCA946997855_01493 CDS open 2543-3370 _na     275_aa malA Maltodextrose utilization protein MalA
2996 CAMPWW010000013.1 GCA946997855_01494 CDS open 3439-4305 _na     288_aa mdxG Maltodextrin transport system permease protein MdxG
2997 CAMPWW010000013.1 GCA946997855_01495 CDS open 4302-5612 _na     436_aa mdxF Maltodextrin transport system permease protein MdxF
2998 CAMPWW010000013.1 GCA946997855_01496 CDS open 5680-7386 _na     568_aa Cyclomaltodextrinase
2999 CAMPWW010000013.1 GCA946997855_01497 CDS open 7652-8992 _na     446_aa Maltooligosaccharide ABC transporter solute-binding lipoprotein
3000 CAMPWW010000013.1 GCA946997855_01498 CDS open 9192-10454 _na     420_aa Maltooligosaccharide ABC transporter solute-binding lipoprotein