HOMD Banner
Taxonomy: V4.3   |  16S rRNA RefSeq: V16.03   |  Genomic RefSeq: V11.03   |  Viruses: V1.2

BAKTAGenome Explorer: Fannyhessea vaginae (GCA_947087685.1)

Select a Genome:
BAKTA Annotations for GCA_947087685.1
Genome Selected: Fannyhessea vaginae
ContigsBases CDSrRNA tmRNAtRNA
8 1489168 1227 0 1 46
[Table]   [AA Fasta]      [Browser]   [Text]   [Excel]  
Search & Sort all 2564 Records
Search These Records: Clear
Sort Column:   Molecule   PID   NA   AA   Gene  Gene Product  Reverse
Annotation Table [page:3]    |    Number of Records Found: 2564 [6 Pages]    |    Previous Page <==> Next Page    |    Jump to Page: [ 1  2  3  4  5  6  ]
Notes:   1- Column headers only sort the current page. 2- Select [NA] or [AA] links to show sequences.
Region Protein-ID Type Genome
Viewer
Range
(bp)
Show Sequences
(length) NA / AA
BAKTA
Gene
BAKTA
GeneProduct
1001 CAMUDH010000002.1 GCA947087685_00643 CDS open 298692-299678 _na     328_aa dppC ABC transporter%2C permease protein
1002 CAMUDH010000002.1 GCA947087685_00644 CDS open 299693-300730 _na     345_aa dppB ABC transporter%2C permease protein
1003 CAMUDH010000002.1 GCA947087685_00645 CDS open 301092-302741 _na     549_aa oppA Tat pathway signal sequence domain protein
1004 CAMUDH010000002.1 GCA947087685_00646 CDS open 303098-303811 _na     237_aa DNA alkylation repair protein
1005 CAMUDH010000002.1 GCA947087685_00647 CDS open 303984-304232 _na     82_aa secG preprotein translocase subunit SecG
1006 CAMUDH010000002.1 GCA947087685_00648 CDS open 304520-305284 _na     254_aa tpiA triose-phosphate isomerase
1007 CAMUDH010000002.1 GCA947087685_00649 CDS open 305277-306467 _na     396_aa pgk Phosphoglycerate kinase
1008 CAMUDH010000002.1 GCA947087685_00650 CDS open 306617-307642 _na     341_aa gap type I glyceraldehyde-3-phosphate dehydrogenase
1009 CAMUDH010000002.1 GCA947087685_00651 CDS open 308113-309342 _na     409_aa rpsA 30S ribosomal protein S1
1010 CAMUDH010000002.1 GCA947087685_00652 CDS open 309666-311369 _na     567_aa yfcC C4-dicarboxylate anaerobic carrier
1011 CAMUDH010000002.1 GCA947087685_00653 CDS open 311809-312801 _na     330_aa argF ornithine carbamoyltransferase
1012 CAMUDH010000002.1 GCA947087685_00654 CDS open 312867-314117 _na     416_aa arcA Arginine deiminase
1013 CAMUDH010000002.1 GCA947087685_00655 CDS open 314634-316541 _na     635_aa ftsH ATP-dependent zinc metalloprotease FtsH
1014 CAMUDH010000002.1 GCA947087685_00657 CDS open 317036-319066 _na     676_aa mdlB ABC transporter%2C ATP-binding protein
1015 CAMUDH010000002.1 GCA947087685_00658 CDS open 319152-321035 _na     627_aa mdlB ABC transporter%2C ATP-binding protein
1016 CAMUDH010000002.1 GCA947087685_00659 CDS open 321039-322856 _na     605_aa ccmA heme ABC exporter ATP-binding protein CcmA
1017 CAMUDH010000002.1 GCA947087685_00660 CDS open 322898-324187 _na     429_aa coaBC bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC
1018 CAMUDH010000002.1 GCA947087685_00661 CDS open 324211-324933 _na     240_aa dR0291 C4-type zinc ribbon domain-containing protein
1019 CAMUDH010000002.1 GCA947087685_00662 CDS open 324960-326135 _na     391_aa nifS Aminotransferase%2C class V
1020 CAMUDH010000002.1 GCA947087685_00663 CDS open 326137-326823 _na     228_aa rpe ribulose-phosphate 3-epimerase
1021 CAMUDH010000002.1 GCA947087685_00664 CDS open 326836-327858 _na     340_aa gpsA Glycerol-3-phosphate dehydrogenase [NAD(P)+]
1022 CAMUDH010000002.1 GCA947087685_00665 CDS open 327996-328679 _na     227_aa plsY glycerol-3-phosphate 1-O-acyltransferase PlsY
1023 CAMUDH010000002.1 GCA947087685_00666 CDS open 328737-330053 _na     438_aa der ribosome biogenesis GTPase Der
1024 CAMUDH010000002.1 GCA947087685_00667 CDS open 330166-331014 _na     282_aa ispH 4-hydroxy-3-methylbut-2-enyl diphosphate reductase
1025 CAMUDH010000002.1 GCA947087685_00668 CDS open 331052-332593 _na     513_aa cmk (d)CMP kinase
1026 CAMUDH010000002.1 GCA947087685_00669 CDS open 332590-333447 _na     285_aa rsuA Pseudouridine synthase
1027 CAMUDH010000002.1 GCA947087685_00670 CDS open 333448-334080 _na     210_aa scpB SMC-Scp complex subunit ScpB
1028 CAMUDH010000002.1 GCA947087685_00671 CDS open 334097-334900 _na     267_aa scpA Segregation and condensation protein A
1029 CAMUDH010000002.1 GCA947087685_00672 CDS open 335004-335699 _na     231_aa spoIVFB Peptidase%2C M50 family
1030 CAMUDH010000002.1 GCA947087685_00673 CDS open 335835-336530 _na     231_aa YGGT family protein
1031 CAMUDH010000002.1 GCA947087685_00674 CDS open 336523-338646 _na     707_aa abc-f ribosomal protection-like ABC-F family protein
1032 CAMUDH010000002.1 GCA947087685_00675 CDS open 338776-339534 _na     252_aa pdxT pyridoxal 5'-phosphate synthase glutaminase subunit PdxT
1033 CAMUDH010000002.1 GCA947087685_00676 CDS open 339587-340534 _na     315_aa pdxS pyridoxal 5'-phosphate synthase lyase subunit PdxS
1034 CAMUDH010000002.1 GCA947087685_00677 CDS open 340898-341275 _na     125_aa hypothetical protein
1035 CAMUDH010000002.1 GCA947087685_00678 CDS open 341459-342748 _na     429_aa eno phosphopyruvate hydratase
1036 CAMUDH010000002.1 GCA947087685_00679 CDS open 343571-345328 _na     585_aa hisJ ABC transporter%2C permease protein
1037 CAMUDH010000002.1 GCA947087685_00680 CDS open 345360-346118 _na     252_aa glnQ ABC transporter%2C ATP-binding protein
1038 CAMUDH010000002.1 GCA947087685_00681 CDS open 346137-346523 _na     128_aa hypothetical protein
1039 CAMUDH010000002.1 GCA947087685_00682 CDS open 346804-348069 _na     421_aa hypothetical protein
1040 CAMUDH010000002.1 GCA947087685_00683 CDS open 348294-349973 _na     559_aa LPXTG-motif protein cell wall anchor domain protein
1041 CAMUDH010000002.1 GCA947087685_00685 CDS open 350770-351558 _na     262_aa puuD Peptidase C26
1042 CAMUDH010000002.1 GCA947087685_00686 CDS open 351612-351836 _na     74_aa hypothetical protein
1043 CAMUDH010000002.1 GCA947087685_00687 CDS open 351751-353310 _na     519_aa aspB alanine transaminase
1044 CAMUDH010000002.1 GCA947087685_00688 CDS open 353544-354755 _na     403_aa norV Metallo-beta-lactamase domain protein
1045 CAMUDH010000002.1 GCA947087685_00689 CDS open 354909-356390 _na     493_aa brnQ branched-chain amino acid transport system II carrier protein
1046 CAMUDH010000002.1 GCA947087685_00690 CDS open 356683-358071 _na     462_aa elsH Endonuclease/exonuclease/phosphatase family protein
1047 CAMUDH010000002.1 GCA947087685_00691 CDS open 358263-360206 _na     647_aa nit1 NAD(+) synthase
1048 CAMUDH010000002.1 GCA947087685_00692 CDS open 360208-362751 _na     847_aa tsaD tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD
1049 CAMUDH010000002.1 GCA947087685_00693 CDS open 362764-363294 _na     176_aa tsaE tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE
1050 CAMUDH010000002.1 GCA947087685_00694 CDS open 363366-364523 _na     385_aa alr alanine racemase
1051 CAMUDH010000002.1 GCA947087685_00695 CDS open 364718-366313 _na     531_aa nnr2 Bifunctional NAD(P)H-hydrate repair enzyme
1052 CAMUDH010000002.1 GCA947087685_00696 CDS open 366472-367026 _na     184_aa acpS Holo-[acyl-carrier-protein] synthase
1053 CAMUDH010000002.1 GCA947087685_00697 CDS open 367130-368977 _na     615_aa glmS glutamine--fructose-6-phosphate transaminase (isomerizing)
1054 CAMUDH010000002.1 GCA947087685_00698 CDS open 369390-370262 _na     290_aa aRA1 Oxidoreductase%2C aldo/keto reductase family protein
1055 CAMUDH010000002.1 GCA947087685_00699 CDS open 370413-371237 _na     274_aa lgt prolipoprotein diacylglyceryl transferase
1056 CAMUDH010000002.1 GCA947087685_00700 CDS open 371243-371812 _na     189_aa NifU-like protein
1057 CAMUDH010000002.1 GCA947087685_00701 CDS open 371952-374549 _na     865_aa rlhA Peptidase%2C U32 family
1058 CAMUDH010000002.1 GCA947087685_00702 CDS open 374630-376534 _na     634_aa wcaE Galactofuranosyltransferase GlfT2 N-terminal domain-containing protein
1059 CAMUDH010000002.1 GCA947087685_00703 CDS open 376586-377818 _na     410_aa tyrS tyrosine--tRNA ligase
1060 CAMUDH010000002.1 GCA947087685_00704 CDS open 378085-380298 _na     737_aa mrcB peptidoglycan glycosyltransferase
1061 CAMUDH010000002.1 GCA947087685_00705 CDS open 380432-381073 _na     213_aa deoC deoxyribose-phosphate aldolase
1062 CAMUDH010000002.1 GCA947087685_00706 CDS open 381311-382414 _na     367_aa Peptidase C39-like domain-containing protein
1063 CAMUDH010000002.1 GCA947087685_00707 CDS open 382936-383379 _na     147_aa argR Arginine repressor
1064 CAMUDH010000002.1 GCA947087685_00708 CDS open 383574-385298 _na     574_aa manB Phosphoglucomutase/phosphomannomutase%2C alpha/beta/alpha domain II
1065 CAMUDH010000002.1 GCA947087685_00709 CDS open 385731-388202 _na     823_aa rlmL bifunctional 23S rRNA (guanine(2069)-N(7))-methyltransferase RlmK/23S rRNA (guanine(2445)-N(2))-methyltransferase RlmL
1066 CAMUDH010000002.1 GCA947087685_00710 CDS open 388404-389153 _na     249_aa udp Uridine phosphorylase
1067 CAMUDH010000002.1 GCA947087685_00711 CDS open 389515-391080 _na     521_aa kex1 Serine carboxypeptidase
1068 CAMUDH010000002.1 GCA947087685_00712 CDS open 391206-393641 _na     811_aa kup putative potassium transport system protein Kup
1069 CAMUDH010000002.1 GCA947087685_00713 CDS open 393851-395182 _na     443_aa NlpC/P60 family protein
1070 CAMUDH010000002.1 GCA947087685_00364 gene open 178-714
1071 CAMUDH010000002.1 GCA947087685_00365 gene open 1036-1767
1072 CAMUDH010000002.1 GCA947087685_00366 gene open 1725-2198
1073 CAMUDH010000002.1 GCA947087685_00367 gene open 2447-2764
1074 CAMUDH010000002.1 GCA947087685_00368 gene open 2779-4686
1075 CAMUDH010000002.1 GCA947087685_00369 gene open 4706-5074
1076 CAMUDH010000002.1 GCA947087685_00370 gene open 5168-5368
1077 CAMUDH010000002.1 GCA947087685_00371 gene open 5529-6116
1078 CAMUDH010000002.1 GCA947087685_00372 gene open 6140-6340
1079 CAMUDH010000002.1 GCA947087685_00373 gene open 6497-7084
1080 CAMUDH010000002.1 GCA947087685_00374 gene open 7144-7413
1081 CAMUDH010000002.1 GCA947087685_00375 gene open 7397-7633
1082 CAMUDH010000002.1 GCA947087685_00376 gene open 7804-9381
1083 CAMUDH010000002.1 GCA947087685_00377 gene open 9488-12475
1084 CAMUDH010000002.1 GCA947087685_00378 gene open 12500-13066
1085 CAMUDH010000002.1 GCA947087685_00379 gene open 13175-13402
1086 CAMUDH010000002.1 GCA947087685_00380 gene open 13415-14620
1087 CAMUDH010000002.1 GCA947087685_00381 gene open 14849-16900
1088 CAMUDH010000002.1 GCA947087685_00382 gene open 16933-17784
1089 CAMUDH010000002.1 GCA947087685_00383 gene open 17797-19371
1090 CAMUDH010000002.1 GCA947087685_00384 gene open 19510-22266
1091 CAMUDH010000002.1 GCA947087685_00385 gene open 22295-22744 prgI
1092 CAMUDH010000002.1 GCA947087685_00386 gene open 22760-23857
1093 CAMUDH010000002.1 GCA947087685_00387 gene open 23870-24091
1094 CAMUDH010000002.1 GCA947087685_00388 gene open 24215-26218
1095 CAMUDH010000002.1 GCA947087685_00389 gene open 26394-27215
1096 CAMUDH010000002.1 GCA947087685_00390 gene open 27285-28106
1097 CAMUDH010000002.1 GCA947087685_00391 gene open 28090-28410
1098 CAMUDH010000002.1 GCA947087685_00392 gene open 28423-28608
1099 CAMUDH010000002.1 GCA947087685_00393 gene open 28635-29606
1100 CAMUDH010000002.1 GCA947087685_00394 gene open 29619-30194
1101 CAMUDH010000002.1 GCA947087685_00395 gene open 30303-31115
1102 CAMUDH010000002.1 GCA947087685_00396 gene open 31174-31896
1103 CAMUDH010000002.1 GCA947087685_00397 gene open 31966-32463
1104 CAMUDH010000002.1 GCA947087685_00398 gene open 32566-34332
1105 CAMUDH010000002.1 GCA947087685_00399 gene open 34346-35548
1106 CAMUDH010000002.1 GCA947087685_00400 gene open 35651-37399
1107 CAMUDH010000002.1 GCA947087685_00401 gene open 37545-38645
1108 CAMUDH010000002.1 GCA947087685_00402 gene open 38656-38961
1109 CAMUDH010000002.1 GCA947087685_00403 gene open 38972-39715
1110 CAMUDH010000002.1 GCA947087685_00404 gene open 39684-40538
1111 CAMUDH010000002.1 GCA947087685_00405 gene open 40551-40811
1112 CAMUDH010000002.1 GCA947087685_00406 gene open 40879-41127
1113 CAMUDH010000002.1 GCA947087685_00407 gene open 41130-41345
1114 CAMUDH010000002.1 GCA947087685_00408 gene open 41456-41824
1115 CAMUDH010000002.1 GCA947087685_00409 gene open 41821-42048
1116 CAMUDH010000002.1 GCA947087685_00410 gene open 42299-42643
1117 CAMUDH010000002.1 GCA947087685_00411 gene open 42750-43094
1118 CAMUDH010000002.1 GCA947087685_00412 gene open 43178-43567
1119 CAMUDH010000002.1 GCA947087685_00413 gene open 43594-44655
1120 CAMUDH010000002.1 GCA947087685_00415 gene open 45015-45785 pgsA
1121 CAMUDH010000002.1 GCA947087685_00416 gene open 45795-46655
1122 CAMUDH010000002.1 GCA947087685_00417 gene open 46659-47072 ridA
1123 CAMUDH010000002.1 GCA947087685_00418 gene open 47135-47575 fHA
1124 CAMUDH010000002.1 GCA947087685_00419 gene open 47583-48314 soxR
1125 CAMUDH010000002.1 GCA947087685_00420 gene open 48359-48892 apt
1126 CAMUDH010000002.1 GCA947087685_00421 gene open 49041-50213
1127 CAMUDH010000002.1 GCA947087685_00422 gene open 50228-51877 clcA
1128 CAMUDH010000002.1 GCA947087685_00423 gene open 52090-53094 trxB
1129 CAMUDH010000002.1 GCA947087685_00424 gene open 53382-54698 uraA
1130 CAMUDH010000002.1 GCA947087685_00425 gene open 54757-56070 nCS2
1131 CAMUDH010000002.1 GCA947087685_00426 gene open 56131-56586 dut
1132 CAMUDH010000002.1 GCA947087685_00427 gene open 56579-57103 nrdR
1133 CAMUDH010000002.1 GCA947087685_00428 gene open 57218-57580 lysM
1134 CAMUDH010000002.1 GCA947087685_00429 gene open 57805-58449 lexA
1135 CAMUDH010000002.1 GCA947087685_00430 gene open 58520-59332
1136 CAMUDH010000002.1 GCA947087685_00431 gene open 59337-60722 hflX
1137 CAMUDH010000002.1 GCA947087685_00432 gene open 60732-61649 miaA
1138 CAMUDH010000002.1 GCA947087685_00433 gene open 61656-63038 miaB
1139 CAMUDH010000002.1 GCA947087685_00434 gene open 63159-63443 spoVS
1140 CAMUDH010000002.1 GCA947087685_00435 gene open 63536-64666 mutL
1141 CAMUDH010000002.1 GCA947087685_00436 gene open 64766-66331 rny
1142 CAMUDH010000002.1 GCA947087685_00437 gene open 67240-68727 trpE
1143 CAMUDH010000002.1 GCA947087685_00438 gene open 68782-69372 pabA
1144 CAMUDH010000002.1 GCA947087685_00439 gene open 69365-70423 trpD
1145 CAMUDH010000002.1 GCA947087685_00440 gene open 70426-71274 trpC
1146 CAMUDH010000002.1 GCA947087685_00441 gene open 71302-71958 trpF
1147 CAMUDH010000002.1 GCA947087685_00442 gene open 71951-73141 trpB
1148 CAMUDH010000002.1 GCA947087685_00443 gene open 73134-74114 trpA
1149 CAMUDH010000002.1 GCA947087685_00444 gene open 74306-74995 recX
1150 CAMUDH010000002.1 GCA947087685_00445 gene open 75054-76145 recA
1151 CAMUDH010000002.1 GCA947087685_00446 gene open 76381-77067 pncC
1152 CAMUDH010000002.1 GCA947087685_00447 gene open 77051-77731 pgsA
1153 CAMUDH010000002.1 GCA947087685_00448 gene open 77737-79251 rimO
1154 CAMUDH010000002.1 GCA947087685_00449 gene open 79384-79881 yajQ
1155 CAMUDH010000002.1 GCA947087685_00450 gene open 79948-81462 rodZ
1156 CAMUDH010000002.1 GCA947087685_00451 gene open 81465-84194 ftsK
1157 CAMUDH010000002.1 GCA947087685_00452 gene open 84195-85853 rnjA
1158 CAMUDH010000002.1 GCA947087685_00453 gene open 86091-88346 pnp
1159 CAMUDH010000002.1 GCA947087685_00454 gene open 88433-88711 rpsO
1160 CAMUDH010000002.1 GCA947087685_00455 gene open 88744-88938
1161 CAMUDH010000002.1 GCA947087685_00456 gene open 88970-89722 recO
1162 CAMUDH010000002.1 GCA947087685_00457 gene open 89843-90736 era
1163 CAMUDH010000002.1 GCA947087685_00458 gene open 90781-91158 dgkA
1164 CAMUDH010000002.1 GCA947087685_00459 gene open 91161-91667 ybeY
1165 CAMUDH010000002.1 GCA947087685_00460 gene open 91754-92710 phoH
1166 CAMUDH010000002.1 GCA947087685_00461 gene open 92790-94055 mtaB
1167 CAMUDH010000002.1 GCA947087685_00462 gene open 94055-95140 dnaJ
1168 CAMUDH010000002.1 GCA947087685_00463 gene open 95173-96300 dnaJ
1169 CAMUDH010000002.1 GCA947087685_00464 gene open 96387-97646 hemN
1170 CAMUDH010000002.1 GCA947087685_00465 gene open 97651-98823 dusA
1171 CAMUDH010000002.1 GCA947087685_00466 gene open 98899-100815 lepA
1172 CAMUDH010000002.1 GCA947087685_00467 gene open 100834-101121 rpsT
1173 CAMUDH010000002.1 GCA947087685_00468 gene open 101253-102263 holA
1174 CAMUDH010000002.1 GCA947087685_00469 gene open 102349-104043
1175 CAMUDH010000002.1 GCA947087685_00470 gene open 104036-104869 comEA
1176 CAMUDH010000002.1 GCA947087685_00471 gene open 105067-106365 thiI
1177 CAMUDH010000002.1 GCA947087685_00472 gene open 106453-106776
1178 CAMUDH010000002.1 GCA947087685_00473 gene open 106780-107253 gmk
1179 CAMUDH010000002.1 GCA947087685_00474 gene open 107355-107663
1180 CAMUDH010000002.1 GCA947087685_00475 gene open 107847-108572 pyrF
1181 CAMUDH010000002.1 GCA947087685_00476 gene open 108566-109495 pyrD
1182 CAMUDH010000002.1 GCA947087685_00477 gene open 109489-110280 mcr1
1183 CAMUDH010000002.1 GCA947087685_00478 gene open 110532-111827 allB
1184 CAMUDH010000002.1 GCA947087685_00479 gene open 111811-112746 pyrB
1185 CAMUDH010000002.1 GCA947087685_00480 gene open 112746-113309 pyrR
1186 CAMUDH010000002.1 GCA947087685_00481 gene open 113588-114703 wcaA
1187 CAMUDH010000002.1 GCA947087685_00482 gene open 114700-115764 wcaA
1188 CAMUDH010000002.1 GCA947087685_00483 gene open 115777-116919 wcaA
1189 CAMUDH010000002.1 GCA947087685_00484 gene open 116922-118151 tagH
1190 CAMUDH010000002.1 GCA947087685_00485 gene open 118251-119066 tagG
1191 CAMUDH010000002.1 GCA947087685_00486 gene open 119251-121158
1192 CAMUDH010000002.1 GCA947087685_00487 gene open 121225-122037 znuB
1193 CAMUDH010000002.1 GCA947087685_00488 gene open 122024-122701 znuC
1194 CAMUDH010000002.1 GCA947087685_00489 gene open 122694-123758 znuA
1195 CAMUDH010000002.1 GCA947087685_00490 gene open 124103-125983
1196 CAMUDH010000002.1 GCA947087685_00493 gene open 126818-127537 livF
1197 CAMUDH010000002.1 GCA947087685_00494 gene open 127538-128485 livG
1198 CAMUDH010000002.1 GCA947087685_00495 gene open 128482-129615 livM
1199 CAMUDH010000002.1 GCA947087685_00496 gene open 129625-130497 livH
1200 CAMUDH010000002.1 GCA947087685_00497 gene open 130644-131948 livK
1201 CAMUDH010000002.1 GCA947087685_00498 gene open 132212-132745 vanZ
1202 CAMUDH010000002.1 GCA947087685_00499 gene open 132745-133923
1203 CAMUDH010000002.1 GCA947087685_00500 gene open 134237-136399 rho
1204 CAMUDH010000002.1 GCA947087685_00501 gene open 136767-138614 argS
1205 CAMUDH010000002.1 GCA947087685_00502 gene open 138862-140361 pncB
1206 CAMUDH010000002.1 GCA947087685_00503 gene open 140434-140757
1207 CAMUDH010000002.1 GCA947087685_00504 gene open 140804-141781 pflX
1208 CAMUDH010000002.1 GCA947087685_00505 gene open 141945-142334
1209 CAMUDH010000002.1 GCA947087685_00507 gene open 142733-143302 ssuE
1210 CAMUDH010000002.1 GCA947087685_00508 gene open 143424-144749 rpoD
1211 CAMUDH010000002.1 GCA947087685_00509 gene open 144815-146677 dnaG
1212 CAMUDH010000002.1 GCA947087685_00510 gene open 146661-147959 ribF
1213 CAMUDH010000002.1 GCA947087685_00511 gene open 147914-148861 truB
1214 CAMUDH010000002.1 GCA947087685_00512 gene open 148858-149874 nrnA
1215 CAMUDH010000002.1 GCA947087685_00513 gene open 149971-150354 rbfA
1216 CAMUDH010000002.1 GCA947087685_00514 gene open 150361-153099 infB
1217 CAMUDH010000002.1 GCA947087685_00515 gene open 153151-154395 nusA
1218 CAMUDH010000002.1 GCA947087685_00516 gene open 154470-154940 rimP
1219 CAMUDH010000002.1 GCA947087685_00517 gene open 155156-157813 leuS
1220 CAMUDH010000002.1 GCA947087685_00518 gene open 157825-159339 ytoI
1221 CAMUDH010000002.1 GCA947087685_00519 gene open 159497-160795 bcsA
1222 CAMUDH010000002.1 GCA947087685_00520 gene open 160978-161994 rluA
1223 CAMUDH010000002.1 GCA947087685_00521 gene open 161987-162490 lspA
1224 CAMUDH010000002.1 GCA947087685_00522 gene open 162601-165408 ileS
1225 CAMUDH010000002.1 GCA947087685_00523 gene open 165820-166665 nadD
1226 CAMUDH010000002.1 GCA947087685_00524 gene open 166662-167930 proA
1227 CAMUDH010000002.1 GCA947087685_00525 gene open 167996-169120 proB
1228 CAMUDH010000002.1 GCA947087685_00526 gene open 169163-170632 obgE
1229 CAMUDH010000002.1 GCA947087685_00527 gene open 170662-171417 ecfT
1230 CAMUDH010000002.1 GCA947087685_00528 gene open 171419-173380 yejF
1231 CAMUDH010000002.1 GCA947087685_00529 gene open 173539-174177 mreD
1232 CAMUDH010000002.1 GCA947087685_00530 gene open 174767-176191 pepD
1233 CAMUDH010000002.1 GCA947087685_00531 gene open 176264-176641
1234 CAMUDH010000002.1 GCA947087685_00532 gene open 176678-177994 hisS
1235 CAMUDH010000002.1 GCA947087685_00533 gene open 178039-179079 ilvE
1236 CAMUDH010000002.1 GCA947087685_00534 gene open 179224-180756 pgaB
1237 CAMUDH010000002.1 GCA947087685_00536 gene open 181477-181635
1238 CAMUDH010000002.1 GCA947087685_00537 gene open 181663-182571 scrK
1239 CAMUDH010000002.1 GCA947087685_00538 gene open 182671-184560 nagE
1240 CAMUDH010000002.1 GCA947087685_00539 gene open 184893-186344 sacC
1241 CAMUDH010000002.1 GCA947087685_00540 gene open 186325-187290 purR
1242 CAMUDH010000002.1 GCA947087685_00541 gene open 187510-189006 alsT
1243 CAMUDH010000002.1 GCA947087685_00542 gene open 189189-189383
1244 CAMUDH010000002.1 GCA947087685_00543 gene open 189480-190112 ykaA
1245 CAMUDH010000002.1 GCA947087685_00544 gene open 190222-191271 pitA
1246 CAMUDH010000002.1 GCA947087685_00545 gene open 191628-192080
1247 CAMUDH010000002.1 GCA947087685_00546 gene open 192420-193604 malK
1248 CAMUDH010000002.1 GCA947087685_00547 gene open 193701-195962 glgP
1249 CAMUDH010000002.1 GCA947087685_00548 gene open 196081-197727 malQ
1250 CAMUDH010000002.1 GCA947087685_00549 gene open 197785-198807 purR
1251 CAMUDH010000002.1 GCA947087685_00550 gene open 198813-199652 ugpE
1252 CAMUDH010000002.1 GCA947087685_00551 gene open 199652-200494 ugpA
1253 CAMUDH010000002.1 GCA947087685_00552 gene open 200619-201962 ugpB
1254 CAMUDH010000002.1 GCA947087685_00553 gene open 202569-203969
1255 CAMUDH010000002.1 GCA947087685_00554 gene open 204139-204741 ykoE
1256 CAMUDH010000002.1 GCA947087685_00555 gene open 204775-207246 ccmA
1257 CAMUDH010000002.1 GCA947087685_00556 gene open 207495-208271 ddaH
1258 CAMUDH010000002.1 GCA947087685_00557 gene open 208385-209914 potE
1259 CAMUDH010000002.1 GCA947087685_00558 gene open 209980-210816 ecfA2
1260 CAMUDH010000002.1 GCA947087685_00559 gene open 210813-211667 ecfA2
1261 CAMUDH010000002.1 GCA947087685_00560 gene open 211661-212449 ecfT
1262 CAMUDH010000002.1 GCA947087685_00561 gene open 212524-213126
1263 CAMUDH010000002.1 GCA947087685_00562 gene open 213247-213810 maf
1264 CAMUDH010000002.1 GCA947087685_00563 gene open 213905-214939 wcaA
1265 CAMUDH010000002.1 GCA947087685_00564 gene open 215057-216259 glf
1266 CAMUDH010000002.1 GCA947087685_00565 gene open 216713-217687 pta
1267 CAMUDH010000002.1 GCA947087685_00566 gene open 217853-218404 rnhA
1268 CAMUDH010000002.1 GCA947087685_00567 gene open 218414-221503 polA
1269 CAMUDH010000002.1 GCA947087685_00568 gene open 221765-223855 glnA3
1270 CAMUDH010000002.1 GCA947087685_00569 gene open 224107-225711 norM
1271 CAMUDH010000002.1 GCA947087685_00570 gene open 225845-226792
1272 CAMUDH010000002.1 GCA947087685_00571 gene open 227047-228822 aspS
1273 CAMUDH010000002.1 GCA947087685_00572 gene open 229278-230639 acrA
1274 CAMUDH010000002.1 GCA947087685_00573 gene open 230651-231382 lolD
1275 CAMUDH010000002.1 GCA947087685_00574 gene open 231379-232731 salY
1276 CAMUDH010000002.1 GCA947087685_00575 gene open 232940-233761 gph
1277 CAMUDH010000002.1 GCA947087685_00576 gene open 233900-234208
1278 CAMUDH010000002.1 GCA947087685_00577 gene open 234886-234999
1279 CAMUDH010000002.1 GCA947087685_00578 gene open 235054-237297
1280 CAMUDH010000002.1 GCA947087685_00579 gene open 237441-238067 fHA
1281 CAMUDH010000002.1 GCA947087685_00580 gene open 238092-238397
1282 CAMUDH010000002.1 GCA947087685_00581 gene open 238436-238999
1283 CAMUDH010000002.1 GCA947087685_00582 gene open 239027-241063
1284 CAMUDH010000002.1 GCA947087685_00583 gene open 241035-241538
1285 CAMUDH010000002.1 GCA947087685_00584 gene open 241513-241818
1286 CAMUDH010000002.1 GCA947087685_00585 gene open 241873-242466
1287 CAMUDH010000002.1 GCA947087685_00586 gene open 242473-242688
1288 CAMUDH010000002.1 GCA947087685_00587 gene open 242758-243195 tadC
1289 CAMUDH010000002.1 GCA947087685_00588 gene open 243407-244351 tadB
1290 CAMUDH010000002.1 GCA947087685_00589 gene open 244324-245685 tadA
1291 CAMUDH010000002.1 GCA947087685_00590 gene open 245686-247569 flhG
1292 CAMUDH010000002.1 GCA947087685_00591 gene open 247665-248483 cpaB
1293 CAMUDH010000002.1 GCA947087685_00592 gene open 248927-250225 rsgA
1294 CAMUDH010000002.1 GCA947087685_00593 gene open 250253-252934 mgtA
1295 CAMUDH010000002.1 GCA947087685_00594 gene open 253086-254339
1296 CAMUDH010000002.1 GCA947087685_00595 gene open 254543-257227 adhE
1297 CAMUDH010000002.1 GCA947087685_00596 gene open 257791-259464 ytoI
1298 CAMUDH010000002.1 GCA947087685_00597 gene open 259526-259681
1299 CAMUDH010000002.1 GCA947087685_00598 gene open 259650-260900 pepT
1300 CAMUDH010000002.1 GCA947087685_00599 gene open 261003-262142 dppD
1301 CAMUDH010000002.1 GCA947087685_00600 gene open 262142-263374 dppD
1302 CAMUDH010000002.1 GCA947087685_00601 gene open 263384-264307 dppC
1303 CAMUDH010000002.1 GCA947087685_00602 gene open 264309-265241 dppB
1304 CAMUDH010000002.1 GCA947087685_00603 gene open 265562-267196 ddpA
1305 CAMUDH010000002.1 GCA947087685_00604 gene open 267933-268799 trmB
1306 CAMUDH010000002.1 GCA947087685_00605 gene open 268890-269501 pncA
1307 CAMUDH010000002.1 GCA947087685_00607 gene open 270596-270736
1308 CAMUDH010000002.1 GCA947087685_00608 gene open 270760-270882
1309 CAMUDH010000002.1 GCA947087685_00609 gene open 271037-271249
1310 CAMUDH010000002.1 GCA947087685_00610 gene open 271617-272309
1311 CAMUDH010000002.1 GCA947087685_00611 gene open 272431-272625
1312 CAMUDH010000002.1 GCA947087685_00612 gene open 272612-272713
1313 CAMUDH010000002.1 GCA947087685_00613 gene open 272902-273093
1314 CAMUDH010000002.1 GCA947087685_00614 gene open 273264-273371
1315 CAMUDH010000002.1 GCA947087685_00615 gene open 273625-273813
1316 CAMUDH010000002.1 GCA947087685_00616 gene open 275320-275454
1317 CAMUDH010000002.1 GCA947087685_00617 gene open 275411-275635
1318 CAMUDH010000002.1 GCA947087685_00618 gene open 275694-275948
1319 CAMUDH010000002.1 GCA947087685_00619 gene open 276074-276181
1320 CAMUDH010000002.1 GCA947087685_00620 gene open 276440-277060
1321 CAMUDH010000002.1 GCA947087685_00621 gene open 277074-277451
1322 CAMUDH010000002.1 GCA947087685_00622 gene open 277831-280434
1323 CAMUDH010000002.1 GCA947087685_00623 gene open 280697-281014
1324 CAMUDH010000002.1 GCA947087685_00624 gene open 281056-282354
1325 CAMUDH010000002.1 GCA947087685_00625 gene open 283161-283748 wbbJ
1326 CAMUDH010000002.1 GCA947087685_00626 gene open 284527-285132
1327 CAMUDH010000002.1 GCA947087685_00627 gene open 285178-285339
1328 CAMUDH010000002.1 GCA947087685_00628 gene open 285581-285769
1329 CAMUDH010000002.1 GCA947087685_00629 gene open 285800-288649
1330 CAMUDH010000002.1 GCA947087685_00630 gene open 288719-289468 aadA
1331 CAMUDH010000002.1 GCA947087685_00631 gene open 289493-289705
1332 CAMUDH010000002.1 GCA947087685_00632 gene open 289713-290264
1333 CAMUDH010000002.1 GCA947087685_00633 gene open 290270-291910
1334 CAMUDH010000002.1 GCA947087685_00634 gene open 292041-292529 yhcG
1335 CAMUDH010000002.1 GCA947087685_00637 gene open 293220-293963 spoIIAA
1336 CAMUDH010000002.1 GCA947087685_00638 gene open 293964-294089
1337 CAMUDH010000002.1 GCA947087685_00639 gene open 294037-296040 rsbU
1338 CAMUDH010000002.1 GCA947087685_00641 gene open 296443-297558 dppD
1339 CAMUDH010000002.1 GCA947087685_00642 gene open 297558-298688 dppD
1340 CAMUDH010000002.1 GCA947087685_00643 gene open 298692-299678 dppC
1341 CAMUDH010000002.1 GCA947087685_00644 gene open 299693-300730 dppB
1342 CAMUDH010000002.1 GCA947087685_00645 gene open 301092-302741 oppA
1343 CAMUDH010000002.1 GCA947087685_00646 gene open 303098-303811
1344 CAMUDH010000002.1 GCA947087685_00647 gene open 303984-304232 secG
1345 CAMUDH010000002.1 GCA947087685_00648 gene open 304520-305284 tpiA
1346 CAMUDH010000002.1 GCA947087685_00649 gene open 305277-306467 pgk
1347 CAMUDH010000002.1 GCA947087685_00650 gene open 306617-307642 gap
1348 CAMUDH010000002.1 GCA947087685_00651 gene open 308113-309342 rpsA
1349 CAMUDH010000002.1 GCA947087685_00652 gene open 309666-311369 yfcC
1350 CAMUDH010000002.1 GCA947087685_00653 gene open 311809-312801 argF
1351 CAMUDH010000002.1 GCA947087685_00654 gene open 312867-314117 arcA
1352 CAMUDH010000002.1 GCA947087685_00655 gene open 314634-316541 ftsH
1353 CAMUDH010000002.1 GCA947087685_00657 gene open 317036-319066 mdlB
1354 CAMUDH010000002.1 GCA947087685_00658 gene open 319152-321035 mdlB
1355 CAMUDH010000002.1 GCA947087685_00659 gene open 321039-322856 ccmA
1356 CAMUDH010000002.1 GCA947087685_00660 gene open 322898-324187 coaBC
1357 CAMUDH010000002.1 GCA947087685_00661 gene open 324211-324933 dR0291
1358 CAMUDH010000002.1 GCA947087685_00662 gene open 324960-326135 nifS
1359 CAMUDH010000002.1 GCA947087685_00663 gene open 326137-326823 rpe
1360 CAMUDH010000002.1 GCA947087685_00664 gene open 326836-327858 gpsA
1361 CAMUDH010000002.1 GCA947087685_00665 gene open 327996-328679 plsY
1362 CAMUDH010000002.1 GCA947087685_00666 gene open 328737-330053 der
1363 CAMUDH010000002.1 GCA947087685_00667 gene open 330166-331014 ispH
1364 CAMUDH010000002.1 GCA947087685_00668 gene open 331052-332593 cmk
1365 CAMUDH010000002.1 GCA947087685_00669 gene open 332590-333447 rsuA
1366 CAMUDH010000002.1 GCA947087685_00670 gene open 333448-334080 scpB
1367 CAMUDH010000002.1 GCA947087685_00671 gene open 334097-334900 scpA
1368 CAMUDH010000002.1 GCA947087685_00672 gene open 335004-335699 spoIVFB
1369 CAMUDH010000002.1 GCA947087685_00673 gene open 335835-336530
1370 CAMUDH010000002.1 GCA947087685_00674 gene open 336523-338646 abc-f
1371 CAMUDH010000002.1 GCA947087685_00675 gene open 338776-339534 pdxT
1372 CAMUDH010000002.1 GCA947087685_00676 gene open 339587-340534 pdxS
1373 CAMUDH010000002.1 GCA947087685_00677 gene open 340898-341275
1374 CAMUDH010000002.1 GCA947087685_00678 gene open 341459-342748 eno
1375 CAMUDH010000002.1 GCA947087685_00679 gene open 343571-345328 hisJ
1376 CAMUDH010000002.1 GCA947087685_00680 gene open 345360-346118 glnQ
1377 CAMUDH010000002.1 GCA947087685_00681 gene open 346137-346523
1378 CAMUDH010000002.1 GCA947087685_00682 gene open 346804-348069
1379 CAMUDH010000002.1 GCA947087685_00683 gene open 348294-349973
1380 CAMUDH010000002.1 GCA947087685_00685 gene open 350770-351558 puuD
1381 CAMUDH010000002.1 GCA947087685_00686 gene open 351612-351836
1382 CAMUDH010000002.1 GCA947087685_00687 gene open 351751-353310 aspB
1383 CAMUDH010000002.1 GCA947087685_00688 gene open 353544-354755 norV
1384 CAMUDH010000002.1 GCA947087685_00689 gene open 354909-356390 brnQ
1385 CAMUDH010000002.1 GCA947087685_00690 gene open 356683-358071 elsH
1386 CAMUDH010000002.1 GCA947087685_00691 gene open 358263-360206 nit1
1387 CAMUDH010000002.1 GCA947087685_00692 gene open 360208-362751 tsaD
1388 CAMUDH010000002.1 GCA947087685_00693 gene open 362764-363294 tsaE
1389 CAMUDH010000002.1 GCA947087685_00694 gene open 363366-364523 alr
1390 CAMUDH010000002.1 GCA947087685_00695 gene open 364718-366313 nnr2
1391 CAMUDH010000002.1 GCA947087685_00696 gene open 366472-367026 acpS
1392 CAMUDH010000002.1 GCA947087685_00697 gene open 367130-368977 glmS
1393 CAMUDH010000002.1 GCA947087685_00698 gene open 369390-370262 aRA1
1394 CAMUDH010000002.1 GCA947087685_00699 gene open 370413-371237 lgt
1395 CAMUDH010000002.1 GCA947087685_00700 gene open 371243-371812
1396 CAMUDH010000002.1 GCA947087685_00701 gene open 371952-374549 rlhA
1397 CAMUDH010000002.1 GCA947087685_00702 gene open 374630-376534 wcaE
1398 CAMUDH010000002.1 GCA947087685_00703 gene open 376586-377818 tyrS
1399 CAMUDH010000002.1 GCA947087685_00704 gene open 378085-380298 mrcB
1400 CAMUDH010000002.1 GCA947087685_00705 gene open 380432-381073 deoC
1401 CAMUDH010000002.1 GCA947087685_00706 gene open 381311-382414
1402 CAMUDH010000002.1 GCA947087685_00707 gene open 382936-383379 argR
1403 CAMUDH010000002.1 GCA947087685_00708 gene open 383574-385298 manB
1404 CAMUDH010000002.1 GCA947087685_00709 gene open 385731-388202 rlmL
1405 CAMUDH010000002.1 GCA947087685_00710 gene open 388404-389153 udp
1406 CAMUDH010000002.1 GCA947087685_00711 gene open 389515-391080 kex1
1407 CAMUDH010000002.1 GCA947087685_00712 gene open 391206-393641 kup
1408 CAMUDH010000002.1 GCA947087685_00713 gene open 393851-395182
1409 CAMUDH010000002.1 GCA947087685_00414 gene open 44808-44882 trnV
1410 CAMUDH010000002.1 GCA947087685_00491 gene open 126433-126508 trnH
1411 CAMUDH010000002.1 GCA947087685_00492 gene open 126519-126594 trnK
1412 CAMUDH010000002.1 GCA947087685_00506 gene open 142514-142588 trnN
1413 CAMUDH010000002.1 GCA947087685_00535 gene open 181348-181423 trnF
1414 CAMUDH010000002.1 GCA947087685_00606 gene open 270358-270431 trnW
1415 CAMUDH010000002.1 GCA947087685_00635 gene open 292841-292914 trnC
1416 CAMUDH010000002.1 GCA947087685_00636 gene open 292979-293054 trnG
1417 CAMUDH010000002.1 GCA947087685_00640 gene open 296176-296266 trnL
1418 CAMUDH010000002.1 GCA947087685_00656 gene open 316797-316873 trnP
1419 CAMUDH010000002.1 GCA947087685_00684 gene open 350279-350355 trnfM
1420 CAMUDH010000002.1 GCA947087685_00414 tRNA open 44808-44882 trnV tRNA-Val(cac)
1421 CAMUDH010000002.1 GCA947087685_00491 tRNA open 126433-126508 trnH tRNA-His(gtg)
1422 CAMUDH010000002.1 GCA947087685_00492 tRNA open 126519-126594 trnK tRNA-Lys(ctt)
1423 CAMUDH010000002.1 GCA947087685_00506 tRNA open 142514-142588 trnN tRNA-Asn(gtt)
1424 CAMUDH010000002.1 GCA947087685_00535 tRNA open 181348-181423 trnF tRNA-Phe(gaa)
1425 CAMUDH010000002.1 GCA947087685_00606 tRNA open 270358-270431 trnW tRNA-Trp(cca)
1426 CAMUDH010000002.1 GCA947087685_00635 tRNA open 292841-292914 trnC tRNA-Cys(gca)
1427 CAMUDH010000002.1 GCA947087685_00636 tRNA open 292979-293054 trnG tRNA-Gly(gcc)
1428 CAMUDH010000002.1 GCA947087685_00640 tRNA open 296176-296266 trnL tRNA-Leu(gag)
1429 CAMUDH010000002.1 GCA947087685_00656 tRNA open 316797-316873 trnP tRNA-Pro(ggg)
1430 CAMUDH010000002.1 GCA947087685_00684 tRNA open 350279-350355 trnfM tRNA-fMet(cat)
1431 CAMUDH010000003.1 GCA947087685_00764 gene open 55587-55716 SpR18_sRNA
1432 CAMUDH010000003.1 GCA947087685_00796 gene open 99052-99411 RNaseP_bact_a
1433 CAMUDH010000003.1 GCA947087685_00764 ncRNA open 55587-55716 Streptococcus sRNA SpR18
1434 CAMUDH010000003.1 GCA947087685_00796 ncRNA open 99052-99411 Bacterial RNase P class A
1435 CAMUDH010000003.1 repeat_region open 34095-35874 CRISPR array with 27 repeats of length 36%2C consensus sequence GTTTTGGAGCAGTGTCATTTTGACTGGTAATCAAAC and spacer length 29
1436 CAMUDH010000003.1 GCA947087685_00714 CDS open 8334-8750 _na     138_aa hypothetical protein
1437 CAMUDH010000003.1 GCA947087685_00715 CDS open 8870-9811 _na     313_aa whiA DNA-binding protein WhiA
1438 CAMUDH010000003.1 GCA947087685_00716 CDS open 9814-10800 _na     328_aa rapZ RNase adapter RapZ
1439 CAMUDH010000003.1 GCA947087685_00717 CDS open 10829-11179 _na     116_aa eMAP tRNA-binding protein
1440 CAMUDH010000003.1 GCA947087685_00718 CDS open 11385-13385 _na     666_aa uvrC excinuclease ABC subunit UvrC
1441 CAMUDH010000003.1 GCA947087685_00719 CDS open 13535-15349 _na     604_aa FAD-binding protein
1442 CAMUDH010000003.1 GCA947087685_00720 CDS open 15519-15917 _na     132_aa ppsR Phosphoenolpyruvate synthase regulatory protein
1443 CAMUDH010000003.1 GCA947087685_00721 CDS open 15934-18030 _na     698_aa glyS Glycine--tRNA ligase beta subunit
1444 CAMUDH010000003.1 GCA947087685_00722 CDS open 18031-18978 _na     315_aa glyQ glycine--tRNA ligase subunit alpha
1445 CAMUDH010000003.1 GCA947087685_00723 CDS open 19054-19647 _na     197_aa lepB signal peptidase I
1446 CAMUDH010000003.1 GCA947087685_00724 CDS open 19647-20393 _na     248_aa trmD tRNA (guanosine(37)-N1)-methyltransferase TrmD
1447 CAMUDH010000003.1 GCA947087685_00725 CDS open 20398-20928 _na     176_aa rimM Ribosomal 30S subunit maturation factor RimM%2C required for 16S rRNA processing
1448 CAMUDH010000003.1 GCA947087685_00726 CDS open 20932-21321 _na     129_aa ylqC RNA-binding protein KhpA
1449 CAMUDH010000003.1 GCA947087685_00727 CDS open 21327-21659 _na     110_aa Small ribosomal subunit protein bS16
1450 CAMUDH010000003.1 GCA947087685_00728 CDS open 21937-22608 _na     223_aa ompR Response regulator receiver domain protein
1451 CAMUDH010000003.1 GCA947087685_00729 CDS open 22703-23974 _na     423_aa baeS Sensor-like histidine kinase SenX3
1452 CAMUDH010000003.1 GCA947087685_00730 CDS open 24003-24422 _na     139_aa rsfS Ribosomal silencing factor RsfS
1453 CAMUDH010000003.1 GCA947087685_00731 CDS open 24427-25086 _na     219_aa yqeK bis(5'-nucleosyl)-tetraphosphatase (symmetrical) YqeK
1454 CAMUDH010000003.1 GCA947087685_00732 CDS open 25157-26506 _na     449_aa rlmD 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD
1455 CAMUDH010000003.1 GCA947087685_00733 CDS open 26551-26742 _na     63_aa Toxin-antitoxin system%2C antitoxin component%2C ribbon-helix-helix domain protein
1456 CAMUDH010000003.1 GCA947087685_00734 CDS open 26711-26845 _na     44_aa hypothetical protein
1457 CAMUDH010000003.1 GCA947087685_00735 CDS open 27954-32159 _na     1401_aa hypothetical protein
1458 CAMUDH010000003.1 GCA947087685_00736 CDS open 32149-33030 _na     293_aa CRISPR-associated endonuclease Cas1
1459 CAMUDH010000003.1 GCA947087685_00737 CDS open 33051-33359 _na     102_aa CRISPR-associated endoribonuclease Cas2
1460 CAMUDH010000003.1 GCA947087685_00738 CDS open 33356-34039 _na     227_aa hypothetical protein
1461 CAMUDH010000003.1 GCA947087685_00739 CDS open 36236-36691 _na     151_aa hypothetical protein
1462 CAMUDH010000003.1 GCA947087685_00740 CDS open 37077-37301 _na     74_aa hypothetical protein
1463 CAMUDH010000003.1 GCA947087685_00741 CDS open 37360-37614 _na     84_aa Immunity protein 35 domain-containing protein
1464 CAMUDH010000003.1 GCA947087685_00742 CDS open 38129-38650 _na     173_aa ycxB YcxB family protein
1465 CAMUDH010000003.1 GCA947087685_00743 CDS open 38676-39338 _na     220_aa class II aldolase/adducin family protein
1466 CAMUDH010000003.1 GCA947087685_00744 CDS open 39365-40786 _na     473_aa PTS transporter subunit IIC
1467 CAMUDH010000003.1 GCA947087685_00745 CDS open 40808-41110 _na     100_aa PTS sugar transporter subunit IIB
1468 CAMUDH010000003.1 GCA947087685_00746 CDS open 41145-41624 _na     159_aa PTS sugar transporter subunit IIA
1469 CAMUDH010000003.1 GCA947087685_00747 CDS open 41825-42586 _na     253_aa DeoR/GlpR family DNA-binding transcription regulator
1470 CAMUDH010000003.1 GCA947087685_00748 CDS open 42753-43502 _na     249_aa gntR GntR family transcriptional regulator
1471 CAMUDH010000003.1 GCA947087685_00749 CDS open 43510-44292 _na     260_aa BtpA/SgcQ family protein
1472 CAMUDH010000003.1 GCA947087685_00750 CDS open 44295-45260 _na     321_aa Initiation factor 2 subunit family
1473 CAMUDH010000003.1 GCA947087685_00751 CDS open 45262-45981 _na     239_aa amidohydrolase family protein
1474 CAMUDH010000003.1 GCA947087685_00752 CDS open 45994-46809 _na     271_aa PTS system mannose/fructose/sorbose family transporter subunit IID
1475 CAMUDH010000003.1 GCA947087685_00753 CDS open 46811-47563 _na     250_aa PTS sugar transporter subunit IIC
1476 CAMUDH010000003.1 GCA947087685_00754 CDS open 47573-48058 _na     161_aa PTS sugar transporter subunit IIB
1477 CAMUDH010000003.1 GCA947087685_00755 CDS open 48055-48444 _na     129_aa PTS sugar transporter subunit IIA
1478 CAMUDH010000003.1 GCA947087685_00756 CDS open 48441-49172 _na     243_aa amidohydrolase family protein
1479 CAMUDH010000003.1 GCA947087685_00757 CDS open 49743-50660 _na     305_aa Abortive infection bacteriophage resistance protein
1480 CAMUDH010000003.1 GCA947087685_00758 CDS open 51009-51845 _na     278_aa rhaD rhamnulose-1-phosphate aldolase
1481 CAMUDH010000003.1 GCA947087685_00759 CDS open 51823-52140 _na     105_aa prgI PrgI family protein
1482 CAMUDH010000003.1 GCA947087685_00760 CDS open 52143-53495 _na     450_aa sgcC PTS system Galactitol-specific IIC component
1483 CAMUDH010000003.1 GCA947087685_00761 CDS open 53602-53880 _na     92_aa sgaB PTS system%2C Lactose/Cellobiose specific IIB subunit
1484 CAMUDH010000003.1 GCA947087685_00762 CDS open 54053-54529 _na     158_aa ptsN Phosphoenolpyruvate-dependent sugar phosphotransferase system%2C EIIA 2
1485 CAMUDH010000003.1 GCA947087685_00763 CDS open 54539-55300 _na     253_aa glpR Transcriptional regulator%2C DeoR family
1486 CAMUDH010000003.1 GCA947087685_00765 CDS open 55702-57318 _na     538_aa guaA glutamine-hydrolyzing GMP synthase
1487 CAMUDH010000003.1 GCA947087685_00766 CDS open 57791-59452 _na     553_aa cps2a Cell envelope-like function transcriptional attenuator common domain protein
1488 CAMUDH010000003.1 GCA947087685_00767 CDS open 59621-60682 _na     353_aa ychF redox-regulated ATPase YchF
1489 CAMUDH010000003.1 GCA947087685_00768 CDS open 60849-62165 _na     438_aa dsrA 4Fe-4S binding domain protein
1490 CAMUDH010000003.1 GCA947087685_00769 CDS open 62557-63555 _na     332_aa asnA aspartate--ammonia ligase
1491 CAMUDH010000003.1 GCA947087685_00770 CDS open 63720-64154 _na     144_aa DZANK-type domain-containing protein
1492 CAMUDH010000003.1 GCA947087685_00771 CDS open 64235-65656 _na     473_aa folC tetrahydrofolate synthase
1493 CAMUDH010000003.1 GCA947087685_00772 CDS open 65661-66524 _na     287_aa folD Bifunctional protein FolD
1494 CAMUDH010000003.1 GCA947087685_00773 CDS open 66531-67175 _na     214_aa ftcD Formiminotransferase-cyclodeaminase
1495 CAMUDH010000003.1 GCA947087685_00774 CDS open 67221-68909 _na     562_aa mIS1 formate--tetrahydrofolate ligase
1496 CAMUDH010000003.1 GCA947087685_00775 CDS open 68939-69571 _na     210_aa fAU1 5-formyltetrahydrofolate cyclo-ligase
1497 CAMUDH010000003.1 GCA947087685_00776 CDS open 69577-72264 _na     895_aa valine--tRNA ligase
1498 CAMUDH010000003.1 GCA947087685_00777 CDS open 72634-74010 _na     458_aa clpX ATP-dependent Clp protease ATP-binding subunit ClpX
1499 CAMUDH010000003.1 GCA947087685_00778 CDS open 74114-74728 _na     204_aa clpP ATP-dependent Clp protease proteolytic subunit
1500 CAMUDH010000003.1 GCA947087685_00779 CDS open 74895-76298 _na     467_aa tig trigger factor