HOMD Banner
Taxonomy: V4.3   |  16S rRNA RefSeq: V16.03   |  Genomic RefSeq: V11.03   |  Viruses: V1.2

BAKTAGenome Explorer: Prevotella amnii (GCA_946999245.1)

Select a Genome:
BAKTA Annotations for GCA_946999245.1
Genome Selected: Prevotella amnii
ContigsBases CDSrRNA tmRNAtRNA
56 1930108 1617 0 1 38
[Table]   [AA Fasta]      [Browser]   [Text]   [Excel]  
Search & Sort all 3325 Records
Search These Records: Clear
Sort Column:   Molecule   PID   NA   AA   Gene  Gene Product  Reverse
Annotation Table [page:4]    |    Number of Records Found: 3325 [7 Pages]    |    Previous Page <==> Next Page    |    Jump to Page: [ 1  2  3  4  5  6  7  ]
Notes:   1- Column headers only sort the current page. 2- Select [NA] or [AA] links to show sequences.
Region Protein-ID Type Genome
Viewer		 Range
(bp)		 Show Sequences
(length) NA / AA		 BAKTA
Gene		 BAKTA
GeneProduct
1501 CAMQCF010000010.1 GCA946999245_00728 gene open 5236-6387
1502 CAMQCF010000010.1 GCA946999245_00729 gene open 6396-7472
1503 CAMQCF010000010.1 GCA946999245_00730 gene open 7469-8521
1504 CAMQCF010000010.1 GCA946999245_00731 gene open 8529-9479
1505 CAMQCF010000010.1 GCA946999245_00732 gene open 9565-10437
1506 CAMQCF010000010.1 GCA946999245_00733 gene open 10437-11552 epsG
1507 CAMQCF010000010.1 GCA946999245_00734 gene open 11617-12171
1508 CAMQCF010000010.1 GCA946999245_00735 gene open 12171-13325
1509 CAMQCF010000010.1 GCA946999245_00736 gene open 13332-14348
1510 CAMQCF010000010.1 GCA946999245_00737 gene open 14361-15326
1511 CAMQCF010000010.1 GCA946999245_00738 gene open 15389-16927
1512 CAMQCF010000010.1 GCA946999245_00739 gene open 17297-18547
1513 CAMQCF010000010.1 GCA946999245_00740 gene open 18652-19848
1514 CAMQCF010000010.1 GCA946999245_00741 gene open 20636-21046
1515 CAMQCF010000010.1 GCA946999245_00742 gene open 21052-23550
1516 CAMQCF010000010.1 GCA946999245_00743 gene open 23583-24461 rfbA
1517 CAMQCF010000010.1 GCA946999245_00744 gene open 24752-25384
1518 CAMQCF010000010.1 GCA946999245_00745 gene open 25460-25753 zapB
1519 CAMQCF010000010.1 GCA946999245_00746 gene open 25790-26083 zapA
1520 CAMQCF010000010.1 GCA946999245_00747 gene open 26121-27662 rny
1521 CAMQCF010000010.1 GCA946999245_00748 gene open 27836-28864 holA
1522 CAMQCF010000010.1 GCA946999245_00749 gene open 29091-30152
1523 CAMQCF010000010.1 GCA946999245_00750 gene open 30212-32257
1524 CAMQCF010000010.1 GCA946999245_00751 gene open 32263-33153 fic
1525 CAMQCF010000010.1 GCA946999245_00752 gene open 33180-34232 fIDO
1526 CAMQCF010000010.1 GCA946999245_00753 gene open 34261-34479
1527 CAMQCF010000010.1 GCA946999245_00754 gene open 34542-38012
1528 CAMQCF010000010.1 GCA946999245_00755 gene open 38259-38909
1529 CAMQCF010000010.1 GCA946999245_00756 gene open 38912-39832
1530 CAMQCF010000010.1 GCA946999245_00757 gene open 39829-40182 mobC
1531 CAMQCF010000010.1 GCA946999245_00758 gene open 40326-41216
1532 CAMQCF010000010.1 GCA946999245_00759 gene open 41435-42649
1533 CAMQCF010000010.1 GCA946999245_00760 gene open 42661-43017
1534 CAMQCF010000010.1 GCA946999245_00761 gene open 43117-43863
1535 CAMQCF010000010.1 GCA946999245_00762 gene open 43878-45134 fimB
1536 CAMQCF010000010.1 GCA946999245_00763 gene open 45148-45411
1537 CAMQCF010000010.1 GCA946999245_00764 gene open 45500-45706
1538 CAMQCF010000010.1 GCA946999245_00765 gene open 45914-47815 dnaK
1539 CAMQCF010000010.1 GCA946999245_00766 gene open 48010-48438
1540 CAMQCF010000010.1 GCA946999245_00767 gene open 49098-51890
1541 CAMQCF010000010.1 GCA946999245_00768 gene open 51921-53297
1542 CAMQCF010000010.1 GCA946999245_00769 gene open 53315-53989
1543 CAMQCF010000010.1 GCA946999245_00770 gene open 54055-55599
1544 CAMQCF010000010.1 GCA946999245_00771 gene open 55679-57193
1545 CAMQCF010000010.1 GCA946999245_00772 gene open 57269-58108
1546 CAMQCF010000011.1 GCA946999245_00773 CDS open 82-1644 _na     520_aa ahpF alkyl hydroperoxide reductase subunit F
1547 CAMQCF010000011.1 GCA946999245_00774 CDS open 1788-2354 _na     188_aa ahpC alkyl hydroperoxide reductase subunit C
1548 CAMQCF010000011.1 GCA946999245_00775 CDS open 2588-3526 _na     312_aa Transcriptional regulator
1549 CAMQCF010000011.1 GCA946999245_00776 CDS open 3695-4555 _na     286_aa Serine protease
1550 CAMQCF010000011.1 GCA946999245_00777 CDS open 4646-6052 _na     468_aa Xaa-Pro aminopeptidase
1551 CAMQCF010000011.1 GCA946999245_00778 CDS open 6139-7344 _na     401_aa Aminopeptidase
1552 CAMQCF010000011.1 GCA946999245_00779 CDS open 7436-9160 _na     574_aa recJ single-stranded-DNA-specific exonuclease RecJ
1553 CAMQCF010000011.1 GCA946999245_00780 CDS open 9200-11095 _na     631_aa recQ ATP-dependent DNA helicase RecQ
1554 CAMQCF010000011.1 GCA946999245_00781 CDS open 11244-12230 _na     328_aa Oxidoreductase%2C NAD-binding domain protein
1555 CAMQCF010000011.1 GCA946999245_00782 CDS open 12311-13447 _na     378_aa DUF4421 domain-containing protein
1556 CAMQCF010000011.1 GCA946999245_00783 CDS open 14569-15015 _na     148_aa DNA-binding helix-turn-helix protein
1557 CAMQCF010000011.1 GCA946999245_00784 CDS open 15394-16212 _na     272_aa Nitroreductase family protein
1558 CAMQCF010000011.1 GCA946999245_00785 CDS open 16235-18835 _na     866_aa adenosylcobalamin-dependent ribonucleoside-diphosphate reductase
1559 CAMQCF010000011.1 GCA946999245_00786 CDS open 18959-19369 _na     136_aa folB dihydroneopterin aldolase
1560 CAMQCF010000011.1 GCA946999245_00787 CDS open 19395-20618 _na     407_aa N-acetylmuramoyl-L-alanine amidase
1561 CAMQCF010000011.1 GCA946999245_00788 CDS open 20625-21605 _na     326_aa Mce/MlaD domain-containing protein
1562 CAMQCF010000011.1 GCA946999245_00789 CDS open 22037-22174 _na     45_aa hypothetical protein
1563 CAMQCF010000011.1 GCA946999245_00790 CDS open 22210-23313 _na     367_aa hypothetical protein
1564 CAMQCF010000011.1 GCA946999245_00791 CDS open 23388-23843 _na     151_aa Phage portal protein
1565 CAMQCF010000011.1 GCA946999245_00792 CDS open 23855-25774 _na     639_aa Major capsid protein
1566 CAMQCF010000011.1 GCA946999245_00793 CDS open 25776-27224 _na     482_aa Replication protein
1567 CAMQCF010000011.1 GCA946999245_00794 CDS open 27224-27400 _na     58_aa hypothetical protein
1568 CAMQCF010000011.1 GCA946999245_00795 CDS open 27427-27729 _na     100_aa Peptidase M15A C-terminal domain-containing protein
1569 CAMQCF010000011.1 GCA946999245_00796 CDS open 27894-29042 _na     382_aa lpxB lipid-A-disaccharide synthase
1570 CAMQCF010000011.1 GCA946999245_00797 CDS open 29105-29866 _na     253_aa surE 5'/3'-nucleotidase SurE
1571 CAMQCF010000011.1 GCA946999245_00798 CDS open 29981-30745 _na     254_aa parA AAA domain-containing protein
1572 CAMQCF010000011.1 GCA946999245_00799 CDS open 30769-31680 _na     303_aa ParB-like protein
1573 CAMQCF010000011.1 GCA946999245_00800 CDS open 31735-32529 _na     264_aa DUF5683 domain-containing protein
1574 CAMQCF010000011.1 GCA946999245_00801 CDS open 32588-34879 _na     763_aa Putative GTP diphosphokinase
1575 CAMQCF010000011.1 GCA946999245_00802 CDS open 34973-35740 _na     255_aa Acyltransferase
1576 CAMQCF010000011.1 GCA946999245_00803 CDS open 35757-36950 _na     397_aa Ser/Thr phosphatase family protein
1577 CAMQCF010000011.1 GCA946999245_00804 CDS open 37040-38389 _na     449_aa dihydroorotase
1578 CAMQCF010000011.1 GCA946999245_00805 CDS open 38427-39275 _na     282_aa DUF4369 domain-containing protein
1579 CAMQCF010000011.1 GCA946999245_00806 CDS open 39384-39803 _na     139_aa DUF4199 domain-containing protein
1580 CAMQCF010000011.1 GCA946999245_00807 CDS open 39808-40137 _na     109_aa Septum formation initiator
1581 CAMQCF010000011.1 GCA946999245_00808 CDS open 40360-40902 _na     180_aa 2-oxoacid:ferredoxin/flavodoxin oxidoreductase%2C gamma subunit
1582 CAMQCF010000011.1 GCA946999245_00809 CDS open 40987-41754 _na     255_aa 2-oxoacid:ferredoxin oxidoreductase%2C beta subunit
1583 CAMQCF010000011.1 GCA946999245_00810 CDS open 41764-42852 _na     362_aa 2-ketoisovalerate ferredoxin oxidoreductase
1584 CAMQCF010000011.1 GCA946999245_00811 CDS open 42856-43089 _na     77_aa Ferredoxin
1585 CAMQCF010000011.1 GCA946999245_00812 CDS open 43102-43281 _na     59_aa Tetratricopeptide repeat protein
1586 CAMQCF010000011.1 GCA946999245_00813 CDS open 43298-44182 _na     294_aa folD bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD
1587 CAMQCF010000011.1 GCA946999245_00814 CDS open 44200-45570 _na     456_aa ffh signal recognition particle protein
1588 CAMQCF010000011.1 GCA946999245_00815 CDS open 46194-47078 _na     294_aa GYF domain-containing protein
1589 CAMQCF010000011.1 GCA946999245_00816 CDS open 47126-48103 _na     325_aa Endonuclease
1590 CAMQCF010000011.1 GCA946999245_00817 CDS open 48176-49246 _na     356_aa Cytochrome C4
1591 CAMQCF010000011.1 GCA946999245_00818 CDS open 49300-52014 _na     904_aa calcium-translocating P-type ATPase%2C PMCA-type
1592 CAMQCF010000011.1 GCA946999245_00819 CDS open 52046-52876 _na     276_aa CAAX amino terminal protease family protein
1593 CAMQCF010000011.1 GCA946999245_00820 CDS open 52928-53869 _na     313_aa bifunctional riboflavin kinase/FAD synthetase
1594 CAMQCF010000011.1 GCA946999245_00773 gene open 82-1644 ahpF
1595 CAMQCF010000011.1 GCA946999245_00774 gene open 1788-2354 ahpC
1596 CAMQCF010000011.1 GCA946999245_00775 gene open 2588-3526
1597 CAMQCF010000011.1 GCA946999245_00776 gene open 3695-4555
1598 CAMQCF010000011.1 GCA946999245_00777 gene open 4646-6052
1599 CAMQCF010000011.1 GCA946999245_00778 gene open 6139-7344
1600 CAMQCF010000011.1 GCA946999245_00779 gene open 7436-9160 recJ
1601 CAMQCF010000011.1 GCA946999245_00780 gene open 9200-11095 recQ
1602 CAMQCF010000011.1 GCA946999245_00781 gene open 11244-12230
1603 CAMQCF010000011.1 GCA946999245_00782 gene open 12311-13447
1604 CAMQCF010000011.1 GCA946999245_00783 gene open 14569-15015
1605 CAMQCF010000011.1 GCA946999245_00784 gene open 15394-16212
1606 CAMQCF010000011.1 GCA946999245_00785 gene open 16235-18835
1607 CAMQCF010000011.1 GCA946999245_00786 gene open 18959-19369 folB
1608 CAMQCF010000011.1 GCA946999245_00787 gene open 19395-20618
1609 CAMQCF010000011.1 GCA946999245_00788 gene open 20625-21605
1610 CAMQCF010000011.1 GCA946999245_00789 gene open 22037-22174
1611 CAMQCF010000011.1 GCA946999245_00790 gene open 22210-23313
1612 CAMQCF010000011.1 GCA946999245_00791 gene open 23388-23843
1613 CAMQCF010000011.1 GCA946999245_00792 gene open 23855-25774
1614 CAMQCF010000011.1 GCA946999245_00793 gene open 25776-27224
1615 CAMQCF010000011.1 GCA946999245_00794 gene open 27224-27400
1616 CAMQCF010000011.1 GCA946999245_00795 gene open 27427-27729
1617 CAMQCF010000011.1 GCA946999245_00796 gene open 27894-29042 lpxB
1618 CAMQCF010000011.1 GCA946999245_00797 gene open 29105-29866 surE
1619 CAMQCF010000011.1 GCA946999245_00798 gene open 29981-30745 parA
1620 CAMQCF010000011.1 GCA946999245_00799 gene open 30769-31680
1621 CAMQCF010000011.1 GCA946999245_00800 gene open 31735-32529
1622 CAMQCF010000011.1 GCA946999245_00801 gene open 32588-34879
1623 CAMQCF010000011.1 GCA946999245_00802 gene open 34973-35740
1624 CAMQCF010000011.1 GCA946999245_00803 gene open 35757-36950
1625 CAMQCF010000011.1 GCA946999245_00804 gene open 37040-38389
1626 CAMQCF010000011.1 GCA946999245_00805 gene open 38427-39275
1627 CAMQCF010000011.1 GCA946999245_00806 gene open 39384-39803
1628 CAMQCF010000011.1 GCA946999245_00807 gene open 39808-40137
1629 CAMQCF010000011.1 GCA946999245_00808 gene open 40360-40902
1630 CAMQCF010000011.1 GCA946999245_00809 gene open 40987-41754
1631 CAMQCF010000011.1 GCA946999245_00810 gene open 41764-42852
1632 CAMQCF010000011.1 GCA946999245_00811 gene open 42856-43089
1633 CAMQCF010000011.1 GCA946999245_00812 gene open 43102-43281
1634 CAMQCF010000011.1 GCA946999245_00813 gene open 43298-44182 folD
1635 CAMQCF010000011.1 GCA946999245_00814 gene open 44200-45570 ffh
1636 CAMQCF010000011.1 GCA946999245_00815 gene open 46194-47078
1637 CAMQCF010000011.1 GCA946999245_00816 gene open 47126-48103
1638 CAMQCF010000011.1 GCA946999245_00817 gene open 48176-49246
1639 CAMQCF010000011.1 GCA946999245_00818 gene open 49300-52014
1640 CAMQCF010000011.1 GCA946999245_00819 gene open 52046-52876
1641 CAMQCF010000011.1 GCA946999245_00820 gene open 52928-53869
1642 CAMQCF010000011.1 GCA946999245_00821 gene open 54243-54316 trnI
1643 CAMQCF010000011.1 GCA946999245_00821 tRNA open 54243-54316 trnI tRNA-Ile2(cat)
1644 CAMQCF010000012.1 GCA946999245_00822 CDS open 48-1007 _na     319_aa DUF6057 domain-containing protein
1645 CAMQCF010000012.1 GCA946999245_00823 CDS open 1021-3090 _na     689_aa 1%2C4-alpha-glucan branching enzyme
1646 CAMQCF010000012.1 GCA946999245_00824 CDS open 3109-4155 _na     348_aa Phosphatidylinositol-4-phosphate 5-kinase
1647 CAMQCF010000012.1 GCA946999245_00825 CDS open 4311-5774 _na     487_aa Metal-independent alpha-mannosidase
1648 CAMQCF010000012.1 GCA946999245_00826 CDS open 5809-6012 _na     67_aa hypothetical protein
1649 CAMQCF010000012.1 GCA946999245_00827 CDS open 6409-7452 _na     347_aa rlmN 23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN
1650 CAMQCF010000012.1 GCA946999245_00828 CDS open 7445-8362 _na     305_aa DUF4837 domain-containing protein
1651 CAMQCF010000012.1 GCA946999245_00829 CDS open 8414-9514 _na     366_aa pdxA Pyridoxal phosphate biosynthetic protein PdxA
1652 CAMQCF010000012.1 GCA946999245_00830 CDS open 9626-11020 _na     464_aa glmM phosphoglucosamine mutase
1653 CAMQCF010000012.1 GCA946999245_00831 CDS open 11048-11689 _na     213_aa DUF4827 domain-containing protein
1654 CAMQCF010000012.1 GCA946999245_00832 CDS open 11930-12799 _na     289_aa Electron transfer flavoprotein%2C beta subunit
1655 CAMQCF010000012.1 GCA946999245_00833 CDS open 12814-13836 _na     340_aa Electron transfer flavoprotein%2C alpha subunit
1656 CAMQCF010000012.1 GCA946999245_00834 CDS open 13910-15619 _na     569_aa Acyl-CoA dehydrogenase protein
1657 CAMQCF010000012.1 GCA946999245_00835 CDS open 15844-17817 _na     657_aa rho transcription termination factor Rho
1658 CAMQCF010000012.1 GCA946999245_00836 CDS open 18267-20477 _na     736_aa MFS transporter
1659 CAMQCF010000012.1 GCA946999245_00837 CDS open 20701-21666 _na     321_aa K+-dependent Na+/Ca+ exchanger family protein
1660 CAMQCF010000012.1 GCA946999245_00838 CDS open 21938-22975 _na     345_aa galE UDP-glucose 4-epimerase GalE
1661 CAMQCF010000012.1 GCA946999245_00839 CDS open 23063-23974 _na     303_aa Lipoprotein
1662 CAMQCF010000012.1 GCA946999245_00840 CDS open 23985-25079 _na     364_aa Carbohydrate binding domain protein
1663 CAMQCF010000012.1 GCA946999245_00841 CDS open 25110-26285 _na     391_aa DUF4856 domain-containing protein
1664 CAMQCF010000012.1 GCA946999245_00842 CDS open 26304-27032 _na     242_aa Lipoprotein
1665 CAMQCF010000012.1 GCA946999245_00843 CDS open 27061-28086 _na     341_aa DUF4302 domain-containing protein
1666 CAMQCF010000012.1 GCA946999245_00844 CDS open 28088-29041 _na     317_aa Lipoprotein
1667 CAMQCF010000012.1 GCA946999245_00845 CDS open 29075-30604 _na     509_aa SusD-like N-terminal domain-containing protein
1668 CAMQCF010000012.1 GCA946999245_00846 CDS open 30606-33995 _na     1129_aa TonB-linked outer membrane protein%2C SusC/RagA family
1669 CAMQCF010000012.1 GCA946999245_00847 CDS open 34040-36295 _na     751_aa fecA TonB-dependent receptor plug domain protein
1670 CAMQCF010000012.1 GCA946999245_00849 CDS open 36723-37610 _na     295_aa Acyltransferase
1671 CAMQCF010000012.1 GCA946999245_00850 CDS open 37603-38685 _na     360_aa Agmatine deiminase
1672 CAMQCF010000012.1 GCA946999245_00851 CDS open 38990-39094 _na     34_aa hypothetical protein
1673 CAMQCF010000012.1 GCA946999245_00852 CDS open 39667-40359 _na     230_aa cmk (d)CMP kinase
1674 CAMQCF010000012.1 GCA946999245_00853 CDS open 40627-41412 _na     261_aa TonB-dependent receptor
1675 CAMQCF010000012.1 GCA946999245_00854 CDS open 41471-42445 _na     324_aa Polyprenyl synthetase
1676 CAMQCF010000012.1 GCA946999245_00855 CDS open 42454-43263 _na     269_aa tatD Hydrolase%2C TatD family
1677 CAMQCF010000012.1 GCA946999245_00857 CDS open 43818-44024 _na     68_aa hypothetical protein
1678 CAMQCF010000012.1 GCA946999245_00858 CDS open 44513-44692 _na     59_aa hypothetical protein
1679 CAMQCF010000012.1 GCA946999245_00822 gene open 48-1007
1680 CAMQCF010000012.1 GCA946999245_00823 gene open 1021-3090
1681 CAMQCF010000012.1 GCA946999245_00824 gene open 3109-4155
1682 CAMQCF010000012.1 GCA946999245_00825 gene open 4311-5774
1683 CAMQCF010000012.1 GCA946999245_00826 gene open 5809-6012
1684 CAMQCF010000012.1 GCA946999245_00827 gene open 6409-7452 rlmN
1685 CAMQCF010000012.1 GCA946999245_00828 gene open 7445-8362
1686 CAMQCF010000012.1 GCA946999245_00829 gene open 8414-9514 pdxA
1687 CAMQCF010000012.1 GCA946999245_00830 gene open 9626-11020 glmM
1688 CAMQCF010000012.1 GCA946999245_00831 gene open 11048-11689
1689 CAMQCF010000012.1 GCA946999245_00832 gene open 11930-12799
1690 CAMQCF010000012.1 GCA946999245_00833 gene open 12814-13836
1691 CAMQCF010000012.1 GCA946999245_00834 gene open 13910-15619
1692 CAMQCF010000012.1 GCA946999245_00835 gene open 15844-17817 rho
1693 CAMQCF010000012.1 GCA946999245_00836 gene open 18267-20477
1694 CAMQCF010000012.1 GCA946999245_00837 gene open 20701-21666
1695 CAMQCF010000012.1 GCA946999245_00838 gene open 21938-22975 galE
1696 CAMQCF010000012.1 GCA946999245_00839 gene open 23063-23974
1697 CAMQCF010000012.1 GCA946999245_00840 gene open 23985-25079
1698 CAMQCF010000012.1 GCA946999245_00841 gene open 25110-26285
1699 CAMQCF010000012.1 GCA946999245_00842 gene open 26304-27032
1700 CAMQCF010000012.1 GCA946999245_00843 gene open 27061-28086
1701 CAMQCF010000012.1 GCA946999245_00844 gene open 28088-29041
1702 CAMQCF010000012.1 GCA946999245_00845 gene open 29075-30604
1703 CAMQCF010000012.1 GCA946999245_00846 gene open 30606-33995
1704 CAMQCF010000012.1 GCA946999245_00847 gene open 34040-36295 fecA
1705 CAMQCF010000012.1 GCA946999245_00849 gene open 36723-37610
1706 CAMQCF010000012.1 GCA946999245_00850 gene open 37603-38685
1707 CAMQCF010000012.1 GCA946999245_00851 gene open 38990-39094
1708 CAMQCF010000012.1 GCA946999245_00852 gene open 39667-40359 cmk
1709 CAMQCF010000012.1 GCA946999245_00853 gene open 40627-41412
1710 CAMQCF010000012.1 GCA946999245_00854 gene open 41471-42445
1711 CAMQCF010000012.1 GCA946999245_00855 gene open 42454-43263 tatD
1712 CAMQCF010000012.1 GCA946999245_00857 gene open 43818-44024
1713 CAMQCF010000012.1 GCA946999245_00858 gene open 44513-44692
1714 CAMQCF010000012.1 GCA946999245_00848 gene open 36524-36597 trnR
1715 CAMQCF010000012.1 GCA946999245_00856 gene open 43280-43367 trnS
1716 CAMQCF010000012.1 GCA946999245_00848 tRNA open 36524-36597 trnR tRNA-Arg(ccg)
1717 CAMQCF010000012.1 GCA946999245_00856 tRNA open 43280-43367 trnS tRNA-Ser(gga)
1718 CAMQCF010000013.1 GCA946999245_00859 CDS open 493-924 _na     143_aa Mobilization protein
1719 CAMQCF010000013.1 GCA946999245_00860 CDS open 908-1969 _na     353_aa Mobilization protein
1720 CAMQCF010000013.1 GCA946999245_00861 CDS open 2509-4428 _na     639_aa Arylsulfatase
1721 CAMQCF010000013.1 GCA946999245_00862 CDS open 4425-5486 _na     353_aa Acyltransferase
1722 CAMQCF010000013.1 GCA946999245_00863 CDS open 5492-6520 _na     342_aa Acyltransferase
1723 CAMQCF010000013.1 GCA946999245_00864 CDS open 6517-7395 _na     292_aa decaprenyl-phosphate phosphoribosyltransferase
1724 CAMQCF010000013.1 GCA946999245_00865 CDS open 7396-7992 _na     198_aa HAD hydrolase%2C family IB
1725 CAMQCF010000013.1 GCA946999245_00866 CDS open 7952-8362 _na     136_aa gtrA Polysaccharide biosynthesis protein GtrA
1726 CAMQCF010000013.1 GCA946999245_00867 CDS open 8412-9776 _na     454_aa Glycosyltransferase RgtA/B/C/D-like domain-containing protein
1727 CAMQCF010000013.1 GCA946999245_00868 CDS open 9754-11187 _na     477_aa Glycosyltransferase RgtA/B/C/D-like domain-containing protein
1728 CAMQCF010000013.1 GCA946999245_00869 CDS open 11201-12193 _na     330_aa Glycosyltransferase%2C group 2 family protein
1729 CAMQCF010000013.1 GCA946999245_00870 CDS open 12275-13705 _na     476_aa Aspartate ammonia-lyase
1730 CAMQCF010000013.1 GCA946999245_00871 CDS open 14104-14745 _na     213_aa DUF4294 domain-containing protein
1731 CAMQCF010000013.1 GCA946999245_00872 CDS open 14751-15917 _na     388_aa cysteine-S-conjugate beta-lyase
1732 CAMQCF010000013.1 GCA946999245_00873 CDS open 15945-16787 _na     280_aa DUF3737 domain-containing protein
1733 CAMQCF010000013.1 GCA946999245_00874 CDS open 17005-19095 _na     696_aa Arylsulfatase
1734 CAMQCF010000013.1 GCA946999245_00875 CDS open 19167-19847 _na     226_aa PAP2 family protein
1735 CAMQCF010000013.1 GCA946999245_00876 CDS open 19924-20910 _na     328_aa Malate/lactate dehydrogenase
1736 CAMQCF010000013.1 GCA946999245_00877 CDS open 21499-22824 _na     441_aa ftsZ cell division protein FtsZ
1737 CAMQCF010000013.1 GCA946999245_00878 CDS open 22885-24342 _na     485_aa ftsA cell division protein FtsA
1738 CAMQCF010000013.1 GCA946999245_00879 CDS open 24384-25322 _na     312_aa ftsQ Cell division protein FtsQ
1739 CAMQCF010000013.1 GCA946999245_00880 CDS open 25328-26707 _na     459_aa murC UDP-N-acetylmuramate--L-alanine ligase
1740 CAMQCF010000013.1 GCA946999245_00881 CDS open 26741-27844 _na     367_aa murG undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase
1741 CAMQCF010000013.1 GCA946999245_00882 CDS open 27912-29210 _na     432_aa ftsW putative peptidoglycan glycosyltransferase FtsW
1742 CAMQCF010000013.1 GCA946999245_00883 CDS open 29371-30702 _na     443_aa murD UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase
1743 CAMQCF010000013.1 GCA946999245_00884 CDS open 30720-31991 _na     423_aa mraY phospho-N-acetylmuramoyl-pentapeptide-transferase
1744 CAMQCF010000013.1 GCA946999245_00885 CDS open 32027-33484 _na     485_aa UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2%2C6-diaminopimelate ligase
1745 CAMQCF010000013.1 GCA946999245_00886 CDS open 33535-35688 _na     717_aa Penicillin-binding protein%2C transpeptidase domain protein
1746 CAMQCF010000013.1 GCA946999245_00887 CDS open 35698-36234 _na     178_aa ftsL Cell division protein FtsL
1747 CAMQCF010000013.1 GCA946999245_00888 CDS open 36218-37174 _na     318_aa rsmH 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH
1748 CAMQCF010000013.1 GCA946999245_00889 CDS open 37239-37682 _na     147_aa mraZ Transcriptional regulator MraZ
1749 CAMQCF010000013.1 GCA946999245_00890 CDS open 37946-38773 _na     275_aa Putative acyltransferase ACT14924-like acyltransferase domain-containing protein
1750 CAMQCF010000013.1 GCA946999245_00891 CDS open 38829-39830 _na     333_aa Hemolysin
1751 CAMQCF010000013.1 GCA946999245_00892 CDS open 40194-41483 _na     429_aa NADH:ubiquinone reductase (non-electrogenic)
1752 CAMQCF010000013.1 GCA946999245_00893 CDS open 41578-43419 _na     613_aa Putative cold-shock DEAD-box protein A
1753 CAMQCF010000013.1 GCA946999245_00859 gene open 493-924
1754 CAMQCF010000013.1 GCA946999245_00860 gene open 908-1969
1755 CAMQCF010000013.1 GCA946999245_00861 gene open 2509-4428
1756 CAMQCF010000013.1 GCA946999245_00862 gene open 4425-5486
1757 CAMQCF010000013.1 GCA946999245_00863 gene open 5492-6520
1758 CAMQCF010000013.1 GCA946999245_00864 gene open 6517-7395
1759 CAMQCF010000013.1 GCA946999245_00865 gene open 7396-7992
1760 CAMQCF010000013.1 GCA946999245_00866 gene open 7952-8362 gtrA
1761 CAMQCF010000013.1 GCA946999245_00867 gene open 8412-9776
1762 CAMQCF010000013.1 GCA946999245_00868 gene open 9754-11187
1763 CAMQCF010000013.1 GCA946999245_00869 gene open 11201-12193
1764 CAMQCF010000013.1 GCA946999245_00870 gene open 12275-13705
1765 CAMQCF010000013.1 GCA946999245_00871 gene open 14104-14745
1766 CAMQCF010000013.1 GCA946999245_00872 gene open 14751-15917
1767 CAMQCF010000013.1 GCA946999245_00873 gene open 15945-16787
1768 CAMQCF010000013.1 GCA946999245_00874 gene open 17005-19095
1769 CAMQCF010000013.1 GCA946999245_00875 gene open 19167-19847
1770 CAMQCF010000013.1 GCA946999245_00876 gene open 19924-20910
1771 CAMQCF010000013.1 GCA946999245_00877 gene open 21499-22824 ftsZ
1772 CAMQCF010000013.1 GCA946999245_00878 gene open 22885-24342 ftsA
1773 CAMQCF010000013.1 GCA946999245_00879 gene open 24384-25322 ftsQ
1774 CAMQCF010000013.1 GCA946999245_00880 gene open 25328-26707 murC
1775 CAMQCF010000013.1 GCA946999245_00881 gene open 26741-27844 murG
1776 CAMQCF010000013.1 GCA946999245_00882 gene open 27912-29210 ftsW
1777 CAMQCF010000013.1 GCA946999245_00883 gene open 29371-30702 murD
1778 CAMQCF010000013.1 GCA946999245_00884 gene open 30720-31991 mraY
1779 CAMQCF010000013.1 GCA946999245_00885 gene open 32027-33484
1780 CAMQCF010000013.1 GCA946999245_00886 gene open 33535-35688
1781 CAMQCF010000013.1 GCA946999245_00887 gene open 35698-36234 ftsL
1782 CAMQCF010000013.1 GCA946999245_00888 gene open 36218-37174 rsmH
1783 CAMQCF010000013.1 GCA946999245_00889 gene open 37239-37682 mraZ
1784 CAMQCF010000013.1 GCA946999245_00890 gene open 37946-38773
1785 CAMQCF010000013.1 GCA946999245_00891 gene open 38829-39830
1786 CAMQCF010000013.1 GCA946999245_00892 gene open 40194-41483
1787 CAMQCF010000013.1 GCA946999245_00893 gene open 41578-43419
1788 CAMQCF010000014.1 GCA946999245_00894 CDS open 157-711 _na     184_aa hypothetical protein
1789 CAMQCF010000014.1 GCA946999245_00895 CDS open 970-1674 _na     234_aa tolA TolA protein
1790 CAMQCF010000014.1 GCA946999245_00896 CDS open 1873-2652 _na     259_aa Oxidoreductase%2C short chain dehydrogenase/reductase family protein
1791 CAMQCF010000014.1 GCA946999245_00897 CDS open 3194-4285 _na     363_aa Aldose 1-epimerase
1792 CAMQCF010000014.1 GCA946999245_00898 CDS open 4531-5847 _na     438_aa Major facilitator transporter
1793 CAMQCF010000014.1 GCA946999245_00899 CDS open 5928-7088 _na     386_aa galK galactokinase
1794 CAMQCF010000014.1 GCA946999245_00900 CDS open 7201-9324 _na     707_aa TonB-dependent receptor plug domain protein
1795 CAMQCF010000014.1 GCA946999245_00901 CDS open 9482-9607 _na     41_aa hypothetical protein
1796 CAMQCF010000014.1 GCA946999245_00902 CDS open 9612-10010 _na     132_aa hypothetical protein
1797 CAMQCF010000014.1 GCA946999245_00903 CDS open 10285-11367 _na     360_aa Glycosyltransferase%2C group 2 family protein
1798 CAMQCF010000014.1 GCA946999245_00904 CDS open 11531-12097 _na     188_aa efp elongation factor P
1799 CAMQCF010000014.1 GCA946999245_00905 CDS open 12319-12474 _na     51_aa rpmH 50S ribosomal protein L34
1800 CAMQCF010000014.1 GCA946999245_00906 CDS open 12598-13365 _na     255_aa PASTA domain protein
1801 CAMQCF010000014.1 GCA946999245_00907 CDS open 13375-14460 _na     361_aa Pseudouridine synthase
1802 CAMQCF010000014.1 GCA946999245_00908 CDS open 14505-15503 _na     332_aa D-alanine--D-alanine ligase
1803 CAMQCF010000014.1 GCA946999245_00909 CDS open 15526-16182 _na     218_aa NigD-like C-terminal beta sandwich domain-containing protein
1804 CAMQCF010000014.1 GCA946999245_00910 CDS open 16254-17441 _na     395_aa kbl glycine C-acetyltransferase
1805 CAMQCF010000014.1 GCA946999245_00911 CDS open 17550-17849 _na     99_aa hypothetical protein
1806 CAMQCF010000014.1 GCA946999245_00912 CDS open 18106-19065 _na     319_aa NAD dependent epimerase/dehydratase family protein
1807 CAMQCF010000014.1 GCA946999245_00913 CDS open 19153-22689 _na     1178_aa mfd transcription-repair coupling factor
1808 CAMQCF010000014.1 GCA946999245_00914 CDS open 22741-23487 _na     248_aa Glycosyltransferase%2C group 2 family protein
1809 CAMQCF010000014.1 GCA946999245_00915 CDS open 23568-24989 _na     473_aa cls cardiolipin synthase
1810 CAMQCF010000014.1 GCA946999245_00916 CDS open 25003-26940 _na     645_aa DNA primase
1811 CAMQCF010000014.1 GCA946999245_00917 CDS open 26960-27139 _na     59_aa hypothetical protein
1812 CAMQCF010000014.1 GCA946999245_00918 CDS open 27301-28743 _na     480_aa UvrD-like helicase C-terminal domain-containing protein
1813 CAMQCF010000014.1 GCA946999245_00919 CDS open 28757-29632 _na     291_aa Endonuclease
1814 CAMQCF010000014.1 GCA946999245_00920 CDS open 29651-30352 _na     233_aa Membrane protein
1815 CAMQCF010000014.1 GCA946999245_00921 CDS open 30371-31012 _na     213_aa hypothetical protein
1816 CAMQCF010000014.1 GCA946999245_00922 CDS open 31037-31852 _na     271_aa DUF3822 domain-containing protein
1817 CAMQCF010000014.1 GCA946999245_00923 CDS open 31873-32403 _na     176_aa rsmD 16S rRNA (guanine(966)-N(2))-methyltransferase RsmD
1818 CAMQCF010000014.1 GCA946999245_00924 CDS open 32420-32758 _na     112_aa merR Transcriptional regulator%2C MerR family
1819 CAMQCF010000014.1 GCA946999245_00925 CDS open 32850-32969 _na     39_aa hypothetical protein
1820 CAMQCF010000014.1 GCA946999245_00926 CDS open 32956-35610 _na     884_aa alaS alanine--tRNA ligase
1821 CAMQCF010000014.1 GCA946999245_00928 CDS open 35928-36074 _na     48_aa hypothetical protein
1822 CAMQCF010000014.1 GCA946999245_00929 CDS open 36124-36483 _na     119_aa rsfS ribosome silencing factor
1823 CAMQCF010000014.1 GCA946999245_00930 CDS open 36543-38663 _na     706_aa ftsH ATP-dependent zinc metalloprotease FtsH
1824 CAMQCF010000014.1 GCA946999245_00931 CDS open 38669-39535 _na     288_aa Phosphatidate cytidylyltransferase
1825 CAMQCF010000014.1 GCA946999245_00932 CDS open 39600-39992 _na     130_aa SprT-like domain-containing protein
1826 CAMQCF010000014.1 GCA946999245_00933 CDS open 40177-40929 _na     250_aa Outer membrane protein beta-barrel domain-containing protein
1827 CAMQCF010000014.1 GCA946999245_00934 CDS open 41218-41958 _na     246_aa fabG 3-oxoacyl-ACP reductase FabG
1828 CAMQCF010000014.1 GCA946999245_00894 gene open 157-711
1829 CAMQCF010000014.1 GCA946999245_00895 gene open 970-1674 tolA
1830 CAMQCF010000014.1 GCA946999245_00896 gene open 1873-2652
1831 CAMQCF010000014.1 GCA946999245_00897 gene open 3194-4285
1832 CAMQCF010000014.1 GCA946999245_00898 gene open 4531-5847
1833 CAMQCF010000014.1 GCA946999245_00899 gene open 5928-7088 galK
1834 CAMQCF010000014.1 GCA946999245_00900 gene open 7201-9324
1835 CAMQCF010000014.1 GCA946999245_00901 gene open 9482-9607
1836 CAMQCF010000014.1 GCA946999245_00902 gene open 9612-10010
1837 CAMQCF010000014.1 GCA946999245_00903 gene open 10285-11367
1838 CAMQCF010000014.1 GCA946999245_00904 gene open 11531-12097 efp
1839 CAMQCF010000014.1 GCA946999245_00905 gene open 12319-12474 rpmH
1840 CAMQCF010000014.1 GCA946999245_00906 gene open 12598-13365
1841 CAMQCF010000014.1 GCA946999245_00907 gene open 13375-14460
1842 CAMQCF010000014.1 GCA946999245_00908 gene open 14505-15503
1843 CAMQCF010000014.1 GCA946999245_00909 gene open 15526-16182
1844 CAMQCF010000014.1 GCA946999245_00910 gene open 16254-17441 kbl
1845 CAMQCF010000014.1 GCA946999245_00911 gene open 17550-17849
1846 CAMQCF010000014.1 GCA946999245_00912 gene open 18106-19065
1847 CAMQCF010000014.1 GCA946999245_00913 gene open 19153-22689 mfd
1848 CAMQCF010000014.1 GCA946999245_00914 gene open 22741-23487
1849 CAMQCF010000014.1 GCA946999245_00915 gene open 23568-24989 cls
1850 CAMQCF010000014.1 GCA946999245_00916 gene open 25003-26940
1851 CAMQCF010000014.1 GCA946999245_00917 gene open 26960-27139
1852 CAMQCF010000014.1 GCA946999245_00918 gene open 27301-28743
1853 CAMQCF010000014.1 GCA946999245_00919 gene open 28757-29632
1854 CAMQCF010000014.1 GCA946999245_00920 gene open 29651-30352
1855 CAMQCF010000014.1 GCA946999245_00921 gene open 30371-31012
1856 CAMQCF010000014.1 GCA946999245_00922 gene open 31037-31852
1857 CAMQCF010000014.1 GCA946999245_00923 gene open 31873-32403 rsmD
1858 CAMQCF010000014.1 GCA946999245_00924 gene open 32420-32758 merR
1859 CAMQCF010000014.1 GCA946999245_00925 gene open 32850-32969
1860 CAMQCF010000014.1 GCA946999245_00926 gene open 32956-35610 alaS
1861 CAMQCF010000014.1 GCA946999245_00928 gene open 35928-36074
1862 CAMQCF010000014.1 GCA946999245_00929 gene open 36124-36483 rsfS
1863 CAMQCF010000014.1 GCA946999245_00930 gene open 36543-38663 ftsH
1864 CAMQCF010000014.1 GCA946999245_00931 gene open 38669-39535
1865 CAMQCF010000014.1 GCA946999245_00932 gene open 39600-39992
1866 CAMQCF010000014.1 GCA946999245_00933 gene open 40177-40929
1867 CAMQCF010000014.1 GCA946999245_00934 gene open 41218-41958 fabG
1868 CAMQCF010000014.1 GCA946999245_00927 gene open 35833-35906 trnQ
1869 CAMQCF010000014.1 GCA946999245_00927 tRNA open 35833-35906 trnQ tRNA-Gln(ctg)
1870 CAMQCF010000015.1 repeat_region open 39556-40457 CRISPR array with 12 repeats of length 47%2C consensus sequence GTTGTGATTTGCTTAAAATTTCTTACCTTTGTAGATGTATAAACAAC and spacer length 29
1871 CAMQCF010000015.1 GCA946999245_00935 CDS open 1314-3962 _na     882_aa hypothetical protein
1872 CAMQCF010000015.1 GCA946999245_00936 CDS open 3966-7043 _na     1025_aa Tape measure domain protein
1873 CAMQCF010000015.1 GCA946999245_00937 CDS open 7116-7589 _na     157_aa hypothetical protein
1874 CAMQCF010000015.1 GCA946999245_00938 CDS open 7593-7868 _na     91_aa Toxin-antitoxin system%2C antitoxin component%2C ribbon-helix-helix domain protein
1875 CAMQCF010000015.1 GCA946999245_00939 CDS open 7913-8230 _na     105_aa Toxin-antitoxin system%2C antitoxin component%2C ribbon-helix-helix domain protein
1876 CAMQCF010000015.1 GCA946999245_00940 CDS open 8242-8697 _na     151_aa Phage major tail protein%2C TP901-1 family
1877 CAMQCF010000015.1 GCA946999245_00941 CDS open 8705-9091 _na     128_aa Phage protein
1878 CAMQCF010000015.1 GCA946999245_00942 CDS open 9088-9609 _na     173_aa Phage virion morphogeneis protein
1879 CAMQCF010000015.1 GCA946999245_00943 CDS open 9615-9935 _na     106_aa Putative phage head-tail adaptor
1880 CAMQCF010000015.1 GCA946999245_00944 CDS open 9932-10249 _na     105_aa head-tail connector protein
1881 CAMQCF010000015.1 GCA946999245_00945 CDS open 10277-11389 _na     370_aa phage major capsid protein
1882 CAMQCF010000015.1 GCA946999245_00946 CDS open 11437-12129 _na     230_aa Phage prohead protease%2C HK97 family
1883 CAMQCF010000015.1 GCA946999245_00947 CDS open 12092-13402 _na     436_aa phage portal protein
1884 CAMQCF010000015.1 GCA946999245_00948 CDS open 13512-13730 _na     72_aa Toxin-antitoxin system%2C antitoxin component%2C ribbon-helix-helix domain protein
1885 CAMQCF010000015.1 GCA946999245_00949 CDS open 13778-14581 _na     267_aa phage antirepressor KilAC domain-containing protein
1886 CAMQCF010000015.1 GCA946999245_00950 CDS open 14954-15049 _na     31_aa hypothetical protein
1887 CAMQCF010000015.1 GCA946999245_00951 CDS open 15140-15394 _na     84_aa DUF5053 domain-containing protein
1888 CAMQCF010000015.1 GCA946999245_00952 CDS open 15630-15812 _na     60_aa hicA Toxin-antitoxin system%2C toxin component%2C HicA family
1889 CAMQCF010000015.1 GCA946999245_00953 CDS open 15901-16299 _na     132_aa hicB Pilus assembly protein HicB
1890 CAMQCF010000015.1 GCA946999245_00954 CDS open 16364-18103 _na     579_aa Putative phage terminase%2C large subunit
1891 CAMQCF010000015.1 GCA946999245_00955 CDS open 18103-18462 _na     119_aa P27 family phage terminase small subunit
1892 CAMQCF010000015.1 GCA946999245_00956 CDS open 18576-18908 _na     110_aa yajD Putative HNH nuclease YajD
1893 CAMQCF010000015.1 GCA946999245_00957 CDS open 18959-20098 _na     379_aa Site-specific recombinase%2C phage integrase family
1894 CAMQCF010000015.1 GCA946999245_00959 CDS open 20534-21061 _na     175_aa Membrane protein
1895 CAMQCF010000015.1 GCA946999245_00960 CDS open 21141-22799 _na     552_aa Tetratricopeptide repeat protein
1896 CAMQCF010000015.1 GCA946999245_00961 CDS open 22810-24471 _na     553_aa recN DNA repair protein RecN
1897 CAMQCF010000015.1 GCA946999245_00962 CDS open 24563-25783 _na     406_aa coaBC bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC
1898 CAMQCF010000015.1 GCA946999245_00963 CDS open 25806-26669 _na     287_aa DNA polymerase III subunit epsilon
1899 CAMQCF010000015.1 GCA946999245_00964 CDS open 26877-28001 _na     374_aa dnaN DNA polymerase III subunit beta
1900 CAMQCF010000015.1 GCA946999245_00965 CDS open 28201-28593 _na     130_aa DUF3127 domain-containing protein
1901 CAMQCF010000015.1 GCA946999245_00966 CDS open 28726-29673 _na     315_aa DNA/RNA non-specific endonuclease
1902 CAMQCF010000015.1 GCA946999245_00967 CDS open 29816-30067 _na     83_aa rpmE type B 50S ribosomal protein L31
1903 CAMQCF010000015.1 GCA946999245_00968 CDS open 30218-31594 _na     458_aa Nucleic acid-binding domain protein
1904 CAMQCF010000015.1 GCA946999245_00969 CDS open 31633-32799 _na     388_aa DUF5689 domain-containing protein
1905 CAMQCF010000015.1 GCA946999245_00970 CDS open 32882-35464 _na     860_aa TonB-dependent receptor
1906 CAMQCF010000015.1 GCA946999245_00971 CDS open 35674-36723 _na     349_aa Endonuclease/exonuclease/phosphatase family protein
1907 CAMQCF010000015.1 GCA946999245_00972 CDS open 36764-37351 _na     195_aa Uracil-DNA glycosylase family protein
1908 CAMQCF010000015.1 GCA946999245_00973 CDS open 37396-38019 _na     207_aa udk uridine kinase
1909 CAMQCF010000015.1 GCA946999245_00974 CDS open 38788-39300 _na     170_aa DUF4468 domain-containing protein
1910 CAMQCF010000015.1 GCA946999245_00935 gene open 1314-3962
1911 CAMQCF010000015.1 GCA946999245_00936 gene open 3966-7043
1912 CAMQCF010000015.1 GCA946999245_00937 gene open 7116-7589
1913 CAMQCF010000015.1 GCA946999245_00938 gene open 7593-7868
1914 CAMQCF010000015.1 GCA946999245_00939 gene open 7913-8230
1915 CAMQCF010000015.1 GCA946999245_00940 gene open 8242-8697
1916 CAMQCF010000015.1 GCA946999245_00941 gene open 8705-9091
1917 CAMQCF010000015.1 GCA946999245_00942 gene open 9088-9609
1918 CAMQCF010000015.1 GCA946999245_00943 gene open 9615-9935
1919 CAMQCF010000015.1 GCA946999245_00944 gene open 9932-10249
1920 CAMQCF010000015.1 GCA946999245_00945 gene open 10277-11389
1921 CAMQCF010000015.1 GCA946999245_00946 gene open 11437-12129
1922 CAMQCF010000015.1 GCA946999245_00947 gene open 12092-13402
1923 CAMQCF010000015.1 GCA946999245_00948 gene open 13512-13730
1924 CAMQCF010000015.1 GCA946999245_00949 gene open 13778-14581
1925 CAMQCF010000015.1 GCA946999245_00950 gene open 14954-15049
1926 CAMQCF010000015.1 GCA946999245_00951 gene open 15140-15394
1927 CAMQCF010000015.1 GCA946999245_00952 gene open 15630-15812 hicA
1928 CAMQCF010000015.1 GCA946999245_00953 gene open 15901-16299 hicB
1929 CAMQCF010000015.1 GCA946999245_00954 gene open 16364-18103
1930 CAMQCF010000015.1 GCA946999245_00955 gene open 18103-18462
1931 CAMQCF010000015.1 GCA946999245_00956 gene open 18576-18908 yajD
1932 CAMQCF010000015.1 GCA946999245_00957 gene open 18959-20098
1933 CAMQCF010000015.1 GCA946999245_00959 gene open 20534-21061
1934 CAMQCF010000015.1 GCA946999245_00960 gene open 21141-22799
1935 CAMQCF010000015.1 GCA946999245_00961 gene open 22810-24471 recN
1936 CAMQCF010000015.1 GCA946999245_00962 gene open 24563-25783 coaBC
1937 CAMQCF010000015.1 GCA946999245_00963 gene open 25806-26669
1938 CAMQCF010000015.1 GCA946999245_00964 gene open 26877-28001 dnaN
1939 CAMQCF010000015.1 GCA946999245_00965 gene open 28201-28593
1940 CAMQCF010000015.1 GCA946999245_00966 gene open 28726-29673
1941 CAMQCF010000015.1 GCA946999245_00967 gene open 29816-30067 rpmE
1942 CAMQCF010000015.1 GCA946999245_00968 gene open 30218-31594
1943 CAMQCF010000015.1 GCA946999245_00969 gene open 31633-32799
1944 CAMQCF010000015.1 GCA946999245_00970 gene open 32882-35464
1945 CAMQCF010000015.1 GCA946999245_00971 gene open 35674-36723
1946 CAMQCF010000015.1 GCA946999245_00972 gene open 36764-37351
1947 CAMQCF010000015.1 GCA946999245_00973 gene open 37396-38019 udk
1948 CAMQCF010000015.1 GCA946999245_00974 gene open 38788-39300
1949 CAMQCF010000015.1 GCA946999245_00958 gene open 20287-20361 trnR
1950 CAMQCF010000015.1 GCA946999245_00958 tRNA open 20287-20361 trnR tRNA-Arg(tct)
1951 CAMQCF010000016.1 GCA946999245_00975 CDS open 154-765 _na     203_aa hypothetical protein
1952 CAMQCF010000016.1 GCA946999245_00976 CDS open 980-1201 _na     73_aa DUF2795 domain-containing protein
1953 CAMQCF010000016.1 GCA946999245_00977 CDS open 1286-1912 _na     208_aa Outer membrane protein beta-barrel domain-containing protein
1954 CAMQCF010000016.1 GCA946999245_00978 CDS open 1943-4240 _na     765_aa priA primosomal protein N'
1955 CAMQCF010000016.1 GCA946999245_00979 CDS open 4405-5931 _na     508_aa Outer membrane protein transport protein%2C Ompp1/FadL/TodX family
1956 CAMQCF010000016.1 GCA946999245_00980 CDS open 6119-8188 _na     689_aa 7TM receptor with intracellular HD hydrolase
1957 CAMQCF010000016.1 GCA946999245_00981 CDS open 8220-9812 _na     530_aa gltX glutamate--tRNA ligase
1958 CAMQCF010000016.1 GCA946999245_00982 CDS open 9859-11079 _na     406_aa 3-deoxy-D-manno-octulosonic acid transferase
1959 CAMQCF010000016.1 GCA946999245_00983 CDS open 11076-11576 _na     166_aa Viral beta C/D like family protein
1960 CAMQCF010000016.1 GCA946999245_00984 CDS open 11646-12734 _na     362_aa trpS tryptophan--tRNA ligase
1961 CAMQCF010000016.1 GCA946999245_00985 CDS open 13405-14706 _na     433_aa nhaA Na+/H+ antiporter NhaA
1962 CAMQCF010000016.1 GCA946999245_00986 CDS open 14991-16343 _na     450_aa Multidrug-efflux transporter
1963 CAMQCF010000016.1 GCA946999245_00987 CDS open 16436-16834 _na     132_aa Histidine triad domain protein
1964 CAMQCF010000016.1 GCA946999245_00988 CDS open 16854-17324 _na     156_aa greA transcription elongation factor GreA
1965 CAMQCF010000016.1 GCA946999245_00989 CDS open 17626-18033 _na     135_aa hypothetical protein
1966 CAMQCF010000016.1 GCA946999245_00990 CDS open 18026-18238 _na     70_aa hypothetical protein
1967 CAMQCF010000016.1 GCA946999245_00991 CDS open 18235-20775 _na     846_aa DUF4906 domain-containing protein
1968 CAMQCF010000016.1 GCA946999245_00992 CDS open 21203-21922 _na     239_aa ybhL Inner membrane protein YbhL
1969 CAMQCF010000016.1 GCA946999245_00993 CDS open 22146-23396 _na     416_aa Clostripain family
1970 CAMQCF010000016.1 GCA946999245_00994 CDS open 23700-24185 _na     161_aa Arginine repressor
1971 CAMQCF010000016.1 GCA946999245_00995 CDS open 24231-24896 _na     221_aa ung uracil-DNA glycosylase
1972 CAMQCF010000016.1 GCA946999245_00996 CDS open 24890-25519 _na     209_aa DUF3109 domain-containing protein
1973 CAMQCF010000016.1 GCA946999245_00997 CDS open 25656-26699 _na     347_aa ribonucleotide-diphosphate reductase subunit beta
1974 CAMQCF010000016.1 GCA946999245_00998 CDS open 26798-29317 _na     839_aa ribonucleoside-diphosphate reductase subunit alpha
1975 CAMQCF010000016.1 GCA946999245_00999 CDS open 29354-29776 _na     140_aa Polyketide cyclase/dehydrase
1976 CAMQCF010000016.1 GCA946999245_01000 CDS open 29778-30410 _na     210_aa Orotate phosphoribosyltransferase
1977 CAMQCF010000016.1 GCA946999245_01001 CDS open 30641-31345 _na     234_aa comF ComF family protein
1978 CAMQCF010000016.1 GCA946999245_01002 CDS open 31329-31814 _na     161_aa recX Regulatory protein RecX
1979 CAMQCF010000016.1 GCA946999245_01003 CDS open 31811-32671 _na     286_aa prmC peptide chain release factor N(5)-glutamine methyltransferase
1980 CAMQCF010000016.1 GCA946999245_01004 CDS open 32700-33641 _na     313_aa ribD bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD
1981 CAMQCF010000016.1 GCA946999245_01005 CDS open 33784-34557 _na     257_aa Nucleotidyl transferase domain-containing protein
1982 CAMQCF010000016.1 GCA946999245_01006 CDS open 34623-36167 _na     514_aa guaA glutamine-hydrolyzing GMP synthase
1983 CAMQCF010000016.1 GCA946999245_01007 CDS open 36502-37725 _na     407_aa pepT peptidase T
1984 CAMQCF010000016.1 GCA946999245_01008 CDS open 37823-40072 _na     749_aa trkA TrkA protein
1985 CAMQCF010000016.1 GCA946999245_00975 gene open 154-765
1986 CAMQCF010000016.1 GCA946999245_00976 gene open 980-1201
1987 CAMQCF010000016.1 GCA946999245_00977 gene open 1286-1912
1988 CAMQCF010000016.1 GCA946999245_00978 gene open 1943-4240 priA
1989 CAMQCF010000016.1 GCA946999245_00979 gene open 4405-5931
1990 CAMQCF010000016.1 GCA946999245_00980 gene open 6119-8188
1991 CAMQCF010000016.1 GCA946999245_00981 gene open 8220-9812 gltX
1992 CAMQCF010000016.1 GCA946999245_00982 gene open 9859-11079
1993 CAMQCF010000016.1 GCA946999245_00983 gene open 11076-11576
1994 CAMQCF010000016.1 GCA946999245_00984 gene open 11646-12734 trpS
1995 CAMQCF010000016.1 GCA946999245_00985 gene open 13405-14706 nhaA
1996 CAMQCF010000016.1 GCA946999245_00986 gene open 14991-16343
1997 CAMQCF010000016.1 GCA946999245_00987 gene open 16436-16834
1998 CAMQCF010000016.1 GCA946999245_00988 gene open 16854-17324 greA
1999 CAMQCF010000016.1 GCA946999245_00989 gene open 17626-18033
2000 CAMQCF010000016.1 GCA946999245_00990 gene open 18026-18238