BAKTAGenome Explorer: Corynebacterium tuscaniense (GCA_947252405.1)
Select a Genome:
|
BAKTA Annotations for GCA_947252405.1
|
Search & Sort all 4055 Records
| ||||||||||||||||||
Notes: 1- Column headers only sort the current page. 2- Select [NA] or [AA] links to show sequences.
| Region | Protein-ID | Type | Genome Viewer |
Range (bp) |
Show Sequences (length) NA / AA |
BAKTA Gene |
BAKTA GeneProduct |
|
|---|---|---|---|---|---|---|---|---|
| 1501 | CAMXVP010000011.1 | GCA947252405_00745 | gene | open | 36886-37713 | |||
| 1502 | CAMXVP010000011.1 | GCA947252405_00746 | gene | open | 37714-38175 | |||
| 1503 | CAMXVP010000011.1 | GCA947252405_00747 | gene | open | 38228-38722 | |||
| 1504 | CAMXVP010000011.1 | GCA947252405_00748 | gene | open | 38872-40023 | |||
| 1505 | CAMXVP010000011.1 | GCA947252405_00749 | gene | open | 40042-41037 | |||
| 1506 | CAMXVP010000011.1 | GCA947252405_00750 | gene | open | 41041-41958 | |||
| 1507 | CAMXVP010000011.1 | GCA947252405_00751 | gene | open | 41955-43052 | |||
| 1508 | CAMXVP010000011.1 | GCA947252405_00752 | gene | open | 43205-43444 | |||
| 1509 | CAMXVP010000011.1 | GCA947252405_00753 | gene | open | 43394-43933 | |||
| 1510 | CAMXVP010000011.1 | GCA947252405_00754 | gene | open | 44372-46462 | deaD | ||
| 1511 | CAMXVP010000011.1 | GCA947252405_00755 | gene | open | 46554-47036 | |||
| 1512 | CAMXVP010000012.1 | GCA947252405_00756 | CDS | open | 422-1924 | _na 500_aa | gatB | Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB |
| 1513 | CAMXVP010000012.1 | GCA947252405_00757 | CDS | open | 1974-2936 | _na 320_aa | Bile acid:sodium symporter | |
| 1514 | CAMXVP010000012.1 | GCA947252405_00758 | CDS | open | 3040-3978 | _na 312_aa | nadA | quinolinate synthase NadA |
| 1515 | CAMXVP010000012.1 | GCA947252405_00759 | CDS | open | 3983-4831 | _na 282_aa | nadC | carboxylating nicotinate-nucleotide diphosphorylase |
| 1516 | CAMXVP010000012.1 | GCA947252405_00760 | CDS | open | 4828-5412 | _na 194_aa | N-acetyltransferase | |
| 1517 | CAMXVP010000012.1 | GCA947252405_00761 | CDS | open | 5412-6443 | _na 343_aa | ATP-dependent 6-phosphofructokinase | |
| 1518 | CAMXVP010000012.1 | GCA947252405_00762 | CDS | open | 6463-7797 | _na 444_aa | MFS transporter | |
| 1519 | CAMXVP010000012.1 | GCA947252405_00763 | CDS | open | 7781-9262 | _na 493_aa | gatA | Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA |
| 1520 | CAMXVP010000012.1 | GCA947252405_00764 | CDS | open | 9263-9571 | _na 102_aa | gatC | Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC |
| 1521 | CAMXVP010000012.1 | GCA947252405_00765 | CDS | open | 9663-10337 | _na 224_aa | Amino acid-binding ACT domain protein | |
| 1522 | CAMXVP010000012.1 | GCA947252405_00766 | CDS | open | 10434-10958 | _na 174_aa | arsR | ArsR family transcriptional regulator |
| 1523 | CAMXVP010000012.1 | GCA947252405_00767 | CDS | open | 10958-11980 | _na 340_aa | Serine hydrolase | |
| 1524 | CAMXVP010000012.1 | GCA947252405_00768 | CDS | open | 11977-12225 | _na 82_aa | DUF3054 domain-containing protein | |
| 1525 | CAMXVP010000012.1 | GCA947252405_00769 | CDS | open | 12222-14288 | _na 688_aa | ligA | NAD-dependent DNA ligase LigA |
| 1526 | CAMXVP010000012.1 | GCA947252405_00770 | CDS | open | 14305-15066 | _na 253_aa | merR | MerR family transcriptional regulator |
| 1527 | CAMXVP010000012.1 | GCA947252405_00771 | CDS | open | 15107-15817 | _na 236_aa | DNA polymerase III subunit epsilon | |
| 1528 | CAMXVP010000012.1 | GCA947252405_00772 | CDS | open | 15822-16694 | _na 290_aa | Methionine synthase | |
| 1529 | CAMXVP010000012.1 | GCA947252405_00773 | CDS | open | 16691-17782 | _na 363_aa | mnmA | tRNA 2-thiouridine(34) synthase MnmA |
| 1530 | CAMXVP010000012.1 | GCA947252405_00774 | CDS | open | 17907-19040 | _na 377_aa | histidine kinase | |
| 1531 | CAMXVP010000012.1 | GCA947252405_00775 | CDS | open | 19037-19723 | _na 228_aa | DNA-binding response regulator | |
| 1532 | CAMXVP010000012.1 | GCA947252405_00776 | CDS | open | 19807-20724 | _na 305_aa | ABC transporter ATP-binding protein | |
| 1533 | CAMXVP010000012.1 | GCA947252405_00777 | CDS | open | 20721-21467 | _na 248_aa | ABC transporter permease | |
| 1534 | CAMXVP010000012.1 | GCA947252405_00778 | CDS | open | 21473-22222 | _na 249_aa | ABC transporter permease | |
| 1535 | CAMXVP010000012.1 | GCA947252405_00779 | CDS | open | 22234-23019 | _na 261_aa | Transferase | |
| 1536 | CAMXVP010000012.1 | GCA947252405_00780 | CDS | open | 23028-24095 | _na 355_aa | Hydrolase | |
| 1537 | CAMXVP010000012.1 | GCA947252405_00781 | CDS | open | 24155-25288 | _na 377_aa | Cysteine desulfurase | |
| 1538 | CAMXVP010000012.1 | GCA947252405_00782 | CDS | open | 25285-26238 | _na 317_aa | Electron transfer flavoprotein subunit alpha | |
| 1539 | CAMXVP010000012.1 | GCA947252405_00783 | CDS | open | 26252-27037 | _na 261_aa | Electron transfer flavoprotein subunit beta | |
| 1540 | CAMXVP010000012.1 | GCA947252405_00784 | CDS | open | 27079-28305 | _na 408_aa | SAM-dependent methyltransferase | |
| 1541 | CAMXVP010000012.1 | GCA947252405_00785 | CDS | open | 28295-29122 | _na 275_aa | NUDIX hydrolase | |
| 1542 | CAMXVP010000012.1 | GCA947252405_00786 | CDS | open | 29180-30040 | _na 286_aa | Iron ABC transporter ATP-binding protein | |
| 1543 | CAMXVP010000012.1 | GCA947252405_00787 | CDS | open | 30173-32191 | _na 672_aa | Alpha-1%2C4-glucan:maltose-1-phosphate maltosyltransferase | |
| 1544 | CAMXVP010000012.1 | GCA947252405_00788 | CDS | open | 32230-34422 | _na 730_aa | glgB | 1%2C4-alpha-glucan branching protein GlgB |
| 1545 | CAMXVP010000012.1 | GCA947252405_00789 | CDS | open | 34902-35537 | _na 211_aa | HNH nuclease domain-containing protein | |
| 1546 | CAMXVP010000012.1 | GCA947252405_00790 | CDS | open | 35884-36576 | _na 230_aa | nucS | endonuclease NucS |
| 1547 | CAMXVP010000012.1 | GCA947252405_00791 | CDS | open | 36596-37078 | _na 160_aa | DUF2550 domain-containing protein | |
| 1548 | CAMXVP010000012.1 | GCA947252405_00792 | CDS | open | 37210-37572 | _na 120_aa | F0F1 ATP synthase subunit epsilon | |
| 1549 | CAMXVP010000012.1 | GCA947252405_00793 | CDS | open | 37582-39108 | _na 508_aa | atpD | F0F1 ATP synthase subunit beta |
| 1550 | CAMXVP010000012.1 | GCA947252405_00794 | CDS | open | 39112-40086 | _na 324_aa | F0F1 ATP synthase subunit gamma | |
| 1551 | CAMXVP010000012.1 | GCA947252405_00795 | CDS | open | 40160-41026 | _na 288_aa | hypothetical protein | |
| 1552 | CAMXVP010000012.1 | GCA947252405_00756 | gene | open | 422-1924 | gatB | ||
| 1553 | CAMXVP010000012.1 | GCA947252405_00757 | gene | open | 1974-2936 | |||
| 1554 | CAMXVP010000012.1 | GCA947252405_00758 | gene | open | 3040-3978 | nadA | ||
| 1555 | CAMXVP010000012.1 | GCA947252405_00759 | gene | open | 3983-4831 | nadC | ||
| 1556 | CAMXVP010000012.1 | GCA947252405_00760 | gene | open | 4828-5412 | |||
| 1557 | CAMXVP010000012.1 | GCA947252405_00761 | gene | open | 5412-6443 | |||
| 1558 | CAMXVP010000012.1 | GCA947252405_00762 | gene | open | 6463-7797 | |||
| 1559 | CAMXVP010000012.1 | GCA947252405_00763 | gene | open | 7781-9262 | gatA | ||
| 1560 | CAMXVP010000012.1 | GCA947252405_00764 | gene | open | 9263-9571 | gatC | ||
| 1561 | CAMXVP010000012.1 | GCA947252405_00765 | gene | open | 9663-10337 | |||
| 1562 | CAMXVP010000012.1 | GCA947252405_00766 | gene | open | 10434-10958 | arsR | ||
| 1563 | CAMXVP010000012.1 | GCA947252405_00767 | gene | open | 10958-11980 | |||
| 1564 | CAMXVP010000012.1 | GCA947252405_00768 | gene | open | 11977-12225 | |||
| 1565 | CAMXVP010000012.1 | GCA947252405_00769 | gene | open | 12222-14288 | ligA | ||
| 1566 | CAMXVP010000012.1 | GCA947252405_00770 | gene | open | 14305-15066 | merR | ||
| 1567 | CAMXVP010000012.1 | GCA947252405_00771 | gene | open | 15107-15817 | |||
| 1568 | CAMXVP010000012.1 | GCA947252405_00772 | gene | open | 15822-16694 | |||
| 1569 | CAMXVP010000012.1 | GCA947252405_00773 | gene | open | 16691-17782 | mnmA | ||
| 1570 | CAMXVP010000012.1 | GCA947252405_00774 | gene | open | 17907-19040 | |||
| 1571 | CAMXVP010000012.1 | GCA947252405_00775 | gene | open | 19037-19723 | |||
| 1572 | CAMXVP010000012.1 | GCA947252405_00776 | gene | open | 19807-20724 | |||
| 1573 | CAMXVP010000012.1 | GCA947252405_00777 | gene | open | 20721-21467 | |||
| 1574 | CAMXVP010000012.1 | GCA947252405_00778 | gene | open | 21473-22222 | |||
| 1575 | CAMXVP010000012.1 | GCA947252405_00779 | gene | open | 22234-23019 | |||
| 1576 | CAMXVP010000012.1 | GCA947252405_00780 | gene | open | 23028-24095 | |||
| 1577 | CAMXVP010000012.1 | GCA947252405_00781 | gene | open | 24155-25288 | |||
| 1578 | CAMXVP010000012.1 | GCA947252405_00782 | gene | open | 25285-26238 | |||
| 1579 | CAMXVP010000012.1 | GCA947252405_00783 | gene | open | 26252-27037 | |||
| 1580 | CAMXVP010000012.1 | GCA947252405_00784 | gene | open | 27079-28305 | |||
| 1581 | CAMXVP010000012.1 | GCA947252405_00785 | gene | open | 28295-29122 | |||
| 1582 | CAMXVP010000012.1 | GCA947252405_00786 | gene | open | 29180-30040 | |||
| 1583 | CAMXVP010000012.1 | GCA947252405_00787 | gene | open | 30173-32191 | |||
| 1584 | CAMXVP010000012.1 | GCA947252405_00788 | gene | open | 32230-34422 | glgB | ||
| 1585 | CAMXVP010000012.1 | GCA947252405_00789 | gene | open | 34902-35537 | |||
| 1586 | CAMXVP010000012.1 | GCA947252405_00790 | gene | open | 35884-36576 | nucS | ||
| 1587 | CAMXVP010000012.1 | GCA947252405_00791 | gene | open | 36596-37078 | |||
| 1588 | CAMXVP010000012.1 | GCA947252405_00792 | gene | open | 37210-37572 | |||
| 1589 | CAMXVP010000012.1 | GCA947252405_00793 | gene | open | 37582-39108 | atpD | ||
| 1590 | CAMXVP010000012.1 | GCA947252405_00794 | gene | open | 39112-40086 | |||
| 1591 | CAMXVP010000012.1 | GCA947252405_00795 | gene | open | 40160-41026 | |||
| 1592 | CAMXVP010000013.1 | GCA947252405_00796 | CDS | open | 734-1405 | _na 223_aa | DNA-binding response regulator | |
| 1593 | CAMXVP010000013.1 | GCA947252405_00797 | CDS | open | 1416-2558 | _na 380_aa | ATP-binding protein | |
| 1594 | CAMXVP010000013.1 | GCA947252405_00798 | CDS | open | 2670-3746 | _na 358_aa | pspC | PspC domain-containing protein |
| 1595 | CAMXVP010000013.1 | GCA947252405_00799 | CDS | open | 3758-5329 | _na 523_aa | guaA | glutamine-hydrolyzing GMP synthase |
| 1596 | CAMXVP010000013.1 | GCA947252405_00800 | CDS | open | 5372-6247 | _na 291_aa | eamA | EamA family transporter |
| 1597 | CAMXVP010000013.1 | GCA947252405_00801 | CDS | open | 6258-6968 | _na 236_aa | Diphtheria toxin repressor | |
| 1598 | CAMXVP010000013.1 | GCA947252405_00802 | CDS | open | 6896-7810 | _na 304_aa | Metal ABC transporter permease | |
| 1599 | CAMXVP010000013.1 | GCA947252405_00803 | CDS | open | 7807-8541 | _na 244_aa | ABC transporter | |
| 1600 | CAMXVP010000013.1 | GCA947252405_00804 | CDS | open | 8546-9463 | _na 305_aa | Metal ABC transporter substrate-binding protein | |
| 1601 | CAMXVP010000013.1 | GCA947252405_00805 | CDS | open | 9626-10840 | _na 404_aa | guaB3 | GuaB3 family IMP dehydrogenase-related protein |
| 1602 | CAMXVP010000013.1 | GCA947252405_00806 | CDS | open | 10843-12390 | _na 515_aa | guaB | IMP dehydrogenase |
| 1603 | CAMXVP010000013.1 | GCA947252405_00807 | CDS | open | 12519-12890 | _na 123_aa | DUF5319 domain-containing protein | |
| 1604 | CAMXVP010000013.1 | GCA947252405_00808 | CDS | open | 12898-13680 | _na 260_aa | rsdA | Anti-sigma-D factor RsdA sigma factor binding region domain-containing protein |
| 1605 | CAMXVP010000013.1 | GCA947252405_00809 | CDS | open | 13683-14258 | _na 191_aa | RNA polymerase subunit sigma | |
| 1606 | CAMXVP010000013.1 | GCA947252405_00810 | CDS | open | 14599-14898 | _na 99_aa | whiB | Transcriptional regulator WhiB |
| 1607 | CAMXVP010000013.1 | GCA947252405_00811 | CDS | open | 15038-16138 | _na 366_aa | HNH endonuclease | |
| 1608 | CAMXVP010000013.1 | GCA947252405_00812 | CDS | open | 16190-17791 | _na 533_aa | groL | chaperonin GroEL |
| 1609 | CAMXVP010000013.1 | GCA947252405_00813 | CDS | open | 17811-18143 | _na 110_aa | groES | co-chaperone GroES |
| 1610 | CAMXVP010000013.1 | GCA947252405_00814 | CDS | open | 18268-18714 | _na 148_aa | hypothetical protein | |
| 1611 | CAMXVP010000013.1 | GCA947252405_00815 | CDS | open | 18797-19846 | _na 349_aa | tsaD | tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD |
| 1612 | CAMXVP010000013.1 | GCA947252405_00816 | CDS | open | 19843-20343 | _na 166_aa | rimI | ribosomal protein S18-alanine N-acetyltransferase |
| 1613 | CAMXVP010000013.1 | GCA947252405_00817 | CDS | open | 20348-21034 | _na 228_aa | tsaB | tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB |
| 1614 | CAMXVP010000013.1 | GCA947252405_00818 | CDS | open | 21047-21571 | _na 174_aa | Secreted protein | |
| 1615 | CAMXVP010000013.1 | GCA947252405_00819 | CDS | open | 21582-22079 | _na 165_aa | tsaE | tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE |
| 1616 | CAMXVP010000013.1 | GCA947252405_00820 | CDS | open | 22063-23190 | _na 375_aa | alr | alanine racemase |
| 1617 | CAMXVP010000013.1 | GCA947252405_00821 | CDS | open | 23209-23856 | _na 215_aa | GAP family protein | |
| 1618 | CAMXVP010000013.1 | GCA947252405_00822 | CDS | open | 23856-25718 | _na 620_aa | glmS | glutamine--fructose-6-phosphate transaminase (isomerizing) |
| 1619 | CAMXVP010000013.1 | GCA947252405_00823 | CDS | open | 25736-26638 | _na 300_aa | Alpha/beta hydrolase | |
| 1620 | CAMXVP010000013.1 | GCA947252405_00824 | CDS | open | 26647-26892 | _na 81_aa | hypothetical protein | |
| 1621 | CAMXVP010000013.1 | GCA947252405_00825 | CDS | open | 26892-27716 | _na 274_aa | ESX-1 secretion-associated protein EspA/EspE-like domain-containing protein | |
| 1622 | CAMXVP010000013.1 | GCA947252405_00826 | CDS | open | 27709-28011 | _na 100_aa | PE domain-containing protein | |
| 1623 | CAMXVP010000013.1 | GCA947252405_00827 | CDS | open | 28136-29479 | _na 447_aa | glmM | phosphoglucosamine mutase |
| 1624 | CAMXVP010000013.1 | GCA947252405_00828 | CDS | open | 29610-30164 | _na 184_aa | rpsI | 30S ribosomal protein S9 |
| 1625 | CAMXVP010000013.1 | GCA947252405_00829 | CDS | open | 30164-30607 | _na 147_aa | rplM | 50S ribosomal protein L13 |
| 1626 | CAMXVP010000013.1 | GCA947252405_00830 | CDS | open | 30957-31244 | _na 95_aa | ESAT-6-like protein | |
| 1627 | CAMXVP010000013.1 | GCA947252405_00831 | CDS | open | 31283-31603 | _na 106_aa | ESAT-6-like protein | |
| 1628 | CAMXVP010000013.1 | GCA947252405_00832 | CDS | open | 31768-32685 | _na 305_aa | Type VII secretion-associated protein | |
| 1629 | CAMXVP010000013.1 | GCA947252405_00833 | CDS | open | 32682-36287 | _na 1201_aa | eccC | Type VII secretion protein EccC |
| 1630 | CAMXVP010000013.1 | GCA947252405_00834 | CDS | open | 36505-37854 | _na 449_aa | eccD | type VII secretion integral membrane protein EccD |
| 1631 | CAMXVP010000013.1 | GCA947252405_00835 | CDS | open | 37857-39089 | _na 410_aa | Peptidase S8 | |
| 1632 | CAMXVP010000013.1 | GCA947252405_00836 | CDS | open | 39025-40185 | _na 386_aa | eccB | type VII secretion protein EccB |
| 1633 | CAMXVP010000013.1 | GCA947252405_00796 | gene | open | 734-1405 | |||
| 1634 | CAMXVP010000013.1 | GCA947252405_00797 | gene | open | 1416-2558 | |||
| 1635 | CAMXVP010000013.1 | GCA947252405_00798 | gene | open | 2670-3746 | pspC | ||
| 1636 | CAMXVP010000013.1 | GCA947252405_00799 | gene | open | 3758-5329 | guaA | ||
| 1637 | CAMXVP010000013.1 | GCA947252405_00800 | gene | open | 5372-6247 | eamA | ||
| 1638 | CAMXVP010000013.1 | GCA947252405_00801 | gene | open | 6258-6968 | |||
| 1639 | CAMXVP010000013.1 | GCA947252405_00802 | gene | open | 6896-7810 | |||
| 1640 | CAMXVP010000013.1 | GCA947252405_00803 | gene | open | 7807-8541 | |||
| 1641 | CAMXVP010000013.1 | GCA947252405_00804 | gene | open | 8546-9463 | |||
| 1642 | CAMXVP010000013.1 | GCA947252405_00805 | gene | open | 9626-10840 | guaB3 | ||
| 1643 | CAMXVP010000013.1 | GCA947252405_00806 | gene | open | 10843-12390 | guaB | ||
| 1644 | CAMXVP010000013.1 | GCA947252405_00807 | gene | open | 12519-12890 | |||
| 1645 | CAMXVP010000013.1 | GCA947252405_00808 | gene | open | 12898-13680 | rsdA | ||
| 1646 | CAMXVP010000013.1 | GCA947252405_00809 | gene | open | 13683-14258 | |||
| 1647 | CAMXVP010000013.1 | GCA947252405_00810 | gene | open | 14599-14898 | whiB | ||
| 1648 | CAMXVP010000013.1 | GCA947252405_00811 | gene | open | 15038-16138 | |||
| 1649 | CAMXVP010000013.1 | GCA947252405_00812 | gene | open | 16190-17791 | groL | ||
| 1650 | CAMXVP010000013.1 | GCA947252405_00813 | gene | open | 17811-18143 | groES | ||
| 1651 | CAMXVP010000013.1 | GCA947252405_00814 | gene | open | 18268-18714 | |||
| 1652 | CAMXVP010000013.1 | GCA947252405_00815 | gene | open | 18797-19846 | tsaD | ||
| 1653 | CAMXVP010000013.1 | GCA947252405_00816 | gene | open | 19843-20343 | rimI | ||
| 1654 | CAMXVP010000013.1 | GCA947252405_00817 | gene | open | 20348-21034 | tsaB | ||
| 1655 | CAMXVP010000013.1 | GCA947252405_00818 | gene | open | 21047-21571 | |||
| 1656 | CAMXVP010000013.1 | GCA947252405_00819 | gene | open | 21582-22079 | tsaE | ||
| 1657 | CAMXVP010000013.1 | GCA947252405_00820 | gene | open | 22063-23190 | alr | ||
| 1658 | CAMXVP010000013.1 | GCA947252405_00821 | gene | open | 23209-23856 | |||
| 1659 | CAMXVP010000013.1 | GCA947252405_00822 | gene | open | 23856-25718 | glmS | ||
| 1660 | CAMXVP010000013.1 | GCA947252405_00823 | gene | open | 25736-26638 | |||
| 1661 | CAMXVP010000013.1 | GCA947252405_00824 | gene | open | 26647-26892 | |||
| 1662 | CAMXVP010000013.1 | GCA947252405_00825 | gene | open | 26892-27716 | |||
| 1663 | CAMXVP010000013.1 | GCA947252405_00826 | gene | open | 27709-28011 | |||
| 1664 | CAMXVP010000013.1 | GCA947252405_00827 | gene | open | 28136-29479 | glmM | ||
| 1665 | CAMXVP010000013.1 | GCA947252405_00828 | gene | open | 29610-30164 | rpsI | ||
| 1666 | CAMXVP010000013.1 | GCA947252405_00829 | gene | open | 30164-30607 | rplM | ||
| 1667 | CAMXVP010000013.1 | GCA947252405_00830 | gene | open | 30957-31244 | |||
| 1668 | CAMXVP010000013.1 | GCA947252405_00831 | gene | open | 31283-31603 | |||
| 1669 | CAMXVP010000013.1 | GCA947252405_00832 | gene | open | 31768-32685 | |||
| 1670 | CAMXVP010000013.1 | GCA947252405_00833 | gene | open | 32682-36287 | eccC | ||
| 1671 | CAMXVP010000013.1 | GCA947252405_00834 | gene | open | 36505-37854 | eccD | ||
| 1672 | CAMXVP010000013.1 | GCA947252405_00835 | gene | open | 37857-39089 | |||
| 1673 | CAMXVP010000013.1 | GCA947252405_00836 | gene | open | 39025-40185 | eccB | ||
| 1674 | CAMXVP010000014.1 | repeat_region | open | 25750-25909 | CRISPR array with 3 repeats of length 31%2C consensus sequence GTGGTGCTCCCCGCGGGAGCGGGGATGAGCC and spacer length 30 | |||
| 1675 | CAMXVP010000014.1 | GCA947252405_00837 | CDS | open | 1483-3606 | _na 707_aa | fusA | elongation factor G |
| 1676 | CAMXVP010000014.1 | GCA947252405_00838 | CDS | open | 3780-4247 | _na 155_aa | rpsG | 30S ribosomal protein S7 |
| 1677 | CAMXVP010000014.1 | GCA947252405_00839 | CDS | open | 4254-4625 | _na 123_aa | rpsL | 30S ribosomal protein S12 |
| 1678 | CAMXVP010000014.1 | GCA947252405_00840 | CDS | open | 4688-5188 | _na 166_aa | hypothetical protein | |
| 1679 | CAMXVP010000014.1 | GCA947252405_00841 | CDS | open | 5401-13425 | _na 2674_aa | Gram-positive cocci surface proteins LPxTG domain-containing protein | |
| 1680 | CAMXVP010000014.1 | GCA947252405_00842 | CDS | open | 13422-13712 | _na 96_aa | hypothetical protein | |
| 1681 | CAMXVP010000014.1 | GCA947252405_00843 | CDS | open | 13699-14649 | _na 316_aa | Class C sortase | |
| 1682 | CAMXVP010000014.1 | GCA947252405_00844 | CDS | open | 14671-16287 | _na 538_aa | hypothetical protein | |
| 1683 | CAMXVP010000014.1 | GCA947252405_00845 | CDS | open | 16595-20605 | _na 1336_aa | DNA-directed RNA polymerase subunit beta' | |
| 1684 | CAMXVP010000014.1 | GCA947252405_00846 | CDS | open | 20692-24171 | _na 1159_aa | DNA-directed RNA polymerase subunit beta | |
| 1685 | CAMXVP010000014.1 | GCA947252405_00847 | CDS | open | 24495-25460 | _na 321_aa | DUF3068 domain-containing protein | |
| 1686 | CAMXVP010000014.1 | GCA947252405_00848 | CDS | open | 26235-26543 | _na 102_aa | hypothetical protein | |
| 1687 | CAMXVP010000014.1 | GCA947252405_00849 | CDS | open | 26938-27327 | _na 129_aa | rplL | 50S ribosomal protein L7/L12 |
| 1688 | CAMXVP010000014.1 | GCA947252405_00850 | CDS | open | 27392-27916 | _na 174_aa | rplJ | 50S ribosomal protein L10 |
| 1689 | CAMXVP010000014.1 | GCA947252405_00851 | CDS | open | 28177-30501 | _na 774_aa | ABC transporter permease | |
| 1690 | CAMXVP010000014.1 | GCA947252405_00852 | CDS | open | 30482-31387 | _na 301_aa | anchored repeat-type ABC transporter permease subunit | |
| 1691 | CAMXVP010000014.1 | GCA947252405_00853 | CDS | open | 31380-32159 | _na 259_aa | anchored repeat-type ABC transporter ATP-binding subunit | |
| 1692 | CAMXVP010000014.1 | GCA947252405_00854 | CDS | open | 32159-33109 | _na 316_aa | Peptidase | |
| 1693 | CAMXVP010000014.1 | GCA947252405_00855 | CDS | open | 33106-34719 | _na 537_aa | anchored repeat ABC transporter%2C substrate-binding protein | |
| 1694 | CAMXVP010000014.1 | GCA947252405_00856 | CDS | open | 34716-36251 | _na 511_aa | Cell surface protein | |
| 1695 | CAMXVP010000014.1 | GCA947252405_00857 | CDS | open | 36521-37231 | _na 236_aa | rplA | 50S ribosomal protein L1 |
| 1696 | CAMXVP010000014.1 | GCA947252405_00858 | CDS | open | 37344-37772 | _na 142_aa | rplK | 50S ribosomal protein L11 |
| 1697 | CAMXVP010000014.1 | GCA947252405_00859 | CDS | open | 37986-38798 | _na 270_aa | nusG | transcription termination/antitermination protein NusG |
| 1698 | CAMXVP010000014.1 | GCA947252405_00860 | CDS | open | 38943-39266 | _na 107_aa | secE | preprotein translocase subunit SecE |
| 1699 | CAMXVP010000014.1 | GCA947252405_00837 | gene | open | 1483-3606 | fusA | ||
| 1700 | CAMXVP010000014.1 | GCA947252405_00838 | gene | open | 3780-4247 | rpsG | ||
| 1701 | CAMXVP010000014.1 | GCA947252405_00839 | gene | open | 4254-4625 | rpsL | ||
| 1702 | CAMXVP010000014.1 | GCA947252405_00840 | gene | open | 4688-5188 | |||
| 1703 | CAMXVP010000014.1 | GCA947252405_00841 | gene | open | 5401-13425 | |||
| 1704 | CAMXVP010000014.1 | GCA947252405_00842 | gene | open | 13422-13712 | |||
| 1705 | CAMXVP010000014.1 | GCA947252405_00843 | gene | open | 13699-14649 | |||
| 1706 | CAMXVP010000014.1 | GCA947252405_00844 | gene | open | 14671-16287 | |||
| 1707 | CAMXVP010000014.1 | GCA947252405_00845 | gene | open | 16595-20605 | |||
| 1708 | CAMXVP010000014.1 | GCA947252405_00846 | gene | open | 20692-24171 | |||
| 1709 | CAMXVP010000014.1 | GCA947252405_00847 | gene | open | 24495-25460 | |||
| 1710 | CAMXVP010000014.1 | GCA947252405_00848 | gene | open | 26235-26543 | |||
| 1711 | CAMXVP010000014.1 | GCA947252405_00849 | gene | open | 26938-27327 | rplL | ||
| 1712 | CAMXVP010000014.1 | GCA947252405_00850 | gene | open | 27392-27916 | rplJ | ||
| 1713 | CAMXVP010000014.1 | GCA947252405_00851 | gene | open | 28177-30501 | |||
| 1714 | CAMXVP010000014.1 | GCA947252405_00852 | gene | open | 30482-31387 | |||
| 1715 | CAMXVP010000014.1 | GCA947252405_00853 | gene | open | 31380-32159 | |||
| 1716 | CAMXVP010000014.1 | GCA947252405_00854 | gene | open | 32159-33109 | |||
| 1717 | CAMXVP010000014.1 | GCA947252405_00855 | gene | open | 33106-34719 | |||
| 1718 | CAMXVP010000014.1 | GCA947252405_00856 | gene | open | 34716-36251 | |||
| 1719 | CAMXVP010000014.1 | GCA947252405_00857 | gene | open | 36521-37231 | rplA | ||
| 1720 | CAMXVP010000014.1 | GCA947252405_00858 | gene | open | 37344-37772 | rplK | ||
| 1721 | CAMXVP010000014.1 | GCA947252405_00859 | gene | open | 37986-38798 | nusG | ||
| 1722 | CAMXVP010000014.1 | GCA947252405_00860 | gene | open | 38943-39266 | secE | ||
| 1723 | CAMXVP010000014.1 | GCA947252405_00861 | gene | open | 39291-39345 | |||
| 1724 | CAMXVP010000014.1 | GCA947252405_00861 | tRNA | open | 39291-39345 | tRNA-Xxx | ||
| 1725 | CAMXVP010000015.1 | GCA947252405_00862 | CDS | open | 52-2058 | _na 668_aa | prolyl oligopeptidase family protein | |
| 1726 | CAMXVP010000015.1 | GCA947252405_00863 | CDS | open | 2133-2762 | _na 209_aa | Copper chaperone PCu(A)C | |
| 1727 | CAMXVP010000015.1 | GCA947252405_00864 | CDS | open | 2789-4078 | _na 429_aa | Peroxidase | |
| 1728 | CAMXVP010000015.1 | GCA947252405_00865 | CDS | open | 4277-5221 | _na 314_aa | DUF559 domain-containing protein | |
| 1729 | CAMXVP010000015.1 | GCA947252405_00866 | CDS | open | 5377-6378 | _na 333_aa | rfbB | dTDP-glucose 4%2C6-dehydratase |
| 1730 | CAMXVP010000015.1 | GCA947252405_00867 | CDS | open | 6423-7568 | _na 381_aa | bifunctional 2-methylcitrate synthase/citrate synthase | |
| 1731 | CAMXVP010000015.1 | GCA947252405_00868 | CDS | open | 7588-9099 | _na 503_aa | prpD | 2-methylcitrate dehydratase PrpD |
| 1732 | CAMXVP010000015.1 | GCA947252405_00869 | CDS | open | 9203-10552 | _na 449_aa | dTDP-4-dehydrorhamnose reductase | |
| 1733 | CAMXVP010000015.1 | GCA947252405_00870 | CDS | open | 10580-11443 | _na 287_aa | rfbA | glucose-1-phosphate thymidylyltransferase RfbA |
| 1734 | CAMXVP010000015.1 | GCA947252405_00871 | CDS | open | 11504-12367 | _na 287_aa | Thioredoxin domain-containing protein | |
| 1735 | CAMXVP010000015.1 | GCA947252405_00872 | CDS | open | 12459-12914 | _na 151_aa | Tetrameric acyl-CoA thioesterase | |
| 1736 | CAMXVP010000015.1 | GCA947252405_00874 | CDS | open | 13093-14325 | _na 410_aa | DNA polymerase III subunit delta' | |
| 1737 | CAMXVP010000015.1 | GCA947252405_00875 | CDS | open | 14376-15893 | _na 505_aa | Adenylate/guanylate cyclase domain-containing protein | |
| 1738 | CAMXVP010000015.1 | GCA947252405_00876 | CDS | open | 15890-18814 | _na 974_aa | topA | type I DNA topoisomerase |
| 1739 | CAMXVP010000015.1 | GCA947252405_00877 | CDS | open | 19045-19680 | _na 211_aa | dedA | DedA family protein |
| 1740 | CAMXVP010000015.1 | GCA947252405_00878 | CDS | open | 19738-20043 | _na 101_aa | cspA | Cold-shock protein CspA |
| 1741 | CAMXVP010000015.1 | GCA947252405_00879 | CDS | open | 20126-22531 | _na 801_aa | DEAD/DEAH box helicase | |
| 1742 | CAMXVP010000015.1 | GCA947252405_00880 | CDS | open | 22528-22854 | _na 108_aa | TadE-like protein | |
| 1743 | CAMXVP010000015.1 | GCA947252405_00881 | CDS | open | 22851-23174 | _na 107_aa | Secreted protein | |
| 1744 | CAMXVP010000015.1 | GCA947252405_00882 | CDS | open | 23149-23403 | _na 84_aa | DUF4244 domain-containing protein | |
| 1745 | CAMXVP010000015.1 | GCA947252405_00883 | CDS | open | 23469-24101 | _na 210_aa | Type II secretion protein F | |
| 1746 | CAMXVP010000015.1 | GCA947252405_00884 | CDS | open | 24098-24871 | _na 257_aa | gspF | Type II secretion system protein GspF domain-containing protein |
| 1747 | CAMXVP010000015.1 | GCA947252405_00885 | CDS | open | 24868-26031 | _na 387_aa | ATPase | |
| 1748 | CAMXVP010000015.1 | GCA947252405_00886 | CDS | open | 26031-27158 | _na 375_aa | Septum formation initiator | |
| 1749 | CAMXVP010000015.1 | GCA947252405_00887 | CDS | open | 27625-28419 | _na 264_aa | HAD family phosphatase | |
| 1750 | CAMXVP010000015.1 | GCA947252405_00888 | CDS | open | 28605-29129 | _na 174_aa | Phage holin family protein | |
| 1751 | CAMXVP010000015.1 | GCA947252405_00889 | CDS | open | 29234-30187 | _na 317_aa | Alpha/beta hydrolase | |
| 1752 | CAMXVP010000015.1 | GCA947252405_00890 | CDS | open | 30200-31390 | _na 396_aa | marP | MarP family serine protease |
| 1753 | CAMXVP010000015.1 | GCA947252405_00891 | CDS | open | 31391-32104 | _na 237_aa | CoA pyrophosphatase | |
| 1754 | CAMXVP010000015.1 | GCA947252405_00892 | CDS | open | 32104-32709 | _na 201_aa | tlpA | TlpA family protein disulfide reductase |
| 1755 | CAMXVP010000015.1 | GCA947252405_00893 | CDS | open | 32706-33563 | _na 285_aa | nth | endonuclease III |
| 1756 | CAMXVP010000015.1 | GCA947252405_00894 | CDS | open | 33911-34594 | _na 227_aa | Cyclic nucleotide-binding domain protein | |
| 1757 | CAMXVP010000015.1 | GCA947252405_00895 | CDS | open | 34766-35587 | _na 273_aa | MBL fold metallo-hydrolase | |
| 1758 | CAMXVP010000015.1 | GCA947252405_00896 | CDS | open | 35635-36090 | _na 151_aa | ridA | RidA family protein |
| 1759 | CAMXVP010000015.1 | GCA947252405_00897 | CDS | open | 36094-36303 | _na 69_aa | DUF4177 domain-containing protein | |
| 1760 | CAMXVP010000015.1 | GCA947252405_00898 | CDS | open | 36380-37078 | _na 232_aa | Exonuclease domain-containing protein | |
| 1761 | CAMXVP010000015.1 | GCA947252405_00899 | CDS | open | 37088-37507 | _na 139_aa | whiB | WhiB family transcriptional regulator |
| 1762 | CAMXVP010000015.1 | GCA947252405_00900 | CDS | open | 37698-38135 | _na 145_aa | hypothetical protein | |
| 1763 | CAMXVP010000015.1 | GCA947252405_00901 | CDS | open | 38238-38672 | _na 144_aa | hypothetical protein | |
| 1764 | CAMXVP010000015.1 | GCA947252405_00862 | gene | open | 52-2058 | |||
| 1765 | CAMXVP010000015.1 | GCA947252405_00863 | gene | open | 2133-2762 | |||
| 1766 | CAMXVP010000015.1 | GCA947252405_00864 | gene | open | 2789-4078 | |||
| 1767 | CAMXVP010000015.1 | GCA947252405_00865 | gene | open | 4277-5221 | |||
| 1768 | CAMXVP010000015.1 | GCA947252405_00866 | gene | open | 5377-6378 | rfbB | ||
| 1769 | CAMXVP010000015.1 | GCA947252405_00867 | gene | open | 6423-7568 | |||
| 1770 | CAMXVP010000015.1 | GCA947252405_00868 | gene | open | 7588-9099 | prpD | ||
| 1771 | CAMXVP010000015.1 | GCA947252405_00869 | gene | open | 9203-10552 | |||
| 1772 | CAMXVP010000015.1 | GCA947252405_00870 | gene | open | 10580-11443 | rfbA | ||
| 1773 | CAMXVP010000015.1 | GCA947252405_00871 | gene | open | 11504-12367 | |||
| 1774 | CAMXVP010000015.1 | GCA947252405_00872 | gene | open | 12459-12914 | |||
| 1775 | CAMXVP010000015.1 | GCA947252405_00874 | gene | open | 13093-14325 | |||
| 1776 | CAMXVP010000015.1 | GCA947252405_00875 | gene | open | 14376-15893 | |||
| 1777 | CAMXVP010000015.1 | GCA947252405_00876 | gene | open | 15890-18814 | topA | ||
| 1778 | CAMXVP010000015.1 | GCA947252405_00877 | gene | open | 19045-19680 | dedA | ||
| 1779 | CAMXVP010000015.1 | GCA947252405_00878 | gene | open | 19738-20043 | cspA | ||
| 1780 | CAMXVP010000015.1 | GCA947252405_00879 | gene | open | 20126-22531 | |||
| 1781 | CAMXVP010000015.1 | GCA947252405_00880 | gene | open | 22528-22854 | |||
| 1782 | CAMXVP010000015.1 | GCA947252405_00881 | gene | open | 22851-23174 | |||
| 1783 | CAMXVP010000015.1 | GCA947252405_00882 | gene | open | 23149-23403 | |||
| 1784 | CAMXVP010000015.1 | GCA947252405_00883 | gene | open | 23469-24101 | |||
| 1785 | CAMXVP010000015.1 | GCA947252405_00884 | gene | open | 24098-24871 | gspF | ||
| 1786 | CAMXVP010000015.1 | GCA947252405_00885 | gene | open | 24868-26031 | |||
| 1787 | CAMXVP010000015.1 | GCA947252405_00886 | gene | open | 26031-27158 | |||
| 1788 | CAMXVP010000015.1 | GCA947252405_00887 | gene | open | 27625-28419 | |||
| 1789 | CAMXVP010000015.1 | GCA947252405_00888 | gene | open | 28605-29129 | |||
| 1790 | CAMXVP010000015.1 | GCA947252405_00889 | gene | open | 29234-30187 | |||
| 1791 | CAMXVP010000015.1 | GCA947252405_00890 | gene | open | 30200-31390 | marP | ||
| 1792 | CAMXVP010000015.1 | GCA947252405_00891 | gene | open | 31391-32104 | |||
| 1793 | CAMXVP010000015.1 | GCA947252405_00892 | gene | open | 32104-32709 | tlpA | ||
| 1794 | CAMXVP010000015.1 | GCA947252405_00893 | gene | open | 32706-33563 | nth | ||
| 1795 | CAMXVP010000015.1 | GCA947252405_00894 | gene | open | 33911-34594 | |||
| 1796 | CAMXVP010000015.1 | GCA947252405_00895 | gene | open | 34766-35587 | |||
| 1797 | CAMXVP010000015.1 | GCA947252405_00896 | gene | open | 35635-36090 | ridA | ||
| 1798 | CAMXVP010000015.1 | GCA947252405_00897 | gene | open | 36094-36303 | |||
| 1799 | CAMXVP010000015.1 | GCA947252405_00898 | gene | open | 36380-37078 | |||
| 1800 | CAMXVP010000015.1 | GCA947252405_00899 | gene | open | 37088-37507 | whiB | ||
| 1801 | CAMXVP010000015.1 | GCA947252405_00900 | gene | open | 37698-38135 | |||
| 1802 | CAMXVP010000015.1 | GCA947252405_00901 | gene | open | 38238-38672 | |||
| 1803 | CAMXVP010000015.1 | GCA947252405_00873 | gene | open | 12948-13023 | trnT | ||
| 1804 | CAMXVP010000015.1 | GCA947252405_00873 | tRNA | open | 12948-13023 | trnT | tRNA-Thr(cgt) | |
| 1805 | CAMXVP010000016.1 | GCA947252405_00902 | CDS | open | 1-321 | _na 106_aa | hypothetical protein | |
| 1806 | CAMXVP010000016.1 | GCA947252405_00903 | CDS | open | 331-1170 | _na 279_aa | Serine hydrolase | |
| 1807 | CAMXVP010000016.1 | GCA947252405_00904 | CDS | open | 1177-1980 | _na 267_aa | Glyoxalase | |
| 1808 | CAMXVP010000016.1 | GCA947252405_00905 | CDS | open | 1984-2229 | _na 81_aa | RNA-binding protein | |
| 1809 | CAMXVP010000016.1 | GCA947252405_00906 | CDS | open | 2229-2549 | _na 106_aa | UPF0145 protein CJ203_04255 | |
| 1810 | CAMXVP010000016.1 | GCA947252405_00907 | CDS | open | 2546-3208 | _na 220_aa | lysE | LysE family translocator |
| 1811 | CAMXVP010000016.1 | GCA947252405_00908 | CDS | open | 3232-3945 | _na 237_aa | SDR family oxidoreductase | |
| 1812 | CAMXVP010000016.1 | GCA947252405_00909 | CDS | open | 3970-4758 | _na 262_aa | hypothetical protein | |
| 1813 | CAMXVP010000016.1 | GCA947252405_00910 | CDS | open | 4850-7102 | _na 750_aa | hrpB | ATP-dependent helicase HrpB |
| 1814 | CAMXVP010000016.1 | GCA947252405_00911 | CDS | open | 7106-7420 | _na 104_aa | higA | HigA family addiction module antitoxin |
| 1815 | CAMXVP010000016.1 | GCA947252405_00912 | CDS | open | 7519-9024 | _na 501_aa | Lysine transporter | |
| 1816 | CAMXVP010000016.1 | GCA947252405_00913 | CDS | open | 9046-9786 | _na 246_aa | putative membrane transporter protein | |
| 1817 | CAMXVP010000016.1 | GCA947252405_00914 | CDS | open | 9833-10861 | _na 342_aa | Ammonia monooxygenase | |
| 1818 | CAMXVP010000016.1 | GCA947252405_00915 | CDS | open | 10858-12513 | _na 551_aa | DUF885 domain-containing protein | |
| 1819 | CAMXVP010000016.1 | GCA947252405_00916 | CDS | open | 12558-13316 | _na 252_aa | NAD-dependent protein deacylase | |
| 1820 | CAMXVP010000016.1 | GCA947252405_00917 | CDS | open | 13338-14393 | _na 351_aa | ROK family protein | |
| 1821 | CAMXVP010000016.1 | GCA947252405_00918 | CDS | open | 14349-14873 | _na 174_aa | gamma carbonic anhydrase family protein | |
| 1822 | CAMXVP010000016.1 | GCA947252405_00919 | CDS | open | 14879-16198 | _na 439_aa | DUF2029 domain-containing protein | |
| 1823 | CAMXVP010000016.1 | GCA947252405_00920 | CDS | open | 16229-17638 | _na 469_aa | amn | AMP nucleosidase |
| 1824 | CAMXVP010000016.1 | GCA947252405_00921 | CDS | open | 17754-18473 | _na 239_aa | Serine hydrolase | |
| 1825 | CAMXVP010000016.1 | GCA947252405_00922 | CDS | open | 18466-19764 | _na 432_aa | Acetylornithine deacetylase | |
| 1826 | CAMXVP010000016.1 | GCA947252405_00923 | CDS | open | 19827-21332 | _na 501_aa | succinic semialdehyde dehydrogenase | |
| 1827 | CAMXVP010000016.1 | GCA947252405_00924 | CDS | open | 21429-22532 | _na 367_aa | HNH endonuclease | |
| 1828 | CAMXVP010000016.1 | GCA947252405_00925 | CDS | open | 22777-24345 | _na 522_aa | MFS transporter | |
| 1829 | CAMXVP010000016.1 | GCA947252405_00926 | CDS | open | 24317-25522 | _na 401_aa | Alpha-amylase | |
| 1830 | CAMXVP010000016.1 | GCA947252405_00927 | CDS | open | 25643-25843 | _na 66_aa | Transcriptional regulator | |
| 1831 | CAMXVP010000016.1 | GCA947252405_00928 | CDS | open | 25868-26383 | _na 171_aa | hypothetical protein | |
| 1832 | CAMXVP010000016.1 | GCA947252405_00929 | CDS | open | 26397-27911 | _na 504_aa | glutaminase | |
| 1833 | CAMXVP010000016.1 | GCA947252405_00930 | CDS | open | 28027-28911 | _na 294_aa | SDR family oxidoreductase | |
| 1834 | CAMXVP010000016.1 | GCA947252405_00931 | CDS | open | 28868-29443 | _na 191_aa | carboxymuconolactone decarboxylase family protein | |
| 1835 | CAMXVP010000016.1 | GCA947252405_00932 | CDS | open | 29487-30134 | _na 215_aa | Porin | |
| 1836 | CAMXVP010000016.1 | GCA947252405_00934 | CDS | open | 30488-31279 | _na 263_aa | DUF3662 domain-containing protein | |
| 1837 | CAMXVP010000016.1 | GCA947252405_00935 | CDS | open | 31316-31762 | _na 148_aa | FHA domain-containing protein | |
| 1838 | CAMXVP010000016.1 | GCA947252405_00936 | CDS | open | 31759-33117 | _na 452_aa | Protein phosphatase | |
| 1839 | CAMXVP010000016.1 | GCA947252405_00937 | CDS | open | 33186-34418 | _na 410_aa | peptidoglycan glycosyltransferase | |
| 1840 | CAMXVP010000016.1 | GCA947252405_00938 | CDS | open | 34415-35863 | _na 482_aa | Penicillin-binding protein | |
| 1841 | CAMXVP010000016.1 | GCA947252405_00939 | CDS | open | 35866-37119 | _na 417_aa | non-specific serine/threonine protein kinase | |
| 1842 | CAMXVP010000016.1 | GCA947252405_00902 | gene | open | 1-321 | |||
| 1843 | CAMXVP010000016.1 | GCA947252405_00903 | gene | open | 331-1170 | |||
| 1844 | CAMXVP010000016.1 | GCA947252405_00904 | gene | open | 1177-1980 | |||
| 1845 | CAMXVP010000016.1 | GCA947252405_00905 | gene | open | 1984-2229 | |||
| 1846 | CAMXVP010000016.1 | GCA947252405_00906 | gene | open | 2229-2549 | |||
| 1847 | CAMXVP010000016.1 | GCA947252405_00907 | gene | open | 2546-3208 | lysE | ||
| 1848 | CAMXVP010000016.1 | GCA947252405_00908 | gene | open | 3232-3945 | |||
| 1849 | CAMXVP010000016.1 | GCA947252405_00909 | gene | open | 3970-4758 | |||
| 1850 | CAMXVP010000016.1 | GCA947252405_00910 | gene | open | 4850-7102 | hrpB | ||
| 1851 | CAMXVP010000016.1 | GCA947252405_00911 | gene | open | 7106-7420 | higA | ||
| 1852 | CAMXVP010000016.1 | GCA947252405_00912 | gene | open | 7519-9024 | |||
| 1853 | CAMXVP010000016.1 | GCA947252405_00913 | gene | open | 9046-9786 | |||
| 1854 | CAMXVP010000016.1 | GCA947252405_00914 | gene | open | 9833-10861 | |||
| 1855 | CAMXVP010000016.1 | GCA947252405_00915 | gene | open | 10858-12513 | |||
| 1856 | CAMXVP010000016.1 | GCA947252405_00916 | gene | open | 12558-13316 | |||
| 1857 | CAMXVP010000016.1 | GCA947252405_00917 | gene | open | 13338-14393 | |||
| 1858 | CAMXVP010000016.1 | GCA947252405_00918 | gene | open | 14349-14873 | |||
| 1859 | CAMXVP010000016.1 | GCA947252405_00919 | gene | open | 14879-16198 | |||
| 1860 | CAMXVP010000016.1 | GCA947252405_00920 | gene | open | 16229-17638 | amn | ||
| 1861 | CAMXVP010000016.1 | GCA947252405_00921 | gene | open | 17754-18473 | |||
| 1862 | CAMXVP010000016.1 | GCA947252405_00922 | gene | open | 18466-19764 | |||
| 1863 | CAMXVP010000016.1 | GCA947252405_00923 | gene | open | 19827-21332 | |||
| 1864 | CAMXVP010000016.1 | GCA947252405_00924 | gene | open | 21429-22532 | |||
| 1865 | CAMXVP010000016.1 | GCA947252405_00925 | gene | open | 22777-24345 | |||
| 1866 | CAMXVP010000016.1 | GCA947252405_00926 | gene | open | 24317-25522 | |||
| 1867 | CAMXVP010000016.1 | GCA947252405_00927 | gene | open | 25643-25843 | |||
| 1868 | CAMXVP010000016.1 | GCA947252405_00928 | gene | open | 25868-26383 | |||
| 1869 | CAMXVP010000016.1 | GCA947252405_00929 | gene | open | 26397-27911 | |||
| 1870 | CAMXVP010000016.1 | GCA947252405_00930 | gene | open | 28027-28911 | |||
| 1871 | CAMXVP010000016.1 | GCA947252405_00931 | gene | open | 28868-29443 | |||
| 1872 | CAMXVP010000016.1 | GCA947252405_00932 | gene | open | 29487-30134 | |||
| 1873 | CAMXVP010000016.1 | GCA947252405_00934 | gene | open | 30488-31279 | |||
| 1874 | CAMXVP010000016.1 | GCA947252405_00935 | gene | open | 31316-31762 | |||
| 1875 | CAMXVP010000016.1 | GCA947252405_00936 | gene | open | 31759-33117 | |||
| 1876 | CAMXVP010000016.1 | GCA947252405_00937 | gene | open | 33186-34418 | |||
| 1877 | CAMXVP010000016.1 | GCA947252405_00938 | gene | open | 34415-35863 | |||
| 1878 | CAMXVP010000016.1 | GCA947252405_00939 | gene | open | 35866-37119 | |||
| 1879 | CAMXVP010000016.1 | GCA947252405_00933 | gene | open | 30250-30333 | trnL | ||
| 1880 | CAMXVP010000016.1 | GCA947252405_00933 | tRNA | open | 30250-30333 | trnL | tRNA-Leu(cag) | |
| 1881 | CAMXVP010000017.1 | GCA947252405_00940 | CDS | open | 71-502 | _na 143_aa | hypothetical protein | |
| 1882 | CAMXVP010000017.1 | GCA947252405_00941 | CDS | open | 499-1395 | _na 298_aa | Amidohydrolase | |
| 1883 | CAMXVP010000017.1 | GCA947252405_00942 | CDS | open | 1633-2862 | _na 409_aa | DUF1023 domain-containing protein | |
| 1884 | CAMXVP010000017.1 | GCA947252405_00943 | CDS | open | 2944-4695 | _na 583_aa | pyruvate dehydrogenase | |
| 1885 | CAMXVP010000017.1 | GCA947252405_00944 | CDS | open | 4692-7115 | _na 807_aa | hypothetical protein | |
| 1886 | CAMXVP010000017.1 | GCA947252405_00945 | CDS | open | 7118-9139 | _na 673_aa | Long Rib domain-containing protein | |
| 1887 | CAMXVP010000017.1 | GCA947252405_00946 | CDS | open | 9263-9661 | _na 132_aa | hspR | heat shock protein transcriptional repressor HspR |
| 1888 | CAMXVP010000017.1 | GCA947252405_00947 | CDS | open | 9674-10879 | _na 401_aa | dnaJ | molecular chaperone DnaJ |
| 1889 | CAMXVP010000017.1 | GCA947252405_00948 | CDS | open | 11006-11662 | _na 218_aa | grpE | nucleotide exchange factor GrpE |
| 1890 | CAMXVP010000017.1 | GCA947252405_00949 | CDS | open | 11675-13519 | _na 614_aa | dnaK | molecular chaperone DnaK |
| 1891 | CAMXVP010000017.1 | GCA947252405_00950 | CDS | open | 13746-14591 | _na 281_aa | Secreted protein | |
| 1892 | CAMXVP010000017.1 | GCA947252405_00951 | CDS | open | 14627-15478 | _na 283_aa | Secreted protein | |
| 1893 | CAMXVP010000017.1 | GCA947252405_00952 | CDS | open | 15677-17125 | _na 482_aa | AI-2E family transporter | |
| 1894 | CAMXVP010000017.1 | GCA947252405_00953 | CDS | open | 17195-17725 | _na 176_aa | Type 1 glutamine amidotransferase | |
| 1895 | CAMXVP010000017.1 | GCA947252405_00954 | CDS | open | 17722-18789 | _na 355_aa | Lipoate--protein ligase | |
| 1896 | CAMXVP010000017.1 | GCA947252405_00955 | CDS | open | 18837-19514 | _na 225_aa | GPP34 family phosphoprotein | |
| 1897 | CAMXVP010000017.1 | GCA947252405_00956 | CDS | open | 20007-20651 | _na 214_aa | FAD/NAD(P)-binding domain-containing protein | |
| 1898 | CAMXVP010000017.1 | GCA947252405_00957 | CDS | open | 20782-22119 | _na 445_aa | Sodium:phosphate symporter | |
| 1899 | CAMXVP010000017.1 | GCA947252405_00958 | CDS | open | 22143-22529 | _na 128_aa | Lsr2 protein | |
| 1900 | CAMXVP010000017.1 | GCA947252405_00959 | CDS | open | 22522-23454 | _na 310_aa | Phosphate ABC transporter substrate-binding protein | |
| 1901 | CAMXVP010000017.1 | GCA947252405_00960 | CDS | open | 23585-25258 | _na 557_aa | Multidrug ABC transporter ATP-binding protein | |
| 1902 | CAMXVP010000017.1 | GCA947252405_00961 | CDS | open | 25255-27201 | _na 648_aa | Multidrug ABC transporter ATP-binding protein | |
| 1903 | CAMXVP010000017.1 | GCA947252405_00962 | CDS | open | 27198-28322 | _na 374_aa | Glycerophosphoryl diester phosphodiesterase membrane domain-containing protein | |
| 1904 | CAMXVP010000017.1 | GCA947252405_00963 | CDS | open | 28408-29049 | _na 213_aa | DUF1707 domain-containing protein | |
| 1905 | CAMXVP010000017.1 | GCA947252405_00964 | CDS | open | 29060-30325 | _na 421_aa | alanine transaminase | |
| 1906 | CAMXVP010000017.1 | GCA947252405_00965 | CDS | open | 30648-31988 | _na 446_aa | UDP-glucose 6-dehydrogenase | |
| 1907 | CAMXVP010000017.1 | GCA947252405_00966 | CDS | open | 32041-32604 | _na 187_aa | dcd | dCTP deaminase |
| 1908 | CAMXVP010000017.1 | GCA947252405_00968 | CDS | open | 32898-34289 | _na 463_aa | ccmA | heme ABC exporter ATP-binding protein CcmA |
| 1909 | CAMXVP010000017.1 | GCA947252405_00969 | CDS | open | 34286-34972 | _na 228_aa | ecfT | Cobalt transport protein |
| 1910 | CAMXVP010000017.1 | GCA947252405_00970 | CDS | open | 34965-35561 | _na 198_aa | TIGR02185 family protein | |
| 1911 | CAMXVP010000017.1 | GCA947252405_00940 | gene | open | 71-502 | |||
| 1912 | CAMXVP010000017.1 | GCA947252405_00941 | gene | open | 499-1395 | |||
| 1913 | CAMXVP010000017.1 | GCA947252405_00942 | gene | open | 1633-2862 | |||
| 1914 | CAMXVP010000017.1 | GCA947252405_00943 | gene | open | 2944-4695 | |||
| 1915 | CAMXVP010000017.1 | GCA947252405_00944 | gene | open | 4692-7115 | |||
| 1916 | CAMXVP010000017.1 | GCA947252405_00945 | gene | open | 7118-9139 | |||
| 1917 | CAMXVP010000017.1 | GCA947252405_00946 | gene | open | 9263-9661 | hspR | ||
| 1918 | CAMXVP010000017.1 | GCA947252405_00947 | gene | open | 9674-10879 | dnaJ | ||
| 1919 | CAMXVP010000017.1 | GCA947252405_00948 | gene | open | 11006-11662 | grpE | ||
| 1920 | CAMXVP010000017.1 | GCA947252405_00949 | gene | open | 11675-13519 | dnaK | ||
| 1921 | CAMXVP010000017.1 | GCA947252405_00950 | gene | open | 13746-14591 | |||
| 1922 | CAMXVP010000017.1 | GCA947252405_00951 | gene | open | 14627-15478 | |||
| 1923 | CAMXVP010000017.1 | GCA947252405_00952 | gene | open | 15677-17125 | |||
| 1924 | CAMXVP010000017.1 | GCA947252405_00953 | gene | open | 17195-17725 | |||
| 1925 | CAMXVP010000017.1 | GCA947252405_00954 | gene | open | 17722-18789 | |||
| 1926 | CAMXVP010000017.1 | GCA947252405_00955 | gene | open | 18837-19514 | |||
| 1927 | CAMXVP010000017.1 | GCA947252405_00956 | gene | open | 20007-20651 | |||
| 1928 | CAMXVP010000017.1 | GCA947252405_00957 | gene | open | 20782-22119 | |||
| 1929 | CAMXVP010000017.1 | GCA947252405_00958 | gene | open | 22143-22529 | |||
| 1930 | CAMXVP010000017.1 | GCA947252405_00959 | gene | open | 22522-23454 | |||
| 1931 | CAMXVP010000017.1 | GCA947252405_00960 | gene | open | 23585-25258 | |||
| 1932 | CAMXVP010000017.1 | GCA947252405_00961 | gene | open | 25255-27201 | |||
| 1933 | CAMXVP010000017.1 | GCA947252405_00962 | gene | open | 27198-28322 | |||
| 1934 | CAMXVP010000017.1 | GCA947252405_00963 | gene | open | 28408-29049 | |||
| 1935 | CAMXVP010000017.1 | GCA947252405_00964 | gene | open | 29060-30325 | |||
| 1936 | CAMXVP010000017.1 | GCA947252405_00965 | gene | open | 30648-31988 | |||
| 1937 | CAMXVP010000017.1 | GCA947252405_00966 | gene | open | 32041-32604 | dcd | ||
| 1938 | CAMXVP010000017.1 | GCA947252405_00968 | gene | open | 32898-34289 | ccmA | ||
| 1939 | CAMXVP010000017.1 | GCA947252405_00969 | gene | open | 34286-34972 | ecfT | ||
| 1940 | CAMXVP010000017.1 | GCA947252405_00970 | gene | open | 34965-35561 | |||
| 1941 | CAMXVP010000017.1 | GCA947252405_00967 | gene | open | 32685-32758 | trnG | ||
| 1942 | CAMXVP010000017.1 | GCA947252405_00967 | tRNA | open | 32685-32758 | trnG | tRNA-Gly(ccc) | |
| 1943 | CAMXVP010000018.1 | GCA947252405_00971 | CDS | open | 34-435 | _na 133_aa | ribA | GTP cyclohydrolase II RibA |
| 1944 | CAMXVP010000018.1 | GCA947252405_00972 | CDS | open | 462-959 | _na 165_aa | ribH | 6%2C7-dimethyl-8-ribityllumazine synthase |
| 1945 | CAMXVP010000018.1 | GCA947252405_00973 | CDS | open | 1051-1587 | _na 178_aa | Low molecular weight protein antigen 6 PH domain-containing protein | |
| 1946 | CAMXVP010000018.1 | GCA947252405_00974 | CDS | open | 1592-3673 | _na 693_aa | uvrC | excinuclease ABC subunit UvrC |
| 1947 | CAMXVP010000018.1 | GCA947252405_00975 | CDS | open | 3720-4604 | _na 294_aa | rapZ | RNase adapter RapZ |
| 1948 | CAMXVP010000018.1 | GCA947252405_00976 | CDS | open | 4672-5673 | _na 333_aa | Putative gluconeogenesis factor | |
| 1949 | CAMXVP010000018.1 | GCA947252405_00977 | CDS | open | 5697-6680 | _na 327_aa | whiA | DNA-binding protein WhiA |
| 1950 | CAMXVP010000018.1 | GCA947252405_00978 | CDS | open | 6832-7842 | _na 336_aa | gap | type I glyceraldehyde-3-phosphate dehydrogenase |
| 1951 | CAMXVP010000018.1 | GCA947252405_00979 | CDS | open | 7977-9197 | _na 406_aa | Phosphoglycerate kinase | |
| 1952 | CAMXVP010000018.1 | GCA947252405_00980 | CDS | open | 9226-10011 | _na 261_aa | tpiA | triose-phosphate isomerase |
| 1953 | CAMXVP010000018.1 | GCA947252405_00981 | CDS | open | 10120-10356 | _na 78_aa | secG | preprotein translocase subunit SecG |
| 1954 | CAMXVP010000018.1 | GCA947252405_00982 | CDS | open | 10676-11407 | _na 243_aa | 6-phosphogluconolactonase | |
| 1955 | CAMXVP010000018.1 | GCA947252405_00983 | CDS | open | 11449-12384 | _na 311_aa | opcA | Oxppcycle protein OpcA |
| 1956 | CAMXVP010000018.1 | GCA947252405_00984 | CDS | open | 12418-13956 | _na 512_aa | zwf | glucose-6-phosphate dehydrogenase |
| 1957 | CAMXVP010000018.1 | GCA947252405_00985 | CDS | open | 14111-15211 | _na 366_aa | tal | transaldolase |
| 1958 | CAMXVP010000018.1 | GCA947252405_00986 | CDS | open | 15242-17416 | _na 724_aa | tkt | transketolase |
| 1959 | CAMXVP010000018.1 | GCA947252405_00987 | CDS | open | 17676-18602 | _na 308_aa | heme o synthase | |
| 1960 | CAMXVP010000018.1 | GCA947252405_00988 | CDS | open | 18599-19561 | _na 320_aa | NADPH:quinone reductase | |
| 1961 | CAMXVP010000018.1 | GCA947252405_00989 | CDS | open | 19643-20659 | _na 338_aa | Heme A synthase | |
| 1962 | CAMXVP010000018.1 | GCA947252405_00990 | CDS | open | 20751-21512 | _na 253_aa | Multidrug ABC transporter permease | |
| 1963 | CAMXVP010000018.1 | GCA947252405_00991 | CDS | open | 21521-22486 | _na 321_aa | Spermidine/putrescine ABC transporter ATP-binding protein | |
| 1964 | CAMXVP010000018.1 | GCA947252405_00992 | CDS | open | 22493-24139 | _na 548_aa | mptB | polyprenol phosphomannose-dependent alpha 1%2C6 mannosyltransferase MptB |
| 1965 | CAMXVP010000018.1 | GCA947252405_00993 | CDS | open | 24244-24948 | _na 234_aa | Transcriptional regulator | |
| 1966 | CAMXVP010000018.1 | GCA947252405_00994 | CDS | open | 24941-26386 | _na 481_aa | sufB | Fe-S cluster assembly protein SufB |
| 1967 | CAMXVP010000018.1 | GCA947252405_00995 | CDS | open | 26390-27568 | _na 392_aa | sufD | Fe-S cluster assembly protein SufD |
| 1968 | CAMXVP010000018.1 | GCA947252405_00996 | CDS | open | 27635-28390 | _na 251_aa | sufC | Fe-S cluster assembly ATPase SufC |
| 1969 | CAMXVP010000018.1 | GCA947252405_00997 | CDS | open | 28470-29732 | _na 420_aa | Cysteine desulfurase | |
| 1970 | CAMXVP010000018.1 | GCA947252405_00998 | CDS | open | 29796-30251 | _na 151_aa | sufU | Fe-S cluster assembly sulfur transfer protein SufU |
| 1971 | CAMXVP010000018.1 | GCA947252405_00999 | CDS | open | 30261-30665 | _na 134_aa | Metal-sulfur cluster assembly factor | |
| 1972 | CAMXVP010000018.1 | GCA947252405_01000 | CDS | open | 30702-32330 | _na 542_aa | ABC transport system ATP-binding protein | |
| 1973 | CAMXVP010000018.1 | GCA947252405_01001 | CDS | open | 32347-33018 | _na 223_aa | hypothetical protein | |
| 1974 | CAMXVP010000018.1 | GCA947252405_01002 | CDS | open | 33035-33769 | _na 244_aa | Glutamine amidotransferase | |
| 1975 | CAMXVP010000018.1 | GCA947252405_01003 | CDS | open | 33787-34032 | _na 81_aa | Cardiolipin synthase N-terminal domain-containing protein | |
| 1976 | CAMXVP010000018.1 | GCA947252405_01004 | CDS | open | 34128-34364 | _na 78_aa | hypothetical protein | |
| 1977 | CAMXVP010000018.1 | GCA947252405_00971 | gene | open | 34-435 | ribA | ||
| 1978 | CAMXVP010000018.1 | GCA947252405_00972 | gene | open | 462-959 | ribH | ||
| 1979 | CAMXVP010000018.1 | GCA947252405_00973 | gene | open | 1051-1587 | |||
| 1980 | CAMXVP010000018.1 | GCA947252405_00974 | gene | open | 1592-3673 | uvrC | ||
| 1981 | CAMXVP010000018.1 | GCA947252405_00975 | gene | open | 3720-4604 | rapZ | ||
| 1982 | CAMXVP010000018.1 | GCA947252405_00976 | gene | open | 4672-5673 | |||
| 1983 | CAMXVP010000018.1 | GCA947252405_00977 | gene | open | 5697-6680 | whiA | ||
| 1984 | CAMXVP010000018.1 | GCA947252405_00978 | gene | open | 6832-7842 | gap | ||
| 1985 | CAMXVP010000018.1 | GCA947252405_00979 | gene | open | 7977-9197 | |||
| 1986 | CAMXVP010000018.1 | GCA947252405_00980 | gene | open | 9226-10011 | tpiA | ||
| 1987 | CAMXVP010000018.1 | GCA947252405_00981 | gene | open | 10120-10356 | secG | ||
| 1988 | CAMXVP010000018.1 | GCA947252405_00982 | gene | open | 10676-11407 | |||
| 1989 | CAMXVP010000018.1 | GCA947252405_00983 | gene | open | 11449-12384 | opcA | ||
| 1990 | CAMXVP010000018.1 | GCA947252405_00984 | gene | open | 12418-13956 | zwf | ||
| 1991 | CAMXVP010000018.1 | GCA947252405_00985 | gene | open | 14111-15211 | tal | ||
| 1992 | CAMXVP010000018.1 | GCA947252405_00986 | gene | open | 15242-17416 | tkt | ||
| 1993 | CAMXVP010000018.1 | GCA947252405_00987 | gene | open | 17676-18602 | |||
| 1994 | CAMXVP010000018.1 | GCA947252405_00988 | gene | open | 18599-19561 | |||
| 1995 | CAMXVP010000018.1 | GCA947252405_00989 | gene | open | 19643-20659 | |||
| 1996 | CAMXVP010000018.1 | GCA947252405_00990 | gene | open | 20751-21512 | |||
| 1997 | CAMXVP010000018.1 | GCA947252405_00991 | gene | open | 21521-22486 | |||
| 1998 | CAMXVP010000018.1 | GCA947252405_00992 | gene | open | 22493-24139 | mptB | ||
| 1999 | CAMXVP010000018.1 | GCA947252405_00993 | gene | open | 24244-24948 | |||
| 2000 | CAMXVP010000018.1 | GCA947252405_00994 | gene | open | 24941-26386 | sufB |

