HOMD Banner
Taxonomy: V4.3   |  16S rRNA RefSeq: V16.03   |  Genomic RefSeq: V11.03   |  Viruses: V1.2

BAKTAGenome Explorer: Lachnocurva vaginae (GCA_947039925.1)

Select a Genome:
BAKTA Annotations for GCA_947039925.1
Genome Selected: Lachnocurva vaginae
ContigsBases CDSrRNA tmRNAtRNA
11 1587070 1474 0 1 40
[Table]   [AA Fasta]      [Browser]   [Text]   [Excel]  
Search & Sort all 3055 Records
Search These Records: Clear
Sort Column:   Molecule   PID   NA   AA   Gene  Gene Product  Reverse
Annotation Table [page:5]    |    Number of Records Found: 3055 [7 Pages]    |    Previous Page <==> Next Page    |    Jump to Page: [ 1  2  3  4  5  6  7  ]
Notes:   1- Column headers only sort the current page. 2- Select [NA] or [AA] links to show sequences.
Region Protein-ID Type Genome
Viewer		 Range
(bp)		 Show Sequences
(length) NA / AA		 BAKTA
Gene		 BAKTA
GeneProduct
2001 CAMRAD010000004.1 GCA947039925_00975 gene open 123334-124713
2002 CAMRAD010000004.1 GCA947039925_00976 gene open 124919-125077
2003 CAMRAD010000004.1 GCA947039925_00977 gene open 125348-126118
2004 CAMRAD010000004.1 GCA947039925_00978 gene open 126306-128885 clpB
2005 CAMRAD010000004.1 GCA947039925_00979 gene open 129037-130392
2006 CAMRAD010000004.1 GCA947039925_00980 gene open 130599-131657
2007 CAMRAD010000004.1 GCA947039925_00981 gene open 131700-132911
2008 CAMRAD010000004.1 GCA947039925_00982 gene open 133251-134267
2009 CAMRAD010000004.1 GCA947039925_00983 gene open 134464-136281
2010 CAMRAD010000004.1 GCA947039925_00984 gene open 136394-136852
2011 CAMRAD010000004.1 GCA947039925_00985 gene open 136970-137656
2012 CAMRAD010000004.1 GCA947039925_00986 gene open 137756-138844
2013 CAMRAD010000004.1 GCA947039925_00987 gene open 139243-140478
2014 CAMRAD010000004.1 GCA947039925_00988 gene open 140615-141607
2015 CAMRAD010000004.1 GCA947039925_00989 gene open 141613-142548
2016 CAMRAD010000004.1 GCA947039925_00990 gene open 142564-144003
2017 CAMRAD010000004.1 GCA947039925_00991 gene open 144174-145424
2018 CAMRAD010000004.1 GCA947039925_00992 gene open 145427-146173
2019 CAMRAD010000004.1 GCA947039925_00993 gene open 146270-147886
2020 CAMRAD010000004.1 GCA947039925_00994 gene open 147873-148520
2021 CAMRAD010000004.1 GCA947039925_00995 gene open 148537-149439
2022 CAMRAD010000004.1 GCA947039925_00996 gene open 149869-150219
2023 CAMRAD010000004.1 GCA947039925_00997 gene open 150327-151004
2024 CAMRAD010000004.1 GCA947039925_00998 gene open 151029-151652
2025 CAMRAD010000004.1 GCA947039925_00999 gene open 151652-151951
2026 CAMRAD010000004.1 GCA947039925_01000 gene open 152012-152854
2027 CAMRAD010000004.1 GCA947039925_01001 gene open 152866-153153
2028 CAMRAD010000004.1 GCA947039925_01002 gene open 153180-153566
2029 CAMRAD010000004.1 GCA947039925_01003 gene open 153581-154252
2030 CAMRAD010000004.1 GCA947039925_01004 gene open 154239-154676
2031 CAMRAD010000004.1 GCA947039925_01005 gene open 154666-154872
2032 CAMRAD010000004.1 GCA947039925_01006 gene open 154899-155156
2033 CAMRAD010000004.1 GCA947039925_01007 gene open 155175-155543
2034 CAMRAD010000004.1 GCA947039925_01008 gene open 155555-155866
2035 CAMRAD010000004.1 GCA947039925_01009 gene open 155887-156426
2036 CAMRAD010000004.1 GCA947039925_01010 gene open 156442-156627
2037 CAMRAD010000004.1 GCA947039925_01011 gene open 156650-157051
2038 CAMRAD010000004.1 GCA947039925_01012 gene open 157114-157653
2039 CAMRAD010000004.1 GCA947039925_01013 gene open 157672-158040
2040 CAMRAD010000004.1 GCA947039925_01014 gene open 158056-158565
2041 CAMRAD010000004.1 GCA947039925_01015 gene open 158576-158764
2042 CAMRAD010000004.1 GCA947039925_01016 gene open 158788-159231
2043 CAMRAD010000004.1 GCA947039925_01017 gene open 159231-160544 secY
2044 CAMRAD010000004.1 GCA947039925_01018 gene open 160561-161208
2045 CAMRAD010000004.1 GCA947039925_01019 gene open 161230-161448 infA
2046 CAMRAD010000004.1 GCA947039925_01020 gene open 161829-162200
2047 CAMRAD010000004.1 GCA947039925_01021 gene open 162245-162634 rpsK
2048 CAMRAD010000004.1 GCA947039925_01022 gene open 162652-163245
2049 CAMRAD010000004.1 GCA947039925_01023 gene open 163291-164259
2050 CAMRAD010000004.1 GCA947039925_01024 gene open 164391-164912
2051 CAMRAD010000004.1 GCA947039925_01025 gene open 165133-166704
2052 CAMRAD010000004.1 GCA947039925_01026 gene open 166981-169371 mutS2
2053 CAMRAD010000004.1 GCA947039925_01027 gene open 169596-170555
2054 CAMRAD010000004.1 GCA947039925_01028 gene open 170608-171996
2055 CAMRAD010000004.1 GCA947039925_01029 gene open 172271-173263 araC
2056 CAMRAD010000004.1 GCA947039925_01030 gene open 173423-175177 mdlB
2057 CAMRAD010000004.1 GCA947039925_01031 gene open 175161-176882 mdlB
2058 CAMRAD010000004.1 GCA947039925_01032 gene open 176893-177477
2059 CAMRAD010000004.1 GCA947039925_01033 gene open 177477-178166 ykoC
2060 CAMRAD010000004.1 GCA947039925_01034 gene open 178160-179524 ccmA
2061 CAMRAD010000004.1 GCA947039925_01035 gene open 179965-180261
2062 CAMRAD010000004.1 GCA947039925_01036 gene open 180300-181742 recG
2063 CAMRAD010000004.1 GCA947039925_00871 gene open 106-179 trnD
2064 CAMRAD010000004.1 GCA947039925_00872 gene open 188-260 trnV
2065 CAMRAD010000004.1 GCA947039925_00873 gene open 283-355 trnT
2066 CAMRAD010000004.1 GCA947039925_00874 gene open 377-458 trnY
2067 CAMRAD010000004.1 GCA947039925_00875 gene open 536-609 trnfM
2068 CAMRAD010000004.1 GCA947039925_00876 gene open 618-690 trnF
2069 CAMRAD010000004.1 GCA947039925_00879 gene open 4599-4672 trnP
2070 CAMRAD010000004.1 GCA947039925_00908 gene open 48047-48130 trnL
2071 CAMRAD010000004.1 GCA947039925_00917 gene open 60121-60191 trnG
2072 CAMRAD010000004.1 GCA947039925_00871 tRNA open 106-179 trnD tRNA-Asp(gtc)
2073 CAMRAD010000004.1 GCA947039925_00872 tRNA open 188-260 trnV tRNA-Val(tac)
2074 CAMRAD010000004.1 GCA947039925_00873 tRNA open 283-355 trnT tRNA-Thr(tgt)
2075 CAMRAD010000004.1 GCA947039925_00874 tRNA open 377-458 trnY tRNA-Tyr(gta)
2076 CAMRAD010000004.1 GCA947039925_00875 tRNA open 536-609 trnfM tRNA-fMet(cat)
2077 CAMRAD010000004.1 GCA947039925_00876 tRNA open 618-690 trnF tRNA-Phe(gaa)
2078 CAMRAD010000004.1 GCA947039925_00879 tRNA open 4599-4672 trnP tRNA-Pro(cgg)
2079 CAMRAD010000004.1 GCA947039925_00908 tRNA open 48047-48130 trnL tRNA-Leu(taa)
2080 CAMRAD010000004.1 GCA947039925_00917 tRNA open 60121-60191 trnG tRNA-Gly(ccc)
2081 CAMRAD010000005.1 GCA947039925_01067 gene open 16002-16095 tracrRNA
2082 CAMRAD010000005.1 GCA947039925_01067 ncRNA open 16002-16095 Trans-activating crRNA
2083 CAMRAD010000005.1 repeat_region open 22357-23281 CRISPR array with 10 repeats of length 36%2C consensus sequence GTTTTATAACTGTGTTGTTTTGAATAGGACTAAAAC and spacer length 30
2084 CAMRAD010000005.1 repeat_region open 23018-23281 CRISPR array with 4 repeats of length 36%2C consensus sequence GTTTTATAACTGTGTTGTTTTGAATAGGACTAAAAC and spacer length 30
2085 CAMRAD010000005.1 GCA947039925_01042 CDS open 872-1150 _na     92_aa hypothetical protein
2086 CAMRAD010000005.1 GCA947039925_01043 CDS open 1548-1877 _na     109_aa sdpI SdpI family protein
2087 CAMRAD010000005.1 GCA947039925_01044 CDS open 2311-2508 _na     65_aa helix-turn-helix transcriptional regulator
2088 CAMRAD010000005.1 GCA947039925_01045 CDS open 2524-3141 _na     205_aa TetR/AcrR family transcriptional regulator
2089 CAMRAD010000005.1 GCA947039925_01046 CDS open 3254-4189 _na     311_aa ABC transporter ATP-binding protein
2090 CAMRAD010000005.1 GCA947039925_01047 CDS open 4173-4919 _na     248_aa ABC transporter permease
2091 CAMRAD010000005.1 GCA947039925_01048 CDS open 4920-5630 _na     236_aa ABC transporter ATP-binding protein
2092 CAMRAD010000005.1 GCA947039925_01049 CDS open 5620-6336 _na     238_aa hypothetical protein
2093 CAMRAD010000005.1 GCA947039925_01050 CDS open 6373-6624 _na     83_aa Amino acid ABC transporter%2C permease protein
2094 CAMRAD010000005.1 GCA947039925_01051 CDS open 6621-6851 _na     76_aa hypothetical protein
2095 CAMRAD010000005.1 GCA947039925_01052 CDS open 6820-7770 _na     316_aa Proline iminopeptidase
2096 CAMRAD010000005.1 GCA947039925_01053 CDS open 7963-8601 _na     212_aa hypothetical protein
2097 CAMRAD010000005.1 GCA947039925_01054 CDS open 8704-9189 _na     161_aa Cys-tRNA(Pro)/Cys-tRNA(Cys) deacylase
2098 CAMRAD010000005.1 GCA947039925_01055 CDS open 9318-10466 _na     382_aa THUMP domain-containing protein
2099 CAMRAD010000005.1 GCA947039925_01056 CDS open 10551-12236 _na     561_aa hypothetical protein
2100 CAMRAD010000005.1 GCA947039925_01057 CDS open 12220-13245 _na     341_aa hypothetical protein
2101 CAMRAD010000005.1 GCA947039925_01058 CDS open 13268-13873 _na     201_aa dITP/XTP pyrophosphatase
2102 CAMRAD010000005.1 GCA947039925_01059 CDS open 14122-14601 _na     159_aa hypothetical protein
2103 CAMRAD010000005.1 GCA947039925_01066 CDS open 15452-15670 _na     72_aa hypothetical protein
2104 CAMRAD010000005.1 GCA947039925_01068 CDS open 16157-20197 _na     1346_aa CRISPR-associated endonuclease Cas9
2105 CAMRAD010000005.1 GCA947039925_01069 CDS open 20198-21064 _na     288_aa CRISPR-associated endonuclease Cas1
2106 CAMRAD010000005.1 GCA947039925_01070 CDS open 21076-21396 _na     106_aa CRISPR-associated endoribonuclease Cas2
2107 CAMRAD010000005.1 GCA947039925_01071 CDS open 21389-22054 _na     221_aa hypothetical protein
2108 CAMRAD010000005.1 GCA947039925_01072 CDS open 23466-23618 _na     50_aa hypothetical protein
2109 CAMRAD010000005.1 GCA947039925_01073 CDS open 24150-24707 _na     185_aa Nicotinamidase
2110 CAMRAD010000005.1 GCA947039925_01074 CDS open 25053-26513 _na     486_aa Flagellin
2111 CAMRAD010000005.1 GCA947039925_01075 CDS open 26713-27366 _na     217_aa Glutamate racemase
2112 CAMRAD010000005.1 GCA947039925_01076 CDS open 27456-29261 _na     601_aa hypothetical protein
2113 CAMRAD010000005.1 GCA947039925_01077 CDS open 29619-30251 _na     210_aa xrtG Exosortase family protein XrtG
2114 CAMRAD010000005.1 GCA947039925_01078 CDS open 30248-31624 _na     458_aa Glycosyltransferase 2-like domain-containing protein
2115 CAMRAD010000005.1 GCA947039925_01079 CDS open 31649-32437 _na     262_aa hypothetical protein
2116 CAMRAD010000005.1 GCA947039925_01080 CDS open 32809-33003 _na     64_aa hypothetical protein
2117 CAMRAD010000005.1 GCA947039925_01081 CDS open 32996-34024 _na     342_aa hypothetical protein
2118 CAMRAD010000005.1 GCA947039925_01082 CDS open 34024-36591 _na     855_aa hypothetical protein
2119 CAMRAD010000005.1 GCA947039925_01083 CDS open 36681-37496 _na     271_aa hypothetical protein
2120 CAMRAD010000005.1 GCA947039925_01084 CDS open 37696-38307 _na     203_aa hypothetical protein
2121 CAMRAD010000005.1 GCA947039925_01085 CDS open 38379-39206 _na     275_aa Transketolase 1
2122 CAMRAD010000005.1 GCA947039925_01086 CDS open 39206-40138 _na     310_aa 1-deoxy-D-xylulose-5-phosphate synthase
2123 CAMRAD010000005.1 GCA947039925_01088 CDS open 40459-41265 _na     268_aa hypothetical protein
2124 CAMRAD010000005.1 GCA947039925_01089 CDS open 41396-41617 _na     73_aa hypothetical protein
2125 CAMRAD010000005.1 GCA947039925_01090 CDS open 41580-44003 _na     807_aa hypothetical protein
2126 CAMRAD010000005.1 GCA947039925_01091 CDS open 44135-45772 _na     545_aa hypothetical protein
2127 CAMRAD010000005.1 GCA947039925_01092 CDS open 45920-46273 _na     117_aa hypothetical protein
2128 CAMRAD010000005.1 GCA947039925_01093 CDS open 46311-46745 _na     144_aa nusB Transcription antitermination protein NusB
2129 CAMRAD010000005.1 GCA947039925_01094 CDS open 46732-48021 _na     429_aa hypothetical protein
2130 CAMRAD010000005.1 GCA947039925_01095 CDS open 48114-48392 _na     92_aa hypothetical protein
2131 CAMRAD010000005.1 GCA947039925_01096 CDS open 48395-49321 _na     308_aa Octaprenyl-diphosphate synthase / Dimethylallyltransferase / Geranyltranstransferase (Farnesyldiphosphate synthase) / Geranylgeranyl pyrophosphate synthetase
2132 CAMRAD010000005.1 GCA947039925_01097 CDS open 49328-51199 _na     623_aa 1-deoxy-D-xylulose-5-phosphate synthase
2133 CAMRAD010000005.1 GCA947039925_01098 CDS open 51277-52080 _na     267_aa RNA-binding S4 domain-containing protein
2134 CAMRAD010000005.1 GCA947039925_01099 CDS open 52077-52976 _na     299_aa hypothetical protein
2135 CAMRAD010000005.1 GCA947039925_01100 CDS open 53037-54710 _na     557_aa hypothetical protein
2136 CAMRAD010000005.1 GCA947039925_01102 CDS open 54896-55246 _na     116_aa hypothetical protein
2137 CAMRAD010000005.1 GCA947039925_01103 CDS open 55294-55962 _na     222_aa queH Epoxyqueuosine reductase QueH
2138 CAMRAD010000005.1 GCA947039925_01104 CDS open 56021-57388 _na     455_aa hypothetical protein
2139 CAMRAD010000005.1 GCA947039925_01105 CDS open 57388-59367 _na     659_aa DNA topoisomerase
2140 CAMRAD010000005.1 GCA947039925_01106 CDS open 59392-60066 _na     224_aa UDP-N-acetylglucosamine pyrophosphorylase
2141 CAMRAD010000005.1 GCA947039925_01107 CDS open 60076-60693 _na     205_aa Cytidylate kinase
2142 CAMRAD010000005.1 GCA947039925_01109 CDS open 61026-62261 _na     411_aa hypothetical protein
2143 CAMRAD010000005.1 GCA947039925_01110 CDS open 62415-63101 _na     228_aa hypothetical protein
2144 CAMRAD010000005.1 GCA947039925_01111 CDS open 63106-63348 _na     80_aa hypothetical protein
2145 CAMRAD010000005.1 GCA947039925_01112 CDS open 63571-64146 _na     191_aa DUF1653 domain-containing protein
2146 CAMRAD010000005.1 GCA947039925_01113 CDS open 64160-64648 _na     162_aa CYTH domain-containing protein
2147 CAMRAD010000005.1 GCA947039925_01114 CDS open 64803-65351 _na     182_aa hypothetical protein
2148 CAMRAD010000005.1 GCA947039925_01115 CDS open 65450-66820 _na     456_aa Trigger factor
2149 CAMRAD010000005.1 GCA947039925_01116 CDS open 66905-67516 _na     203_aa ATP-dependent Clp protease proteolytic subunit 1
2150 CAMRAD010000005.1 GCA947039925_01117 CDS open 67516-68808 _na     430_aa clpX ATP-dependent Clp protease ATP-binding subunit ClpX
2151 CAMRAD010000005.1 GCA947039925_01118 CDS open 68886-69491 _na     201_aa engB putative GTP-binding protein EngB
2152 CAMRAD010000005.1 GCA947039925_01119 CDS open 69527-70840 _na     437_aa Hemolysin
2153 CAMRAD010000005.1 GCA947039925_01120 CDS open 70978-71295 _na     105_aa hypothetical protein
2154 CAMRAD010000005.1 GCA947039925_01121 CDS open 71685-73934 _na     749_aa Anaerobic ribonucleoside-triphosphate reductase
2155 CAMRAD010000005.1 GCA947039925_01122 CDS open 73954-74481 _na     175_aa Anaerobic ribonucleoside-triphosphate reductase-activating protein
2156 CAMRAD010000005.1 GCA947039925_01123 CDS open 74511-75497 _na     328_aa Phosphate acetyltransferase
2157 CAMRAD010000005.1 GCA947039925_01124 CDS open 75448-75579 _na     43_aa hypothetical protein
2158 CAMRAD010000005.1 GCA947039925_01125 CDS open 75601-76203 _na     200_aa NADPH-dependent FMN reductase
2159 CAMRAD010000005.1 GCA947039925_01126 CDS open 76357-77649 _na     430_aa RCK C-terminal domain-containing protein
2160 CAMRAD010000005.1 GCA947039925_01127 CDS open 77922-79445 _na     507_aa hypothetical protein
2161 CAMRAD010000005.1 GCA947039925_01128 CDS open 79496-79645 _na     49_aa Six-cysteine ranthipeptide SCIFF
2162 CAMRAD010000005.1 GCA947039925_01129 CDS open 79745-81151 _na     468_aa Thioether cross-link-forming SCIFF peptide maturase
2163 CAMRAD010000005.1 GCA947039925_01130 CDS open 81369-83987 _na     872_aa Aldehyde-alcohol dehydrogenase
2164 CAMRAD010000005.1 GCA947039925_01131 CDS open 84006-84761 _na     251_aa Phosphotransferase enzyme family protein
2165 CAMRAD010000005.1 GCA947039925_01132 CDS open 85079-86158 _na     359_aa hypothetical protein
2166 CAMRAD010000005.1 GCA947039925_01133 CDS open 86351-87442 _na     363_aa Phosphotransferase system EIIC domain-containing protein
2167 CAMRAD010000005.1 GCA947039925_01134 CDS open 87586-88104 _na     172_aa nadR Transcription repressor NadR
2168 CAMRAD010000005.1 GCA947039925_01135 CDS open 88343-90127 _na     594_aa Methyl-accepting chemotaxis protein
2169 CAMRAD010000005.1 GCA947039925_01136 CDS open 90252-91139 _na     295_aa hypothetical protein
2170 CAMRAD010000005.1 GCA947039925_01137 CDS open 91173-91274 _na     33_aa hypothetical protein
2171 CAMRAD010000005.1 GCA947039925_01138 CDS open 91388-91666 _na     92_aa yafQ type II toxin-antitoxin system YafQ family toxin
2172 CAMRAD010000005.1 GCA947039925_01139 CDS open 91672-91956 _na     94_aa relB Damage-inducible protein
2173 CAMRAD010000005.1 GCA947039925_01140 CDS open 92261-92773 _na     170_aa Nitroreductase domain-containing protein
2174 CAMRAD010000005.1 GCA947039925_01141 CDS open 92791-93606 _na     271_aa hypothetical protein
2175 CAMRAD010000005.1 GCA947039925_01142 CDS open 93623-94810 _na     395_aa cysteine-S-conjugate beta-lyase
2176 CAMRAD010000005.1 GCA947039925_01143 CDS open 95134-96456 _na     440_aa GHKL domain-containing protein
2177 CAMRAD010000005.1 GCA947039925_01144 CDS open 96453-97205 _na     250_aa Stage 0 sporulation A-like protein
2178 CAMRAD010000005.1 GCA947039925_01145 CDS open 97429-97665 _na     78_aa hypothetical protein
2179 CAMRAD010000005.1 GCA947039925_01146 CDS open 98066-99421 _na     451_aa ATPase
2180 CAMRAD010000005.1 GCA947039925_01147 CDS open 99597-100232 _na     211_aa Restriction endonuclease subunit S
2181 CAMRAD010000005.1 GCA947039925_01042 gene open 872-1150
2182 CAMRAD010000005.1 GCA947039925_01043 gene open 1548-1877 sdpI
2183 CAMRAD010000005.1 GCA947039925_01044 gene open 2311-2508
2184 CAMRAD010000005.1 GCA947039925_01045 gene open 2524-3141
2185 CAMRAD010000005.1 GCA947039925_01046 gene open 3254-4189
2186 CAMRAD010000005.1 GCA947039925_01047 gene open 4173-4919
2187 CAMRAD010000005.1 GCA947039925_01048 gene open 4920-5630
2188 CAMRAD010000005.1 GCA947039925_01049 gene open 5620-6336
2189 CAMRAD010000005.1 GCA947039925_01050 gene open 6373-6624
2190 CAMRAD010000005.1 GCA947039925_01051 gene open 6621-6851
2191 CAMRAD010000005.1 GCA947039925_01052 gene open 6820-7770
2192 CAMRAD010000005.1 GCA947039925_01053 gene open 7963-8601
2193 CAMRAD010000005.1 GCA947039925_01054 gene open 8704-9189
2194 CAMRAD010000005.1 GCA947039925_01055 gene open 9318-10466
2195 CAMRAD010000005.1 GCA947039925_01056 gene open 10551-12236
2196 CAMRAD010000005.1 GCA947039925_01057 gene open 12220-13245
2197 CAMRAD010000005.1 GCA947039925_01058 gene open 13268-13873
2198 CAMRAD010000005.1 GCA947039925_01059 gene open 14122-14601
2199 CAMRAD010000005.1 GCA947039925_01066 gene open 15452-15670
2200 CAMRAD010000005.1 GCA947039925_01068 gene open 16157-20197
2201 CAMRAD010000005.1 GCA947039925_01069 gene open 20198-21064
2202 CAMRAD010000005.1 GCA947039925_01070 gene open 21076-21396
2203 CAMRAD010000005.1 GCA947039925_01071 gene open 21389-22054
2204 CAMRAD010000005.1 GCA947039925_01072 gene open 23466-23618
2205 CAMRAD010000005.1 GCA947039925_01073 gene open 24150-24707
2206 CAMRAD010000005.1 GCA947039925_01074 gene open 25053-26513
2207 CAMRAD010000005.1 GCA947039925_01075 gene open 26713-27366
2208 CAMRAD010000005.1 GCA947039925_01076 gene open 27456-29261
2209 CAMRAD010000005.1 GCA947039925_01077 gene open 29619-30251 xrtG
2210 CAMRAD010000005.1 GCA947039925_01078 gene open 30248-31624
2211 CAMRAD010000005.1 GCA947039925_01079 gene open 31649-32437
2212 CAMRAD010000005.1 GCA947039925_01080 gene open 32809-33003
2213 CAMRAD010000005.1 GCA947039925_01081 gene open 32996-34024
2214 CAMRAD010000005.1 GCA947039925_01082 gene open 34024-36591
2215 CAMRAD010000005.1 GCA947039925_01083 gene open 36681-37496
2216 CAMRAD010000005.1 GCA947039925_01084 gene open 37696-38307
2217 CAMRAD010000005.1 GCA947039925_01085 gene open 38379-39206
2218 CAMRAD010000005.1 GCA947039925_01086 gene open 39206-40138
2219 CAMRAD010000005.1 GCA947039925_01088 gene open 40459-41265
2220 CAMRAD010000005.1 GCA947039925_01089 gene open 41396-41617
2221 CAMRAD010000005.1 GCA947039925_01090 gene open 41580-44003
2222 CAMRAD010000005.1 GCA947039925_01091 gene open 44135-45772
2223 CAMRAD010000005.1 GCA947039925_01092 gene open 45920-46273
2224 CAMRAD010000005.1 GCA947039925_01093 gene open 46311-46745 nusB
2225 CAMRAD010000005.1 GCA947039925_01094 gene open 46732-48021
2226 CAMRAD010000005.1 GCA947039925_01095 gene open 48114-48392
2227 CAMRAD010000005.1 GCA947039925_01096 gene open 48395-49321
2228 CAMRAD010000005.1 GCA947039925_01097 gene open 49328-51199
2229 CAMRAD010000005.1 GCA947039925_01098 gene open 51277-52080
2230 CAMRAD010000005.1 GCA947039925_01099 gene open 52077-52976
2231 CAMRAD010000005.1 GCA947039925_01100 gene open 53037-54710
2232 CAMRAD010000005.1 GCA947039925_01102 gene open 54896-55246
2233 CAMRAD010000005.1 GCA947039925_01103 gene open 55294-55962 queH
2234 CAMRAD010000005.1 GCA947039925_01104 gene open 56021-57388
2235 CAMRAD010000005.1 GCA947039925_01105 gene open 57388-59367
2236 CAMRAD010000005.1 GCA947039925_01106 gene open 59392-60066
2237 CAMRAD010000005.1 GCA947039925_01107 gene open 60076-60693
2238 CAMRAD010000005.1 GCA947039925_01109 gene open 61026-62261
2239 CAMRAD010000005.1 GCA947039925_01110 gene open 62415-63101
2240 CAMRAD010000005.1 GCA947039925_01111 gene open 63106-63348
2241 CAMRAD010000005.1 GCA947039925_01112 gene open 63571-64146
2242 CAMRAD010000005.1 GCA947039925_01113 gene open 64160-64648
2243 CAMRAD010000005.1 GCA947039925_01114 gene open 64803-65351
2244 CAMRAD010000005.1 GCA947039925_01115 gene open 65450-66820
2245 CAMRAD010000005.1 GCA947039925_01116 gene open 66905-67516
2246 CAMRAD010000005.1 GCA947039925_01117 gene open 67516-68808 clpX
2247 CAMRAD010000005.1 GCA947039925_01118 gene open 68886-69491 engB
2248 CAMRAD010000005.1 GCA947039925_01119 gene open 69527-70840
2249 CAMRAD010000005.1 GCA947039925_01120 gene open 70978-71295
2250 CAMRAD010000005.1 GCA947039925_01121 gene open 71685-73934
2251 CAMRAD010000005.1 GCA947039925_01122 gene open 73954-74481
2252 CAMRAD010000005.1 GCA947039925_01123 gene open 74511-75497
2253 CAMRAD010000005.1 GCA947039925_01124 gene open 75448-75579
2254 CAMRAD010000005.1 GCA947039925_01125 gene open 75601-76203
2255 CAMRAD010000005.1 GCA947039925_01126 gene open 76357-77649
2256 CAMRAD010000005.1 GCA947039925_01127 gene open 77922-79445
2257 CAMRAD010000005.1 GCA947039925_01128 gene open 79496-79645
2258 CAMRAD010000005.1 GCA947039925_01129 gene open 79745-81151
2259 CAMRAD010000005.1 GCA947039925_01130 gene open 81369-83987
2260 CAMRAD010000005.1 GCA947039925_01131 gene open 84006-84761
2261 CAMRAD010000005.1 GCA947039925_01132 gene open 85079-86158
2262 CAMRAD010000005.1 GCA947039925_01133 gene open 86351-87442
2263 CAMRAD010000005.1 GCA947039925_01134 gene open 87586-88104 nadR
2264 CAMRAD010000005.1 GCA947039925_01135 gene open 88343-90127
2265 CAMRAD010000005.1 GCA947039925_01136 gene open 90252-91139
2266 CAMRAD010000005.1 GCA947039925_01137 gene open 91173-91274
2267 CAMRAD010000005.1 GCA947039925_01138 gene open 91388-91666 yafQ
2268 CAMRAD010000005.1 GCA947039925_01139 gene open 91672-91956 relB
2269 CAMRAD010000005.1 GCA947039925_01140 gene open 92261-92773
2270 CAMRAD010000005.1 GCA947039925_01141 gene open 92791-93606
2271 CAMRAD010000005.1 GCA947039925_01142 gene open 93623-94810
2272 CAMRAD010000005.1 GCA947039925_01143 gene open 95134-96456
2273 CAMRAD010000005.1 GCA947039925_01144 gene open 96453-97205
2274 CAMRAD010000005.1 GCA947039925_01145 gene open 97429-97665
2275 CAMRAD010000005.1 GCA947039925_01146 gene open 98066-99421
2276 CAMRAD010000005.1 GCA947039925_01147 gene open 99597-100232
2277 CAMRAD010000005.1 GCA947039925_01037 gene open 392-463 trnN
2278 CAMRAD010000005.1 GCA947039925_01038 gene open 469-540 trnE
2279 CAMRAD010000005.1 GCA947039925_01039 gene open 547-620 trnI
2280 CAMRAD010000005.1 GCA947039925_01040 gene open 624-697 trnD
2281 CAMRAD010000005.1 GCA947039925_01041 gene open 710-784 trnR
2282 CAMRAD010000005.1 GCA947039925_01060 gene open 14853-14927 trnP
2283 CAMRAD010000005.1 GCA947039925_01061 gene open 14943-15013 trnG
2284 CAMRAD010000005.1 GCA947039925_01062 gene open 15019-15092 trnR
2285 CAMRAD010000005.1 GCA947039925_01063 gene open 15098-15171 trnH
2286 CAMRAD010000005.1 GCA947039925_01064 gene open 15199-15270 trnQ
2287 CAMRAD010000005.1 GCA947039925_01065 gene open 15299-15371 trnK
2288 CAMRAD010000005.1 GCA947039925_01087 gene open 40166-40238 trnT
2289 CAMRAD010000005.1 GCA947039925_01101 gene open 54726-54798 trnT
2290 CAMRAD010000005.1 GCA947039925_01108 gene open 60793-60875 trnL
2291 CAMRAD010000005.1 GCA947039925_01037 tRNA open 392-463 trnN tRNA-Asn(gtt)
2292 CAMRAD010000005.1 GCA947039925_01038 tRNA open 469-540 trnE tRNA-Glu(ttc)
2293 CAMRAD010000005.1 GCA947039925_01039 tRNA open 547-620 trnI tRNA-Ile2(cat)
2294 CAMRAD010000005.1 GCA947039925_01040 tRNA open 624-697 trnD tRNA-Asp(gtc)
2295 CAMRAD010000005.1 GCA947039925_01041 tRNA open 710-784 trnR tRNA-Arg(acg)
2296 CAMRAD010000005.1 GCA947039925_01060 tRNA open 14853-14927 trnP tRNA-Pro(tgg)
2297 CAMRAD010000005.1 GCA947039925_01061 tRNA open 14943-15013 trnG tRNA-Gly(tcc)
2298 CAMRAD010000005.1 GCA947039925_01062 tRNA open 15019-15092 trnR tRNA-Arg(tct)
2299 CAMRAD010000005.1 GCA947039925_01063 tRNA open 15098-15171 trnH tRNA-His(gtg)
2300 CAMRAD010000005.1 GCA947039925_01064 tRNA open 15199-15270 trnQ tRNA-Gln(ttg)
2301 CAMRAD010000005.1 GCA947039925_01065 tRNA open 15299-15371 trnK tRNA-Lys(ttt)
2302 CAMRAD010000005.1 GCA947039925_01087 tRNA open 40166-40238 trnT tRNA-Thr(ggt)
2303 CAMRAD010000005.1 GCA947039925_01101 tRNA open 54726-54798 trnT tRNA-Thr(cgt)
2304 CAMRAD010000005.1 GCA947039925_01108 tRNA open 60793-60875 trnL tRNA-Leu(tag)
2305 CAMRAD010000006.1 GCA947039925_01148 CDS open 57-4730 _na     1557_aa hypothetical protein
2306 CAMRAD010000006.1 GCA947039925_01149 CDS open 4886-6328 _na     480_aa hypothetical protein
2307 CAMRAD010000006.1 GCA947039925_01150 CDS open 6393-8519 _na     708_aa hypothetical protein
2308 CAMRAD010000006.1 GCA947039925_01151 CDS open 8706-9371 _na     221_aa hypothetical protein
2309 CAMRAD010000006.1 GCA947039925_01152 CDS open 9385-10230 _na     281_aa hypothetical protein
2310 CAMRAD010000006.1 GCA947039925_01153 CDS open 10301-11503 _na     400_aa hypothetical protein
2311 CAMRAD010000006.1 GCA947039925_01154 CDS open 11536-11724 _na     62_aa hypothetical protein
2312 CAMRAD010000006.1 GCA947039925_01155 CDS open 11874-12668 _na     264_aa hypothetical protein
2313 CAMRAD010000006.1 GCA947039925_01156 CDS open 12833-13693 _na     286_aa hypothetical protein
2314 CAMRAD010000006.1 GCA947039925_01157 CDS open 13695-13922 _na     75_aa hypothetical protein
2315 CAMRAD010000006.1 GCA947039925_01158 CDS open 14258-14854 _na     198_aa hypothetical protein
2316 CAMRAD010000006.1 GCA947039925_01159 CDS open 14938-15450 _na     170_aa hypothetical protein
2317 CAMRAD010000006.1 GCA947039925_01160 CDS open 15665-16003 _na     112_aa hypothetical protein
2318 CAMRAD010000006.1 GCA947039925_01161 CDS open 16155-17738 _na     527_aa Helicase
2319 CAMRAD010000006.1 GCA947039925_01162 CDS open 17961-19088 _na     375_aa hypothetical protein
2320 CAMRAD010000006.1 GCA947039925_01163 CDS open 19440-21923 _na     827_aa virB4 Type IV secretory pathway%2C VirB4 component
2321 CAMRAD010000006.1 GCA947039925_01164 CDS open 22001-22483 _na     160_aa hypothetical protein
2322 CAMRAD010000006.1 GCA947039925_01165 CDS open 22501-23346 _na     281_aa hypothetical protein
2323 CAMRAD010000006.1 GCA947039925_01166 CDS open 23352-24077 _na     241_aa hypothetical protein
2324 CAMRAD010000006.1 GCA947039925_01167 CDS open 24091-24414 _na     107_aa hypothetical protein
2325 CAMRAD010000006.1 GCA947039925_01168 CDS open 24527-27226 _na     899_aa hypothetical protein
2326 CAMRAD010000006.1 GCA947039925_01169 CDS open 27341-28069 _na     242_aa hypothetical protein
2327 CAMRAD010000006.1 GCA947039925_01170 CDS open 28201-28488 _na     95_aa hypothetical protein
2328 CAMRAD010000006.1 GCA947039925_01171 CDS open 28494-29042 _na     182_aa hypothetical protein
2329 CAMRAD010000006.1 GCA947039925_01172 CDS open 29054-30190 _na     378_aa ParM/StbA family protein
2330 CAMRAD010000006.1 GCA947039925_01173 CDS open 30405-30725 _na     106_aa hypothetical protein
2331 CAMRAD010000006.1 GCA947039925_01174 CDS open 30726-32249 _na     507_aa Type-2 restriction enzyme Sau3AI
2332 CAMRAD010000006.1 GCA947039925_01175 CDS open 32332-33546 _na     404_aa Cytosine-specific methyltransferase
2333 CAMRAD010000006.1 GCA947039925_01176 CDS open 33970-34686 _na     238_aa hypothetical protein
2334 CAMRAD010000006.1 GCA947039925_01177 CDS open 34829-35140 _na     103_aa hypothetical protein
2335 CAMRAD010000006.1 GCA947039925_01178 CDS open 35156-35974 _na     272_aa hypothetical protein
2336 CAMRAD010000006.1 GCA947039925_01179 CDS open 35994-37091 _na     365_aa hypothetical protein
2337 CAMRAD010000006.1 GCA947039925_01180 CDS open 37108-37683 _na     191_aa hypothetical protein
2338 CAMRAD010000006.1 GCA947039925_01181 CDS open 37676-38320 _na     214_aa hypothetical protein
2339 CAMRAD010000006.1 GCA947039925_01182 CDS open 39154-40560 _na     468_aa hypothetical protein
2340 CAMRAD010000006.1 GCA947039925_01183 CDS open 40705-41223 _na     172_aa hypothetical protein
2341 CAMRAD010000006.1 GCA947039925_01184 CDS open 41226-41996 _na     256_aa Sporulation initiation inhibitor protein soj
2342 CAMRAD010000006.1 GCA947039925_01185 CDS open 42157-42423 _na     88_aa hypothetical protein
2343 CAMRAD010000006.1 GCA947039925_01186 CDS open 42455-42955 _na     166_aa hypothetical protein
2344 CAMRAD010000006.1 GCA947039925_01187 CDS open 43236-44870 _na     544_aa hypothetical protein
2345 CAMRAD010000006.1 GCA947039925_01188 CDS open 44947-45315 _na     122_aa hypothetical protein
2346 CAMRAD010000006.1 GCA947039925_01189 CDS open 45446-47137 _na     563_aa hypothetical protein
2347 CAMRAD010000006.1 GCA947039925_01190 CDS open 47521-47787 _na     88_aa hypothetical protein
2348 CAMRAD010000006.1 GCA947039925_01191 CDS open 49599-49766 _na     55_aa hypothetical protein
2349 CAMRAD010000006.1 GCA947039925_01192 CDS open 50026-51345 _na     439_aa hypothetical protein
2350 CAMRAD010000006.1 GCA947039925_01193 CDS open 51364-52149 _na     261_aa hypothetical protein
2351 CAMRAD010000006.1 GCA947039925_01194 CDS open 52168-53607 _na     479_aa hypothetical protein
2352 CAMRAD010000006.1 GCA947039925_01195 CDS open 53784-54011 _na     75_aa hypothetical protein
2353 CAMRAD010000006.1 GCA947039925_01196 CDS open 54001-54279 _na     92_aa hypothetical protein
2354 CAMRAD010000006.1 GCA947039925_01197 CDS open 54276-54866 _na     196_aa hypothetical protein
2355 CAMRAD010000006.1 GCA947039925_01198 CDS open 54892-55206 _na     104_aa hypothetical protein
2356 CAMRAD010000006.1 GCA947039925_01199 CDS open 55217-55708 _na     163_aa hypothetical protein
2357 CAMRAD010000006.1 GCA947039925_01200 CDS open 55705-56199 _na     164_aa hypothetical protein
2358 CAMRAD010000006.1 GCA947039925_01201 CDS open 56258-56503 _na     81_aa hypothetical protein
2359 CAMRAD010000006.1 GCA947039925_01202 CDS open 56670-57848 _na     392_aa hypothetical protein
2360 CAMRAD010000006.1 GCA947039925_01203 CDS open 57862-58551 _na     229_aa hypothetical protein
2361 CAMRAD010000006.1 GCA947039925_01204 CDS open 58666-60912 _na     748_aa hypothetical protein
2362 CAMRAD010000006.1 GCA947039925_01205 CDS open 60973-61896 _na     307_aa hypothetical protein
2363 CAMRAD010000006.1 GCA947039925_01206 CDS open 62009-62560 _na     183_aa hypothetical protein
2364 CAMRAD010000006.1 GCA947039925_01207 CDS open 62670-63548 _na     292_aa hypothetical protein
2365 CAMRAD010000006.1 GCA947039925_01208 CDS open 63675-67667 _na     1330_aa hypothetical protein
2366 CAMRAD010000006.1 GCA947039925_01209 CDS open 67796-71284 _na     1162_aa hypothetical protein
2367 CAMRAD010000006.1 GCA947039925_01210 CDS open 71502-72905 _na     467_aa hypothetical protein
2368 CAMRAD010000006.1 GCA947039925_01211 CDS open 73022-74872 _na     616_aa hypothetical protein
2369 CAMRAD010000006.1 GCA947039925_01212 CDS open 74992-75228 _na     78_aa hypothetical protein
2370 CAMRAD010000006.1 GCA947039925_01213 CDS open 75244-75660 _na     138_aa hypothetical protein
2371 CAMRAD010000006.1 GCA947039925_01214 CDS open 75657-76049 _na     130_aa hypothetical protein
2372 CAMRAD010000006.1 GCA947039925_01215 CDS open 76086-76655 _na     189_aa hypothetical protein
2373 CAMRAD010000006.1 GCA947039925_01216 CDS open 76652-77014 _na     120_aa hypothetical protein
2374 CAMRAD010000006.1 GCA947039925_01217 CDS open 77174-77872 _na     232_aa hypothetical protein
2375 CAMRAD010000006.1 GCA947039925_01218 CDS open 78095-78877 _na     260_aa hypothetical protein
2376 CAMRAD010000006.1 GCA947039925_01219 CDS open 79010-80143 _na     377_aa hypothetical protein
2377 CAMRAD010000006.1 GCA947039925_01220 CDS open 80362-81264 _na     300_aa hypothetical protein
2378 CAMRAD010000006.1 GCA947039925_01221 CDS open 81337-82059 _na     240_aa hypothetical protein
2379 CAMRAD010000006.1 GCA947039925_01222 CDS open 82197-83342 _na     381_aa hypothetical protein
2380 CAMRAD010000006.1 GCA947039925_01223 CDS open 83467-83805 _na     112_aa hypothetical protein
2381 CAMRAD010000006.1 GCA947039925_01224 CDS open 84291-84575 _na     94_aa hypothetical protein
2382 CAMRAD010000006.1 GCA947039925_01225 CDS open 84578-85270 _na     230_aa hypothetical protein
2383 CAMRAD010000006.1 GCA947039925_01226 CDS open 85267-85770 _na     167_aa ruvC crossover junction endodeoxyribonuclease RuvC
2384 CAMRAD010000006.1 GCA947039925_01227 CDS open 85774-86934 _na     386_aa hypothetical protein
2385 CAMRAD010000006.1 GCA947039925_01228 CDS open 86931-87326 _na     131_aa hypothetical protein
2386 CAMRAD010000006.1 GCA947039925_01229 CDS open 87429-87644 _na     71_aa hypothetical protein
2387 CAMRAD010000006.1 GCA947039925_01230 CDS open 87619-88380 _na     253_aa hypothetical protein
2388 CAMRAD010000006.1 GCA947039925_01231 CDS open 88413-89396 _na     327_aa Zinc ABC transporter substrate-binding protein
2389 CAMRAD010000006.1 GCA947039925_01232 CDS open 89398-90111 _na     237_aa adcC Putative zinc transport system ATP-binding protein AdcC
2390 CAMRAD010000006.1 GCA947039925_01233 CDS open 90108-90923 _na     271_aa Metal ABC transporter permease
2391 CAMRAD010000006.1 GCA947039925_01234 CDS open 90940-91521 _na     193_aa hypothetical protein
2392 CAMRAD010000006.1 GCA947039925_01235 CDS open 91632-91922 _na     96_aa hypothetical protein
2393 CAMRAD010000006.1 GCA947039925_01236 CDS open 92148-93158 _na     336_aa hypothetical protein
2394 CAMRAD010000006.1 GCA947039925_01237 CDS open 93283-93552 _na     89_aa hypothetical protein
2395 CAMRAD010000006.1 GCA947039925_01148 gene open 57-4730
2396 CAMRAD010000006.1 GCA947039925_01149 gene open 4886-6328
2397 CAMRAD010000006.1 GCA947039925_01150 gene open 6393-8519
2398 CAMRAD010000006.1 GCA947039925_01151 gene open 8706-9371
2399 CAMRAD010000006.1 GCA947039925_01152 gene open 9385-10230
2400 CAMRAD010000006.1 GCA947039925_01153 gene open 10301-11503
2401 CAMRAD010000006.1 GCA947039925_01154 gene open 11536-11724
2402 CAMRAD010000006.1 GCA947039925_01155 gene open 11874-12668
2403 CAMRAD010000006.1 GCA947039925_01156 gene open 12833-13693
2404 CAMRAD010000006.1 GCA947039925_01157 gene open 13695-13922
2405 CAMRAD010000006.1 GCA947039925_01158 gene open 14258-14854
2406 CAMRAD010000006.1 GCA947039925_01159 gene open 14938-15450
2407 CAMRAD010000006.1 GCA947039925_01160 gene open 15665-16003
2408 CAMRAD010000006.1 GCA947039925_01161 gene open 16155-17738
2409 CAMRAD010000006.1 GCA947039925_01162 gene open 17961-19088
2410 CAMRAD010000006.1 GCA947039925_01163 gene open 19440-21923 virB4
2411 CAMRAD010000006.1 GCA947039925_01164 gene open 22001-22483
2412 CAMRAD010000006.1 GCA947039925_01165 gene open 22501-23346
2413 CAMRAD010000006.1 GCA947039925_01166 gene open 23352-24077
2414 CAMRAD010000006.1 GCA947039925_01167 gene open 24091-24414
2415 CAMRAD010000006.1 GCA947039925_01168 gene open 24527-27226
2416 CAMRAD010000006.1 GCA947039925_01169 gene open 27341-28069
2417 CAMRAD010000006.1 GCA947039925_01170 gene open 28201-28488
2418 CAMRAD010000006.1 GCA947039925_01171 gene open 28494-29042
2419 CAMRAD010000006.1 GCA947039925_01172 gene open 29054-30190
2420 CAMRAD010000006.1 GCA947039925_01173 gene open 30405-30725
2421 CAMRAD010000006.1 GCA947039925_01174 gene open 30726-32249
2422 CAMRAD010000006.1 GCA947039925_01175 gene open 32332-33546
2423 CAMRAD010000006.1 GCA947039925_01176 gene open 33970-34686
2424 CAMRAD010000006.1 GCA947039925_01177 gene open 34829-35140
2425 CAMRAD010000006.1 GCA947039925_01178 gene open 35156-35974
2426 CAMRAD010000006.1 GCA947039925_01179 gene open 35994-37091
2427 CAMRAD010000006.1 GCA947039925_01180 gene open 37108-37683
2428 CAMRAD010000006.1 GCA947039925_01181 gene open 37676-38320
2429 CAMRAD010000006.1 GCA947039925_01182 gene open 39154-40560
2430 CAMRAD010000006.1 GCA947039925_01183 gene open 40705-41223
2431 CAMRAD010000006.1 GCA947039925_01184 gene open 41226-41996
2432 CAMRAD010000006.1 GCA947039925_01185 gene open 42157-42423
2433 CAMRAD010000006.1 GCA947039925_01186 gene open 42455-42955
2434 CAMRAD010000006.1 GCA947039925_01187 gene open 43236-44870
2435 CAMRAD010000006.1 GCA947039925_01188 gene open 44947-45315
2436 CAMRAD010000006.1 GCA947039925_01189 gene open 45446-47137
2437 CAMRAD010000006.1 GCA947039925_01190 gene open 47521-47787
2438 CAMRAD010000006.1 GCA947039925_01191 gene open 49599-49766
2439 CAMRAD010000006.1 GCA947039925_01192 gene open 50026-51345
2440 CAMRAD010000006.1 GCA947039925_01193 gene open 51364-52149
2441 CAMRAD010000006.1 GCA947039925_01194 gene open 52168-53607
2442 CAMRAD010000006.1 GCA947039925_01195 gene open 53784-54011
2443 CAMRAD010000006.1 GCA947039925_01196 gene open 54001-54279
2444 CAMRAD010000006.1 GCA947039925_01197 gene open 54276-54866
2445 CAMRAD010000006.1 GCA947039925_01198 gene open 54892-55206
2446 CAMRAD010000006.1 GCA947039925_01199 gene open 55217-55708
2447 CAMRAD010000006.1 GCA947039925_01200 gene open 55705-56199
2448 CAMRAD010000006.1 GCA947039925_01201 gene open 56258-56503
2449 CAMRAD010000006.1 GCA947039925_01202 gene open 56670-57848
2450 CAMRAD010000006.1 GCA947039925_01203 gene open 57862-58551
2451 CAMRAD010000006.1 GCA947039925_01204 gene open 58666-60912
2452 CAMRAD010000006.1 GCA947039925_01205 gene open 60973-61896
2453 CAMRAD010000006.1 GCA947039925_01206 gene open 62009-62560
2454 CAMRAD010000006.1 GCA947039925_01207 gene open 62670-63548
2455 CAMRAD010000006.1 GCA947039925_01208 gene open 63675-67667
2456 CAMRAD010000006.1 GCA947039925_01209 gene open 67796-71284
2457 CAMRAD010000006.1 GCA947039925_01210 gene open 71502-72905
2458 CAMRAD010000006.1 GCA947039925_01211 gene open 73022-74872
2459 CAMRAD010000006.1 GCA947039925_01212 gene open 74992-75228
2460 CAMRAD010000006.1 GCA947039925_01213 gene open 75244-75660
2461 CAMRAD010000006.1 GCA947039925_01214 gene open 75657-76049
2462 CAMRAD010000006.1 GCA947039925_01215 gene open 76086-76655
2463 CAMRAD010000006.1 GCA947039925_01216 gene open 76652-77014
2464 CAMRAD010000006.1 GCA947039925_01217 gene open 77174-77872
2465 CAMRAD010000006.1 GCA947039925_01218 gene open 78095-78877
2466 CAMRAD010000006.1 GCA947039925_01219 gene open 79010-80143
2467 CAMRAD010000006.1 GCA947039925_01220 gene open 80362-81264
2468 CAMRAD010000006.1 GCA947039925_01221 gene open 81337-82059
2469 CAMRAD010000006.1 GCA947039925_01222 gene open 82197-83342
2470 CAMRAD010000006.1 GCA947039925_01223 gene open 83467-83805
2471 CAMRAD010000006.1 GCA947039925_01224 gene open 84291-84575
2472 CAMRAD010000006.1 GCA947039925_01225 gene open 84578-85270
2473 CAMRAD010000006.1 GCA947039925_01226 gene open 85267-85770 ruvC
2474 CAMRAD010000006.1 GCA947039925_01227 gene open 85774-86934
2475 CAMRAD010000006.1 GCA947039925_01228 gene open 86931-87326
2476 CAMRAD010000006.1 GCA947039925_01229 gene open 87429-87644
2477 CAMRAD010000006.1 GCA947039925_01230 gene open 87619-88380
2478 CAMRAD010000006.1 GCA947039925_01231 gene open 88413-89396
2479 CAMRAD010000006.1 GCA947039925_01232 gene open 89398-90111 adcC
2480 CAMRAD010000006.1 GCA947039925_01233 gene open 90108-90923
2481 CAMRAD010000006.1 GCA947039925_01234 gene open 90940-91521
2482 CAMRAD010000006.1 GCA947039925_01235 gene open 91632-91922
2483 CAMRAD010000006.1 GCA947039925_01236 gene open 92148-93158
2484 CAMRAD010000006.1 GCA947039925_01237 gene open 93283-93552
2485 CAMRAD010000007.1 GCA947039925_01238 CDS open 148-1512 _na     454_aa radA DNA repair protein RadA
2486 CAMRAD010000007.1 GCA947039925_01239 CDS open 1512-1919 _na     135_aa Peptidase S11 D-Ala-D-Ala carboxypeptidase A C-terminal domain-containing protein
2487 CAMRAD010000007.1 GCA947039925_01240 CDS open 1948-4440 _na     830_aa clpC ATP-dependent Clp protease ATP-binding subunit ClpC
2488 CAMRAD010000007.1 GCA947039925_01241 CDS open 4456-6666 _na     736_aa hypothetical protein
2489 CAMRAD010000007.1 GCA947039925_01242 CDS open 6844-8214 _na     456_aa Permease
2490 CAMRAD010000007.1 GCA947039925_01243 CDS open 8335-8682 _na     115_aa yajC Preprotein translocase%2C YajC subunit
2491 CAMRAD010000007.1 GCA947039925_01244 CDS open 8797-9951 _na     384_aa Queuine tRNA-ribosyltransferase
2492 CAMRAD010000007.1 GCA947039925_01245 CDS open 10102-11187 _na     361_aa hypothetical protein
2493 CAMRAD010000007.1 GCA947039925_01246 CDS open 11197-12423 _na     408_aa yhbU putative protease yhbU
2494 CAMRAD010000007.1 GCA947039925_01247 CDS open 12508-13149 _na     213_aa hypothetical protein
2495 CAMRAD010000007.1 GCA947039925_01248 CDS open 13151-14815 _na     554_aa Ribonuclease J
2496 CAMRAD010000007.1 GCA947039925_01249 CDS open 14843-15094 _na     83_aa hypothetical protein
2497 CAMRAD010000007.1 GCA947039925_01250 CDS open 15097-15528 _na     143_aa Putative pre-16S rRNA nuclease
2498 CAMRAD010000007.1 GCA947039925_01251 CDS open 15528-15794 _na     88_aa UPF0297 protein Cthe_0151
2499 CAMRAD010000007.1 GCA947039925_01252 CDS open 15828-17156 _na     442_aa miaB (Dimethylallyl)adenosine tRNA methylthiotransferase MiaB
2500 CAMRAD010000007.1 GCA947039925_01253 CDS open 17242-17475 _na     77_aa HPr domain-containing protein