HOMD Banner
Taxonomy: V4.3   |  16S rRNA RefSeq: V16.03   |  Genomic RefSeq: V11.03   |  Viruses: V1.2

BAKTAGenome Explorer: Haemophilus parainfluenzae (GCA_946998075.1)

Select a Genome:
BAKTA Annotations for GCA_946998075.1
Genome Selected: Haemophilus parainfluenzae
ContigsBases CDSrRNA tmRNAtRNA
55 2109283 2113 0 1 37
[Table]   [AA Fasta]      [Browser]   [Text]   [Excel]  
Search & Sort all 4348 Records
Search These Records: Clear
Sort Column:   Molecule   PID   NA   AA   Gene  Gene Product  Reverse
Annotation Table [page:6]    |    Number of Records Found: 4348 [9 Pages]    |    Previous Page <==> Next Page    |    Jump to Page: [ 1  2  3  4  5  6  7  8  9  ]
Notes:   1- Column headers only sort the current page. 2- Select [NA] or [AA] links to show sequences.
Region Protein-ID Type Genome
Viewer		 Range
(bp)		 Show Sequences
(length) NA / AA		 BAKTA
Gene		 BAKTA
GeneProduct
2501 CAMPWI010000014.1 GCA946998075_01269 CDS open 49443-50402 _na     319_aa Cold shock domain-containing protein
2502 CAMPWI010000014.1 GCA946998075_01270 CDS open 50641-51270 _na     209_aa DUF417 domain-containing protein
2503 CAMPWI010000014.1 GCA946998075_01271 CDS open 51457-55350 _na     1297_aa purL phosphoribosylformylglycinamidine synthase
2504 CAMPWI010000014.1 GCA946998075_01272 CDS open 55526-56323 _na     265_aa Type 11 methyltransferase
2505 CAMPWI010000014.1 GCA946998075_01273 CDS open 56370-57044 _na     224_aa phosphoglycolate phosphatase
2506 CAMPWI010000014.1 GCA946998075_01274 CDS open 57057-57728 _na     223_aa rpe ribulose-phosphate 3-epimerase
2507 CAMPWI010000014.1 GCA946998075_01275 CDS open 57892-59556 _na     554_aa 5'-nucleotidase%2C C-terminal domain protein
2508 CAMPWI010000014.1 GCA946998075_01276 CDS open 59688-60017 _na     109_aa DLP12 prophage multidrug resistance protein
2509 CAMPWI010000014.1 GCA946998075_01277 CDS open 60232-64647 _na     1471_aa Ig-like domain-containing protein
2510 CAMPWI010000014.1 GCA946998075_01224 gene open 54-854 ygiD
2511 CAMPWI010000014.1 GCA946998075_01225 gene open 1166-1534
2512 CAMPWI010000014.1 GCA946998075_01226 gene open 1892-2113
2513 CAMPWI010000014.1 GCA946998075_01227 gene open 2420-2653
2514 CAMPWI010000014.1 GCA946998075_01228 gene open 2810-3658
2515 CAMPWI010000014.1 GCA946998075_01229 gene open 3787-4677
2516 CAMPWI010000014.1 GCA946998075_01230 gene open 4727-5521 focA
2517 CAMPWI010000014.1 GCA946998075_01231 gene open 5741-6331 lolA
2518 CAMPWI010000014.1 GCA946998075_01232 gene open 7201-7656
2519 CAMPWI010000014.1 GCA946998075_01233 gene open 7668-9215 sufI
2520 CAMPWI010000014.1 GCA946998075_01234 gene open 9309-9776
2521 CAMPWI010000014.1 GCA946998075_01235 gene open 9939-12770 uvrA
2522 CAMPWI010000014.1 GCA946998075_01236 gene open 12826-14352
2523 CAMPWI010000014.1 GCA946998075_01237 gene open 14361-15530
2524 CAMPWI010000014.1 GCA946998075_01238 gene open 15665-16540 rarD
2525 CAMPWI010000014.1 GCA946998075_01239 gene open 16673-17131
2526 CAMPWI010000014.1 GCA946998075_01240 gene open 17191-18375 nhaA
2527 CAMPWI010000014.1 GCA946998075_01241 gene open 18592-19893 brnQ
2528 CAMPWI010000014.1 GCA946998075_01242 gene open 19960-20700 rlmB
2529 CAMPWI010000014.1 GCA946998075_01243 gene open 20717-23062 rnr
2530 CAMPWI010000014.1 GCA946998075_01244 gene open 23227-23490 rpsT
2531 CAMPWI010000014.1 GCA946998075_01245 gene open 23799-25331 murJ
2532 CAMPWI010000014.1 GCA946998075_01246 gene open 25378-26304 ribF
2533 CAMPWI010000014.1 GCA946998075_01247 gene open 26307-26504
2534 CAMPWI010000014.1 GCA946998075_01248 gene open 26533-27051 dfsB
2535 CAMPWI010000014.1 GCA946998075_01249 gene open 27230-27457
2536 CAMPWI010000014.1 GCA946998075_01250 gene open 27459-27707
2537 CAMPWI010000014.1 GCA946998075_01251 gene open 27734-30559 ileS
2538 CAMPWI010000014.1 GCA946998075_01252 gene open 30649-30765
2539 CAMPWI010000014.1 GCA946998075_01253 gene open 30935-32302 purB
2540 CAMPWI010000014.1 GCA946998075_01254 gene open 32319-32990 hflD
2541 CAMPWI010000014.1 GCA946998075_01255 gene open 33083-34087 trpS
2542 CAMPWI010000014.1 GCA946998075_01256 gene open 34142-34432
2543 CAMPWI010000014.1 GCA946998075_01257 gene open 34465-35253
2544 CAMPWI010000014.1 GCA946998075_01258 gene open 35359-36606
2545 CAMPWI010000014.1 GCA946998075_01259 gene open 36734-37450 deoD
2546 CAMPWI010000014.1 GCA946998075_01260 gene open 37521-37997 greB
2547 CAMPWI010000014.1 GCA946998075_01261 gene open 38103-40415 tex
2548 CAMPWI010000014.1 GCA946998075_01262 gene open 40515-40898
2549 CAMPWI010000014.1 GCA946998075_01263 gene open 41036-42127
2550 CAMPWI010000014.1 GCA946998075_01264 gene open 42198-43475 glpC
2551 CAMPWI010000014.1 GCA946998075_01265 gene open 43485-44774 glpB
2552 CAMPWI010000014.1 GCA946998075_01266 gene open 44764-46455 glpA
2553 CAMPWI010000014.1 GCA946998075_01267 gene open 46747-48186 glpT
2554 CAMPWI010000014.1 GCA946998075_01268 gene open 48281-49366 glpQ
2555 CAMPWI010000014.1 GCA946998075_01269 gene open 49443-50402
2556 CAMPWI010000014.1 GCA946998075_01270 gene open 50641-51270
2557 CAMPWI010000014.1 GCA946998075_01271 gene open 51457-55350 purL
2558 CAMPWI010000014.1 GCA946998075_01272 gene open 55526-56323
2559 CAMPWI010000014.1 GCA946998075_01273 gene open 56370-57044
2560 CAMPWI010000014.1 GCA946998075_01274 gene open 57057-57728 rpe
2561 CAMPWI010000014.1 GCA946998075_01275 gene open 57892-59556
2562 CAMPWI010000014.1 GCA946998075_01276 gene open 59688-60017
2563 CAMPWI010000014.1 GCA946998075_01277 gene open 60232-64647
2564 CAMPWI010000015.1 GCA946998075_01310 gene open 32903-33093 gcvB
2565 CAMPWI010000015.1 GCA946998075_01310 ncRNA open 32903-33093 gcvB GcvB RNA
2566 CAMPWI010000015.1 regulatory_region open 25076-25196 Ribosomal S15 leader
2567 CAMPWI010000015.1 regulatory_region open 48180-48205 L25-Gammaproteobacteria ribosomal protein leader
2568 CAMPWI010000015.1 repeat_region open 41798-42570 CRISPR array with 12 repeats of length 36%2C consensus sequence GTTGTAGCTCCCTTTTTTATTTCGCAGTGCTATAAT and spacer length 30
2569 CAMPWI010000015.1 GCA946998075_01278 CDS open 12-1709 _na     565_aa hypothetical protein
2570 CAMPWI010000015.1 GCA946998075_01279 CDS open 1750-2598 _na     282_aa DUF808 domain-containing protein
2571 CAMPWI010000015.1 GCA946998075_01280 CDS open 2665-3918 _na     417_aa glutamate-5-semialdehyde dehydrogenase
2572 CAMPWI010000015.1 GCA946998075_01281 CDS open 3934-4596 _na     220_aa Glycine transporter domain-containing protein
2573 CAMPWI010000015.1 GCA946998075_01282 CDS open 4730-5530 _na     266_aa Gamma-glutamyl phosphate reductase
2574 CAMPWI010000015.1 GCA946998075_01283 CDS open 5785-6003 _na     72_aa DUF465 domain-containing protein
2575 CAMPWI010000015.1 GCA946998075_01284 CDS open 6242-7531 _na     429_aa serS serine--tRNA ligase
2576 CAMPWI010000015.1 GCA946998075_01285 CDS open 7696-7851 _na     51_aa hypothetical protein
2577 CAMPWI010000015.1 GCA946998075_01286 CDS open 7882-8640 _na     252_aa tehA dicarboxylate transporter/tellurite-resistance protein TehA
2578 CAMPWI010000015.1 GCA946998075_01287 CDS open 8727-10706 _na     659_aa rnb exoribonuclease II
2579 CAMPWI010000015.1 GCA946998075_01288 CDS open 10773-11561 _na     262_aa fabI Enoyl-[acyl-carrier-protein] reductase [NADH] FabI
2580 CAMPWI010000015.1 GCA946998075_01289 CDS open 11647-12402 _na     251_aa Nif3-like dinuclear metal center hexameric protein
2581 CAMPWI010000015.1 GCA946998075_01290 CDS open 12646-13581 _na     311_aa Lipid A biosynthesis acyltransferase
2582 CAMPWI010000015.1 GCA946998075_01291 CDS open 13679-15109 _na     476_aa rfaE ADP-heptose synthase
2583 CAMPWI010000015.1 GCA946998075_01292 CDS open 15163-17151 _na     662_aa TonB-dependent receptor
2584 CAMPWI010000015.1 GCA946998075_01293 CDS open 17120-17635 _na     171_aa Chemotaxis protein
2585 CAMPWI010000015.1 GCA946998075_01294 CDS open 17781-18779 _na     332_aa Periplasmic binding protein
2586 CAMPWI010000015.1 GCA946998075_01295 CDS open 18782-19795 _na     337_aa Iron chelate uptake ABC transporter%2C FeCT family%2C permease protein
2587 CAMPWI010000015.1 GCA946998075_01296 CDS open 19792-20541 _na     249_aa ABC transporter%2C ATP-binding protein
2588 CAMPWI010000015.1 GCA946998075_01297 CDS open 20551-21396 _na     281_aa modD Putative pyrophosphorylase ModD
2589 CAMPWI010000015.1 GCA946998075_01298 CDS open 21486-22526 _na     346_aa Fe/B12 periplasmic-binding domain-containing protein
2590 CAMPWI010000015.1 GCA946998075_01299 CDS open 22516-23529 _na     337_aa Iron chelate uptake ABC transporter%2C FeCT family%2C permease protein
2591 CAMPWI010000015.1 GCA946998075_01300 CDS open 23522-24298 _na     258_aa ABC transporter%2C ATP-binding protein
2592 CAMPWI010000015.1 GCA946998075_01301 CDS open 24291-25007 _na     238_aa modA molybdate ABC transporter substrate-binding protein
2593 CAMPWI010000015.1 GCA946998075_01302 CDS open 25140-25409 _na     89_aa rpsO 30S ribosomal protein S15
2594 CAMPWI010000015.1 GCA946998075_01303 CDS open 25523-27562 _na     679_aa prlC oligopeptidase A
2595 CAMPWI010000015.1 GCA946998075_01304 CDS open 27679-28155 _na     158_aa ybaN Inner membrane protein ybaN
2596 CAMPWI010000015.1 GCA946998075_01305 CDS open 28148-29713 _na     521_aa Putative ABC-type oligopeptide transport system%2C periplasmic component
2597 CAMPWI010000015.1 GCA946998075_01306 CDS open 29850-30491 _na     213_aa merR Transcriptional regulator%2C MerR family
2598 CAMPWI010000015.1 GCA946998075_01307 CDS open 30488-31153 _na     221_aa 2-acyl-glycerophospho-ethanolamine acyltransferase
2599 CAMPWI010000015.1 GCA946998075_01308 CDS open 31105-31620 _na     171_aa hypothetical protein
2600 CAMPWI010000015.1 GCA946998075_01309 CDS open 31688-32719 _na     343_aa ilvE branched-chain amino acid aminotransferase
2601 CAMPWI010000015.1 GCA946998075_01311 CDS open 33201-34094 _na     297_aa lysR LysR substrate binding domain protein
2602 CAMPWI010000015.1 GCA946998075_01312 CDS open 34087-35175 _na     362_aa rlmM 23S rRNA (cytidine(2498)-2'-O)-methyltransferase RlmM
2603 CAMPWI010000015.1 GCA946998075_01313 CDS open 35235-36200 _na     321_aa cmoB tRNA 5-methoxyuridine(34)/uridine 5-oxyacetic acid(34) synthase CmoB
2604 CAMPWI010000015.1 GCA946998075_01314 CDS open 36200-37714 _na     504_aa putP sodium/proline symporter PutP
2605 CAMPWI010000015.1 GCA946998075_01315 CDS open 37832-39307 _na     491_aa rng ribonuclease G
2606 CAMPWI010000015.1 GCA946998075_01316 CDS open 39352-40749 _na     465_aa Multidrug-efflux transporter
2607 CAMPWI010000015.1 GCA946998075_01317 CDS open 40795-41409 _na     204_aa riboflavin synthase subunit alpha
2608 CAMPWI010000015.1 GCA946998075_01318 CDS open 41438-41713 _na     91_aa hypothetical protein
2609 CAMPWI010000015.1 GCA946998075_01319 CDS open 42940-43857 _na     305_aa cas1 type II CRISPR-associated endonuclease Cas1
2610 CAMPWI010000015.1 GCA946998075_01320 CDS open 43911-47078 _na     1055_aa cas9 type II CRISPR RNA-guided endonuclease Cas9
2611 CAMPWI010000015.1 GCA946998075_01321 CDS open 47407-48012 _na     201_aa dedA SNARE-like domain protein
2612 CAMPWI010000015.1 GCA946998075_01322 CDS open 48239-48526 _na     95_aa rplY 50S ribosomal protein L25
2613 CAMPWI010000015.1 GCA946998075_01323 CDS open 48674-49705 _na     343_aa Integrase
2614 CAMPWI010000015.1 GCA946998075_01324 CDS open 49719-50072 _na     117_aa hypothetical protein
2615 CAMPWI010000015.1 GCA946998075_01325 CDS open 50038-50307 _na     89_aa hypothetical protein
2616 CAMPWI010000015.1 GCA946998075_01326 CDS open 50367-50543 _na     58_aa hypothetical protein
2617 CAMPWI010000015.1 GCA946998075_01327 CDS open 50576-51496 _na     306_aa DNA cytosine methyltransferase
2618 CAMPWI010000015.1 GCA946998075_01328 CDS open 51525-51743 _na     72_aa flbD flagellar FlbD family protein
2619 CAMPWI010000015.1 GCA946998075_01329 CDS open 51753-52556 _na     267_aa Helix-hairpin-helix domain-containing protein
2620 CAMPWI010000015.1 GCA946998075_01330 CDS open 52543-53097 _na     184_aa Phosphohydrolase
2621 CAMPWI010000015.1 GCA946998075_01331 CDS open 53084-53296 _na     70_aa ANR family transcriptional regulator
2622 CAMPWI010000015.1 GCA946998075_01332 CDS open 53299-53553 _na     84_aa hypothetical protein
2623 CAMPWI010000015.1 GCA946998075_01333 CDS open 53934-54821 _na     295_aa DUF4393 domain-containing protein
2624 CAMPWI010000015.1 GCA946998075_01334 CDS open 54816-54986 _na     56_aa Lipoprotein
2625 CAMPWI010000015.1 GCA946998075_01335 CDS open 55443-55967 _na     174_aa Integral membrane protein
2626 CAMPWI010000015.1 GCA946998075_01336 CDS open 56300-56467 _na     55_aa hypothetical protein
2627 CAMPWI010000015.1 GCA946998075_01337 CDS open 56497-56931 _na     144_aa hypothetical protein
2628 CAMPWI010000015.1 GCA946998075_01338 CDS open 56931-57413 _na     160_aa putative protein encoded in hypervariable junctions of pilus gene clusters
2629 CAMPWI010000015.1 GCA946998075_01339 CDS open 57427-57681 _na     84_aa hicA Type II toxin-antitoxin system HicA family toxin
2630 CAMPWI010000015.1 GCA946998075_01340 CDS open 57755-58420 _na     221_aa lexA LexA repressor
2631 CAMPWI010000015.1 GCA946998075_01341 CDS open 58520-58759 _na     79_aa Regulatory protein
2632 CAMPWI010000015.1 GCA946998075_01342 CDS open 58814-59254 _na     146_aa ymfL YmfL family putative regulatory protein
2633 CAMPWI010000015.1 GCA946998075_01343 CDS open 59300-59434 _na     44_aa hypothetical protein
2634 CAMPWI010000015.1 GCA946998075_01344 CDS open 59436-60005 _na     189_aa HNH endonuclease
2635 CAMPWI010000015.1 GCA946998075_01345 CDS open 59995-60780 _na     261_aa hypothetical protein
2636 CAMPWI010000015.1 GCA946998075_01346 CDS open 60777-61403 _na     208_aa Replication protein P
2637 CAMPWI010000015.1 GCA946998075_01278 gene open 12-1709
2638 CAMPWI010000015.1 GCA946998075_01279 gene open 1750-2598
2639 CAMPWI010000015.1 GCA946998075_01280 gene open 2665-3918
2640 CAMPWI010000015.1 GCA946998075_01281 gene open 3934-4596
2641 CAMPWI010000015.1 GCA946998075_01282 gene open 4730-5530
2642 CAMPWI010000015.1 GCA946998075_01283 gene open 5785-6003
2643 CAMPWI010000015.1 GCA946998075_01284 gene open 6242-7531 serS
2644 CAMPWI010000015.1 GCA946998075_01285 gene open 7696-7851
2645 CAMPWI010000015.1 GCA946998075_01286 gene open 7882-8640 tehA
2646 CAMPWI010000015.1 GCA946998075_01287 gene open 8727-10706 rnb
2647 CAMPWI010000015.1 GCA946998075_01288 gene open 10773-11561 fabI
2648 CAMPWI010000015.1 GCA946998075_01289 gene open 11647-12402
2649 CAMPWI010000015.1 GCA946998075_01290 gene open 12646-13581
2650 CAMPWI010000015.1 GCA946998075_01291 gene open 13679-15109 rfaE
2651 CAMPWI010000015.1 GCA946998075_01292 gene open 15163-17151
2652 CAMPWI010000015.1 GCA946998075_01293 gene open 17120-17635
2653 CAMPWI010000015.1 GCA946998075_01294 gene open 17781-18779
2654 CAMPWI010000015.1 GCA946998075_01295 gene open 18782-19795
2655 CAMPWI010000015.1 GCA946998075_01296 gene open 19792-20541
2656 CAMPWI010000015.1 GCA946998075_01297 gene open 20551-21396 modD
2657 CAMPWI010000015.1 GCA946998075_01298 gene open 21486-22526
2658 CAMPWI010000015.1 GCA946998075_01299 gene open 22516-23529
2659 CAMPWI010000015.1 GCA946998075_01300 gene open 23522-24298
2660 CAMPWI010000015.1 GCA946998075_01301 gene open 24291-25007 modA
2661 CAMPWI010000015.1 GCA946998075_01302 gene open 25140-25409 rpsO
2662 CAMPWI010000015.1 GCA946998075_01303 gene open 25523-27562 prlC
2663 CAMPWI010000015.1 GCA946998075_01304 gene open 27679-28155 ybaN
2664 CAMPWI010000015.1 GCA946998075_01305 gene open 28148-29713
2665 CAMPWI010000015.1 GCA946998075_01306 gene open 29850-30491 merR
2666 CAMPWI010000015.1 GCA946998075_01307 gene open 30488-31153
2667 CAMPWI010000015.1 GCA946998075_01308 gene open 31105-31620
2668 CAMPWI010000015.1 GCA946998075_01309 gene open 31688-32719 ilvE
2669 CAMPWI010000015.1 GCA946998075_01311 gene open 33201-34094 lysR
2670 CAMPWI010000015.1 GCA946998075_01312 gene open 34087-35175 rlmM
2671 CAMPWI010000015.1 GCA946998075_01313 gene open 35235-36200 cmoB
2672 CAMPWI010000015.1 GCA946998075_01314 gene open 36200-37714 putP
2673 CAMPWI010000015.1 GCA946998075_01315 gene open 37832-39307 rng
2674 CAMPWI010000015.1 GCA946998075_01316 gene open 39352-40749
2675 CAMPWI010000015.1 GCA946998075_01317 gene open 40795-41409
2676 CAMPWI010000015.1 GCA946998075_01318 gene open 41438-41713
2677 CAMPWI010000015.1 GCA946998075_01319 gene open 42940-43857 cas1
2678 CAMPWI010000015.1 GCA946998075_01320 gene open 43911-47078 cas9
2679 CAMPWI010000015.1 GCA946998075_01321 gene open 47407-48012 dedA
2680 CAMPWI010000015.1 GCA946998075_01322 gene open 48239-48526 rplY
2681 CAMPWI010000015.1 GCA946998075_01323 gene open 48674-49705
2682 CAMPWI010000015.1 GCA946998075_01324 gene open 49719-50072
2683 CAMPWI010000015.1 GCA946998075_01325 gene open 50038-50307
2684 CAMPWI010000015.1 GCA946998075_01326 gene open 50367-50543
2685 CAMPWI010000015.1 GCA946998075_01327 gene open 50576-51496
2686 CAMPWI010000015.1 GCA946998075_01328 gene open 51525-51743 flbD
2687 CAMPWI010000015.1 GCA946998075_01329 gene open 51753-52556
2688 CAMPWI010000015.1 GCA946998075_01330 gene open 52543-53097
2689 CAMPWI010000015.1 GCA946998075_01331 gene open 53084-53296
2690 CAMPWI010000015.1 GCA946998075_01332 gene open 53299-53553
2691 CAMPWI010000015.1 GCA946998075_01333 gene open 53934-54821
2692 CAMPWI010000015.1 GCA946998075_01334 gene open 54816-54986
2693 CAMPWI010000015.1 GCA946998075_01335 gene open 55443-55967
2694 CAMPWI010000015.1 GCA946998075_01336 gene open 56300-56467
2695 CAMPWI010000015.1 GCA946998075_01337 gene open 56497-56931
2696 CAMPWI010000015.1 GCA946998075_01338 gene open 56931-57413
2697 CAMPWI010000015.1 GCA946998075_01339 gene open 57427-57681 hicA
2698 CAMPWI010000015.1 GCA946998075_01340 gene open 57755-58420 lexA
2699 CAMPWI010000015.1 GCA946998075_01341 gene open 58520-58759
2700 CAMPWI010000015.1 GCA946998075_01342 gene open 58814-59254 ymfL
2701 CAMPWI010000015.1 GCA946998075_01343 gene open 59300-59434
2702 CAMPWI010000015.1 GCA946998075_01344 gene open 59436-60005
2703 CAMPWI010000015.1 GCA946998075_01345 gene open 59995-60780
2704 CAMPWI010000015.1 GCA946998075_01346 gene open 60777-61403
2705 CAMPWI010000016.1 GCA946998075_01367 gene open 16881-17078 6S
2706 CAMPWI010000016.1 GCA946998075_01367 ncRNA open 16881-17078 6S / SsrS RNA
2707 CAMPWI010000016.1 GCA946998075_01347 CDS open 77-214 _na     45_aa ykgO type B 50S ribosomal protein L36
2708 CAMPWI010000016.1 GCA946998075_01348 CDS open 224-490 _na     88_aa type B 50S ribosomal protein L31
2709 CAMPWI010000016.1 GCA946998075_01349 CDS open 535-699 _na     54_aa hypothetical protein
2710 CAMPWI010000016.1 GCA946998075_01350 CDS open 651-1133 _na     160_aa smpB SsrA-binding protein SmpB
2711 CAMPWI010000016.1 GCA946998075_01351 CDS open 1246-1959 _na     237_aa arcA two-component system response regulator ArcA
2712 CAMPWI010000016.1 GCA946998075_01352 CDS open 2137-3906 _na     589_aa dsbD Thiol:disulfide interchange protein DsbD
2713 CAMPWI010000016.1 GCA946998075_01353 CDS open 4024-4422 _na     132_aa Membrane protein
2714 CAMPWI010000016.1 GCA946998075_01354 CDS open 4603-6201 _na     532_aa purH bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase
2715 CAMPWI010000016.1 GCA946998075_01355 CDS open 6390-7679 _na     429_aa purD Phosphoribosylamine--glycine ligase
2716 CAMPWI010000016.1 GCA946998075_01356 CDS open 7803-9065 _na     420_aa glyA Serine hydroxymethyltransferase
2717 CAMPWI010000016.1 GCA946998075_01357 CDS open 9065-9340 _na     91_aa DUF1294 domain-containing protein
2718 CAMPWI010000016.1 GCA946998075_01358 CDS open 9415-9948 _na     177_aa dsbB disulfide bond formation protein DsbB
2719 CAMPWI010000016.1 GCA946998075_01359 CDS open 9968-11506 _na     512_aa nhaB Na(+)/H(+) antiporter NhaB
2720 CAMPWI010000016.1 GCA946998075_01360 CDS open 11629-12357 _na     242_aa fadR fatty acid metabolism transcriptional regulator FadR
2721 CAMPWI010000016.1 GCA946998075_01361 CDS open 12416-13150 _na     244_aa rsmE 16S rRNA (uracil(1498)-N(3))-methyltransferase
2722 CAMPWI010000016.1 GCA946998075_01362 CDS open 13150-13710 _na     186_aa YqgE/AlgH family protein
2723 CAMPWI010000016.1 GCA946998075_01363 CDS open 13710-14129 _na     139_aa ruvX Holliday junction resolvase RuvX
2724 CAMPWI010000016.1 GCA946998075_01364 CDS open 14178-14915 _na     245_aa pgeF peptidoglycan editing factor PgeF
2725 CAMPWI010000016.1 GCA946998075_01365 CDS open 14917-15891 _na     324_aa rluD 23S rRNA pseudouridine(1911/1915/1917) synthase RluD
2726 CAMPWI010000016.1 GCA946998075_01366 CDS open 16000-16788 _na     262_aa bamD Outer membrane protein assembly factor BamD
2727 CAMPWI010000016.1 GCA946998075_01368 CDS open 17105-17677 _na     190_aa 5-formyltetrahydrofolate cyclo-ligase
2728 CAMPWI010000016.1 GCA946998075_01369 CDS open 17813-20383 _na     856_aa clpB ATP-dependent chaperone ClpB
2729 CAMPWI010000016.1 GCA946998075_01370 CDS open 20496-21089 _na     197_aa mog molybdopterin adenylyltransferase
2730 CAMPWI010000016.1 GCA946998075_01371 CDS open 21091-21429 _na     112_aa glnB nitrogen regulatory protein P-II
2731 CAMPWI010000016.1 GCA946998075_01372 CDS open 21429-22469 _na     346_aa tqsA Autoinducer 2 exporter TqsA
2732 CAMPWI010000016.1 GCA946998075_01373 CDS open 22551-23525 _na     324_aa secF Protein-export membrane protein SecF
2733 CAMPWI010000016.1 GCA946998075_01374 CDS open 23536-25386 _na     616_aa secD Protein translocase subunit SecD
2734 CAMPWI010000016.1 GCA946998075_01375 CDS open 25410-25700 _na     96_aa yajC preprotein translocase subunit YajC
2735 CAMPWI010000016.1 GCA946998075_01376 CDS open 25803-26030 _na     75_aa UPF0033 domain-containing protein
2736 CAMPWI010000016.1 GCA946998075_01377 CDS open 26034-26546 _na     170_aa Hemerythrin HHE cation-binding domain-containing protein
2737 CAMPWI010000016.1 GCA946998075_01378 CDS open 26611-27759 _na     382_aa tgt tRNA guanosine(34) transglycosylase Tgt
2738 CAMPWI010000016.1 GCA946998075_01379 CDS open 27872-28963 _na     363_aa queA tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA
2739 CAMPWI010000016.1 GCA946998075_01380 CDS open 29157-30536 _na     459_aa yegQ tRNA 5-hydroxyuridine modification protein YegQ
2740 CAMPWI010000016.1 GCA946998075_01381 CDS open 30716-32032 _na     438_aa nCS2 Putative permease HI_0125
2741 CAMPWI010000016.1 GCA946998075_01382 CDS open 32240-32770 _na     176_aa ppa Inorganic pyrophosphatase
2742 CAMPWI010000016.1 GCA946998075_01383 CDS open 32883-33290 _na     135_aa soxR putative HTH-type transcriptional regulator HI_0186
2743 CAMPWI010000016.1 GCA946998075_01384 CDS open 33412-34548 _na     378_aa frmA S-(hydroxymethyl)glutathione dehydrogenase/class III alcohol dehydrogenase
2744 CAMPWI010000016.1 GCA946998075_01385 CDS open 34557-35384 _na     275_aa fghA S-formylglutathione hydrolase
2745 CAMPWI010000016.1 GCA946998075_01386 CDS open 35435-38668 _na     1077_aa Outer membrane autotransporter barrel domain protein
2746 CAMPWI010000016.1 GCA946998075_01387 CDS open 38873-39889 _na     338_aa galE UDP-glucose 4-epimerase
2747 CAMPWI010000016.1 GCA946998075_01388 CDS open 39969-41243 _na     424_aa AmpG-related permease
2748 CAMPWI010000016.1 GCA946998075_01389 CDS open 41342-41986 _na     214_aa adk adenylate kinase
2749 CAMPWI010000016.1 GCA946998075_01390 CDS open 42084-44108 _na     674_aa DUF945 domain-containing protein
2750 CAMPWI010000016.1 GCA946998075_01391 CDS open 44178-45140 _na     320_aa lipA lipoyl synthase
2751 CAMPWI010000016.1 GCA946998075_01392 CDS open 45202-45843 _na     213_aa lipB lipoyl(octanoyl) transferase LipB
2752 CAMPWI010000016.1 GCA946998075_01393 CDS open 45845-46123 _na     92_aa ybeD DUF493 domain-containing protein
2753 CAMPWI010000016.1 GCA946998075_01394 CDS open 46230-47417 _na     395_aa serine-type D-Ala-D-Ala carboxypeptidase
2754 CAMPWI010000016.1 GCA946998075_01395 CDS open 47548-48219 _na     223_aa rlpA Endolytic peptidoglycan transglycosylase RlpA
2755 CAMPWI010000016.1 GCA946998075_01396 CDS open 48315-49430 _na     371_aa rodA rod shape-determining protein RodA
2756 CAMPWI010000016.1 GCA946998075_01397 CDS open 49448-51406 _na     652_aa mrdA penicillin-binding protein 2
2757 CAMPWI010000016.1 GCA946998075_01398 CDS open 51422-51889 _na     155_aa rlmH 23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH
2758 CAMPWI010000016.1 GCA946998075_01399 CDS open 51929-52237 _na     102_aa rsfS ribosome silencing factor
2759 CAMPWI010000016.1 GCA946998075_01400 CDS open 52388-54040 _na     550_aa putative transporter
2760 CAMPWI010000016.1 GCA946998075_01401 CDS open 54206-55996 _na     596_aa Multidrug ABC transporter membrane protein/ATP-binding protein
2761 CAMPWI010000016.1 GCA946998075_01347 gene open 77-214 ykgO
2762 CAMPWI010000016.1 GCA946998075_01348 gene open 224-490
2763 CAMPWI010000016.1 GCA946998075_01349 gene open 535-699
2764 CAMPWI010000016.1 GCA946998075_01350 gene open 651-1133 smpB
2765 CAMPWI010000016.1 GCA946998075_01351 gene open 1246-1959 arcA
2766 CAMPWI010000016.1 GCA946998075_01352 gene open 2137-3906 dsbD
2767 CAMPWI010000016.1 GCA946998075_01353 gene open 4024-4422
2768 CAMPWI010000016.1 GCA946998075_01354 gene open 4603-6201 purH
2769 CAMPWI010000016.1 GCA946998075_01355 gene open 6390-7679 purD
2770 CAMPWI010000016.1 GCA946998075_01356 gene open 7803-9065 glyA
2771 CAMPWI010000016.1 GCA946998075_01357 gene open 9065-9340
2772 CAMPWI010000016.1 GCA946998075_01358 gene open 9415-9948 dsbB
2773 CAMPWI010000016.1 GCA946998075_01359 gene open 9968-11506 nhaB
2774 CAMPWI010000016.1 GCA946998075_01360 gene open 11629-12357 fadR
2775 CAMPWI010000016.1 GCA946998075_01361 gene open 12416-13150 rsmE
2776 CAMPWI010000016.1 GCA946998075_01362 gene open 13150-13710
2777 CAMPWI010000016.1 GCA946998075_01363 gene open 13710-14129 ruvX
2778 CAMPWI010000016.1 GCA946998075_01364 gene open 14178-14915 pgeF
2779 CAMPWI010000016.1 GCA946998075_01365 gene open 14917-15891 rluD
2780 CAMPWI010000016.1 GCA946998075_01366 gene open 16000-16788 bamD
2781 CAMPWI010000016.1 GCA946998075_01368 gene open 17105-17677
2782 CAMPWI010000016.1 GCA946998075_01369 gene open 17813-20383 clpB
2783 CAMPWI010000016.1 GCA946998075_01370 gene open 20496-21089 mog
2784 CAMPWI010000016.1 GCA946998075_01371 gene open 21091-21429 glnB
2785 CAMPWI010000016.1 GCA946998075_01372 gene open 21429-22469 tqsA
2786 CAMPWI010000016.1 GCA946998075_01373 gene open 22551-23525 secF
2787 CAMPWI010000016.1 GCA946998075_01374 gene open 23536-25386 secD
2788 CAMPWI010000016.1 GCA946998075_01375 gene open 25410-25700 yajC
2789 CAMPWI010000016.1 GCA946998075_01376 gene open 25803-26030
2790 CAMPWI010000016.1 GCA946998075_01377 gene open 26034-26546
2791 CAMPWI010000016.1 GCA946998075_01378 gene open 26611-27759 tgt
2792 CAMPWI010000016.1 GCA946998075_01379 gene open 27872-28963 queA
2793 CAMPWI010000016.1 GCA946998075_01380 gene open 29157-30536 yegQ
2794 CAMPWI010000016.1 GCA946998075_01381 gene open 30716-32032 nCS2
2795 CAMPWI010000016.1 GCA946998075_01382 gene open 32240-32770 ppa
2796 CAMPWI010000016.1 GCA946998075_01383 gene open 32883-33290 soxR
2797 CAMPWI010000016.1 GCA946998075_01384 gene open 33412-34548 frmA
2798 CAMPWI010000016.1 GCA946998075_01385 gene open 34557-35384 fghA
2799 CAMPWI010000016.1 GCA946998075_01386 gene open 35435-38668
2800 CAMPWI010000016.1 GCA946998075_01387 gene open 38873-39889 galE
2801 CAMPWI010000016.1 GCA946998075_01388 gene open 39969-41243
2802 CAMPWI010000016.1 GCA946998075_01389 gene open 41342-41986 adk
2803 CAMPWI010000016.1 GCA946998075_01390 gene open 42084-44108
2804 CAMPWI010000016.1 GCA946998075_01391 gene open 44178-45140 lipA
2805 CAMPWI010000016.1 GCA946998075_01392 gene open 45202-45843 lipB
2806 CAMPWI010000016.1 GCA946998075_01393 gene open 45845-46123 ybeD
2807 CAMPWI010000016.1 GCA946998075_01394 gene open 46230-47417
2808 CAMPWI010000016.1 GCA946998075_01395 gene open 47548-48219 rlpA
2809 CAMPWI010000016.1 GCA946998075_01396 gene open 48315-49430 rodA
2810 CAMPWI010000016.1 GCA946998075_01397 gene open 49448-51406 mrdA
2811 CAMPWI010000016.1 GCA946998075_01398 gene open 51422-51889 rlmH
2812 CAMPWI010000016.1 GCA946998075_01399 gene open 51929-52237 rsfS
2813 CAMPWI010000016.1 GCA946998075_01400 gene open 52388-54040
2814 CAMPWI010000016.1 GCA946998075_01401 gene open 54206-55996
2815 CAMPWI010000017.1 GCA946998075_01467 gene open 51857-51963 AaHKsRNA54
2816 CAMPWI010000017.1 GCA946998075_01467 ncRNA open 51857-51963 Aggregatibacter sRNA 54
2817 CAMPWI010000017.1 GCA946998075_01402 CDS open 348-764 _na     138_aa phage virion morphogenesis protein
2818 CAMPWI010000017.1 GCA946998075_01403 CDS open 900-2201 _na     433_aa Phage head morphogenesis protein%2C SPP1 gp7 family
2819 CAMPWI010000017.1 GCA946998075_01404 CDS open 2185-3807 _na     540_aa Portal protein
2820 CAMPWI010000017.1 GCA946998075_01405 CDS open 3817-5466 _na     549_aa Phage lprotein
2821 CAMPWI010000017.1 GCA946998075_01406 CDS open 5467-5613 _na     48_aa Holin
2822 CAMPWI010000017.1 GCA946998075_01407 CDS open 5613-6113 _na     166_aa DUF1804 domain-containing protein
2823 CAMPWI010000017.1 GCA946998075_01408 CDS open 6119-6385 _na     88_aa xhlA Hemolysin XhlA
2824 CAMPWI010000017.1 GCA946998075_01409 CDS open 6385-6639 _na     84_aa Holin
2825 CAMPWI010000017.1 GCA946998075_01410 CDS open 6623-6814 _na     63_aa Lipoprotein
2826 CAMPWI010000017.1 GCA946998075_01411 CDS open 6756-7013 _na     85_aa DUF2681 domain-containing protein
2827 CAMPWI010000017.1 GCA946998075_01412 CDS open 7013-7303 _na     96_aa DUF2644 domain-containing protein
2828 CAMPWI010000017.1 GCA946998075_01413 CDS open 7300-7479 _na     59_aa Transposase
2829 CAMPWI010000017.1 GCA946998075_01414 CDS open 7469-7972 _na     167_aa Glycoside hydrolase family 108 protein
2830 CAMPWI010000017.1 GCA946998075_01415 CDS open 8053-8481 _na     142_aa Mor transcription activator family
2831 CAMPWI010000017.1 GCA946998075_01416 CDS open 8588-9292 _na     234_aa hypothetical protein
2832 CAMPWI010000017.1 GCA946998075_01417 CDS open 9351-9752 _na     133_aa gp16 family protein
2833 CAMPWI010000017.1 GCA946998075_01418 CDS open 9742-10290 _na     182_aa Phage protein
2834 CAMPWI010000017.1 GCA946998075_01419 CDS open 10406-10699 _na     97_aa Transcriptional regulator
2835 CAMPWI010000017.1 GCA946998075_01420 CDS open 10696-11424 _na     242_aa DUF2786 domain-containing protein
2836 CAMPWI010000017.1 GCA946998075_01421 CDS open 11397-11570 _na     57_aa FMN-dependent NADH-azoreductase
2837 CAMPWI010000017.1 GCA946998075_01422 CDS open 11567-11731 _na     54_aa Phage protein
2838 CAMPWI010000017.1 GCA946998075_01423 CDS open 11724-11933 _na     69_aa ANR family transcriptional regulator
2839 CAMPWI010000017.1 GCA946998075_01424 CDS open 12041-12658 _na     205_aa DUF3164 domain-containing protein
2840 CAMPWI010000017.1 GCA946998075_01425 CDS open 12659-12850 _na     63_aa Helix-turn-helix type 11 domain-containing protein
2841 CAMPWI010000017.1 GCA946998075_01426 CDS open 12859-13155 _na     98_aa Sulfate transporter
2842 CAMPWI010000017.1 GCA946998075_01427 CDS open 13166-14047 _na     293_aa DNA-binding helix-turn-helix protein
2843 CAMPWI010000017.1 GCA946998075_01428 CDS open 14058-16040 _na     660_aa Mu transposase C-terminal domain-containing protein
2844 CAMPWI010000017.1 GCA946998075_01429 CDS open 16084-16362 _na     92_aa DNA-binding protein Ner
2845 CAMPWI010000017.1 GCA946998075_01430 CDS open 16322-16555 _na     77_aa hypothetical protein
2846 CAMPWI010000017.1 GCA946998075_01431 CDS open 16581-17243 _na     220_aa lexA LexA family transcriptional regulator
2847 CAMPWI010000017.1 GCA946998075_01432 CDS open 17913-18821 _na     302_aa glyQ glycine--tRNA ligase subunit alpha
2848 CAMPWI010000017.1 GCA946998075_01433 CDS open 18875-19525 _na     216_aa THAP4-like heme-binding beta-barrel domain-containing protein
2849 CAMPWI010000017.1 GCA946998075_01434 CDS open 19525-19782 _na     85_aa Glutaredoxin-like protein
2850 CAMPWI010000017.1 GCA946998075_01435 CDS open 19787-20233 _na     148_aa hypothetical protein
2851 CAMPWI010000017.1 GCA946998075_01436 CDS open 20243-21520 _na     425_aa Acid glucose-1-phosphate phosphatase
2852 CAMPWI010000017.1 GCA946998075_01437 CDS open 21781-22422 _na     213_aa hypothetical protein
2853 CAMPWI010000017.1 GCA946998075_01438 CDS open 22484-24550 _na     688_aa glyS Glycine--tRNA ligase beta subunit
2854 CAMPWI010000017.1 GCA946998075_01440 CDS open 24768-25493 _na     241_aa 3-deoxy-D-manno-octulosonic acid kinase
2855 CAMPWI010000017.1 GCA946998075_01441 CDS open 25571-26626 _na     351_aa ADP-heptose--lipooligosaccharide heptosyltransferase I
2856 CAMPWI010000017.1 GCA946998075_01442 CDS open 26698-27042 _na     114_aa yurZ Alkylhydroperoxidase AhpD family core domain protein
2857 CAMPWI010000017.1 GCA946998075_01443 CDS open 27146-28036 _na     296_aa HTH-type transcriptional regulator
2858 CAMPWI010000017.1 GCA946998075_01444 CDS open 28113-29957 _na     614_aa mdlB ABC transporter%2C ATP-binding protein
2859 CAMPWI010000017.1 GCA946998075_01445 CDS open 30091-30615 _na     174_aa yceD 23S rRNA accumulation protein YceD
2860 CAMPWI010000017.1 GCA946998075_01446 CDS open 30638-30808 _na     56_aa rpmF 50S ribosomal protein L32
2861 CAMPWI010000017.1 GCA946998075_01447 CDS open 30830-31849 _na     339_aa plsX phosphate acyltransferase PlsX
2862 CAMPWI010000017.1 GCA946998075_01448 CDS open 31868-32818 _na     316_aa Beta-ketoacyl-[acyl-carrier-protein] synthase III
2863 CAMPWI010000017.1 GCA946998075_01449 CDS open 32911-33849 _na     312_aa fabD ACP S-malonyltransferase
2864 CAMPWI010000017.1 GCA946998075_01450 CDS open 33864-34592 _na     242_aa fabG 3-oxoacyl-ACP reductase FabG
2865 CAMPWI010000017.1 GCA946998075_01451 CDS open 34810-35040 _na     76_aa acpP acyl carrier protein
2866 CAMPWI010000017.1 GCA946998075_01452 CDS open 35323-36990 _na     555_aa dcuA Transporter%2C anaerobic C4-dicarboxylate uptake (Dcu) family
2867 CAMPWI010000017.1 GCA946998075_01453 CDS open 37296-37838 _na     180_aa aroK shikimate kinase AroK
2868 CAMPWI010000017.1 GCA946998075_01454 CDS open 37848-38936 _na     362_aa aroB 3-dehydroquinate synthase
2869 CAMPWI010000017.1 GCA946998075_01455 CDS open 38951-39805 _na     284_aa Site-specific DNA-methyltransferase (adenine-specific)
2870 CAMPWI010000017.1 GCA946998075_01456 CDS open 39807-40127 _na     106_aa DUF721 domain-containing protein
2871 CAMPWI010000017.1 GCA946998075_01457 CDS open 40200-40517 _na     105_aa secM secA translation cis-regulator SecM
2872 CAMPWI010000017.1 GCA946998075_01458 CDS open 40591-43287 _na     898_aa secA preprotein translocase subunit SecA
2873 CAMPWI010000017.1 GCA946998075_01459 CDS open 43375-43779 _na     134_aa mutT 8-oxo-dGTP diphosphatase MutT
2874 CAMPWI010000017.1 GCA946998075_01460 CDS open 43802-45466 _na     554_aa Arylsulfatase
2875 CAMPWI010000017.1 GCA946998075_01461 CDS open 45497-46534 _na     345_aa holA DNA polymerase III subunit delta
2876 CAMPWI010000017.1 GCA946998075_01462 CDS open 46534-47037 _na     167_aa lptE LPS-assembly lipoprotein LptE
2877 CAMPWI010000017.1 GCA946998075_01463 CDS open 47125-49713 _na     862_aa leuS leucine--tRNA ligase
2878 CAMPWI010000017.1 GCA946998075_01464 CDS open 49832-50119 _na     95_aa yggU DUF167 domain-containing protein
2879 CAMPWI010000017.1 GCA946998075_01465 CDS open 50203-50748 _na     181_aa yggT YggT family protein
2880 CAMPWI010000017.1 GCA946998075_01466 CDS open 50748-51695 _na     315_aa corA magnesium/cobalt transporter CorA
2881 CAMPWI010000017.1 GCA946998075_01468 CDS open 52014-52613 _na     199_aa Lipoprotein
2882 CAMPWI010000017.1 GCA946998075_01469 CDS open 52698-53009 _na     103_aa Penicillin binding proteins and beta lactamase transcription regulator
2883 CAMPWI010000017.1 GCA946998075_01470 CDS open 53362-54705 _na     447_aa Na(+)-translocating NADH-quinone reductase subunit A
2884 CAMPWI010000017.1 GCA946998075_01402 gene open 348-764
2885 CAMPWI010000017.1 GCA946998075_01403 gene open 900-2201
2886 CAMPWI010000017.1 GCA946998075_01404 gene open 2185-3807
2887 CAMPWI010000017.1 GCA946998075_01405 gene open 3817-5466
2888 CAMPWI010000017.1 GCA946998075_01406 gene open 5467-5613
2889 CAMPWI010000017.1 GCA946998075_01407 gene open 5613-6113
2890 CAMPWI010000017.1 GCA946998075_01408 gene open 6119-6385 xhlA
2891 CAMPWI010000017.1 GCA946998075_01409 gene open 6385-6639
2892 CAMPWI010000017.1 GCA946998075_01410 gene open 6623-6814
2893 CAMPWI010000017.1 GCA946998075_01411 gene open 6756-7013
2894 CAMPWI010000017.1 GCA946998075_01412 gene open 7013-7303
2895 CAMPWI010000017.1 GCA946998075_01413 gene open 7300-7479
2896 CAMPWI010000017.1 GCA946998075_01414 gene open 7469-7972
2897 CAMPWI010000017.1 GCA946998075_01415 gene open 8053-8481
2898 CAMPWI010000017.1 GCA946998075_01416 gene open 8588-9292
2899 CAMPWI010000017.1 GCA946998075_01417 gene open 9351-9752
2900 CAMPWI010000017.1 GCA946998075_01418 gene open 9742-10290
2901 CAMPWI010000017.1 GCA946998075_01419 gene open 10406-10699
2902 CAMPWI010000017.1 GCA946998075_01420 gene open 10696-11424
2903 CAMPWI010000017.1 GCA946998075_01421 gene open 11397-11570
2904 CAMPWI010000017.1 GCA946998075_01422 gene open 11567-11731
2905 CAMPWI010000017.1 GCA946998075_01423 gene open 11724-11933
2906 CAMPWI010000017.1 GCA946998075_01424 gene open 12041-12658
2907 CAMPWI010000017.1 GCA946998075_01425 gene open 12659-12850
2908 CAMPWI010000017.1 GCA946998075_01426 gene open 12859-13155
2909 CAMPWI010000017.1 GCA946998075_01427 gene open 13166-14047
2910 CAMPWI010000017.1 GCA946998075_01428 gene open 14058-16040
2911 CAMPWI010000017.1 GCA946998075_01429 gene open 16084-16362
2912 CAMPWI010000017.1 GCA946998075_01430 gene open 16322-16555
2913 CAMPWI010000017.1 GCA946998075_01431 gene open 16581-17243 lexA
2914 CAMPWI010000017.1 GCA946998075_01432 gene open 17913-18821 glyQ
2915 CAMPWI010000017.1 GCA946998075_01433 gene open 18875-19525
2916 CAMPWI010000017.1 GCA946998075_01434 gene open 19525-19782
2917 CAMPWI010000017.1 GCA946998075_01435 gene open 19787-20233
2918 CAMPWI010000017.1 GCA946998075_01436 gene open 20243-21520
2919 CAMPWI010000017.1 GCA946998075_01437 gene open 21781-22422
2920 CAMPWI010000017.1 GCA946998075_01438 gene open 22484-24550 glyS
2921 CAMPWI010000017.1 GCA946998075_01440 gene open 24768-25493
2922 CAMPWI010000017.1 GCA946998075_01441 gene open 25571-26626
2923 CAMPWI010000017.1 GCA946998075_01442 gene open 26698-27042 yurZ
2924 CAMPWI010000017.1 GCA946998075_01443 gene open 27146-28036
2925 CAMPWI010000017.1 GCA946998075_01444 gene open 28113-29957 mdlB
2926 CAMPWI010000017.1 GCA946998075_01445 gene open 30091-30615 yceD
2927 CAMPWI010000017.1 GCA946998075_01446 gene open 30638-30808 rpmF
2928 CAMPWI010000017.1 GCA946998075_01447 gene open 30830-31849 plsX
2929 CAMPWI010000017.1 GCA946998075_01448 gene open 31868-32818
2930 CAMPWI010000017.1 GCA946998075_01449 gene open 32911-33849 fabD
2931 CAMPWI010000017.1 GCA946998075_01450 gene open 33864-34592 fabG
2932 CAMPWI010000017.1 GCA946998075_01451 gene open 34810-35040 acpP
2933 CAMPWI010000017.1 GCA946998075_01452 gene open 35323-36990 dcuA
2934 CAMPWI010000017.1 GCA946998075_01453 gene open 37296-37838 aroK
2935 CAMPWI010000017.1 GCA946998075_01454 gene open 37848-38936 aroB
2936 CAMPWI010000017.1 GCA946998075_01455 gene open 38951-39805
2937 CAMPWI010000017.1 GCA946998075_01456 gene open 39807-40127
2938 CAMPWI010000017.1 GCA946998075_01457 gene open 40200-40517 secM
2939 CAMPWI010000017.1 GCA946998075_01458 gene open 40591-43287 secA
2940 CAMPWI010000017.1 GCA946998075_01459 gene open 43375-43779 mutT
2941 CAMPWI010000017.1 GCA946998075_01460 gene open 43802-45466
2942 CAMPWI010000017.1 GCA946998075_01461 gene open 45497-46534 holA
2943 CAMPWI010000017.1 GCA946998075_01462 gene open 46534-47037 lptE
2944 CAMPWI010000017.1 GCA946998075_01463 gene open 47125-49713 leuS
2945 CAMPWI010000017.1 GCA946998075_01464 gene open 49832-50119 yggU
2946 CAMPWI010000017.1 GCA946998075_01465 gene open 50203-50748 yggT
2947 CAMPWI010000017.1 GCA946998075_01466 gene open 50748-51695 corA
2948 CAMPWI010000017.1 GCA946998075_01468 gene open 52014-52613
2949 CAMPWI010000017.1 GCA946998075_01469 gene open 52698-53009
2950 CAMPWI010000017.1 GCA946998075_01470 gene open 53362-54705
2951 CAMPWI010000017.1 GCA946998075_01439 gene open 24638-24714 trnI
2952 CAMPWI010000017.1 GCA946998075_01439 tRNA open 24638-24714 trnI tRNA-Ile2(cat)
2953 CAMPWI010000018.1 regulatory_region open 31742-31857 Alpha operon ribosome binding site
2954 CAMPWI010000018.1 GCA946998075_01471 CDS open 358-627 _na     89_aa hypothetical protein
2955 CAMPWI010000018.1 GCA946998075_01472 CDS open 822-1079 _na     85_aa Ribokinase
2956 CAMPWI010000018.1 GCA946998075_01473 CDS open 1231-1965 _na     244_aa deoR DNA-binding transcriptional repressor DeoR
2957 CAMPWI010000018.1 GCA946998075_01474 CDS open 2005-2679 _na     224_aa deoC deoxyribose-phosphate aldolase
2958 CAMPWI010000018.1 GCA946998075_01475 CDS open 2745-4526 _na     593_aa proS proline--tRNA ligase
2959 CAMPWI010000018.1 GCA946998075_01476 CDS open 4556-5785 _na     409_aa nlpD murein hydrolase activator NlpD
2960 CAMPWI010000018.1 GCA946998075_01477 CDS open 5809-5997 _na     62_aa Lipoprotein
2961 CAMPWI010000018.1 GCA946998075_01478 CDS open 6014-6589 _na     191_aa VTT domain-containing protein
2962 CAMPWI010000018.1 GCA946998075_01479 CDS open 6643-7383 _na     246_aa surE 5'/3'-nucleotidase SurE
2963 CAMPWI010000018.1 GCA946998075_01480 CDS open 7383-8405 _na     340_aa truD tRNA pseudouridine(13) synthase TruD
2964 CAMPWI010000018.1 GCA946998075_01481 CDS open 8613-9041 _na     142_aa rraB ribonuclease E inhibitor RraB
2965 CAMPWI010000018.1 GCA946998075_01482 CDS open 9104-9817 _na     237_aa SIMPL domain-containing protein
2966 CAMPWI010000018.1 GCA946998075_01483 CDS open 9862-10506 _na     214_aa slyD peptidylprolyl isomerase
2967 CAMPWI010000018.1 GCA946998075_01484 CDS open 10557-11114 _na     185_aa UPF0114 protein NCTC10665_00665
2968 CAMPWI010000018.1 GCA946998075_01485 CDS open 11184-12794 _na     536_aa Recombination limiting protein
2969 CAMPWI010000018.1 GCA946998075_01486 CDS open 12911-13306 _na     131_aa hslR ribosome-associated heat shock protein Hsp15
2970 CAMPWI010000018.1 GCA946998075_01487 CDS open 13372-13920 _na     182_aa nudE ADP compounds hydrolase NudE
2971 CAMPWI010000018.1 GCA946998075_01488 CDS open 14035-16035 _na     666_aa OPT family oligopeptide transporter
2972 CAMPWI010000018.1 GCA946998075_01489 CDS open 16086-16892 _na     268_aa cysQ 3'(2')%2C5'-bisphosphate nucleotidase CysQ
2973 CAMPWI010000018.1 GCA946998075_01490 CDS open 16966-18447 _na     493_aa zwf glucose-6-phosphate dehydrogenase
2974 CAMPWI010000018.1 GCA946998075_01491 CDS open 18536-19234 _na     232_aa pgl 6-phosphogluconolactonase
2975 CAMPWI010000018.1 GCA946998075_01492 CDS open 19268-19660 _na     130_aa N-acetyltransferase domain-containing protein
2976 CAMPWI010000018.1 GCA946998075_01493 CDS open 19687-20103 _na     138_aa Lipoprotein
2977 CAMPWI010000018.1 GCA946998075_01494 CDS open 20191-21645 _na     484_aa gnd decarboxylating NADP(+)-dependent phosphogluconate dehydrogenase
2978 CAMPWI010000018.1 GCA946998075_01495 CDS open 21725-22045 _na     106_aa DUF4298 domain-containing protein
2979 CAMPWI010000018.1 GCA946998075_01496 CDS open 22175-22378 _na     67_aa surface antigen
2980 CAMPWI010000018.1 GCA946998075_01497 CDS open 22420-23748 _na     442_aa srmB ATP-dependent RNA helicase SrmB
2981 CAMPWI010000018.1 GCA946998075_01498 CDS open 23870-24517 _na     215_aa tRNA1(Val) (adenine(37)-N6)-methyltransferase
2982 CAMPWI010000018.1 GCA946998075_01499 CDS open 24552-25235 _na     227_aa pnuC nicotinamide riboside transporter PnuC
2983 CAMPWI010000018.1 GCA946998075_01500 CDS open 25435-28197 _na     920_aa rapA RNA polymerase-associated protein RapA
2984 CAMPWI010000018.1 GCA946998075_01501 CDS open 28199-28858 _na     219_aa rluA bifunctional tRNA pseudouridine(32) synthase/23S rRNA pseudouridine(746) synthase RluA
2985 CAMPWI010000018.1 GCA946998075_01502 CDS open 28917-29300 _na     127_aa rplQ 50S ribosomal protein L17
2986 CAMPWI010000018.1 GCA946998075_01503 CDS open 29341-30330 _na     329_aa rpoA DNA-directed RNA polymerase subunit alpha
2987 CAMPWI010000018.1 GCA946998075_01504 CDS open 30362-30982 _na     206_aa rpsD 30S ribosomal protein S4
2988 CAMPWI010000018.1 GCA946998075_01505 CDS open 31012-31401 _na     129_aa rpsK 30S ribosomal protein S11
2989 CAMPWI010000018.1 GCA946998075_01506 CDS open 31418-31774 _na     118_aa rpsM 30S ribosomal protein S13
2990 CAMPWI010000018.1 GCA946998075_01507 CDS open 31916-32029 _na     37_aa rpmJ 50S ribosomal protein L36
2991 CAMPWI010000018.1 GCA946998075_01508 CDS open 32058-33383 _na     441_aa secY preprotein translocase subunit SecY
2992 CAMPWI010000018.1 GCA946998075_01509 CDS open 33391-33825 _na     144_aa rplO 50S ribosomal protein L15
2993 CAMPWI010000018.1 GCA946998075_01510 CDS open 33830-34009 _na     59_aa rpmD 50S ribosomal protein L30
2994 CAMPWI010000018.1 GCA946998075_01511 CDS open 34016-34516 _na     166_aa rpsE 30S ribosomal protein S5
2995 CAMPWI010000018.1 GCA946998075_01512 CDS open 34531-34884 _na     117_aa rplR 50S ribosomal protein L18
2996 CAMPWI010000018.1 GCA946998075_01513 CDS open 34898-35431 _na     177_aa rplF 50S ribosomal protein L6
2997 CAMPWI010000018.1 GCA946998075_01514 CDS open 35447-35839 _na     130_aa rpsH 30S ribosomal protein S8
2998 CAMPWI010000018.1 GCA946998075_01515 CDS open 35876-36181 _na     101_aa rpsN 30S ribosomal protein S14
2999 CAMPWI010000018.1 GCA946998075_01516 CDS open 36193-36732 _na     179_aa rplE 50S ribosomal protein L5
3000 CAMPWI010000018.1 GCA946998075_01517 CDS open 36750-37061 _na     103_aa rplX 50S ribosomal protein L24