BAKTAGenome Explorer: Lachnocurva vaginae (GCA_947252375.1)
Select a Genome:
|
BAKTA Annotations for GCA_947252375.1
|
Search & Sort all 2981 Records
| ||||||||||||||||||
Notes: 1- Column headers only sort the current page. 2- Select [NA] or [AA] links to show sequences.
| Region | Protein-ID | Type | Genome Viewer |
Range (bp) |
Show Sequences (length) NA / AA |
BAKTA Gene |
BAKTA GeneProduct |
|
|---|---|---|---|---|---|---|---|---|
| 2501 | CAMXVF010000009.1 | GCA947252375_01252 | CDS | open | 5653-7677 | _na 674_aa | DNA ligase | |
| 2502 | CAMXVF010000009.1 | GCA947252375_01253 | CDS | open | 7665-8375 | _na 236_aa | Amino acid racemase | |
| 2503 | CAMXVF010000009.1 | GCA947252375_01254 | CDS | open | 8519-9727 | _na 402_aa | ATP-grasp domain-containing protein | |
| 2504 | CAMXVF010000009.1 | GCA947252375_01255 | CDS | open | 10051-11574 | _na 507_aa | Sodium/proline symporter | |
| 2505 | CAMXVF010000009.1 | GCA947252375_01256 | CDS | open | 11589-12983 | _na 464_aa | HTH gntR-type domain-containing protein | |
| 2506 | CAMXVF010000009.1 | GCA947252375_01257 | CDS | open | 13035-13175 | _na 46_aa | hypothetical protein | |
| 2507 | CAMXVF010000009.1 | GCA947252375_01258 | CDS | open | 13277-14770 | _na 497_aa | aldA | Putative aldehyde dehydrogenase AldA |
| 2508 | CAMXVF010000009.1 | GCA947252375_01259 | CDS | open | 14900-16321 | _na 473_aa | Serine/threonine exchange transporter%2C LAT family | |
| 2509 | CAMXVF010000009.1 | GCA947252375_01260 | CDS | open | 16560-17018 | _na 152_aa | D-aminoacyl-tRNA deacylase | |
| 2510 | CAMXVF010000009.1 | GCA947252375_01261 | CDS | open | 17118-17507 | _na 129_aa | arsR | DNA-binding transcriptional regulator%2C ArsR family |
| 2511 | CAMXVF010000009.1 | GCA947252375_01262 | CDS | open | 17856-19757 | _na 633_aa | Cd(2+)-exporting ATPase | |
| 2512 | CAMXVF010000009.1 | GCA947252375_01263 | CDS | open | 19770-20249 | _na 159_aa | Ribosomal RNA large subunit methyltransferase H | |
| 2513 | CAMXVF010000009.1 | GCA947252375_01264 | CDS | open | 20435-22036 | _na 533_aa | D-alanyl-lipoteichoic acid acyltransferase DltB%2C MBOAT superfamily | |
| 2514 | CAMXVF010000009.1 | GCA947252375_01265 | CDS | open | 22114-23109 | _na 331_aa | hypothetical protein | |
| 2515 | CAMXVF010000009.1 | GCA947252375_01266 | CDS | open | 23124-24665 | _na 513_aa | D-alanine--poly(Phosphoribitol) ligase | |
| 2516 | CAMXVF010000009.1 | GCA947252375_01267 | CDS | open | 24662-25864 | _na 400_aa | Diaminopimelate decarboxylase | |
| 2517 | CAMXVF010000009.1 | GCA947252375_01268 | CDS | open | 25904-26134 | _na 76_aa | Phosphopantetheine attachment site | |
| 2518 | CAMXVF010000009.1 | GCA947252375_01269 | CDS | open | 26223-26927 | _na 234_aa | Stage 0 sporulation A-like protein | |
| 2519 | CAMXVF010000009.1 | GCA947252375_01270 | CDS | open | 27042-28658 | _na 538_aa | hypothetical protein | |
| 2520 | CAMXVF010000009.1 | GCA947252375_01271 | CDS | open | 28767-30524 | _na 585_aa | Phosphate:Na+ symporter | |
| 2521 | CAMXVF010000009.1 | GCA947252375_01272 | CDS | open | 30565-32685 | _na 706_aa | hypothetical protein | |
| 2522 | CAMXVF010000009.1 | GCA947252375_01273 | CDS | open | 32757-33464 | _na 235_aa | hypothetical protein | |
| 2523 | CAMXVF010000009.1 | GCA947252375_01274 | CDS | open | 33465-34154 | _na 229_aa | Stage 0 sporulation A-like protein | |
| 2524 | CAMXVF010000009.1 | GCA947252375_01275 | CDS | open | 34154-35824 | _na 556_aa | histidine kinase | |
| 2525 | CAMXVF010000009.1 | GCA947252375_01276 | CDS | open | 35821-36747 | _na 308_aa | hypothetical protein | |
| 2526 | CAMXVF010000009.1 | GCA947252375_01277 | CDS | open | 36788-38788 | _na 666_aa | hypothetical protein | |
| 2527 | CAMXVF010000009.1 | GCA947252375_01278 | CDS | open | 39065-39328 | _na 87_aa | Small ribosomal subunit protein bS20 | |
| 2528 | CAMXVF010000009.1 | GCA947252375_01279 | CDS | open | 39417-40415 | _na 332_aa | hypothetical protein | |
| 2529 | CAMXVF010000009.1 | GCA947252375_01280 | CDS | open | 40578-42389 | _na 603_aa | Elongation factor 4 | |
| 2530 | CAMXVF010000009.1 | GCA947252375_01281 | CDS | open | 42398-43555 | _na 385_aa | hypothetical protein | |
| 2531 | CAMXVF010000009.1 | GCA947252375_01282 | CDS | open | 43815-44882 | _na 355_aa | hrcA | Heat-inducible transcription repressor HrcA |
| 2532 | CAMXVF010000009.1 | GCA947252375_01283 | CDS | open | 44890-45549 | _na 219_aa | hypothetical protein | |
| 2533 | CAMXVF010000009.1 | GCA947252375_01284 | CDS | open | 45641-47527 | _na 628_aa | dnaK | Chaperone protein DnaK |
| 2534 | CAMXVF010000009.1 | GCA947252375_01285 | CDS | open | 47560-48732 | _na 390_aa | dnaJ | Chaperone protein DnaJ |
| 2535 | CAMXVF010000009.1 | GCA947252375_01286 | CDS | open | 48947-50101 | _na 384_aa | cysteine desulfurase | |
| 2536 | CAMXVF010000009.1 | GCA947252375_01287 | CDS | open | 50147-51337 | _na 396_aa | putative tRNA sulfurtransferase | |
| 2537 | CAMXVF010000009.1 | GCA947252375_01288 | CDS | open | 51608-51841 | _na 77_aa | HPr domain-containing protein | |
| 2538 | CAMXVF010000009.1 | GCA947252375_01289 | CDS | open | 51927-53255 | _na 442_aa | miaB | (Dimethylallyl)adenosine tRNA methylthiotransferase MiaB |
| 2539 | CAMXVF010000009.1 | GCA947252375_01290 | CDS | open | 53289-53555 | _na 88_aa | UPF0297 protein Cthe_0151 | |
| 2540 | CAMXVF010000009.1 | GCA947252375_01291 | CDS | open | 53555-53986 | _na 143_aa | Putative pre-16S rRNA nuclease | |
| 2541 | CAMXVF010000009.1 | GCA947252375_01292 | CDS | open | 53989-54240 | _na 83_aa | hypothetical protein | |
| 2542 | CAMXVF010000009.1 | GCA947252375_01293 | CDS | open | 54268-55932 | _na 554_aa | Ribonuclease J | |
| 2543 | CAMXVF010000009.1 | GCA947252375_01294 | CDS | open | 55934-56575 | _na 213_aa | hypothetical protein | |
| 2544 | CAMXVF010000009.1 | GCA947252375_01295 | CDS | open | 56660-57886 | _na 408_aa | yhbU | putative protease yhbU |
| 2545 | CAMXVF010000009.1 | GCA947252375_01296 | CDS | open | 57896-58981 | _na 361_aa | hypothetical protein | |
| 2546 | CAMXVF010000009.1 | GCA947252375_01297 | CDS | open | 59097-60251 | _na 384_aa | Queuine tRNA-ribosyltransferase | |
| 2547 | CAMXVF010000009.1 | GCA947252375_01298 | CDS | open | 60352-60699 | _na 115_aa | yajC | Preprotein translocase%2C YajC subunit |
| 2548 | CAMXVF010000009.1 | GCA947252375_01299 | CDS | open | 60820-62190 | _na 456_aa | Permease | |
| 2549 | CAMXVF010000009.1 | GCA947252375_01300 | CDS | open | 62368-64578 | _na 736_aa | hypothetical protein | |
| 2550 | CAMXVF010000009.1 | GCA947252375_01301 | CDS | open | 64594-67086 | _na 830_aa | clpC | ATP-dependent Clp protease ATP-binding subunit ClpC |
| 2551 | CAMXVF010000009.1 | GCA947252375_01302 | CDS | open | 67127-67534 | _na 135_aa | Peptidase S11 D-Ala-D-Ala carboxypeptidase A C-terminal domain-containing protein | |
| 2552 | CAMXVF010000009.1 | GCA947252375_01303 | CDS | open | 67534-68898 | _na 454_aa | radA | DNA repair protein RadA |
| 2553 | CAMXVF010000009.1 | GCA947252375_01243 | gene | open | 387-575 | |||
| 2554 | CAMXVF010000009.1 | GCA947252375_01244 | gene | open | 976-1239 | |||
| 2555 | CAMXVF010000009.1 | GCA947252375_01245 | gene | open | 1264-1437 | |||
| 2556 | CAMXVF010000009.1 | GCA947252375_01246 | gene | open | 1409-1564 | |||
| 2557 | CAMXVF010000009.1 | GCA947252375_01247 | gene | open | 1579-1698 | |||
| 2558 | CAMXVF010000009.1 | GCA947252375_01248 | gene | open | 1740-3149 | |||
| 2559 | CAMXVF010000009.1 | GCA947252375_01250 | gene | open | 3400-4695 | |||
| 2560 | CAMXVF010000009.1 | GCA947252375_01251 | gene | open | 4900-5598 | |||
| 2561 | CAMXVF010000009.1 | GCA947252375_01252 | gene | open | 5653-7677 | |||
| 2562 | CAMXVF010000009.1 | GCA947252375_01253 | gene | open | 7665-8375 | |||
| 2563 | CAMXVF010000009.1 | GCA947252375_01254 | gene | open | 8519-9727 | |||
| 2564 | CAMXVF010000009.1 | GCA947252375_01255 | gene | open | 10051-11574 | |||
| 2565 | CAMXVF010000009.1 | GCA947252375_01256 | gene | open | 11589-12983 | |||
| 2566 | CAMXVF010000009.1 | GCA947252375_01257 | gene | open | 13035-13175 | |||
| 2567 | CAMXVF010000009.1 | GCA947252375_01258 | gene | open | 13277-14770 | aldA | ||
| 2568 | CAMXVF010000009.1 | GCA947252375_01259 | gene | open | 14900-16321 | |||
| 2569 | CAMXVF010000009.1 | GCA947252375_01260 | gene | open | 16560-17018 | |||
| 2570 | CAMXVF010000009.1 | GCA947252375_01261 | gene | open | 17118-17507 | arsR | ||
| 2571 | CAMXVF010000009.1 | GCA947252375_01262 | gene | open | 17856-19757 | |||
| 2572 | CAMXVF010000009.1 | GCA947252375_01263 | gene | open | 19770-20249 | |||
| 2573 | CAMXVF010000009.1 | GCA947252375_01264 | gene | open | 20435-22036 | |||
| 2574 | CAMXVF010000009.1 | GCA947252375_01265 | gene | open | 22114-23109 | |||
| 2575 | CAMXVF010000009.1 | GCA947252375_01266 | gene | open | 23124-24665 | |||
| 2576 | CAMXVF010000009.1 | GCA947252375_01267 | gene | open | 24662-25864 | |||
| 2577 | CAMXVF010000009.1 | GCA947252375_01268 | gene | open | 25904-26134 | |||
| 2578 | CAMXVF010000009.1 | GCA947252375_01269 | gene | open | 26223-26927 | |||
| 2579 | CAMXVF010000009.1 | GCA947252375_01270 | gene | open | 27042-28658 | |||
| 2580 | CAMXVF010000009.1 | GCA947252375_01271 | gene | open | 28767-30524 | |||
| 2581 | CAMXVF010000009.1 | GCA947252375_01272 | gene | open | 30565-32685 | |||
| 2582 | CAMXVF010000009.1 | GCA947252375_01273 | gene | open | 32757-33464 | |||
| 2583 | CAMXVF010000009.1 | GCA947252375_01274 | gene | open | 33465-34154 | |||
| 2584 | CAMXVF010000009.1 | GCA947252375_01275 | gene | open | 34154-35824 | |||
| 2585 | CAMXVF010000009.1 | GCA947252375_01276 | gene | open | 35821-36747 | |||
| 2586 | CAMXVF010000009.1 | GCA947252375_01277 | gene | open | 36788-38788 | |||
| 2587 | CAMXVF010000009.1 | GCA947252375_01278 | gene | open | 39065-39328 | |||
| 2588 | CAMXVF010000009.1 | GCA947252375_01279 | gene | open | 39417-40415 | |||
| 2589 | CAMXVF010000009.1 | GCA947252375_01280 | gene | open | 40578-42389 | |||
| 2590 | CAMXVF010000009.1 | GCA947252375_01281 | gene | open | 42398-43555 | |||
| 2591 | CAMXVF010000009.1 | GCA947252375_01282 | gene | open | 43815-44882 | hrcA | ||
| 2592 | CAMXVF010000009.1 | GCA947252375_01283 | gene | open | 44890-45549 | |||
| 2593 | CAMXVF010000009.1 | GCA947252375_01284 | gene | open | 45641-47527 | dnaK | ||
| 2594 | CAMXVF010000009.1 | GCA947252375_01285 | gene | open | 47560-48732 | dnaJ | ||
| 2595 | CAMXVF010000009.1 | GCA947252375_01286 | gene | open | 48947-50101 | |||
| 2596 | CAMXVF010000009.1 | GCA947252375_01287 | gene | open | 50147-51337 | |||
| 2597 | CAMXVF010000009.1 | GCA947252375_01288 | gene | open | 51608-51841 | |||
| 2598 | CAMXVF010000009.1 | GCA947252375_01289 | gene | open | 51927-53255 | miaB | ||
| 2599 | CAMXVF010000009.1 | GCA947252375_01290 | gene | open | 53289-53555 | |||
| 2600 | CAMXVF010000009.1 | GCA947252375_01291 | gene | open | 53555-53986 | |||
| 2601 | CAMXVF010000009.1 | GCA947252375_01292 | gene | open | 53989-54240 | |||
| 2602 | CAMXVF010000009.1 | GCA947252375_01293 | gene | open | 54268-55932 | |||
| 2603 | CAMXVF010000009.1 | GCA947252375_01294 | gene | open | 55934-56575 | |||
| 2604 | CAMXVF010000009.1 | GCA947252375_01295 | gene | open | 56660-57886 | yhbU | ||
| 2605 | CAMXVF010000009.1 | GCA947252375_01296 | gene | open | 57896-58981 | |||
| 2606 | CAMXVF010000009.1 | GCA947252375_01297 | gene | open | 59097-60251 | |||
| 2607 | CAMXVF010000009.1 | GCA947252375_01298 | gene | open | 60352-60699 | yajC | ||
| 2608 | CAMXVF010000009.1 | GCA947252375_01299 | gene | open | 60820-62190 | |||
| 2609 | CAMXVF010000009.1 | GCA947252375_01300 | gene | open | 62368-64578 | |||
| 2610 | CAMXVF010000009.1 | GCA947252375_01301 | gene | open | 64594-67086 | clpC | ||
| 2611 | CAMXVF010000009.1 | GCA947252375_01302 | gene | open | 67127-67534 | |||
| 2612 | CAMXVF010000009.1 | GCA947252375_01303 | gene | open | 67534-68898 | radA | ||
| 2613 | CAMXVF010000009.1 | GCA947252375_01249 | gene | open | 3242-3315 | trnR | ||
| 2614 | CAMXVF010000009.1 | GCA947252375_01249 | tRNA | open | 3242-3315 | trnR | tRNA-Arg(ccg) | |
| 2615 | CAMXVF010000010.1 | GCA947252375_01362 | gene | open | 59564-59657 | tracrRNA | ||
| 2616 | CAMXVF010000010.1 | GCA947252375_01362 | ncRNA | open | 59564-59657 | Trans-activating crRNA | ||
| 2617 | CAMXVF010000010.1 | repeat_region | open | 53068-53510 | CRISPR array with 7 repeats of length 36%2C consensus sequence GTTTTAGTCCTATTCAAAACAACACAGTTATAAAAC and spacer length 30 | |||
| 2618 | CAMXVF010000010.1 | GCA947252375_01304 | CDS | open | 112-714 | _na 200_aa | NADPH-dependent FMN reductase | |
| 2619 | CAMXVF010000010.1 | GCA947252375_01305 | CDS | open | 736-867 | _na 43_aa | hypothetical protein | |
| 2620 | CAMXVF010000010.1 | GCA947252375_01306 | CDS | open | 818-1804 | _na 328_aa | Phosphate acetyltransferase | |
| 2621 | CAMXVF010000010.1 | GCA947252375_01307 | CDS | open | 1834-2361 | _na 175_aa | Anaerobic ribonucleoside-triphosphate reductase-activating protein | |
| 2622 | CAMXVF010000010.1 | GCA947252375_01308 | CDS | open | 2381-4630 | _na 749_aa | Anaerobic ribonucleoside-triphosphate reductase | |
| 2623 | CAMXVF010000010.1 | GCA947252375_01309 | CDS | open | 5050-5367 | _na 105_aa | hypothetical protein | |
| 2624 | CAMXVF010000010.1 | GCA947252375_01310 | CDS | open | 5505-6827 | _na 440_aa | Hemolysin | |
| 2625 | CAMXVF010000010.1 | GCA947252375_01311 | CDS | open | 6873-7478 | _na 201_aa | engB | putative GTP-binding protein EngB |
| 2626 | CAMXVF010000010.1 | GCA947252375_01312 | CDS | open | 7556-8848 | _na 430_aa | clpX | ATP-dependent Clp protease ATP-binding subunit ClpX |
| 2627 | CAMXVF010000010.1 | GCA947252375_01313 | CDS | open | 8848-9459 | _na 203_aa | ATP-dependent Clp protease proteolytic subunit 1 | |
| 2628 | CAMXVF010000010.1 | GCA947252375_01314 | CDS | open | 9544-10914 | _na 456_aa | Trigger factor | |
| 2629 | CAMXVF010000010.1 | GCA947252375_01315 | CDS | open | 11013-11561 | _na 182_aa | hypothetical protein | |
| 2630 | CAMXVF010000010.1 | GCA947252375_01316 | CDS | open | 11716-12204 | _na 162_aa | CYTH domain-containing protein | |
| 2631 | CAMXVF010000010.1 | GCA947252375_01317 | CDS | open | 12218-12835 | _na 205_aa | DUF1653 domain-containing protein | |
| 2632 | CAMXVF010000010.1 | GCA947252375_01318 | CDS | open | 13058-13300 | _na 80_aa | hypothetical protein | |
| 2633 | CAMXVF010000010.1 | GCA947252375_01319 | CDS | open | 13305-13991 | _na 228_aa | hypothetical protein | |
| 2634 | CAMXVF010000010.1 | GCA947252375_01320 | CDS | open | 14145-15380 | _na 411_aa | hypothetical protein | |
| 2635 | CAMXVF010000010.1 | GCA947252375_01322 | CDS | open | 15704-16321 | _na 205_aa | Cytidylate kinase | |
| 2636 | CAMXVF010000010.1 | GCA947252375_01323 | CDS | open | 16331-17005 | _na 224_aa | UDP-N-acetylglucosamine pyrophosphorylase | |
| 2637 | CAMXVF010000010.1 | GCA947252375_01324 | CDS | open | 17030-19009 | _na 659_aa | DNA topoisomerase | |
| 2638 | CAMXVF010000010.1 | GCA947252375_01325 | CDS | open | 19009-20376 | _na 455_aa | hypothetical protein | |
| 2639 | CAMXVF010000010.1 | GCA947252375_01326 | CDS | open | 20435-21103 | _na 222_aa | queH | Epoxyqueuosine reductase QueH |
| 2640 | CAMXVF010000010.1 | GCA947252375_01327 | CDS | open | 21151-21501 | _na 116_aa | hypothetical protein | |
| 2641 | CAMXVF010000010.1 | GCA947252375_01329 | CDS | open | 21687-23360 | _na 557_aa | hypothetical protein | |
| 2642 | CAMXVF010000010.1 | GCA947252375_01330 | CDS | open | 23422-24321 | _na 299_aa | hypothetical protein | |
| 2643 | CAMXVF010000010.1 | GCA947252375_01331 | CDS | open | 24318-25121 | _na 267_aa | RNA-binding S4 domain-containing protein | |
| 2644 | CAMXVF010000010.1 | GCA947252375_01332 | CDS | open | 25199-27070 | _na 623_aa | 1-deoxy-D-xylulose-5-phosphate synthase | |
| 2645 | CAMXVF010000010.1 | GCA947252375_01333 | CDS | open | 27077-28003 | _na 308_aa | Octaprenyl-diphosphate synthase / Dimethylallyltransferase / Geranyltranstransferase (Farnesyldiphosphate synthase) / Geranylgeranyl pyrophosphate synthetase | |
| 2646 | CAMXVF010000010.1 | GCA947252375_01334 | CDS | open | 28006-28284 | _na 92_aa | hypothetical protein | |
| 2647 | CAMXVF010000010.1 | GCA947252375_01335 | CDS | open | 28377-29666 | _na 429_aa | hypothetical protein | |
| 2648 | CAMXVF010000010.1 | GCA947252375_01336 | CDS | open | 29653-30087 | _na 144_aa | nusB | Transcription antitermination protein NusB |
| 2649 | CAMXVF010000010.1 | GCA947252375_01337 | CDS | open | 30125-30478 | _na 117_aa | hypothetical protein | |
| 2650 | CAMXVF010000010.1 | GCA947252375_01338 | CDS | open | 30628-32265 | _na 545_aa | hypothetical protein | |
| 2651 | CAMXVF010000010.1 | GCA947252375_01339 | CDS | open | 32397-34838 | _na 813_aa | hypothetical protein | |
| 2652 | CAMXVF010000010.1 | GCA947252375_01340 | CDS | open | 34801-35022 | _na 73_aa | hypothetical protein | |
| 2653 | CAMXVF010000010.1 | GCA947252375_01341 | CDS | open | 35133-35939 | _na 268_aa | hypothetical protein | |
| 2654 | CAMXVF010000010.1 | GCA947252375_01343 | CDS | open | 36241-37173 | _na 310_aa | 1-deoxy-D-xylulose-5-phosphate synthase | |
| 2655 | CAMXVF010000010.1 | GCA947252375_01344 | CDS | open | 37173-38000 | _na 275_aa | Transketolase 1 | |
| 2656 | CAMXVF010000010.1 | GCA947252375_01345 | CDS | open | 38073-38684 | _na 203_aa | hypothetical protein | |
| 2657 | CAMXVF010000010.1 | GCA947252375_01346 | CDS | open | 38884-39699 | _na 271_aa | hypothetical protein | |
| 2658 | CAMXVF010000010.1 | GCA947252375_01347 | CDS | open | 39789-42356 | _na 855_aa | hypothetical protein | |
| 2659 | CAMXVF010000010.1 | GCA947252375_01348 | CDS | open | 42356-43336 | _na 326_aa | hypothetical protein | |
| 2660 | CAMXVF010000010.1 | GCA947252375_01349 | CDS | open | 43329-43580 | _na 83_aa | hypothetical protein | |
| 2661 | CAMXVF010000010.1 | GCA947252375_01350 | CDS | open | 43868-44656 | _na 262_aa | hypothetical protein | |
| 2662 | CAMXVF010000010.1 | GCA947252375_01351 | CDS | open | 44722-46098 | _na 458_aa | Glycosyltransferase 2-like domain-containing protein | |
| 2663 | CAMXVF010000010.1 | GCA947252375_01352 | CDS | open | 46095-46727 | _na 210_aa | xrtG | Exosortase family protein XrtG |
| 2664 | CAMXVF010000010.1 | GCA947252375_01353 | CDS | open | 47086-48891 | _na 601_aa | hypothetical protein | |
| 2665 | CAMXVF010000010.1 | GCA947252375_01354 | CDS | open | 48981-49634 | _na 217_aa | Glutamate racemase | |
| 2666 | CAMXVF010000010.1 | GCA947252375_01355 | CDS | open | 49834-51294 | _na 486_aa | Flagellin | |
| 2667 | CAMXVF010000010.1 | GCA947252375_01356 | CDS | open | 51633-52190 | _na 185_aa | Nicotinamidase | |
| 2668 | CAMXVF010000010.1 | GCA947252375_01357 | CDS | open | 52702-52854 | _na 50_aa | hypothetical protein | |
| 2669 | CAMXVF010000010.1 | GCA947252375_01358 | CDS | open | 53605-54270 | _na 221_aa | hypothetical protein | |
| 2670 | CAMXVF010000010.1 | GCA947252375_01359 | CDS | open | 54263-54583 | _na 106_aa | CRISPR-associated endoribonuclease Cas2 | |
| 2671 | CAMXVF010000010.1 | GCA947252375_01360 | CDS | open | 54595-55461 | _na 288_aa | CRISPR-associated endonuclease Cas1 | |
| 2672 | CAMXVF010000010.1 | GCA947252375_01361 | CDS | open | 55462-59502 | _na 1346_aa | CRISPR-associated endonuclease Cas9 | |
| 2673 | CAMXVF010000010.1 | GCA947252375_01363 | CDS | open | 59989-60207 | _na 72_aa | hypothetical protein | |
| 2674 | CAMXVF010000010.1 | GCA947252375_01370 | CDS | open | 61060-61539 | _na 159_aa | hypothetical protein | |
| 2675 | CAMXVF010000010.1 | GCA947252375_01304 | gene | open | 112-714 | |||
| 2676 | CAMXVF010000010.1 | GCA947252375_01305 | gene | open | 736-867 | |||
| 2677 | CAMXVF010000010.1 | GCA947252375_01306 | gene | open | 818-1804 | |||
| 2678 | CAMXVF010000010.1 | GCA947252375_01307 | gene | open | 1834-2361 | |||
| 2679 | CAMXVF010000010.1 | GCA947252375_01308 | gene | open | 2381-4630 | |||
| 2680 | CAMXVF010000010.1 | GCA947252375_01309 | gene | open | 5050-5367 | |||
| 2681 | CAMXVF010000010.1 | GCA947252375_01310 | gene | open | 5505-6827 | |||
| 2682 | CAMXVF010000010.1 | GCA947252375_01311 | gene | open | 6873-7478 | engB | ||
| 2683 | CAMXVF010000010.1 | GCA947252375_01312 | gene | open | 7556-8848 | clpX | ||
| 2684 | CAMXVF010000010.1 | GCA947252375_01313 | gene | open | 8848-9459 | |||
| 2685 | CAMXVF010000010.1 | GCA947252375_01314 | gene | open | 9544-10914 | |||
| 2686 | CAMXVF010000010.1 | GCA947252375_01315 | gene | open | 11013-11561 | |||
| 2687 | CAMXVF010000010.1 | GCA947252375_01316 | gene | open | 11716-12204 | |||
| 2688 | CAMXVF010000010.1 | GCA947252375_01317 | gene | open | 12218-12835 | |||
| 2689 | CAMXVF010000010.1 | GCA947252375_01318 | gene | open | 13058-13300 | |||
| 2690 | CAMXVF010000010.1 | GCA947252375_01319 | gene | open | 13305-13991 | |||
| 2691 | CAMXVF010000010.1 | GCA947252375_01320 | gene | open | 14145-15380 | |||
| 2692 | CAMXVF010000010.1 | GCA947252375_01322 | gene | open | 15704-16321 | |||
| 2693 | CAMXVF010000010.1 | GCA947252375_01323 | gene | open | 16331-17005 | |||
| 2694 | CAMXVF010000010.1 | GCA947252375_01324 | gene | open | 17030-19009 | |||
| 2695 | CAMXVF010000010.1 | GCA947252375_01325 | gene | open | 19009-20376 | |||
| 2696 | CAMXVF010000010.1 | GCA947252375_01326 | gene | open | 20435-21103 | queH | ||
| 2697 | CAMXVF010000010.1 | GCA947252375_01327 | gene | open | 21151-21501 | |||
| 2698 | CAMXVF010000010.1 | GCA947252375_01329 | gene | open | 21687-23360 | |||
| 2699 | CAMXVF010000010.1 | GCA947252375_01330 | gene | open | 23422-24321 | |||
| 2700 | CAMXVF010000010.1 | GCA947252375_01331 | gene | open | 24318-25121 | |||
| 2701 | CAMXVF010000010.1 | GCA947252375_01332 | gene | open | 25199-27070 | |||
| 2702 | CAMXVF010000010.1 | GCA947252375_01333 | gene | open | 27077-28003 | |||
| 2703 | CAMXVF010000010.1 | GCA947252375_01334 | gene | open | 28006-28284 | |||
| 2704 | CAMXVF010000010.1 | GCA947252375_01335 | gene | open | 28377-29666 | |||
| 2705 | CAMXVF010000010.1 | GCA947252375_01336 | gene | open | 29653-30087 | nusB | ||
| 2706 | CAMXVF010000010.1 | GCA947252375_01337 | gene | open | 30125-30478 | |||
| 2707 | CAMXVF010000010.1 | GCA947252375_01338 | gene | open | 30628-32265 | |||
| 2708 | CAMXVF010000010.1 | GCA947252375_01339 | gene | open | 32397-34838 | |||
| 2709 | CAMXVF010000010.1 | GCA947252375_01340 | gene | open | 34801-35022 | |||
| 2710 | CAMXVF010000010.1 | GCA947252375_01341 | gene | open | 35133-35939 | |||
| 2711 | CAMXVF010000010.1 | GCA947252375_01343 | gene | open | 36241-37173 | |||
| 2712 | CAMXVF010000010.1 | GCA947252375_01344 | gene | open | 37173-38000 | |||
| 2713 | CAMXVF010000010.1 | GCA947252375_01345 | gene | open | 38073-38684 | |||
| 2714 | CAMXVF010000010.1 | GCA947252375_01346 | gene | open | 38884-39699 | |||
| 2715 | CAMXVF010000010.1 | GCA947252375_01347 | gene | open | 39789-42356 | |||
| 2716 | CAMXVF010000010.1 | GCA947252375_01348 | gene | open | 42356-43336 | |||
| 2717 | CAMXVF010000010.1 | GCA947252375_01349 | gene | open | 43329-43580 | |||
| 2718 | CAMXVF010000010.1 | GCA947252375_01350 | gene | open | 43868-44656 | |||
| 2719 | CAMXVF010000010.1 | GCA947252375_01351 | gene | open | 44722-46098 | |||
| 2720 | CAMXVF010000010.1 | GCA947252375_01352 | gene | open | 46095-46727 | xrtG | ||
| 2721 | CAMXVF010000010.1 | GCA947252375_01353 | gene | open | 47086-48891 | |||
| 2722 | CAMXVF010000010.1 | GCA947252375_01354 | gene | open | 48981-49634 | |||
| 2723 | CAMXVF010000010.1 | GCA947252375_01355 | gene | open | 49834-51294 | |||
| 2724 | CAMXVF010000010.1 | GCA947252375_01356 | gene | open | 51633-52190 | |||
| 2725 | CAMXVF010000010.1 | GCA947252375_01357 | gene | open | 52702-52854 | |||
| 2726 | CAMXVF010000010.1 | GCA947252375_01358 | gene | open | 53605-54270 | |||
| 2727 | CAMXVF010000010.1 | GCA947252375_01359 | gene | open | 54263-54583 | |||
| 2728 | CAMXVF010000010.1 | GCA947252375_01360 | gene | open | 54595-55461 | |||
| 2729 | CAMXVF010000010.1 | GCA947252375_01361 | gene | open | 55462-59502 | |||
| 2730 | CAMXVF010000010.1 | GCA947252375_01363 | gene | open | 59989-60207 | |||
| 2731 | CAMXVF010000010.1 | GCA947252375_01370 | gene | open | 61060-61539 | |||
| 2732 | CAMXVF010000010.1 | GCA947252375_01321 | gene | open | 15522-15604 | trnL | ||
| 2733 | CAMXVF010000010.1 | GCA947252375_01328 | gene | open | 21599-21671 | trnT | ||
| 2734 | CAMXVF010000010.1 | GCA947252375_01342 | gene | open | 36140-36212 | trnT | ||
| 2735 | CAMXVF010000010.1 | GCA947252375_01364 | gene | open | 60290-60362 | trnK | ||
| 2736 | CAMXVF010000010.1 | GCA947252375_01365 | gene | open | 60391-60462 | trnQ | ||
| 2737 | CAMXVF010000010.1 | GCA947252375_01366 | gene | open | 60490-60563 | trnH | ||
| 2738 | CAMXVF010000010.1 | GCA947252375_01367 | gene | open | 60569-60642 | trnR | ||
| 2739 | CAMXVF010000010.1 | GCA947252375_01368 | gene | open | 60648-60718 | trnG | ||
| 2740 | CAMXVF010000010.1 | GCA947252375_01369 | gene | open | 60734-60808 | trnP | ||
| 2741 | CAMXVF010000010.1 | GCA947252375_01321 | tRNA | open | 15522-15604 | trnL | tRNA-Leu(tag) | |
| 2742 | CAMXVF010000010.1 | GCA947252375_01328 | tRNA | open | 21599-21671 | trnT | tRNA-Thr(cgt) | |
| 2743 | CAMXVF010000010.1 | GCA947252375_01342 | tRNA | open | 36140-36212 | trnT | tRNA-Thr(ggt) | |
| 2744 | CAMXVF010000010.1 | GCA947252375_01364 | tRNA | open | 60290-60362 | trnK | tRNA-Lys(ttt) | |
| 2745 | CAMXVF010000010.1 | GCA947252375_01365 | tRNA | open | 60391-60462 | trnQ | tRNA-Gln(ttg) | |
| 2746 | CAMXVF010000010.1 | GCA947252375_01366 | tRNA | open | 60490-60563 | trnH | tRNA-His(gtg) | |
| 2747 | CAMXVF010000010.1 | GCA947252375_01367 | tRNA | open | 60569-60642 | trnR | tRNA-Arg(tct) | |
| 2748 | CAMXVF010000010.1 | GCA947252375_01368 | tRNA | open | 60648-60718 | trnG | tRNA-Gly(tcc) | |
| 2749 | CAMXVF010000010.1 | GCA947252375_01369 | tRNA | open | 60734-60808 | trnP | tRNA-Pro(tgg) | |
| 2750 | CAMXVF010000011.1 | GCA947252375_01377 | gene | open | 6535-6879 | ssrA | ||
| 2751 | CAMXVF010000011.1 | GCA947252375_01377 | tmRNA | open | 6535-6879 | ssrA | transfer-messenger RNA%2C SsrA | |
| 2752 | CAMXVF010000011.1 | GCA947252375_01371 | CDS | open | 207-914 | _na 235_aa | D/L-lactic acid transporter | |
| 2753 | CAMXVF010000011.1 | GCA947252375_01372 | CDS | open | 1095-1964 | _na 289_aa | pyridoxal kinase | |
| 2754 | CAMXVF010000011.1 | GCA947252375_01373 | CDS | open | 2075-2329 | _na 84_aa | secG | Protein-export membrane protein SecG |
| 2755 | CAMXVF010000011.1 | GCA947252375_01374 | CDS | open | 2401-4488 | _na 695_aa | Ribonuclease R | |
| 2756 | CAMXVF010000011.1 | GCA947252375_01375 | CDS | open | 4597-5070 | _na 157_aa | SsrA-binding protein | |
| 2757 | CAMXVF010000011.1 | GCA947252375_01376 | CDS | open | 5411-6172 | _na 253_aa | Uridine phosphorylase | |
| 2758 | CAMXVF010000011.1 | GCA947252375_01378 | CDS | open | 7109-7573 | _na 154_aa | Nucleoside 2-deoxyribosyltransferase | |
| 2759 | CAMXVF010000011.1 | GCA947252375_01379 | CDS | open | 7601-8152 | _na 183_aa | Catalase | |
| 2760 | CAMXVF010000011.1 | GCA947252375_01380 | CDS | open | 8253-9287 | _na 344_aa | Tryptophan--tRNA ligase | |
| 2761 | CAMXVF010000011.1 | GCA947252375_01381 | CDS | open | 9394-10539 | _na 381_aa | hypothetical protein | |
| 2762 | CAMXVF010000011.1 | GCA947252375_01382 | CDS | open | 10635-12209 | _na 524_aa | hypothetical protein | |
| 2763 | CAMXVF010000011.1 | GCA947252375_01383 | CDS | open | 12467-14551 | _na 694_aa | DNA topoisomerase 1 | |
| 2764 | CAMXVF010000011.1 | GCA947252375_01384 | CDS | open | 14621-15403 | _na 260_aa | codY | Global transcriptional regulator CodY |
| 2765 | CAMXVF010000011.1 | GCA947252375_01385 | CDS | open | 15629-16024 | _na 131_aa | flgB | Flagellar basal body rod protein FlgB |
| 2766 | CAMXVF010000011.1 | GCA947252375_01386 | CDS | open | 16044-16493 | _na 149_aa | flgC | Flagellar basal-body rod protein FlgC |
| 2767 | CAMXVF010000011.1 | GCA947252375_01387 | CDS | open | 16542-16871 | _na 109_aa | fliE | Flagellar hook-basal body complex protein FliE |
| 2768 | CAMXVF010000011.1 | GCA947252375_01388 | CDS | open | 16899-18515 | _na 538_aa | fliF | Flagellar M-ring protein FliF |
| 2769 | CAMXVF010000011.1 | GCA947252375_01389 | CDS | open | 18519-19526 | _na 335_aa | fliG | Flagellar motor switch protein FliG |
| 2770 | CAMXVF010000011.1 | GCA947252375_01390 | CDS | open | 19519-20388 | _na 289_aa | hypothetical protein | |
| 2771 | CAMXVF010000011.1 | GCA947252375_01391 | CDS | open | 20406-21731 | _na 441_aa | Type 3 secretion system ATPase | |
| 2772 | CAMXVF010000011.1 | GCA947252375_01392 | CDS | open | 21761-22204 | _na 147_aa | fliJ | Flagellar FliJ protein |
| 2773 | CAMXVF010000011.1 | GCA947252375_01393 | CDS | open | 22249-23124 | _na 291_aa | hypothetical protein | |
| 2774 | CAMXVF010000011.1 | GCA947252375_01394 | CDS | open | 23150-24763 | _na 537_aa | hypothetical protein | |
| 2775 | CAMXVF010000011.1 | GCA947252375_01395 | CDS | open | 24820-25572 | _na 250_aa | hypothetical protein | |
| 2776 | CAMXVF010000011.1 | GCA947252375_01396 | CDS | open | 25650-26057 | _na 135_aa | Flagellar operon protein | |
| 2777 | CAMXVF010000011.1 | GCA947252375_01397 | CDS | open | 26139-27818 | _na 559_aa | flgE | Flagellar hook protein FlgE |
| 2778 | CAMXVF010000011.1 | GCA947252375_01371 | gene | open | 207-914 | |||
| 2779 | CAMXVF010000011.1 | GCA947252375_01372 | gene | open | 1095-1964 | |||
| 2780 | CAMXVF010000011.1 | GCA947252375_01373 | gene | open | 2075-2329 | secG | ||
| 2781 | CAMXVF010000011.1 | GCA947252375_01374 | gene | open | 2401-4488 | |||
| 2782 | CAMXVF010000011.1 | GCA947252375_01375 | gene | open | 4597-5070 | |||
| 2783 | CAMXVF010000011.1 | GCA947252375_01376 | gene | open | 5411-6172 | |||
| 2784 | CAMXVF010000011.1 | GCA947252375_01378 | gene | open | 7109-7573 | |||
| 2785 | CAMXVF010000011.1 | GCA947252375_01379 | gene | open | 7601-8152 | |||
| 2786 | CAMXVF010000011.1 | GCA947252375_01380 | gene | open | 8253-9287 | |||
| 2787 | CAMXVF010000011.1 | GCA947252375_01381 | gene | open | 9394-10539 | |||
| 2788 | CAMXVF010000011.1 | GCA947252375_01382 | gene | open | 10635-12209 | |||
| 2789 | CAMXVF010000011.1 | GCA947252375_01383 | gene | open | 12467-14551 | |||
| 2790 | CAMXVF010000011.1 | GCA947252375_01384 | gene | open | 14621-15403 | codY | ||
| 2791 | CAMXVF010000011.1 | GCA947252375_01385 | gene | open | 15629-16024 | flgB | ||
| 2792 | CAMXVF010000011.1 | GCA947252375_01386 | gene | open | 16044-16493 | flgC | ||
| 2793 | CAMXVF010000011.1 | GCA947252375_01387 | gene | open | 16542-16871 | fliE | ||
| 2794 | CAMXVF010000011.1 | GCA947252375_01388 | gene | open | 16899-18515 | fliF | ||
| 2795 | CAMXVF010000011.1 | GCA947252375_01389 | gene | open | 18519-19526 | fliG | ||
| 2796 | CAMXVF010000011.1 | GCA947252375_01390 | gene | open | 19519-20388 | |||
| 2797 | CAMXVF010000011.1 | GCA947252375_01391 | gene | open | 20406-21731 | |||
| 2798 | CAMXVF010000011.1 | GCA947252375_01392 | gene | open | 21761-22204 | fliJ | ||
| 2799 | CAMXVF010000011.1 | GCA947252375_01393 | gene | open | 22249-23124 | |||
| 2800 | CAMXVF010000011.1 | GCA947252375_01394 | gene | open | 23150-24763 | |||
| 2801 | CAMXVF010000011.1 | GCA947252375_01395 | gene | open | 24820-25572 | |||
| 2802 | CAMXVF010000011.1 | GCA947252375_01396 | gene | open | 25650-26057 | |||
| 2803 | CAMXVF010000011.1 | GCA947252375_01397 | gene | open | 26139-27818 | flgE | ||
| 2804 | CAMXVF010000012.1 | GCA947252375_01398 | CDS | open | 155-1447 | _na 430_aa | RCK C-terminal domain-containing protein | |
| 2805 | CAMXVF010000012.1 | GCA947252375_01399 | CDS | open | 1720-3234 | _na 504_aa | Arginine decarboxylase | |
| 2806 | CAMXVF010000012.1 | GCA947252375_01400 | CDS | open | 3285-3434 | _na 49_aa | Six-cysteine ranthipeptide SCIFF | |
| 2807 | CAMXVF010000012.1 | GCA947252375_01401 | CDS | open | 3534-4940 | _na 468_aa | Thioether cross-link-forming SCIFF peptide maturase | |
| 2808 | CAMXVF010000012.1 | GCA947252375_01402 | CDS | open | 5157-7775 | _na 872_aa | Aldehyde-alcohol dehydrogenase | |
| 2809 | CAMXVF010000012.1 | GCA947252375_01403 | CDS | open | 7795-8550 | _na 251_aa | Phosphotransferase enzyme family protein | |
| 2810 | CAMXVF010000012.1 | GCA947252375_01404 | CDS | open | 8867-9946 | _na 359_aa | hypothetical protein | |
| 2811 | CAMXVF010000012.1 | GCA947252375_01405 | CDS | open | 10139-11230 | _na 363_aa | Phosphotransferase system EIIC domain-containing protein | |
| 2812 | CAMXVF010000012.1 | GCA947252375_01406 | CDS | open | 11373-11891 | _na 172_aa | nadR | Transcription repressor NadR |
| 2813 | CAMXVF010000012.1 | GCA947252375_01407 | CDS | open | 12130-13914 | _na 594_aa | Methyl-accepting chemotaxis protein | |
| 2814 | CAMXVF010000012.1 | GCA947252375_01408 | CDS | open | 14039-14926 | _na 295_aa | hypothetical protein | |
| 2815 | CAMXVF010000012.1 | GCA947252375_01409 | CDS | open | 14960-15073 | _na 37_aa | hypothetical protein | |
| 2816 | CAMXVF010000012.1 | GCA947252375_01410 | CDS | open | 15277-15561 | _na 94_aa | relB | Damage-inducible protein |
| 2817 | CAMXVF010000012.1 | GCA947252375_01411 | CDS | open | 15866-16378 | _na 170_aa | Nitroreductase domain-containing protein | |
| 2818 | CAMXVF010000012.1 | GCA947252375_01412 | CDS | open | 16396-17220 | _na 274_aa | hypothetical protein | |
| 2819 | CAMXVF010000012.1 | GCA947252375_01413 | CDS | open | 17237-18424 | _na 395_aa | cysteine-S-conjugate beta-lyase | |
| 2820 | CAMXVF010000012.1 | GCA947252375_01414 | CDS | open | 18679-19245 | _na 188_aa | hypothetical protein | |
| 2821 | CAMXVF010000012.1 | GCA947252375_01415 | CDS | open | 19238-19561 | _na 107_aa | hypothetical protein | |
| 2822 | CAMXVF010000012.1 | GCA947252375_01416 | CDS | open | 19558-20310 | _na 250_aa | Stage 0 sporulation A-like protein | |
| 2823 | CAMXVF010000012.1 | GCA947252375_01417 | CDS | open | 20845-21633 | _na 262_aa | insO | IS3 family transposase |
| 2824 | CAMXVF010000012.1 | GCA947252375_01418 | CDS | open | 21657-22220 | _na 187_aa | Transposase | |
| 2825 | CAMXVF010000012.1 | GCA947252375_01398 | gene | open | 155-1447 | |||
| 2826 | CAMXVF010000012.1 | GCA947252375_01399 | gene | open | 1720-3234 | |||
| 2827 | CAMXVF010000012.1 | GCA947252375_01400 | gene | open | 3285-3434 | |||
| 2828 | CAMXVF010000012.1 | GCA947252375_01401 | gene | open | 3534-4940 | |||
| 2829 | CAMXVF010000012.1 | GCA947252375_01402 | gene | open | 5157-7775 | |||
| 2830 | CAMXVF010000012.1 | GCA947252375_01403 | gene | open | 7795-8550 | |||
| 2831 | CAMXVF010000012.1 | GCA947252375_01404 | gene | open | 8867-9946 | |||
| 2832 | CAMXVF010000012.1 | GCA947252375_01405 | gene | open | 10139-11230 | |||
| 2833 | CAMXVF010000012.1 | GCA947252375_01406 | gene | open | 11373-11891 | nadR | ||
| 2834 | CAMXVF010000012.1 | GCA947252375_01407 | gene | open | 12130-13914 | |||
| 2835 | CAMXVF010000012.1 | GCA947252375_01408 | gene | open | 14039-14926 | |||
| 2836 | CAMXVF010000012.1 | GCA947252375_01409 | gene | open | 14960-15073 | |||
| 2837 | CAMXVF010000012.1 | GCA947252375_01410 | gene | open | 15277-15561 | relB | ||
| 2838 | CAMXVF010000012.1 | GCA947252375_01411 | gene | open | 15866-16378 | |||
| 2839 | CAMXVF010000012.1 | GCA947252375_01412 | gene | open | 16396-17220 | |||
| 2840 | CAMXVF010000012.1 | GCA947252375_01413 | gene | open | 17237-18424 | |||
| 2841 | CAMXVF010000012.1 | GCA947252375_01414 | gene | open | 18679-19245 | |||
| 2842 | CAMXVF010000012.1 | GCA947252375_01415 | gene | open | 19238-19561 | |||
| 2843 | CAMXVF010000012.1 | GCA947252375_01416 | gene | open | 19558-20310 | |||
| 2844 | CAMXVF010000012.1 | GCA947252375_01417 | gene | open | 20845-21633 | insO | ||
| 2845 | CAMXVF010000012.1 | GCA947252375_01418 | gene | open | 21657-22220 | |||
| 2846 | CAMXVF010000013.1 | GCA947252375_01420 | CDS | open | 458-1282 | _na 274_aa | hypothetical protein | |
| 2847 | CAMXVF010000013.1 | GCA947252375_01423 | CDS | open | 1832-2374 | _na 180_aa | 2-C-methyl-D-erythritol 2%2C4-cyclodiphosphate synthase | |
| 2848 | CAMXVF010000013.1 | GCA947252375_01424 | CDS | open | 2457-3875 | _na 472_aa | Cysteine--tRNA ligase | |
| 2849 | CAMXVF010000013.1 | GCA947252375_01425 | CDS | open | 3860-4309 | _na 149_aa | Mini-ribonuclease 3 | |
| 2850 | CAMXVF010000013.1 | GCA947252375_01426 | CDS | open | 4299-5048 | _na 249_aa | trmH | TrmH family tRNA/rRNA methyltransferase |
| 2851 | CAMXVF010000013.1 | GCA947252375_01427 | CDS | open | 5060-5641 | _na 193_aa | hypothetical protein | |
| 2852 | CAMXVF010000013.1 | GCA947252375_01428 | CDS | open | 5707-7137 | _na 476_aa | Amino acid permease | |
| 2853 | CAMXVF010000013.1 | GCA947252375_01429 | CDS | open | 7356-8096 | _na 246_aa | Glucosamine-6-phosphate deaminase | |
| 2854 | CAMXVF010000013.1 | GCA947252375_01430 | CDS | open | 8405-9553 | _na 382_aa | hypothetical protein | |
| 2855 | CAMXVF010000013.1 | GCA947252375_01431 | CDS | open | 9689-10708 | _na 339_aa | Glyceraldehyde-3-phosphate dehydrogenase | |
| 2856 | CAMXVF010000013.1 | GCA947252375_01432 | CDS | open | 10730-12001 | _na 423_aa | Phosphoglycerate kinase | |
| 2857 | CAMXVF010000013.1 | GCA947252375_01433 | CDS | open | 12022-12768 | _na 248_aa | Triosephosphate isomerase | |
| 2858 | CAMXVF010000013.1 | GCA947252375_01434 | CDS | open | 12843-13982 | _na 379_aa | hypothetical protein | |
| 2859 | CAMXVF010000013.1 | GCA947252375_01435 | CDS | open | 14026-15492 | _na 488_aa | Adenylosuccinate lyase | |
| 2860 | CAMXVF010000013.1 | GCA947252375_01436 | CDS | open | 15645-16076 | _na 143_aa | hypothetical protein | |
| 2861 | CAMXVF010000013.1 | GCA947252375_01437 | CDS | open | 16349-17821 | _na 490_aa | Dipeptidase | |
| 2862 | CAMXVF010000013.1 | GCA947252375_01438 | CDS | open | 17825-17974 | _na 49_aa | hypothetical protein | |
| 2863 | CAMXVF010000013.1 | GCA947252375_01420 | gene | open | 458-1282 | |||
| 2864 | CAMXVF010000013.1 | GCA947252375_01423 | gene | open | 1832-2374 | |||
| 2865 | CAMXVF010000013.1 | GCA947252375_01424 | gene | open | 2457-3875 | |||
| 2866 | CAMXVF010000013.1 | GCA947252375_01425 | gene | open | 3860-4309 | |||
| 2867 | CAMXVF010000013.1 | GCA947252375_01426 | gene | open | 4299-5048 | trmH | ||
| 2868 | CAMXVF010000013.1 | GCA947252375_01427 | gene | open | 5060-5641 | |||
| 2869 | CAMXVF010000013.1 | GCA947252375_01428 | gene | open | 5707-7137 | |||
| 2870 | CAMXVF010000013.1 | GCA947252375_01429 | gene | open | 7356-8096 | |||
| 2871 | CAMXVF010000013.1 | GCA947252375_01430 | gene | open | 8405-9553 | |||
| 2872 | CAMXVF010000013.1 | GCA947252375_01431 | gene | open | 9689-10708 | |||
| 2873 | CAMXVF010000013.1 | GCA947252375_01432 | gene | open | 10730-12001 | |||
| 2874 | CAMXVF010000013.1 | GCA947252375_01433 | gene | open | 12022-12768 | |||
| 2875 | CAMXVF010000013.1 | GCA947252375_01434 | gene | open | 12843-13982 | |||
| 2876 | CAMXVF010000013.1 | GCA947252375_01435 | gene | open | 14026-15492 | |||
| 2877 | CAMXVF010000013.1 | GCA947252375_01436 | gene | open | 15645-16076 | |||
| 2878 | CAMXVF010000013.1 | GCA947252375_01437 | gene | open | 16349-17821 | |||
| 2879 | CAMXVF010000013.1 | GCA947252375_01438 | gene | open | 17825-17974 | |||
| 2880 | CAMXVF010000013.1 | GCA947252375_01419 | gene | open | 139-211 | trnW | ||
| 2881 | CAMXVF010000013.1 | GCA947252375_01421 | gene | open | 1368-1440 | trnV | ||
| 2882 | CAMXVF010000013.1 | GCA947252375_01422 | gene | open | 1449-1522 | trnM | ||
| 2883 | CAMXVF010000013.1 | GCA947252375_01419 | tRNA | open | 139-211 | trnW | tRNA-Trp(cca) | |
| 2884 | CAMXVF010000013.1 | GCA947252375_01421 | tRNA | open | 1368-1440 | trnV | tRNA-Val(tac) | |
| 2885 | CAMXVF010000013.1 | GCA947252375_01422 | tRNA | open | 1449-1522 | trnM | tRNA-Met(cat) | |
| 2886 | CAMXVF010000014.1 | GCA947252375_01439 | CDS | open | 45-650 | _na 201_aa | dITP/XTP pyrophosphatase | |
| 2887 | CAMXVF010000014.1 | GCA947252375_01440 | CDS | open | 673-1698 | _na 341_aa | hypothetical protein | |
| 2888 | CAMXVF010000014.1 | GCA947252375_01441 | CDS | open | 1682-3367 | _na 561_aa | hypothetical protein | |
| 2889 | CAMXVF010000014.1 | GCA947252375_01442 | CDS | open | 3452-4600 | _na 382_aa | THUMP domain-containing protein | |
| 2890 | CAMXVF010000014.1 | GCA947252375_01443 | CDS | open | 4729-5214 | _na 161_aa | Cys-tRNA(Pro)/Cys-tRNA(Cys) deacylase | |
| 2891 | CAMXVF010000014.1 | GCA947252375_01444 | CDS | open | 5317-5955 | _na 212_aa | hypothetical protein | |
| 2892 | CAMXVF010000014.1 | GCA947252375_01445 | CDS | open | 6091-7098 | _na 335_aa | Proline iminopeptidase | |
| 2893 | CAMXVF010000014.1 | GCA947252375_01446 | CDS | open | 7292-7543 | _na 83_aa | Amino acid ABC transporter%2C permease protein | |
| 2894 | CAMXVF010000014.1 | GCA947252375_01447 | CDS | open | 7580-8296 | _na 238_aa | hypothetical protein | |
| 2895 | CAMXVF010000014.1 | GCA947252375_01448 | CDS | open | 8286-8996 | _na 236_aa | ABC transporter ATP-binding protein | |
| 2896 | CAMXVF010000014.1 | GCA947252375_01449 | CDS | open | 8997-9743 | _na 248_aa | ABC transporter permease | |
| 2897 | CAMXVF010000014.1 | GCA947252375_01450 | CDS | open | 9727-10662 | _na 311_aa | ABC transporter ATP-binding protein | |
| 2898 | CAMXVF010000014.1 | GCA947252375_01451 | CDS | open | 10775-11392 | _na 205_aa | TetR/AcrR family transcriptional regulator | |
| 2899 | CAMXVF010000014.1 | GCA947252375_01452 | CDS | open | 11408-11605 | _na 65_aa | helix-turn-helix transcriptional regulator | |
| 2900 | CAMXVF010000014.1 | GCA947252375_01453 | CDS | open | 12039-12368 | _na 109_aa | sdpI | SdpI family protein |
| 2901 | CAMXVF010000014.1 | GCA947252375_01454 | CDS | open | 12788-13066 | _na 92_aa | hypothetical protein | |
| 2902 | CAMXVF010000014.1 | GCA947252375_01439 | gene | open | 45-650 | |||
| 2903 | CAMXVF010000014.1 | GCA947252375_01440 | gene | open | 673-1698 | |||
| 2904 | CAMXVF010000014.1 | GCA947252375_01441 | gene | open | 1682-3367 | |||
| 2905 | CAMXVF010000014.1 | GCA947252375_01442 | gene | open | 3452-4600 | |||
| 2906 | CAMXVF010000014.1 | GCA947252375_01443 | gene | open | 4729-5214 | |||
| 2907 | CAMXVF010000014.1 | GCA947252375_01444 | gene | open | 5317-5955 | |||
| 2908 | CAMXVF010000014.1 | GCA947252375_01445 | gene | open | 6091-7098 | |||
| 2909 | CAMXVF010000014.1 | GCA947252375_01446 | gene | open | 7292-7543 | |||
| 2910 | CAMXVF010000014.1 | GCA947252375_01447 | gene | open | 7580-8296 | |||
| 2911 | CAMXVF010000014.1 | GCA947252375_01448 | gene | open | 8286-8996 | |||
| 2912 | CAMXVF010000014.1 | GCA947252375_01449 | gene | open | 8997-9743 | |||
| 2913 | CAMXVF010000014.1 | GCA947252375_01450 | gene | open | 9727-10662 | |||
| 2914 | CAMXVF010000014.1 | GCA947252375_01451 | gene | open | 10775-11392 | |||
| 2915 | CAMXVF010000014.1 | GCA947252375_01452 | gene | open | 11408-11605 | |||
| 2916 | CAMXVF010000014.1 | GCA947252375_01453 | gene | open | 12039-12368 | sdpI | ||
| 2917 | CAMXVF010000014.1 | GCA947252375_01454 | gene | open | 12788-13066 | |||
| 2918 | CAMXVF010000014.1 | GCA947252375_01455 | gene | open | 13154-13228 | trnR | ||
| 2919 | CAMXVF010000014.1 | GCA947252375_01456 | gene | open | 13241-13314 | trnD | ||
| 2920 | CAMXVF010000014.1 | GCA947252375_01457 | gene | open | 13318-13391 | trnI | ||
| 2921 | CAMXVF010000014.1 | GCA947252375_01458 | gene | open | 13398-13469 | trnE | ||
| 2922 | CAMXVF010000014.1 | GCA947252375_01459 | gene | open | 13475-13546 | trnN | ||
| 2923 | CAMXVF010000014.1 | GCA947252375_01455 | tRNA | open | 13154-13228 | trnR | tRNA-Arg(acg) | |
| 2924 | CAMXVF010000014.1 | GCA947252375_01456 | tRNA | open | 13241-13314 | trnD | tRNA-Asp(gtc) | |
| 2925 | CAMXVF010000014.1 | GCA947252375_01457 | tRNA | open | 13318-13391 | trnI | tRNA-Ile2(cat) | |
| 2926 | CAMXVF010000014.1 | GCA947252375_01458 | tRNA | open | 13398-13469 | trnE | tRNA-Glu(ttc) | |
| 2927 | CAMXVF010000014.1 | GCA947252375_01459 | tRNA | open | 13475-13546 | trnN | tRNA-Asn(gtt) | |
| 2928 | CAMXVF010000015.1 | GCA947252375_01460 | CDS | open | 296-1774 | _na 492_aa | lsa | Lsa family ABC-F type ribosomal protection protein |
| 2929 | CAMXVF010000015.1 | GCA947252375_01461 | CDS | open | 1890-2765 | _na 291_aa | ABC-2 type transporter | |
| 2930 | CAMXVF010000015.1 | GCA947252375_01462 | CDS | open | 3334-3873 | _na 179_aa | hypothetical protein | |
| 2931 | CAMXVF010000015.1 | GCA947252375_01463 | CDS | open | 4032-4385 | _na 117_aa | hypothetical protein | |
| 2932 | CAMXVF010000015.1 | GCA947252375_01464 | CDS | open | 4718-5119 | _na 133_aa | hypothetical protein | |
| 2933 | CAMXVF010000015.1 | GCA947252375_01465 | CDS | open | 5404-6036 | _na 210_aa | hipB | HTH cro/C1-type domain-containing protein |
| 2934 | CAMXVF010000015.1 | GCA947252375_01466 | CDS | open | 6070-6579 | _na 169_aa | DUF4417 domain-containing protein | |
| 2935 | CAMXVF010000015.1 | GCA947252375_01467 | CDS | open | 6808-7275 | _na 155_aa | Lipoprotein | |
| 2936 | CAMXVF010000015.1 | GCA947252375_01468 | CDS | open | 7473-7652 | _na 59_aa | hypothetical protein | |
| 2937 | CAMXVF010000015.1 | GCA947252375_01469 | CDS | open | 7736-9151 | _na 471_aa | ATPase | |
| 2938 | CAMXVF010000015.1 | GCA947252375_01470 | CDS | open | 9233-9493 | _na 86_aa | hypothetical protein | |
| 2939 | CAMXVF010000015.1 | GCA947252375_01471 | CDS | open | 9623-9748 | _na 41_aa | hypothetical protein | |
| 2940 | CAMXVF010000015.1 | GCA947252375_01472 | CDS | open | 9855-10220 | _na 121_aa | hypothetical protein | |
| 2941 | CAMXVF010000015.1 | GCA947252375_01473 | CDS | open | 10377-10709 | _na 110_aa | hypothetical protein | |
| 2942 | CAMXVF010000015.1 | GCA947252375_01474 | CDS | open | 10736-10951 | _na 71_aa | hypothetical protein | |
| 2943 | CAMXVF010000015.1 | GCA947252375_01475 | CDS | open | 10982-11593 | _na 203_aa | hypothetical protein | |
| 2944 | CAMXVF010000015.1 | GCA947252375_01476 | CDS | open | 11580-12059 | _na 159_aa | hypothetical protein | |
| 2945 | CAMXVF010000015.1 | GCA947252375_01460 | gene | open | 296-1774 | lsa | ||
| 2946 | CAMXVF010000015.1 | GCA947252375_01461 | gene | open | 1890-2765 | |||
| 2947 | CAMXVF010000015.1 | GCA947252375_01462 | gene | open | 3334-3873 | |||
| 2948 | CAMXVF010000015.1 | GCA947252375_01463 | gene | open | 4032-4385 | |||
| 2949 | CAMXVF010000015.1 | GCA947252375_01464 | gene | open | 4718-5119 | |||
| 2950 | CAMXVF010000015.1 | GCA947252375_01465 | gene | open | 5404-6036 | hipB | ||
| 2951 | CAMXVF010000015.1 | GCA947252375_01466 | gene | open | 6070-6579 | |||
| 2952 | CAMXVF010000015.1 | GCA947252375_01467 | gene | open | 6808-7275 | |||
| 2953 | CAMXVF010000015.1 | GCA947252375_01468 | gene | open | 7473-7652 | |||
| 2954 | CAMXVF010000015.1 | GCA947252375_01469 | gene | open | 7736-9151 | |||
| 2955 | CAMXVF010000015.1 | GCA947252375_01470 | gene | open | 9233-9493 | |||
| 2956 | CAMXVF010000015.1 | GCA947252375_01471 | gene | open | 9623-9748 | |||
| 2957 | CAMXVF010000015.1 | GCA947252375_01472 | gene | open | 9855-10220 | |||
| 2958 | CAMXVF010000015.1 | GCA947252375_01473 | gene | open | 10377-10709 | |||
| 2959 | CAMXVF010000015.1 | GCA947252375_01474 | gene | open | 10736-10951 | |||
| 2960 | CAMXVF010000015.1 | GCA947252375_01475 | gene | open | 10982-11593 | |||
| 2961 | CAMXVF010000015.1 | GCA947252375_01476 | gene | open | 11580-12059 | |||
| 2962 | CAMXVF010000016.1 | GCA947252375_01477 | CDS | open | 6-1199 | _na 397_aa | ATPase | |
| 2963 | CAMXVF010000016.1 | GCA947252375_01478 | CDS | open | 1575-2744 | _na 389_aa | hypothetical protein | |
| 2964 | CAMXVF010000016.1 | GCA947252375_01479 | CDS | open | 2802-4151 | _na 449_aa | Isoleucine 2-epimerase | |
| 2965 | CAMXVF010000016.1 | GCA947252375_01480 | CDS | open | 4498-4641 | _na 47_aa | hypothetical protein | |
| 2966 | CAMXVF010000016.1 | GCA947252375_01481 | CDS | open | 5030-5884 | _na 284_aa | Peptidase C-terminal archaeal/bacterial domain-containing protein | |
| 2967 | CAMXVF010000016.1 | GCA947252375_01482 | CDS | open | 5904-6776 | _na 290_aa | hypothetical protein | |
| 2968 | CAMXVF010000016.1 | GCA947252375_01483 | CDS | open | 6993-7172 | _na 59_aa | Transcriptional regulator | |
| 2969 | CAMXVF010000016.1 | GCA947252375_01477 | gene | open | 6-1199 | |||
| 2970 | CAMXVF010000016.1 | GCA947252375_01478 | gene | open | 1575-2744 | |||
| 2971 | CAMXVF010000016.1 | GCA947252375_01479 | gene | open | 2802-4151 | |||
| 2972 | CAMXVF010000016.1 | GCA947252375_01480 | gene | open | 4498-4641 | |||
| 2973 | CAMXVF010000016.1 | GCA947252375_01481 | gene | open | 5030-5884 | |||
| 2974 | CAMXVF010000016.1 | GCA947252375_01482 | gene | open | 5904-6776 | |||
| 2975 | CAMXVF010000016.1 | GCA947252375_01483 | gene | open | 6993-7172 | |||
| 2976 | CAMXVF010000017.1 | GCA947252375_01484 | CDS | open | 40-462 | _na 140_aa | mobC | Plasmid mobilization relaxosome protein MobC |
| 2977 | CAMXVF010000017.1 | GCA947252375_01485 | CDS | open | 1140-1826 | _na 228_aa | hypothetical protein | |
| 2978 | CAMXVF010000017.1 | GCA947252375_01486 | CDS | open | 1826-3769 | _na 647_aa | Eco57I restriction-modification methylase domain-containing protein | |
| 2979 | CAMXVF010000017.1 | GCA947252375_01484 | gene | open | 40-462 | mobC | ||
| 2980 | CAMXVF010000017.1 | GCA947252375_01485 | gene | open | 1140-1826 | |||
| 2981 | CAMXVF010000017.1 | GCA947252375_01486 | gene | open | 1826-3769 |

