HOMD Banner
Taxonomy: V4.3   |  16S rRNA RefSeq: V16.03   |  Genomic RefSeq: V11.03   |  Viruses: V1.2

BAKTAGenome Explorer: Prevotella bivia (GCA_947041195.1)

Select a Genome:
BAKTA Annotations for GCA_947041195.1
Genome Selected: Prevotella bivia
ContigsBases CDSrRNA tmRNAtRNA
46 2110058 1769 1 0 41
[Table]   [AA Fasta]      [Browser]   [Text]   [Excel]  
Search & Sort all 3639 Records
Search These Records: Clear
Sort Column:   Molecule   PID   NA   AA   Gene  Gene Product  Reverse
Annotation Table [page:8]    |    Number of Records Found: 3639 [8 Pages]    |    Previous Page <==> Next Page    |    Jump to Page: [ 1  2  3  4  5  6  7  8  ]
Notes:   1- Column headers only sort the current page. 2- Select [NA] or [AA] links to show sequences.
Region Protein-ID Type Genome
Viewer		 Range
(bp)		 Show Sequences
(length) NA / AA		 BAKTA
Gene		 BAKTA
GeneProduct
3501 CAMRDC010000037.1 GCA947041195_01743 gene open 3984-4757
3502 CAMRDC010000037.1 GCA947041195_01744 gene open 4852-5436
3503 CAMRDC010000037.1 GCA947041195_01745 gene open 5530-6261
3504 CAMRDC010000037.1 GCA947041195_01746 gene open 6323-6655
3505 CAMRDC010000037.1 GCA947041195_01747 gene open 6684-9944
3506 CAMRDC010000037.1 GCA947041195_01748 gene open 10653-11441
3507 CAMRDC010000037.1 GCA947041195_01749 gene open 11469-12023
3508 CAMRDC010000037.1 GCA947041195_01750 gene open 12023-13285 nupG
3509 CAMRDC010000037.1 GCA947041195_01751 gene open 13370-13969
3510 CAMRDC010000037.1 GCA947041195_01752 gene open 14845-15327
3511 CAMRDC010000037.1 GCA947041195_01753 gene open 15596-16012
3512 CAMRDC010000037.1 GCA947041195_01754 gene open 16009-17340
3513 CAMRDC010000037.1 GCA947041195_01755 gene open 17642-17872
3514 CAMRDC010000037.1 GCA947041195_01756 gene open 17869-18114
3515 CAMRDC010000037.1 GCA947041195_01757 gene open 18057-18476 yahA
3516 CAMRDC010000037.1 GCA947041195_01758 gene open 18885-20216
3517 CAMRDC010000037.1 GCA947041195_01738 gene open 142-214 trnfM
3518 CAMRDC010000037.1 GCA947041195_01738 tRNA open 142-214 trnfM tRNA-fMet(cat)
3519 CAMRDC010000038.1 repeat_region open 7929-10133 CRISPR array with 29 repeats of length 47%2C consensus sequence GTTGTGTTTGATACCACAAAGATAGAAATTTTCAAGCAAATCACAAC and spacer length 29
3520 CAMRDC010000038.1 GCA947041195_01759 CDS open 773-1417 _na     214_aa luxR Transcriptional regulator%2C LuxR family
3521 CAMRDC010000038.1 GCA947041195_01760 CDS open 1473-1649 _na     58_aa hypothetical protein
3522 CAMRDC010000038.1 GCA947041195_01761 CDS open 2077-6534 _na     1485_aa cas9 type II CRISPR RNA-guided endonuclease Cas9
3523 CAMRDC010000038.1 GCA947041195_01762 CDS open 6544-7476 _na     310_aa cas1 type II CRISPR-associated endonuclease Cas1
3524 CAMRDC010000038.1 GCA947041195_01763 CDS open 7478-7819 _na     113_aa cas2 CRISPR-associated endonuclease Cas2
3525 CAMRDC010000038.1 GCA947041195_01764 CDS open 10228-10746 _na     172_aa Phage integrase SAM-like domain-containing protein
3526 CAMRDC010000038.1 GCA947041195_01766 CDS open 11234-12271 _na     345_aa asnA aspartate--ammonia ligase
3527 CAMRDC010000038.1 GCA947041195_01767 CDS open 12415-13302 _na     295_aa Acyltransferase
3528 CAMRDC010000038.1 GCA947041195_01768 CDS open 13314-14378 _na     354_aa Peptidylarginine deiminase-like enzyme
3529 CAMRDC010000038.1 GCA947041195_01769 CDS open 14676-14786 _na     36_aa hypothetical protein
3530 CAMRDC010000038.1 GCA947041195_01770 CDS open 15140-15955 _na     271_aa Nif3-like dinuclear metal center hexameric protein
3531 CAMRDC010000038.1 GCA947041195_01771 CDS open 15991-16815 _na     274_aa C4-type zinc ribbon domain-containing protein
3532 CAMRDC010000038.1 GCA947041195_01759 gene open 773-1417 luxR
3533 CAMRDC010000038.1 GCA947041195_01760 gene open 1473-1649
3534 CAMRDC010000038.1 GCA947041195_01761 gene open 2077-6534 cas9
3535 CAMRDC010000038.1 GCA947041195_01762 gene open 6544-7476 cas1
3536 CAMRDC010000038.1 GCA947041195_01763 gene open 7478-7819 cas2
3537 CAMRDC010000038.1 GCA947041195_01764 gene open 10228-10746
3538 CAMRDC010000038.1 GCA947041195_01766 gene open 11234-12271 asnA
3539 CAMRDC010000038.1 GCA947041195_01767 gene open 12415-13302
3540 CAMRDC010000038.1 GCA947041195_01768 gene open 13314-14378
3541 CAMRDC010000038.1 GCA947041195_01769 gene open 14676-14786
3542 CAMRDC010000038.1 GCA947041195_01770 gene open 15140-15955
3543 CAMRDC010000038.1 GCA947041195_01771 gene open 15991-16815
3544 CAMRDC010000038.1 GCA947041195_01765 gene open 10862-10933 trnR
3545 CAMRDC010000038.1 GCA947041195_01765 tRNA open 10862-10933 trnR tRNA-Arg(ccg)
3546 CAMRDC010000039.1 GCA947041195_01772 CDS open 120-1316 _na     398_aa tuf elongation factor Tu
3547 CAMRDC010000039.1 GCA947041195_01774 CDS open 1469-1660 _na     63_aa secE preprotein translocase subunit SecE
3548 CAMRDC010000039.1 GCA947041195_01775 CDS open 1674-2222 _na     182_aa nusG transcription termination/antitermination protein NusG
3549 CAMRDC010000039.1 GCA947041195_01776 CDS open 2282-2722 _na     146_aa rplK 50S ribosomal protein L11
3550 CAMRDC010000039.1 GCA947041195_01777 CDS open 2744-3436 _na     230_aa rplA 50S ribosomal protein L1
3551 CAMRDC010000039.1 GCA947041195_01778 CDS open 3455-3973 _na     172_aa rplJ 50S ribosomal protein L10
3552 CAMRDC010000039.1 GCA947041195_01779 CDS open 4033-4410 _na     125_aa rplL 50S ribosomal protein L7/L12
3553 CAMRDC010000039.1 GCA947041195_01780 CDS open 4552-8361 _na     1269_aa rpoB DNA-directed RNA polymerase subunit beta
3554 CAMRDC010000039.1 GCA947041195_01781 CDS open 8388-12761 _na     1457_aa rpoC DNA-directed RNA polymerase subunit beta'
3555 CAMRDC010000039.1 GCA947041195_01782 CDS open 12893-13222 _na     109_aa DUF3467 domain-containing protein
3556 CAMRDC010000039.1 GCA947041195_01772 gene open 120-1316 tuf
3557 CAMRDC010000039.1 GCA947041195_01774 gene open 1469-1660 secE
3558 CAMRDC010000039.1 GCA947041195_01775 gene open 1674-2222 nusG
3559 CAMRDC010000039.1 GCA947041195_01776 gene open 2282-2722 rplK
3560 CAMRDC010000039.1 GCA947041195_01777 gene open 2744-3436 rplA
3561 CAMRDC010000039.1 GCA947041195_01778 gene open 3455-3973 rplJ
3562 CAMRDC010000039.1 GCA947041195_01779 gene open 4033-4410 rplL
3563 CAMRDC010000039.1 GCA947041195_01780 gene open 4552-8361 rpoB
3564 CAMRDC010000039.1 GCA947041195_01781 gene open 8388-12761 rpoC
3565 CAMRDC010000039.1 GCA947041195_01782 gene open 12893-13222
3566 CAMRDC010000039.1 GCA947041195_01773 gene open 1380-1452 trnW
3567 CAMRDC010000039.1 GCA947041195_01773 tRNA open 1380-1452 trnW tRNA-Trp(cca)
3568 CAMRDC010000040.1 GCA947041195_01783 CDS open 55-792 _na     245_aa Nitroreductase
3569 CAMRDC010000040.1 GCA947041195_01784 CDS open 889-3477 _na     862_aa adenosylcobalamin-dependent ribonucleoside-diphosphate reductase
3570 CAMRDC010000040.1 GCA947041195_01785 CDS open 3537-3947 _na     136_aa folB dihydroneopterin aldolase
3571 CAMRDC010000040.1 GCA947041195_01786 CDS open 3972-5201 _na     409_aa N-acetylmuramoyl-L-alanine amidase
3572 CAMRDC010000040.1 GCA947041195_01787 CDS open 5214-6194 _na     326_aa Mce/MlaD domain-containing protein
3573 CAMRDC010000040.1 GCA947041195_01788 CDS open 6594-7997 _na     467_aa dnaA chromosomal replication initiator protein DnaA
3574 CAMRDC010000040.1 GCA947041195_01789 CDS open 8154-8885 _na     243_aa Cysteine-rich domain protein
3575 CAMRDC010000040.1 GCA947041195_01790 CDS open 8906-10321 _na     471_aa 4Fe-4S ferredoxin-type domain-containing protein
3576 CAMRDC010000040.1 GCA947041195_01791 CDS open 10346-10921 _na     191_aa LUD domain-containing protein
3577 CAMRDC010000040.1 GCA947041195_01792 CDS open 11049-12356 _na     435_aa eno phosphopyruvate hydratase
3578 CAMRDC010000040.1 GCA947041195_01783 gene open 55-792
3579 CAMRDC010000040.1 GCA947041195_01784 gene open 889-3477
3580 CAMRDC010000040.1 GCA947041195_01785 gene open 3537-3947 folB
3581 CAMRDC010000040.1 GCA947041195_01786 gene open 3972-5201
3582 CAMRDC010000040.1 GCA947041195_01787 gene open 5214-6194
3583 CAMRDC010000040.1 GCA947041195_01788 gene open 6594-7997 dnaA
3584 CAMRDC010000040.1 GCA947041195_01789 gene open 8154-8885
3585 CAMRDC010000040.1 GCA947041195_01790 gene open 8906-10321
3586 CAMRDC010000040.1 GCA947041195_01791 gene open 10346-10921
3587 CAMRDC010000040.1 GCA947041195_01792 gene open 11049-12356 eno
3588 CAMRDC010000041.1 GCA947041195_01793 CDS open 355-1173 _na     272_aa Lipoprotein
3589 CAMRDC010000041.1 GCA947041195_01794 CDS open 1320-3098 _na     592_aa Pyruvate/oxaloacetate carboxyltransferase
3590 CAMRDC010000041.1 GCA947041195_01795 CDS open 3205-3738 _na     177_aa HEAT repeat domain-containing protein
3591 CAMRDC010000041.1 GCA947041195_01796 CDS open 3740-4276 _na     178_aa Phosphohydrolase
3592 CAMRDC010000041.1 GCA947041195_01797 CDS open 4344-5030 _na     228_aa cutC PF03932 family protein CutC
3593 CAMRDC010000041.1 GCA947041195_01793 gene open 355-1173
3594 CAMRDC010000041.1 GCA947041195_01794 gene open 1320-3098
3595 CAMRDC010000041.1 GCA947041195_01795 gene open 3205-3738
3596 CAMRDC010000041.1 GCA947041195_01796 gene open 3740-4276
3597 CAMRDC010000041.1 GCA947041195_01797 gene open 4344-5030 cutC
3598 CAMRDC010000042.1 GCA947041195_01798 CDS open 75-953 _na     292_aa Peptidase M48 domain-containing protein
3599 CAMRDC010000042.1 GCA947041195_01799 CDS open 1085-2476 _na     463_aa mepA Multidrug export protein MepA
3600 CAMRDC010000042.1 GCA947041195_01800 CDS open 2503-3627 _na     374_aa UDP-N-acetylglucosamine 2-epimerase
3601 CAMRDC010000042.1 GCA947041195_01801 CDS open 3636-4589 _na     317_aa Membrane protease subunit%2C stomatin/prohibitin
3602 CAMRDC010000042.1 GCA947041195_01802 CDS open 4606-5064 _na     152_aa Membrane protein implicated in regulation of membrane protease activity
3603 CAMRDC010000042.1 GCA947041195_01798 gene open 75-953
3604 CAMRDC010000042.1 GCA947041195_01799 gene open 1085-2476 mepA
3605 CAMRDC010000042.1 GCA947041195_01800 gene open 2503-3627
3606 CAMRDC010000042.1 GCA947041195_01801 gene open 3636-4589
3607 CAMRDC010000042.1 GCA947041195_01802 gene open 4606-5064
3608 CAMRDC010000043.1 GCA947041195_01803 CDS open 341-1507 _na     388_aa RHS repeat domain-containing protein
3609 CAMRDC010000043.1 GCA947041195_01804 CDS open 1586-2218 _na     210_aa hypothetical protein
3610 CAMRDC010000043.1 GCA947041195_01805 CDS open 2218-3516 _na     432_aa RHS repeat-associated core domain protein
3611 CAMRDC010000043.1 GCA947041195_01806 CDS open 3461-4195 _na     244_aa hypothetical protein
3612 CAMRDC010000043.1 GCA947041195_01807 CDS open 4422-4859 _na     145_aa Astacin (Peptidase family M12A)
3613 CAMRDC010000043.1 GCA947041195_01803 gene open 341-1507
3614 CAMRDC010000043.1 GCA947041195_01804 gene open 1586-2218
3615 CAMRDC010000043.1 GCA947041195_01805 gene open 2218-3516
3616 CAMRDC010000043.1 GCA947041195_01806 gene open 3461-4195
3617 CAMRDC010000043.1 GCA947041195_01807 gene open 4422-4859
3618 CAMRDC010000044.1 GCA947041195_01808 CDS open 59-685 _na     208_aa hypothetical protein
3619 CAMRDC010000044.1 GCA947041195_01809 CDS open 1042-1860 _na     272_aa GLPGLI family protein
3620 CAMRDC010000044.1 GCA947041195_01810 CDS open 1860-4454 _na     864_aa Outer membrane protein beta-barrel domain-containing protein
3621 CAMRDC010000044.1 GCA947041195_01811 CDS open 4457-4627 _na     56_aa Peptidase C39 domain-containing protein
3622 CAMRDC010000044.1 GCA947041195_01808 gene open 59-685
3623 CAMRDC010000044.1 GCA947041195_01809 gene open 1042-1860
3624 CAMRDC010000044.1 GCA947041195_01810 gene open 1860-4454
3625 CAMRDC010000044.1 GCA947041195_01811 gene open 4457-4627
3626 CAMRDC010000045.1 GCA947041195_01812 CDS open 185-700 _na     171_aa bacteriocin fulvocin C-related protein
3627 CAMRDC010000045.1 GCA947041195_01813 CDS open 805-1239 _na     144_aa hypothetical protein
3628 CAMRDC010000045.1 GCA947041195_01814 CDS open 1795-2496 _na     233_aa rsmI 16S rRNA (cytidine(1402)-2'-O)-methyltransferase
3629 CAMRDC010000045.1 GCA947041195_01815 CDS open 2520-3434 _na     304_aa Lipoprotein
3630 CAMRDC010000045.1 GCA947041195_01816 CDS open 3475-3693 _na     72_aa hypothetical protein
3631 CAMRDC010000045.1 GCA947041195_01812 gene open 185-700
3632 CAMRDC010000045.1 GCA947041195_01813 gene open 805-1239
3633 CAMRDC010000045.1 GCA947041195_01814 gene open 1795-2496 rsmI
3634 CAMRDC010000045.1 GCA947041195_01815 gene open 2520-3434
3635 CAMRDC010000045.1 GCA947041195_01816 gene open 3475-3693
3636 CAMRDC010000046.1 GCA947041195_01817 CDS open 448-2082 _na     544_aa Lipoprotein
3637 CAMRDC010000046.1 GCA947041195_01818 CDS open 2179-2391 _na     70_aa hypothetical protein
3638 CAMRDC010000046.1 GCA947041195_01817 gene open 448-2082
3639 CAMRDC010000046.1 GCA947041195_01818 gene open 2179-2391