BAKTAGenome Explorer: Corynebacterium tuscaniense (GCA_947252405.1)
Select a Genome:
|
BAKTA Annotations for GCA_947252405.1
|
Search & Sort all 4055 Records
| ||||||||||||||||||
Notes: 1- Column headers only sort the current page. 2- Select [NA] or [AA] links to show sequences.
| Region | Protein-ID | Type | Genome Viewer |
Range (bp) |
Show Sequences (length) NA / AA |
BAKTA Gene |
BAKTA GeneProduct |
|
|---|---|---|---|---|---|---|---|---|
| 3001 | CAMXVP010000040.1 | GCA947252405_01496 | gene | open | 9993-10784 | |||
| 3002 | CAMXVP010000040.1 | GCA947252405_01497 | gene | open | 10777-11685 | |||
| 3003 | CAMXVP010000040.1 | GCA947252405_01498 | gene | open | 11682-12710 | |||
| 3004 | CAMXVP010000040.1 | GCA947252405_01499 | gene | open | 12799-14172 | |||
| 3005 | CAMXVP010000040.1 | GCA947252405_01500 | gene | open | 14289-16316 | |||
| 3006 | CAMXVP010000040.1 | GCA947252405_01501 | gene | open | 16467-16895 | |||
| 3007 | CAMXVP010000040.1 | GCA947252405_01502 | gene | open | 17004-17321 | |||
| 3008 | CAMXVP010000040.1 | GCA947252405_01503 | gene | open | 17318-18652 | |||
| 3009 | CAMXVP010000041.1 | GCA947252405_01504 | CDS | open | 88-603 | _na 171_aa | hypothetical protein | |
| 3010 | CAMXVP010000041.1 | GCA947252405_01505 | CDS | open | 728-2017 | _na 429_aa | adenylosuccinate synthase | |
| 3011 | CAMXVP010000041.1 | GCA947252405_01506 | CDS | open | 2225-3013 | _na 262_aa | DAGKc domain-containing protein | |
| 3012 | CAMXVP010000041.1 | GCA947252405_01507 | CDS | open | 3135-4433 | _na 432_aa | Integral membrane bound transporter domain-containing protein | |
| 3013 | CAMXVP010000041.1 | GCA947252405_01508 | CDS | open | 4507-5541 | _na 344_aa | fbaA | class II fructose-bisphosphate aldolase |
| 3014 | CAMXVP010000041.1 | GCA947252405_01509 | CDS | open | 5572-6936 | _na 454_aa | Glycoside hydrolase family 76 | |
| 3015 | CAMXVP010000041.1 | GCA947252405_01510 | CDS | open | 7593-8234 | _na 213_aa | RNA methyltransferase | |
| 3016 | CAMXVP010000041.1 | GCA947252405_01511 | CDS | open | 8299-8853 | _na 184_aa | Orotate phosphoribosyltransferase | |
| 3017 | CAMXVP010000041.1 | GCA947252405_01512 | CDS | open | 8878-9864 | _na 328_aa | Secreted protein | |
| 3018 | CAMXVP010000041.1 | GCA947252405_01513 | CDS | open | 10019-10852 | _na 277_aa | Sulfurtransferase | |
| 3019 | CAMXVP010000041.1 | GCA947252405_01514 | CDS | open | 10867-11265 | _na 132_aa | DUF4265 domain-containing protein | |
| 3020 | CAMXVP010000041.1 | GCA947252405_01515 | CDS | open | 11506-12537 | _na 343_aa | adhP | alcohol dehydrogenase AdhP |
| 3021 | CAMXVP010000041.1 | GCA947252405_01516 | CDS | open | 12683-15229 | _na 848_aa | clpB | ATP-dependent chaperone ClpB |
| 3022 | CAMXVP010000041.1 | GCA947252405_01517 | CDS | open | 15857-16345 | _na 162_aa | Helix-turn-helix type 11 domain-containing protein | |
| 3023 | CAMXVP010000041.1 | GCA947252405_01518 | CDS | open | 16350-17687 | _na 445_aa | Sodium:glutamate symporter | |
| 3024 | CAMXVP010000041.1 | GCA947252405_01504 | gene | open | 88-603 | |||
| 3025 | CAMXVP010000041.1 | GCA947252405_01505 | gene | open | 728-2017 | |||
| 3026 | CAMXVP010000041.1 | GCA947252405_01506 | gene | open | 2225-3013 | |||
| 3027 | CAMXVP010000041.1 | GCA947252405_01507 | gene | open | 3135-4433 | |||
| 3028 | CAMXVP010000041.1 | GCA947252405_01508 | gene | open | 4507-5541 | fbaA | ||
| 3029 | CAMXVP010000041.1 | GCA947252405_01509 | gene | open | 5572-6936 | |||
| 3030 | CAMXVP010000041.1 | GCA947252405_01510 | gene | open | 7593-8234 | |||
| 3031 | CAMXVP010000041.1 | GCA947252405_01511 | gene | open | 8299-8853 | |||
| 3032 | CAMXVP010000041.1 | GCA947252405_01512 | gene | open | 8878-9864 | |||
| 3033 | CAMXVP010000041.1 | GCA947252405_01513 | gene | open | 10019-10852 | |||
| 3034 | CAMXVP010000041.1 | GCA947252405_01514 | gene | open | 10867-11265 | |||
| 3035 | CAMXVP010000041.1 | GCA947252405_01515 | gene | open | 11506-12537 | adhP | ||
| 3036 | CAMXVP010000041.1 | GCA947252405_01516 | gene | open | 12683-15229 | clpB | ||
| 3037 | CAMXVP010000041.1 | GCA947252405_01517 | gene | open | 15857-16345 | |||
| 3038 | CAMXVP010000041.1 | GCA947252405_01518 | gene | open | 16350-17687 | |||
| 3039 | CAMXVP010000042.1 | GCA947252405_01519 | CDS | open | 185-427 | _na 80_aa | purS | phosphoribosylformylglycinamidine synthase subunit PurS |
| 3040 | CAMXVP010000042.1 | GCA947252405_01520 | CDS | open | 550-1581 | _na 343_aa | ABC transporter substrate-binding protein | |
| 3041 | CAMXVP010000042.1 | GCA947252405_01521 | CDS | open | 1591-2286 | _na 231_aa | ABC transporter ATP-binding protein | |
| 3042 | CAMXVP010000042.1 | GCA947252405_01522 | CDS | open | 2283-3137 | _na 284_aa | Helicase | |
| 3043 | CAMXVP010000042.1 | GCA947252405_01523 | CDS | open | 3122-3796 | _na 224_aa | DUF2334 domain-containing protein | |
| 3044 | CAMXVP010000042.1 | GCA947252405_01524 | CDS | open | 3886-5313 | _na 475_aa | dctA | C4-dicarboxylate transporter DctA |
| 3045 | CAMXVP010000042.1 | GCA947252405_01525 | CDS | open | 5399-7516 | _na 705_aa | Oligopeptidase B | |
| 3046 | CAMXVP010000042.1 | GCA947252405_01526 | CDS | open | 7543-8418 | _na 291_aa | phosphoribosylaminoimidazolesuccinocarboxamide synthase | |
| 3047 | CAMXVP010000042.1 | GCA947252405_01527 | CDS | open | 8441-9883 | _na 480_aa | purB | adenylosuccinate lyase |
| 3048 | CAMXVP010000042.1 | GCA947252405_01528 | CDS | open | 9867-11057 | _na 396_aa | Phosphoribosylamine--glycine ligase | |
| 3049 | CAMXVP010000042.1 | GCA947252405_01529 | CDS | open | 11167-11622 | _na 151_aa | HIT family protein | |
| 3050 | CAMXVP010000042.1 | GCA947252405_01530 | CDS | open | 11627-13045 | _na 472_aa | histidine kinase | |
| 3051 | CAMXVP010000042.1 | GCA947252405_01531 | CDS | open | 13065-13778 | _na 237_aa | DNA-binding response regulator | |
| 3052 | CAMXVP010000042.1 | GCA947252405_01533 | CDS | open | 14116-15648 | _na 510_aa | thrE | threonine/serine exporter ThrE |
| 3053 | CAMXVP010000042.1 | GCA947252405_01534 | CDS | open | 15703-16110 | _na 135_aa | hypothetical protein | |
| 3054 | CAMXVP010000042.1 | GCA947252405_01535 | CDS | open | 15976-16617 | _na 213_aa | hypothetical protein | |
| 3055 | CAMXVP010000042.1 | GCA947252405_01536 | CDS | open | 16666-17100 | _na 144_aa | hypothetical protein | |
| 3056 | CAMXVP010000042.1 | GCA947252405_01537 | CDS | open | 17107-17400 | _na 97_aa | hypothetical protein | |
| 3057 | CAMXVP010000042.1 | GCA947252405_01519 | gene | open | 185-427 | purS | ||
| 3058 | CAMXVP010000042.1 | GCA947252405_01520 | gene | open | 550-1581 | |||
| 3059 | CAMXVP010000042.1 | GCA947252405_01521 | gene | open | 1591-2286 | |||
| 3060 | CAMXVP010000042.1 | GCA947252405_01522 | gene | open | 2283-3137 | |||
| 3061 | CAMXVP010000042.1 | GCA947252405_01523 | gene | open | 3122-3796 | |||
| 3062 | CAMXVP010000042.1 | GCA947252405_01524 | gene | open | 3886-5313 | dctA | ||
| 3063 | CAMXVP010000042.1 | GCA947252405_01525 | gene | open | 5399-7516 | |||
| 3064 | CAMXVP010000042.1 | GCA947252405_01526 | gene | open | 7543-8418 | |||
| 3065 | CAMXVP010000042.1 | GCA947252405_01527 | gene | open | 8441-9883 | purB | ||
| 3066 | CAMXVP010000042.1 | GCA947252405_01528 | gene | open | 9867-11057 | |||
| 3067 | CAMXVP010000042.1 | GCA947252405_01529 | gene | open | 11167-11622 | |||
| 3068 | CAMXVP010000042.1 | GCA947252405_01530 | gene | open | 11627-13045 | |||
| 3069 | CAMXVP010000042.1 | GCA947252405_01531 | gene | open | 13065-13778 | |||
| 3070 | CAMXVP010000042.1 | GCA947252405_01533 | gene | open | 14116-15648 | thrE | ||
| 3071 | CAMXVP010000042.1 | GCA947252405_01534 | gene | open | 15703-16110 | |||
| 3072 | CAMXVP010000042.1 | GCA947252405_01535 | gene | open | 15976-16617 | |||
| 3073 | CAMXVP010000042.1 | GCA947252405_01536 | gene | open | 16666-17100 | |||
| 3074 | CAMXVP010000042.1 | GCA947252405_01537 | gene | open | 17107-17400 | |||
| 3075 | CAMXVP010000042.1 | GCA947252405_01532 | gene | open | 13916-13988 | trnT | ||
| 3076 | CAMXVP010000042.1 | GCA947252405_01532 | tRNA | open | 13916-13988 | trnT | tRNA-Thr(tgt) | |
| 3077 | CAMXVP010000043.1 | regulatory_region | open | 4127-4235 | mraW RNA | |||
| 3078 | CAMXVP010000043.1 | GCA947252405_01538 | CDS | open | 494-1597 | _na 367_aa | Geranylgeranyl pyrophosphate synthase | |
| 3079 | CAMXVP010000043.1 | GCA947252405_01539 | CDS | open | 1668-2219 | _na 183_aa | N-acetyltransferase | |
| 3080 | CAMXVP010000043.1 | GCA947252405_01540 | CDS | open | 2365-2802 | _na 145_aa | SAV-6107-like HEPN domain-containing protein | |
| 3081 | CAMXVP010000043.1 | GCA947252405_01541 | CDS | open | 2901-3290 | _na 129_aa | DUF3040 domain-containing protein | |
| 3082 | CAMXVP010000043.1 | GCA947252405_01542 | CDS | open | 3680-4114 | _na 144_aa | mraZ | division/cell wall cluster transcriptional repressor MraZ |
| 3083 | CAMXVP010000043.1 | GCA947252405_01543 | CDS | open | 4277-5275 | _na 332_aa | rsmH | 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH |
| 3084 | CAMXVP010000043.1 | GCA947252405_01544 | CDS | open | 5318-5950 | _na 210_aa | ftsL | Cell division protein FtsL |
| 3085 | CAMXVP010000043.1 | GCA947252405_01545 | CDS | open | 6046-7158 | _na 370_aa | ftsI | Cell division protein FtsI |
| 3086 | CAMXVP010000043.1 | GCA947252405_01546 | CDS | open | 7109-8011 | _na 300_aa | penicillin-binding protein 2 | |
| 3087 | CAMXVP010000043.1 | GCA947252405_01547 | CDS | open | 8025-9509 | _na 494_aa | UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2%2C6-diaminopimelate ligase | |
| 3088 | CAMXVP010000043.1 | GCA947252405_01548 | CDS | open | 9512-11017 | _na 501_aa | UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase | |
| 3089 | CAMXVP010000043.1 | GCA947252405_01549 | CDS | open | 11033-12142 | _na 369_aa | mraY | phospho-N-acetylmuramoyl-pentapeptide-transferase |
| 3090 | CAMXVP010000043.1 | GCA947252405_01550 | CDS | open | 12139-13491 | _na 450_aa | murD | UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase |
| 3091 | CAMXVP010000043.1 | GCA947252405_01551 | CDS | open | 13508-14911 | _na 467_aa | ftsW | putative peptidoglycan glycosyltransferase FtsW |
| 3092 | CAMXVP010000043.1 | GCA947252405_01552 | CDS | open | 14929-15987 | _na 352_aa | UDP-N-acetylglucosamine--N-acetylmuramyl-(pentapeptide) pyrophosphoryl-undecaprenol N-acetylglucosamine transferase | |
| 3093 | CAMXVP010000043.1 | GCA947252405_01553 | CDS | open | 16128-16349 | _na 73_aa | hypothetical protein | |
| 3094 | CAMXVP010000043.1 | GCA947252405_01554 | CDS | open | 16497-16736 | _na 79_aa | hypothetical protein | |
| 3095 | CAMXVP010000043.1 | GCA947252405_01538 | gene | open | 494-1597 | |||
| 3096 | CAMXVP010000043.1 | GCA947252405_01539 | gene | open | 1668-2219 | |||
| 3097 | CAMXVP010000043.1 | GCA947252405_01540 | gene | open | 2365-2802 | |||
| 3098 | CAMXVP010000043.1 | GCA947252405_01541 | gene | open | 2901-3290 | |||
| 3099 | CAMXVP010000043.1 | GCA947252405_01542 | gene | open | 3680-4114 | mraZ | ||
| 3100 | CAMXVP010000043.1 | GCA947252405_01543 | gene | open | 4277-5275 | rsmH | ||
| 3101 | CAMXVP010000043.1 | GCA947252405_01544 | gene | open | 5318-5950 | ftsL | ||
| 3102 | CAMXVP010000043.1 | GCA947252405_01545 | gene | open | 6046-7158 | ftsI | ||
| 3103 | CAMXVP010000043.1 | GCA947252405_01546 | gene | open | 7109-8011 | |||
| 3104 | CAMXVP010000043.1 | GCA947252405_01547 | gene | open | 8025-9509 | |||
| 3105 | CAMXVP010000043.1 | GCA947252405_01548 | gene | open | 9512-11017 | |||
| 3106 | CAMXVP010000043.1 | GCA947252405_01549 | gene | open | 11033-12142 | mraY | ||
| 3107 | CAMXVP010000043.1 | GCA947252405_01550 | gene | open | 12139-13491 | murD | ||
| 3108 | CAMXVP010000043.1 | GCA947252405_01551 | gene | open | 13508-14911 | ftsW | ||
| 3109 | CAMXVP010000043.1 | GCA947252405_01552 | gene | open | 14929-15987 | |||
| 3110 | CAMXVP010000043.1 | GCA947252405_01553 | gene | open | 16128-16349 | |||
| 3111 | CAMXVP010000043.1 | GCA947252405_01554 | gene | open | 16497-16736 | |||
| 3112 | CAMXVP010000044.1 | regulatory_region | open | 844-1056 | c-di-AMP riboswitch aptamer (ydaO/yuaA leader) | |||
| 3113 | CAMXVP010000044.1 | GCA947252405_01555 | CDS | open | 230-832 | _na 200_aa | DUF3235 domain-containing protein | |
| 3114 | CAMXVP010000044.1 | GCA947252405_01556 | CDS | open | 1368-1751 | _na 127_aa | Cold-shock protein | |
| 3115 | CAMXVP010000044.1 | GCA947252405_01557 | CDS | open | 1767-2285 | _na 172_aa | DUF2771 domain-containing protein | |
| 3116 | CAMXVP010000044.1 | GCA947252405_01558 | CDS | open | 2297-3094 | _na 265_aa | Glutamine cyclotransferase | |
| 3117 | CAMXVP010000044.1 | GCA947252405_01559 | CDS | open | 3124-3879 | _na 251_aa | DUF3027 domain-containing protein | |
| 3118 | CAMXVP010000044.1 | GCA947252405_01560 | CDS | open | 4048-5541 | _na 497_aa | NCS2 family permease | |
| 3119 | CAMXVP010000044.1 | GCA947252405_01561 | CDS | open | 5562-6392 | _na 276_aa | rRNA methyltransferase | |
| 3120 | CAMXVP010000044.1 | GCA947252405_01562 | CDS | open | 6389-7234 | _na 281_aa | DUF6928 domain-containing protein | |
| 3121 | CAMXVP010000044.1 | GCA947252405_01563 | CDS | open | 7241-8239 | _na 332_aa | sepH | septation protein SepH |
| 3122 | CAMXVP010000044.1 | GCA947252405_01564 | CDS | open | 8329-9456 | _na 375_aa | serC | phosphoserine transaminase |
| 3123 | CAMXVP010000044.1 | GCA947252405_01565 | CDS | open | 9600-10994 | _na 464_aa | citrate synthase | |
| 3124 | CAMXVP010000044.1 | GCA947252405_01566 | CDS | open | 11135-11494 | _na 119_aa | Peptidyl-prolyl cis-trans isomerase | |
| 3125 | CAMXVP010000044.1 | GCA947252405_01567 | CDS | open | 11499-12347 | _na 282_aa | Aldo/keto reductase | |
| 3126 | CAMXVP010000044.1 | GCA947252405_01568 | CDS | open | 12507-12848 | _na 113_aa | DUF485 domain-containing protein | |
| 3127 | CAMXVP010000044.1 | GCA947252405_01569 | CDS | open | 12852-14507 | _na 551_aa | Transporter%2C SSS family | |
| 3128 | CAMXVP010000044.1 | GCA947252405_01570 | CDS | open | 14710-15735 | _na 341_aa | Tat pathway signal sequence domain protein | |
| 3129 | CAMXVP010000044.1 | GCA947252405_01571 | CDS | open | 15824-16555 | _na 243_aa | DUF981 domain-containing protein | |
| 3130 | CAMXVP010000044.1 | GCA947252405_01555 | gene | open | 230-832 | |||
| 3131 | CAMXVP010000044.1 | GCA947252405_01556 | gene | open | 1368-1751 | |||
| 3132 | CAMXVP010000044.1 | GCA947252405_01557 | gene | open | 1767-2285 | |||
| 3133 | CAMXVP010000044.1 | GCA947252405_01558 | gene | open | 2297-3094 | |||
| 3134 | CAMXVP010000044.1 | GCA947252405_01559 | gene | open | 3124-3879 | |||
| 3135 | CAMXVP010000044.1 | GCA947252405_01560 | gene | open | 4048-5541 | |||
| 3136 | CAMXVP010000044.1 | GCA947252405_01561 | gene | open | 5562-6392 | |||
| 3137 | CAMXVP010000044.1 | GCA947252405_01562 | gene | open | 6389-7234 | |||
| 3138 | CAMXVP010000044.1 | GCA947252405_01563 | gene | open | 7241-8239 | sepH | ||
| 3139 | CAMXVP010000044.1 | GCA947252405_01564 | gene | open | 8329-9456 | serC | ||
| 3140 | CAMXVP010000044.1 | GCA947252405_01565 | gene | open | 9600-10994 | |||
| 3141 | CAMXVP010000044.1 | GCA947252405_01566 | gene | open | 11135-11494 | |||
| 3142 | CAMXVP010000044.1 | GCA947252405_01567 | gene | open | 11499-12347 | |||
| 3143 | CAMXVP010000044.1 | GCA947252405_01568 | gene | open | 12507-12848 | |||
| 3144 | CAMXVP010000044.1 | GCA947252405_01569 | gene | open | 12852-14507 | |||
| 3145 | CAMXVP010000044.1 | GCA947252405_01570 | gene | open | 14710-15735 | |||
| 3146 | CAMXVP010000044.1 | GCA947252405_01571 | gene | open | 15824-16555 | |||
| 3147 | CAMXVP010000045.1 | GCA947252405_01572 | CDS | open | 115-2058 | _na 647_aa | pknB | Stk1 family PASTA domain-containing Ser/Thr kinase |
| 3148 | CAMXVP010000045.1 | GCA947252405_01573 | CDS | open | 2136-2411 | _na 91_aa | crgA | cell division protein CrgA |
| 3149 | CAMXVP010000045.1 | GCA947252405_01574 | CDS | open | 2768-3418 | _na 216_aa | Rhomboid family intramembrane serine protease | |
| 3150 | CAMXVP010000045.1 | GCA947252405_01575 | CDS | open | 3419-3940 | _na 173_aa | Peptidyl-prolyl cis-trans isomerase | |
| 3151 | CAMXVP010000045.1 | GCA947252405_01576 | CDS | open | 4095-4934 | _na 279_aa | Metal ABC transporter substrate-binding protein | |
| 3152 | CAMXVP010000045.1 | GCA947252405_01577 | CDS | open | 4934-5755 | _na 273_aa | ABC transporter | |
| 3153 | CAMXVP010000045.1 | GCA947252405_01578 | CDS | open | 5759-6445 | _na 228_aa | ABC transporter%2C permease protein | |
| 3154 | CAMXVP010000045.1 | GCA947252405_01579 | CDS | open | 6493-7428 | _na 311_aa | Abortive phage resistance protein | |
| 3155 | CAMXVP010000045.1 | GCA947252405_01580 | CDS | open | 7580-9037 | _na 485_aa | pucR | PucR family transcriptional regulator |
| 3156 | CAMXVP010000045.1 | GCA947252405_01581 | CDS | open | 9161-10471 | _na 436_aa | gabT | 4-aminobutyrate--2-oxoglutarate transaminase |
| 3157 | CAMXVP010000045.1 | GCA947252405_01582 | CDS | open | 10503-11960 | _na 485_aa | NAD-dependent succinate-semialdehyde dehydrogenase | |
| 3158 | CAMXVP010000045.1 | GCA947252405_01583 | CDS | open | 12007-13257 | _na 416_aa | ykvI | Membrane protein YkvI |
| 3159 | CAMXVP010000045.1 | GCA947252405_01584 | CDS | open | 13260-14447 | _na 395_aa | CoA-transferase family III protein | |
| 3160 | CAMXVP010000045.1 | GCA947252405_01585 | CDS | open | 14488-15702 | _na 404_aa | glutaryl-CoA dehydrogenase (ETF) | |
| 3161 | CAMXVP010000045.1 | GCA947252405_01572 | gene | open | 115-2058 | pknB | ||
| 3162 | CAMXVP010000045.1 | GCA947252405_01573 | gene | open | 2136-2411 | crgA | ||
| 3163 | CAMXVP010000045.1 | GCA947252405_01574 | gene | open | 2768-3418 | |||
| 3164 | CAMXVP010000045.1 | GCA947252405_01575 | gene | open | 3419-3940 | |||
| 3165 | CAMXVP010000045.1 | GCA947252405_01576 | gene | open | 4095-4934 | |||
| 3166 | CAMXVP010000045.1 | GCA947252405_01577 | gene | open | 4934-5755 | |||
| 3167 | CAMXVP010000045.1 | GCA947252405_01578 | gene | open | 5759-6445 | |||
| 3168 | CAMXVP010000045.1 | GCA947252405_01579 | gene | open | 6493-7428 | |||
| 3169 | CAMXVP010000045.1 | GCA947252405_01580 | gene | open | 7580-9037 | pucR | ||
| 3170 | CAMXVP010000045.1 | GCA947252405_01581 | gene | open | 9161-10471 | gabT | ||
| 3171 | CAMXVP010000045.1 | GCA947252405_01582 | gene | open | 10503-11960 | |||
| 3172 | CAMXVP010000045.1 | GCA947252405_01583 | gene | open | 12007-13257 | ykvI | ||
| 3173 | CAMXVP010000045.1 | GCA947252405_01584 | gene | open | 13260-14447 | |||
| 3174 | CAMXVP010000045.1 | GCA947252405_01585 | gene | open | 14488-15702 | |||
| 3175 | CAMXVP010000046.1 | GCA947252405_01586 | CDS | open | 114-755 | _na 213_aa | rsmG | 16S rRNA (guanine(527)-N(7))-methyltransferase RsmG |
| 3176 | CAMXVP010000046.1 | GCA947252405_01587 | CDS | open | 820-1761 | _na 313_aa | Chromosome partitioning protein | |
| 3177 | CAMXVP010000046.1 | GCA947252405_01588 | CDS | open | 1763-2848 | _na 361_aa | Cell division protein | |
| 3178 | CAMXVP010000046.1 | GCA947252405_01589 | CDS | open | 2965-4125 | _na 386_aa | N-acetylmuramoyl-L-alanine amidase | |
| 3179 | CAMXVP010000046.1 | GCA947252405_01590 | CDS | open | 4223-4546 | _na 107_aa | trxA | thioredoxin |
| 3180 | CAMXVP010000046.1 | GCA947252405_01591 | CDS | open | 4597-5586 | _na 329_aa | trxB | thioredoxin-disulfide reductase |
| 3181 | CAMXVP010000046.1 | GCA947252405_01592 | CDS | open | 5597-6184 | _na 195_aa | RNA polymerase subunit sigma | |
| 3182 | CAMXVP010000046.1 | GCA947252405_01593 | CDS | open | 6312-9332 | _na 1006_aa | murJ | murein biosynthesis integral membrane protein MurJ |
| 3183 | CAMXVP010000046.1 | GCA947252405_01594 | CDS | open | 9383-11893 | _na 836_aa | Secreted protein | |
| 3184 | CAMXVP010000046.1 | GCA947252405_01595 | CDS | open | 11893-12396 | _na 167_aa | NUDIX hydrolase | |
| 3185 | CAMXVP010000046.1 | GCA947252405_01596 | CDS | open | 12804-14345 | _na 513_aa | CCA tRNA nucleotidyltransferase | |
| 3186 | CAMXVP010000046.1 | GCA947252405_01597 | CDS | open | 14338-14946 | _na 202_aa | YqgE/AlgH family protein | |
| 3187 | CAMXVP010000046.1 | GCA947252405_01598 | CDS | open | 14936-15676 | _na 246_aa | Branched-chain amino acid ABC transporter permease | |
| 3188 | CAMXVP010000046.1 | GCA947252405_01599 | CDS | open | 15715-16032 | _na 105_aa | Branched-chain amino acid ABC transporter permease | |
| 3189 | CAMXVP010000046.1 | GCA947252405_01586 | gene | open | 114-755 | rsmG | ||
| 3190 | CAMXVP010000046.1 | GCA947252405_01587 | gene | open | 820-1761 | |||
| 3191 | CAMXVP010000046.1 | GCA947252405_01588 | gene | open | 1763-2848 | |||
| 3192 | CAMXVP010000046.1 | GCA947252405_01589 | gene | open | 2965-4125 | |||
| 3193 | CAMXVP010000046.1 | GCA947252405_01590 | gene | open | 4223-4546 | trxA | ||
| 3194 | CAMXVP010000046.1 | GCA947252405_01591 | gene | open | 4597-5586 | trxB | ||
| 3195 | CAMXVP010000046.1 | GCA947252405_01592 | gene | open | 5597-6184 | |||
| 3196 | CAMXVP010000046.1 | GCA947252405_01593 | gene | open | 6312-9332 | murJ | ||
| 3197 | CAMXVP010000046.1 | GCA947252405_01594 | gene | open | 9383-11893 | |||
| 3198 | CAMXVP010000046.1 | GCA947252405_01595 | gene | open | 11893-12396 | |||
| 3199 | CAMXVP010000046.1 | GCA947252405_01596 | gene | open | 12804-14345 | |||
| 3200 | CAMXVP010000046.1 | GCA947252405_01597 | gene | open | 14338-14946 | |||
| 3201 | CAMXVP010000046.1 | GCA947252405_01598 | gene | open | 14936-15676 | |||
| 3202 | CAMXVP010000046.1 | GCA947252405_01599 | gene | open | 15715-16032 | |||
| 3203 | CAMXVP010000047.1 | GCA947252405_01600 | CDS | open | 243-563 | _na 106_aa | Integration host factor | |
| 3204 | CAMXVP010000047.1 | GCA947252405_01601 | CDS | open | 567-1157 | _na 196_aa | gmk | guanylate kinase |
| 3205 | CAMXVP010000047.1 | GCA947252405_01602 | CDS | open | 1164-1472 | _na 102_aa | rpoZ | DNA-directed RNA polymerase subunit omega |
| 3206 | CAMXVP010000047.1 | GCA947252405_01603 | CDS | open | 2080-3396 | _na 438_aa | coaBC | bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC |
| 3207 | CAMXVP010000047.1 | GCA947252405_01604 | CDS | open | 3487-4701 | _na 404_aa | metK | methionine adenosyltransferase |
| 3208 | CAMXVP010000047.1 | GCA947252405_01605 | CDS | open | 4714-5619 | _na 301_aa | FHA domain-containing protein | |
| 3209 | CAMXVP010000047.1 | GCA947252405_01606 | CDS | open | 5622-6026 | _na 134_aa | SPW repeat protein | |
| 3210 | CAMXVP010000047.1 | GCA947252405_01607 | CDS | open | 6067-6948 | _na 293_aa | Polysaccharide deacetylase family protein | |
| 3211 | CAMXVP010000047.1 | GCA947252405_01608 | CDS | open | 7107-9122 | _na 671_aa | primosomal protein N' | |
| 3212 | CAMXVP010000047.1 | GCA947252405_01609 | CDS | open | 9155-9667 | _na 170_aa | def | peptide deformylase |
| 3213 | CAMXVP010000047.1 | GCA947252405_01610 | CDS | open | 9696-10622 | _na 308_aa | fmt | methionyl-tRNA formyltransferase |
| 3214 | CAMXVP010000047.1 | GCA947252405_01611 | CDS | open | 10619-12070 | _na 483_aa | MFS transporter | |
| 3215 | CAMXVP010000047.1 | GCA947252405_01612 | CDS | open | 12178-12840 | _na 220_aa | rpe | ribulose-phosphate 3-epimerase |
| 3216 | CAMXVP010000047.1 | GCA947252405_01613 | CDS | open | 12853-13854 | _na 333_aa | ribD | bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD |
| 3217 | CAMXVP010000047.1 | GCA947252405_01614 | CDS | open | 13854-14456 | _na 200_aa | riboflavin synthase | |
| 3218 | CAMXVP010000047.1 | GCA947252405_01600 | gene | open | 243-563 | |||
| 3219 | CAMXVP010000047.1 | GCA947252405_01601 | gene | open | 567-1157 | gmk | ||
| 3220 | CAMXVP010000047.1 | GCA947252405_01602 | gene | open | 1164-1472 | rpoZ | ||
| 3221 | CAMXVP010000047.1 | GCA947252405_01603 | gene | open | 2080-3396 | coaBC | ||
| 3222 | CAMXVP010000047.1 | GCA947252405_01604 | gene | open | 3487-4701 | metK | ||
| 3223 | CAMXVP010000047.1 | GCA947252405_01605 | gene | open | 4714-5619 | |||
| 3224 | CAMXVP010000047.1 | GCA947252405_01606 | gene | open | 5622-6026 | |||
| 3225 | CAMXVP010000047.1 | GCA947252405_01607 | gene | open | 6067-6948 | |||
| 3226 | CAMXVP010000047.1 | GCA947252405_01608 | gene | open | 7107-9122 | |||
| 3227 | CAMXVP010000047.1 | GCA947252405_01609 | gene | open | 9155-9667 | def | ||
| 3228 | CAMXVP010000047.1 | GCA947252405_01610 | gene | open | 9696-10622 | fmt | ||
| 3229 | CAMXVP010000047.1 | GCA947252405_01611 | gene | open | 10619-12070 | |||
| 3230 | CAMXVP010000047.1 | GCA947252405_01612 | gene | open | 12178-12840 | rpe | ||
| 3231 | CAMXVP010000047.1 | GCA947252405_01613 | gene | open | 12853-13854 | ribD | ||
| 3232 | CAMXVP010000047.1 | GCA947252405_01614 | gene | open | 13854-14456 | |||
| 3233 | CAMXVP010000048.1 | GCA947252405_01615 | CDS | open | 34-669 | _na 211_aa | hypothetical protein | |
| 3234 | CAMXVP010000048.1 | GCA947252405_01616 | CDS | open | 702-1889 | _na 395_aa | histidine kinase | |
| 3235 | CAMXVP010000048.1 | GCA947252405_01617 | CDS | open | 1891-2541 | _na 216_aa | DNA-binding response regulator | |
| 3236 | CAMXVP010000048.1 | GCA947252405_01618 | CDS | open | 2588-3313 | _na 241_aa | Bacitracin ABC transporter ATP-binding protein | |
| 3237 | CAMXVP010000048.1 | GCA947252405_01619 | CDS | open | 3318-4757 | _na 479_aa | Tat pathway signal sequence domain protein | |
| 3238 | CAMXVP010000048.1 | GCA947252405_01620 | CDS | open | 4777-5805 | _na 342_aa | 1%2C4-dihydroxy-2-naphthoyl-CoA synthase | |
| 3239 | CAMXVP010000048.1 | GCA947252405_01621 | CDS | open | 5825-6859 | _na 344_aa | o-succinylbenzoate synthase | |
| 3240 | CAMXVP010000048.1 | GCA947252405_01622 | CDS | open | 6843-7460 | _na 205_aa | Secreted protein | |
| 3241 | CAMXVP010000048.1 | GCA947252405_01623 | CDS | open | 7488-9131 | _na 547_aa | menD | 2-succinyl-5-enolpyruvyl-6-hydroxy-3-cyclohexene-1-carboxylic-acid synthase |
| 3242 | CAMXVP010000048.1 | GCA947252405_01624 | CDS | open | 9175-9618 | _na 147_aa | DUF3592 domain-containing protein | |
| 3243 | CAMXVP010000048.1 | GCA947252405_01625 | CDS | open | 9640-10833 | _na 397_aa | Alpha-mannosyltransferase | |
| 3244 | CAMXVP010000048.1 | GCA947252405_01626 | CDS | open | 10778-11569 | _na 263_aa | demethylmenaquinone methyltransferase | |
| 3245 | CAMXVP010000048.1 | GCA947252405_01627 | CDS | open | 11590-12840 | _na 416_aa | FAD-linked oxidoreductase | |
| 3246 | CAMXVP010000048.1 | GCA947252405_01628 | CDS | open | 12933-13949 | _na 338_aa | Geranylgeranyl pyrophosphate synthase | |
| 3247 | CAMXVP010000048.1 | GCA947252405_01615 | gene | open | 34-669 | |||
| 3248 | CAMXVP010000048.1 | GCA947252405_01616 | gene | open | 702-1889 | |||
| 3249 | CAMXVP010000048.1 | GCA947252405_01617 | gene | open | 1891-2541 | |||
| 3250 | CAMXVP010000048.1 | GCA947252405_01618 | gene | open | 2588-3313 | |||
| 3251 | CAMXVP010000048.1 | GCA947252405_01619 | gene | open | 3318-4757 | |||
| 3252 | CAMXVP010000048.1 | GCA947252405_01620 | gene | open | 4777-5805 | |||
| 3253 | CAMXVP010000048.1 | GCA947252405_01621 | gene | open | 5825-6859 | |||
| 3254 | CAMXVP010000048.1 | GCA947252405_01622 | gene | open | 6843-7460 | |||
| 3255 | CAMXVP010000048.1 | GCA947252405_01623 | gene | open | 7488-9131 | menD | ||
| 3256 | CAMXVP010000048.1 | GCA947252405_01624 | gene | open | 9175-9618 | |||
| 3257 | CAMXVP010000048.1 | GCA947252405_01625 | gene | open | 9640-10833 | |||
| 3258 | CAMXVP010000048.1 | GCA947252405_01626 | gene | open | 10778-11569 | |||
| 3259 | CAMXVP010000048.1 | GCA947252405_01627 | gene | open | 11590-12840 | |||
| 3260 | CAMXVP010000048.1 | GCA947252405_01628 | gene | open | 12933-13949 | |||
| 3261 | CAMXVP010000048.1 | GCA947252405_01629 | gene | open | 14020-14105 | trnY | ||
| 3262 | CAMXVP010000048.1 | GCA947252405_01630 | gene | open | 14344-14416 | trnT | ||
| 3263 | CAMXVP010000048.1 | GCA947252405_01631 | gene | open | 14447-14518 | trnM | ||
| 3264 | CAMXVP010000048.1 | GCA947252405_01629 | tRNA | open | 14020-14105 | trnY | tRNA-Tyr(gta) | |
| 3265 | CAMXVP010000048.1 | GCA947252405_01630 | tRNA | open | 14344-14416 | trnT | tRNA-Thr(ggt) | |
| 3266 | CAMXVP010000048.1 | GCA947252405_01631 | tRNA | open | 14447-14518 | trnM | tRNA-Met(cat) | |
| 3267 | CAMXVP010000049.1 | regulatory_region | open | 4666-4842 | c-di-AMP riboswitch aptamer (ydaO/yuaA leader) | |||
| 3268 | CAMXVP010000049.1 | GCA947252405_01632 | CDS | open | 18-566 | _na 182_aa | cytochrome-c oxidase | |
| 3269 | CAMXVP010000049.1 | GCA947252405_01633 | CDS | open | 619-1467 | _na 282_aa | Cytochrome bc1 complex cytochrome c subunit | |
| 3270 | CAMXVP010000049.1 | GCA947252405_01634 | CDS | open | 1464-2687 | _na 407_aa | Cytochrome bc1 complex Rieske iron-sulfur subunit | |
| 3271 | CAMXVP010000049.1 | GCA947252405_01635 | CDS | open | 2687-4306 | _na 539_aa | Cytochrome bc1 complex cytochrome b subunit | |
| 3272 | CAMXVP010000049.1 | GCA947252405_01636 | CDS | open | 4851-5480 | _na 209_aa | NlpC/P60 family protein | |
| 3273 | CAMXVP010000049.1 | GCA947252405_01637 | CDS | open | 5654-6676 | _na 340_aa | Hydrolase | |
| 3274 | CAMXVP010000049.1 | GCA947252405_01638 | CDS | open | 6660-7817 | _na 385_aa | Alpha-(1-2)-phosphatidylinositol mannosyltransferase | |
| 3275 | CAMXVP010000049.1 | GCA947252405_01639 | CDS | open | 7829-8788 | _na 319_aa | Glucokinase | |
| 3276 | CAMXVP010000049.1 | GCA947252405_01640 | CDS | open | 8796-9548 | _na 250_aa | 1-acyl-sn-glycerol-3-phosphate acyltransferase | |
| 3277 | CAMXVP010000049.1 | GCA947252405_01641 | CDS | open | 9557-10069 | _na 170_aa | polyadenylate-specific 3'-exoribonuclease AS | |
| 3278 | CAMXVP010000049.1 | GCA947252405_01642 | CDS | open | 10103-11491 | _na 462_aa | class II 3-deoxy-7-phosphoheptulonate synthase | |
| 3279 | CAMXVP010000049.1 | GCA947252405_01643 | CDS | open | 11488-12645 | _na 385_aa | non-specific serine/threonine protein kinase | |
| 3280 | CAMXVP010000049.1 | GCA947252405_01644 | CDS | open | 12704-13072 | _na 122_aa | DNA-binding protein | |
| 3281 | CAMXVP010000049.1 | GCA947252405_01645 | CDS | open | 13041-14012 | _na 323_aa | hypothetical protein | |
| 3282 | CAMXVP010000049.1 | GCA947252405_01632 | gene | open | 18-566 | |||
| 3283 | CAMXVP010000049.1 | GCA947252405_01633 | gene | open | 619-1467 | |||
| 3284 | CAMXVP010000049.1 | GCA947252405_01634 | gene | open | 1464-2687 | |||
| 3285 | CAMXVP010000049.1 | GCA947252405_01635 | gene | open | 2687-4306 | |||
| 3286 | CAMXVP010000049.1 | GCA947252405_01636 | gene | open | 4851-5480 | |||
| 3287 | CAMXVP010000049.1 | GCA947252405_01637 | gene | open | 5654-6676 | |||
| 3288 | CAMXVP010000049.1 | GCA947252405_01638 | gene | open | 6660-7817 | |||
| 3289 | CAMXVP010000049.1 | GCA947252405_01639 | gene | open | 7829-8788 | |||
| 3290 | CAMXVP010000049.1 | GCA947252405_01640 | gene | open | 8796-9548 | |||
| 3291 | CAMXVP010000049.1 | GCA947252405_01641 | gene | open | 9557-10069 | |||
| 3292 | CAMXVP010000049.1 | GCA947252405_01642 | gene | open | 10103-11491 | |||
| 3293 | CAMXVP010000049.1 | GCA947252405_01643 | gene | open | 11488-12645 | |||
| 3294 | CAMXVP010000049.1 | GCA947252405_01644 | gene | open | 12704-13072 | |||
| 3295 | CAMXVP010000049.1 | GCA947252405_01645 | gene | open | 13041-14012 | |||
| 3296 | CAMXVP010000050.1 | GCA947252405_01646 | CDS | open | 419-727 | _na 102_aa | hypothetical protein | |
| 3297 | CAMXVP010000050.1 | GCA947252405_01647 | CDS | open | 981-1520 | _na 179_aa | DUF2017 domain-containing protein | |
| 3298 | CAMXVP010000050.1 | GCA947252405_01648 | CDS | open | 1549-2040 | _na 163_aa | clpS | ATP-dependent Clp protease adapter protein ClpS |
| 3299 | CAMXVP010000050.1 | GCA947252405_01649 | CDS | open | 2054-3304 | _na 416_aa | nicotinate phosphoribosyltransferase | |
| 3300 | CAMXVP010000050.1 | GCA947252405_01650 | CDS | open | 3314-5326 | _na 670_aa | DNA 5'-3' helicase | |
| 3301 | CAMXVP010000050.1 | GCA947252405_01651 | CDS | open | 5350-6111 | _na 253_aa | peptidyl-tRNA hydrolase | |
| 3302 | CAMXVP010000050.1 | GCA947252405_01652 | CDS | open | 6111-7388 | _na 425_aa | serB | phosphoserine phosphatase SerB |
| 3303 | CAMXVP010000050.1 | GCA947252405_01653 | CDS | open | 7471-9180 | _na 569_aa | ctaD | cytochrome c oxidase subunit I |
| 3304 | CAMXVP010000050.1 | GCA947252405_01654 | CDS | open | 9575-10570 | _na 331_aa | nrdF | class 1b ribonucleoside-diphosphate reductase subunit beta |
| 3305 | CAMXVP010000050.1 | GCA947252405_01655 | CDS | open | 10627-12777 | _na 716_aa | nrdE | class 1b ribonucleoside-diphosphate reductase subunit alpha |
| 3306 | CAMXVP010000050.1 | GCA947252405_01656 | CDS | open | 12914-13444 | _na 176_aa | nrdI | class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI |
| 3307 | CAMXVP010000050.1 | GCA947252405_01657 | CDS | open | 13513-13746 | _na 77_aa | nrdH | Glutaredoxin-like protein NrdH |
| 3308 | CAMXVP010000050.1 | GCA947252405_01646 | gene | open | 419-727 | |||
| 3309 | CAMXVP010000050.1 | GCA947252405_01647 | gene | open | 981-1520 | |||
| 3310 | CAMXVP010000050.1 | GCA947252405_01648 | gene | open | 1549-2040 | clpS | ||
| 3311 | CAMXVP010000050.1 | GCA947252405_01649 | gene | open | 2054-3304 | |||
| 3312 | CAMXVP010000050.1 | GCA947252405_01650 | gene | open | 3314-5326 | |||
| 3313 | CAMXVP010000050.1 | GCA947252405_01651 | gene | open | 5350-6111 | |||
| 3314 | CAMXVP010000050.1 | GCA947252405_01652 | gene | open | 6111-7388 | serB | ||
| 3315 | CAMXVP010000050.1 | GCA947252405_01653 | gene | open | 7471-9180 | ctaD | ||
| 3316 | CAMXVP010000050.1 | GCA947252405_01654 | gene | open | 9575-10570 | nrdF | ||
| 3317 | CAMXVP010000050.1 | GCA947252405_01655 | gene | open | 10627-12777 | nrdE | ||
| 3318 | CAMXVP010000050.1 | GCA947252405_01656 | gene | open | 12914-13444 | nrdI | ||
| 3319 | CAMXVP010000050.1 | GCA947252405_01657 | gene | open | 13513-13746 | nrdH | ||
| 3320 | CAMXVP010000051.1 | GCA947252405_01658 | CDS | open | 15-254 | _na 79_aa | hypothetical protein | |
| 3321 | CAMXVP010000051.1 | GCA947252405_01659 | CDS | open | 482-997 | _na 171_aa | Glycosyl-4%2C4'-diaponeurosporenoate acyltransferase | |
| 3322 | CAMXVP010000051.1 | GCA947252405_01660 | CDS | open | 1305-4487 | _na 1060_aa | Error-prone DNA polymerase | |
| 3323 | CAMXVP010000051.1 | GCA947252405_01661 | CDS | open | 4631-5530 | _na 299_aa | Methionine ABC transporter substrate-binding protein | |
| 3324 | CAMXVP010000051.1 | GCA947252405_01662 | CDS | open | 5536-6588 | _na 350_aa | Methionine ABC transporter ATP-binding protein | |
| 3325 | CAMXVP010000051.1 | GCA947252405_01663 | CDS | open | 6589-7272 | _na 227_aa | ABC transporter permease | |
| 3326 | CAMXVP010000051.1 | GCA947252405_01664 | CDS | open | 7374-8846 | _na 490_aa | APC family permease | |
| 3327 | CAMXVP010000051.1 | GCA947252405_01665 | CDS | open | 8843-10000 | _na 385_aa | Class II histone deacetylase | |
| 3328 | CAMXVP010000051.1 | GCA947252405_01666 | CDS | open | 10109-10219 | _na 36_aa | hypothetical protein | |
| 3329 | CAMXVP010000051.1 | GCA947252405_01667 | CDS | open | 10210-11133 | _na 307_aa | Sucrase ferredoxin | |
| 3330 | CAMXVP010000051.1 | GCA947252405_01668 | CDS | open | 11253-11855 | _na 200_aa | AMIN domain-containing protein | |
| 3331 | CAMXVP010000051.1 | GCA947252405_01669 | CDS | open | 11862-13418 | _na 518_aa | DNA polymerase | |
| 3332 | CAMXVP010000051.1 | GCA947252405_01658 | gene | open | 15-254 | |||
| 3333 | CAMXVP010000051.1 | GCA947252405_01659 | gene | open | 482-997 | |||
| 3334 | CAMXVP010000051.1 | GCA947252405_01660 | gene | open | 1305-4487 | |||
| 3335 | CAMXVP010000051.1 | GCA947252405_01661 | gene | open | 4631-5530 | |||
| 3336 | CAMXVP010000051.1 | GCA947252405_01662 | gene | open | 5536-6588 | |||
| 3337 | CAMXVP010000051.1 | GCA947252405_01663 | gene | open | 6589-7272 | |||
| 3338 | CAMXVP010000051.1 | GCA947252405_01664 | gene | open | 7374-8846 | |||
| 3339 | CAMXVP010000051.1 | GCA947252405_01665 | gene | open | 8843-10000 | |||
| 3340 | CAMXVP010000051.1 | GCA947252405_01666 | gene | open | 10109-10219 | |||
| 3341 | CAMXVP010000051.1 | GCA947252405_01667 | gene | open | 10210-11133 | |||
| 3342 | CAMXVP010000051.1 | GCA947252405_01668 | gene | open | 11253-11855 | |||
| 3343 | CAMXVP010000051.1 | GCA947252405_01669 | gene | open | 11862-13418 | |||
| 3344 | CAMXVP010000052.1 | GCA947252405_01670 | CDS | open | 150-920 | _na 256_aa | ABC transporter ATP-binding protein | |
| 3345 | CAMXVP010000052.1 | GCA947252405_01671 | CDS | open | 920-3487 | _na 855_aa | ABC transporter permease | |
| 3346 | CAMXVP010000052.1 | GCA947252405_01672 | CDS | open | 3501-3944 | _na 147_aa | fluC | Fluoride-specific ion channel FluC |
| 3347 | CAMXVP010000052.1 | GCA947252405_01673 | CDS | open | 3941-4285 | _na 114_aa | Fluoride-specific ion channel | |
| 3348 | CAMXVP010000052.1 | GCA947252405_01674 | CDS | open | 4404-6065 | _na 553_aa | pgm | phosphoglucomutase (alpha-D-glucose-1%2C6-bisphosphate-dependent) |
| 3349 | CAMXVP010000052.1 | GCA947252405_01675 | CDS | open | 6139-6591 | _na 150_aa | mauE | Methylamine utilisation protein MauE domain-containing protein |
| 3350 | CAMXVP010000052.1 | GCA947252405_01676 | CDS | open | 6640-7407 | _na 255_aa | Thioredoxin-like fold domain-containing protein | |
| 3351 | CAMXVP010000052.1 | GCA947252405_01678 | CDS | open | 7856-8494 | _na 212_aa | DUF2335 domain-containing protein | |
| 3352 | CAMXVP010000052.1 | GCA947252405_01679 | CDS | open | 8711-8965 | _na 84_aa | hypothetical protein | |
| 3353 | CAMXVP010000052.1 | GCA947252405_01680 | CDS | open | 8962-9447 | _na 161_aa | Nucleoside 2-deoxyribosyltransferase-like protein | |
| 3354 | CAMXVP010000052.1 | GCA947252405_01681 | CDS | open | 9547-10083 | _na 178_aa | hypothetical protein | |
| 3355 | CAMXVP010000052.1 | GCA947252405_01682 | CDS | open | 10092-10835 | _na 247_aa | Lipoprotein | |
| 3356 | CAMXVP010000052.1 | GCA947252405_01683 | CDS | open | 10843-11325 | _na 160_aa | Methylated-DNA--protein-cysteine methyltransferase | |
| 3357 | CAMXVP010000052.1 | GCA947252405_01684 | CDS | open | 11306-12067 | _na 253_aa | Fructosamine kinase | |
| 3358 | CAMXVP010000052.1 | GCA947252405_01685 | CDS | open | 12064-12900 | _na 278_aa | nadE | ammonia-dependent NAD(+) synthetase |
| 3359 | CAMXVP010000052.1 | GCA947252405_01670 | gene | open | 150-920 | |||
| 3360 | CAMXVP010000052.1 | GCA947252405_01671 | gene | open | 920-3487 | |||
| 3361 | CAMXVP010000052.1 | GCA947252405_01672 | gene | open | 3501-3944 | fluC | ||
| 3362 | CAMXVP010000052.1 | GCA947252405_01673 | gene | open | 3941-4285 | |||
| 3363 | CAMXVP010000052.1 | GCA947252405_01674 | gene | open | 4404-6065 | pgm | ||
| 3364 | CAMXVP010000052.1 | GCA947252405_01675 | gene | open | 6139-6591 | mauE | ||
| 3365 | CAMXVP010000052.1 | GCA947252405_01676 | gene | open | 6640-7407 | |||
| 3366 | CAMXVP010000052.1 | GCA947252405_01678 | gene | open | 7856-8494 | |||
| 3367 | CAMXVP010000052.1 | GCA947252405_01679 | gene | open | 8711-8965 | |||
| 3368 | CAMXVP010000052.1 | GCA947252405_01680 | gene | open | 8962-9447 | |||
| 3369 | CAMXVP010000052.1 | GCA947252405_01681 | gene | open | 9547-10083 | |||
| 3370 | CAMXVP010000052.1 | GCA947252405_01682 | gene | open | 10092-10835 | |||
| 3371 | CAMXVP010000052.1 | GCA947252405_01683 | gene | open | 10843-11325 | |||
| 3372 | CAMXVP010000052.1 | GCA947252405_01684 | gene | open | 11306-12067 | |||
| 3373 | CAMXVP010000052.1 | GCA947252405_01685 | gene | open | 12064-12900 | nadE | ||
| 3374 | CAMXVP010000052.1 | GCA947252405_01677 | gene | open | 7525-7597 | trnA | ||
| 3375 | CAMXVP010000052.1 | GCA947252405_01677 | tRNA | open | 7525-7597 | trnA | tRNA-Ala(ggc) | |
| 3376 | CAMXVP010000053.1 | GCA947252405_01686 | CDS | open | 10-411 | _na 133_aa | hypothetical protein | |
| 3377 | CAMXVP010000053.1 | GCA947252405_01687 | CDS | open | 560-1438 | _na 292_aa | Alpha/beta hydrolase | |
| 3378 | CAMXVP010000053.1 | GCA947252405_01688 | CDS | open | 1521-3602 | _na 693_aa | gyrB | DNA topoisomerase (ATP-hydrolyzing) subunit B |
| 3379 | CAMXVP010000053.1 | GCA947252405_01689 | CDS | open | 3781-5034 | _na 417_aa | AAA family ATPase | |
| 3380 | CAMXVP010000053.1 | GCA947252405_01690 | CDS | open | 5129-5755 | _na 208_aa | DUF721 domain-containing protein | |
| 3381 | CAMXVP010000053.1 | GCA947252405_01691 | CDS | open | 5752-6951 | _na 399_aa | recF | DNA replication/repair protein RecF |
| 3382 | CAMXVP010000053.1 | GCA947252405_01692 | CDS | open | 6996-8186 | _na 396_aa | dnaN | DNA polymerase III subunit beta |
| 3383 | CAMXVP010000053.1 | GCA947252405_01693 | CDS | open | 8790-10433 | _na 547_aa | dnaA | chromosomal replication initiator protein DnaA |
| 3384 | CAMXVP010000053.1 | GCA947252405_01694 | CDS | open | 10649-11167 | _na 172_aa | hypothetical protein | |
| 3385 | CAMXVP010000053.1 | GCA947252405_01695 | CDS | open | 11289-11426 | _na 45_aa | rpmH | 50S ribosomal protein L34 |
| 3386 | CAMXVP010000053.1 | GCA947252405_01696 | CDS | open | 11488-11796 | _na 102_aa | rnpA | ribonuclease P protein component |
| 3387 | CAMXVP010000053.1 | GCA947252405_01697 | CDS | open | 11924-12649 | _na 241_aa | hypothetical protein | |
| 3388 | CAMXVP010000053.1 | GCA947252405_01686 | gene | open | 10-411 | |||
| 3389 | CAMXVP010000053.1 | GCA947252405_01687 | gene | open | 560-1438 | |||
| 3390 | CAMXVP010000053.1 | GCA947252405_01688 | gene | open | 1521-3602 | gyrB | ||
| 3391 | CAMXVP010000053.1 | GCA947252405_01689 | gene | open | 3781-5034 | |||
| 3392 | CAMXVP010000053.1 | GCA947252405_01690 | gene | open | 5129-5755 | |||
| 3393 | CAMXVP010000053.1 | GCA947252405_01691 | gene | open | 5752-6951 | recF | ||
| 3394 | CAMXVP010000053.1 | GCA947252405_01692 | gene | open | 6996-8186 | dnaN | ||
| 3395 | CAMXVP010000053.1 | GCA947252405_01693 | gene | open | 8790-10433 | dnaA | ||
| 3396 | CAMXVP010000053.1 | GCA947252405_01694 | gene | open | 10649-11167 | |||
| 3397 | CAMXVP010000053.1 | GCA947252405_01695 | gene | open | 11289-11426 | rpmH | ||
| 3398 | CAMXVP010000053.1 | GCA947252405_01696 | gene | open | 11488-11796 | rnpA | ||
| 3399 | CAMXVP010000053.1 | GCA947252405_01697 | gene | open | 11924-12649 | |||
| 3400 | CAMXVP010000054.1 | GCA947252405_01698 | CDS | open | 102-452 | _na 116_aa | hypothetical protein | |
| 3401 | CAMXVP010000054.1 | GCA947252405_01699 | CDS | open | 513-1022 | _na 169_aa | hypothetical protein | |
| 3402 | CAMXVP010000054.1 | GCA947252405_01700 | CDS | open | 1060-1794 | _na 244_aa | lipB | lipoyl(octanoyl) transferase LipB |
| 3403 | CAMXVP010000054.1 | GCA947252405_01701 | CDS | open | 1822-2211 | _na 129_aa | gcvH | glycine cleavage system protein GcvH |
| 3404 | CAMXVP010000054.1 | GCA947252405_01702 | CDS | open | 2214-3302 | _na 362_aa | gcvT | glycine cleavage system aminomethyltransferase GcvT |
| 3405 | CAMXVP010000054.1 | GCA947252405_01703 | CDS | open | 3344-6199 | _na 951_aa | gcvP | aminomethyl-transferring glycine dehydrogenase |
| 3406 | CAMXVP010000054.1 | GCA947252405_01704 | CDS | open | 6350-8410 | _na 686_aa | sucB | 2-oxoglutarate dehydrogenase%2C E2 component%2C dihydrolipoamide succinyltransferase |
| 3407 | CAMXVP010000054.1 | GCA947252405_01705 | CDS | open | 8520-8924 | _na 134_aa | Oxidoreductase | |
| 3408 | CAMXVP010000054.1 | GCA947252405_01706 | CDS | open | 8937-10412 | _na 491_aa | putative cytosol aminopeptidase | |
| 3409 | CAMXVP010000054.1 | GCA947252405_01707 | CDS | open | 10508-11617 | _na 369_aa | branched-chain amino acid aminotransferase | |
| 3410 | CAMXVP010000054.1 | GCA947252405_01708 | CDS | open | 11633-12649 | _na 338_aa | nicotinate-nucleotide--dimethylbenzimidazole phosphoribosyltransferase | |
| 3411 | CAMXVP010000054.1 | GCA947252405_01698 | gene | open | 102-452 | |||
| 3412 | CAMXVP010000054.1 | GCA947252405_01699 | gene | open | 513-1022 | |||
| 3413 | CAMXVP010000054.1 | GCA947252405_01700 | gene | open | 1060-1794 | lipB | ||
| 3414 | CAMXVP010000054.1 | GCA947252405_01701 | gene | open | 1822-2211 | gcvH | ||
| 3415 | CAMXVP010000054.1 | GCA947252405_01702 | gene | open | 2214-3302 | gcvT | ||
| 3416 | CAMXVP010000054.1 | GCA947252405_01703 | gene | open | 3344-6199 | gcvP | ||
| 3417 | CAMXVP010000054.1 | GCA947252405_01704 | gene | open | 6350-8410 | sucB | ||
| 3418 | CAMXVP010000054.1 | GCA947252405_01705 | gene | open | 8520-8924 | |||
| 3419 | CAMXVP010000054.1 | GCA947252405_01706 | gene | open | 8937-10412 | |||
| 3420 | CAMXVP010000054.1 | GCA947252405_01707 | gene | open | 10508-11617 | |||
| 3421 | CAMXVP010000054.1 | GCA947252405_01708 | gene | open | 11633-12649 | |||
| 3422 | CAMXVP010000055.1 | GCA947252405_01709 | CDS | open | 206-1630 | _na 474_aa | UPF0033 domain-containing protein | |
| 3423 | CAMXVP010000055.1 | GCA947252405_01710 | CDS | open | 1850-2059 | _na 69_aa | hypothetical protein | |
| 3424 | CAMXVP010000055.1 | GCA947252405_01711 | CDS | open | 2104-4164 | _na 686_aa | Helicase XPB/Ssl2 N-terminal domain-containing protein | |
| 3425 | CAMXVP010000055.1 | GCA947252405_01712 | CDS | open | 4339-4527 | _na 62_aa | Transcriptional regulator | |
| 3426 | CAMXVP010000055.1 | GCA947252405_01713 | CDS | open | 4524-5006 | _na 160_aa | Secreted protein | |
| 3427 | CAMXVP010000055.1 | GCA947252405_01714 | CDS | open | 5009-5098 | _na 29_aa | hypothetical protein | |
| 3428 | CAMXVP010000055.1 | GCA947252405_01715 | CDS | open | 5144-5887 | _na 247_aa | ABC transporter ATP-binding protein | |
| 3429 | CAMXVP010000055.1 | GCA947252405_01716 | CDS | open | 5888-7087 | _na 399_aa | ABC transporter permease | |
| 3430 | CAMXVP010000055.1 | GCA947252405_01717 | CDS | open | 7321-8970 | _na 549_aa | DNA repair helicase XPB | |
| 3431 | CAMXVP010000055.1 | GCA947252405_01718 | CDS | open | 8981-9628 | _na 215_aa | DUF3239 domain-containing protein | |
| 3432 | CAMXVP010000055.1 | GCA947252405_01719 | CDS | open | 9741-11564 | _na 607_aa | Metallophosphoesterase family protein | |
| 3433 | CAMXVP010000055.1 | GCA947252405_01720 | CDS | open | 11628-12416 | _na 262_aa | putative membrane transporter protein | |
| 3434 | CAMXVP010000055.1 | GCA947252405_01709 | gene | open | 206-1630 | |||
| 3435 | CAMXVP010000055.1 | GCA947252405_01710 | gene | open | 1850-2059 | |||
| 3436 | CAMXVP010000055.1 | GCA947252405_01711 | gene | open | 2104-4164 | |||
| 3437 | CAMXVP010000055.1 | GCA947252405_01712 | gene | open | 4339-4527 | |||
| 3438 | CAMXVP010000055.1 | GCA947252405_01713 | gene | open | 4524-5006 | |||
| 3439 | CAMXVP010000055.1 | GCA947252405_01714 | gene | open | 5009-5098 | |||
| 3440 | CAMXVP010000055.1 | GCA947252405_01715 | gene | open | 5144-5887 | |||
| 3441 | CAMXVP010000055.1 | GCA947252405_01716 | gene | open | 5888-7087 | |||
| 3442 | CAMXVP010000055.1 | GCA947252405_01717 | gene | open | 7321-8970 | |||
| 3443 | CAMXVP010000055.1 | GCA947252405_01718 | gene | open | 8981-9628 | |||
| 3444 | CAMXVP010000055.1 | GCA947252405_01719 | gene | open | 9741-11564 | |||
| 3445 | CAMXVP010000055.1 | GCA947252405_01720 | gene | open | 11628-12416 | |||
| 3446 | CAMXVP010000056.1 | GCA947252405_01721 | CDS | open | 114-677 | _na 187_aa | hypothetical protein | |
| 3447 | CAMXVP010000056.1 | GCA947252405_01722 | CDS | open | 1042-1452 | _na 136_aa | Secreted protein | |
| 3448 | CAMXVP010000056.1 | GCA947252405_01723 | CDS | open | 1449-2231 | _na 260_aa | CPBP family intramembrane metalloprotease | |
| 3449 | CAMXVP010000056.1 | GCA947252405_01724 | CDS | open | 2417-3055 | _na 212_aa | Lactate utilization protein B/C | |
| 3450 | CAMXVP010000056.1 | GCA947252405_01725 | CDS | open | 3055-4587 | _na 510_aa | LutB/LldF family L-lactate oxidation iron-sulfur protein | |
| 3451 | CAMXVP010000056.1 | GCA947252405_01726 | CDS | open | 4584-5369 | _na 261_aa | lldE | L-lactate dehydrogenase complex protein LldE |
| 3452 | CAMXVP010000056.1 | GCA947252405_01727 | CDS | open | 5539-7206 | _na 555_aa | argS | arginine--tRNA ligase |
| 3453 | CAMXVP010000056.1 | GCA947252405_01728 | CDS | open | 7210-8610 | _na 466_aa | lysA | diaminopimelate decarboxylase |
| 3454 | CAMXVP010000056.1 | GCA947252405_01729 | CDS | open | 8665-10017 | _na 450_aa | Homoserine dehydrogenase | |
| 3455 | CAMXVP010000056.1 | GCA947252405_01730 | CDS | open | 10043-10972 | _na 309_aa | thrB | homoserine kinase |
| 3456 | CAMXVP010000056.1 | GCA947252405_01731 | CDS | open | 10976-12466 | _na 496_aa | long-chain fatty-acid--CoA ligase | |
| 3457 | CAMXVP010000056.1 | GCA947252405_01721 | gene | open | 114-677 | |||
| 3458 | CAMXVP010000056.1 | GCA947252405_01722 | gene | open | 1042-1452 | |||
| 3459 | CAMXVP010000056.1 | GCA947252405_01723 | gene | open | 1449-2231 | |||
| 3460 | CAMXVP010000056.1 | GCA947252405_01724 | gene | open | 2417-3055 | |||
| 3461 | CAMXVP010000056.1 | GCA947252405_01725 | gene | open | 3055-4587 | |||
| 3462 | CAMXVP010000056.1 | GCA947252405_01726 | gene | open | 4584-5369 | lldE | ||
| 3463 | CAMXVP010000056.1 | GCA947252405_01727 | gene | open | 5539-7206 | argS | ||
| 3464 | CAMXVP010000056.1 | GCA947252405_01728 | gene | open | 7210-8610 | lysA | ||
| 3465 | CAMXVP010000056.1 | GCA947252405_01729 | gene | open | 8665-10017 | |||
| 3466 | CAMXVP010000056.1 | GCA947252405_01730 | gene | open | 10043-10972 | thrB | ||
| 3467 | CAMXVP010000056.1 | GCA947252405_01731 | gene | open | 10976-12466 | |||
| 3468 | CAMXVP010000057.1 | GCA947252405_01732 | CDS | open | 49-369 | _na 106_aa | hypothetical protein | |
| 3469 | CAMXVP010000057.1 | GCA947252405_01734 | CDS | open | 754-1296 | _na 180_aa | Polyisoprenoid-binding protein | |
| 3470 | CAMXVP010000057.1 | GCA947252405_01735 | CDS | open | 1293-1772 | _na 159_aa | marR | MarR family transcriptional regulator |
| 3471 | CAMXVP010000057.1 | GCA947252405_01736 | CDS | open | 1843-4497 | _na 884_aa | Rad50/SbcC-type AAA domain-containing protein | |
| 3472 | CAMXVP010000057.1 | GCA947252405_01737 | CDS | open | 4497-5648 | _na 383_aa | DNA repair exonuclease | |
| 3473 | CAMXVP010000057.1 | GCA947252405_01738 | CDS | open | 5708-6580 | _na 290_aa | SWIM-type domain-containing protein | |
| 3474 | CAMXVP010000057.1 | GCA947252405_01739 | CDS | open | 6584-9637 | _na 1017_aa | ATP-dependent helicase | |
| 3475 | CAMXVP010000057.1 | GCA947252405_01740 | CDS | open | 9771-11363 | _na 530_aa | putP | sodium/proline symporter PutP |
| 3476 | CAMXVP010000057.1 | GCA947252405_01741 | CDS | open | 11370-11993 | _na 207_aa | HNH endonuclease | |
| 3477 | CAMXVP010000057.1 | GCA947252405_01732 | gene | open | 49-369 | |||
| 3478 | CAMXVP010000057.1 | GCA947252405_01734 | gene | open | 754-1296 | |||
| 3479 | CAMXVP010000057.1 | GCA947252405_01735 | gene | open | 1293-1772 | marR | ||
| 3480 | CAMXVP010000057.1 | GCA947252405_01736 | gene | open | 1843-4497 | |||
| 3481 | CAMXVP010000057.1 | GCA947252405_01737 | gene | open | 4497-5648 | |||
| 3482 | CAMXVP010000057.1 | GCA947252405_01738 | gene | open | 5708-6580 | |||
| 3483 | CAMXVP010000057.1 | GCA947252405_01739 | gene | open | 6584-9637 | |||
| 3484 | CAMXVP010000057.1 | GCA947252405_01740 | gene | open | 9771-11363 | putP | ||
| 3485 | CAMXVP010000057.1 | GCA947252405_01741 | gene | open | 11370-11993 | |||
| 3486 | CAMXVP010000057.1 | GCA947252405_01733 | gene | open | 484-557 | trnR | ||
| 3487 | CAMXVP010000057.1 | GCA947252405_01733 | tRNA | open | 484-557 | trnR | tRNA-Arg(ccg) | |
| 3488 | CAMXVP010000058.1 | repeat_region | open | 1-1503 | CRISPR array with 25 repeats of length 28%2C consensus sequence GGACCACCCCCGCGCATGCGGGGAAGAC and spacer length 33 | |||
| 3489 | CAMXVP010000058.1 | GCA947252405_01742 | CDS | open | 1597-4959 | _na 1120_aa | cas3u | type I-U CRISPR-associated helicase/endonuclease Cas3 |
| 3490 | CAMXVP010000058.1 | GCA947252405_01743 | CDS | open | 4956-6206 | _na 416_aa | csb2 | type I-U CRISPR-associated protein Csb2 |
| 3491 | CAMXVP010000058.1 | GCA947252405_01744 | CDS | open | 6206-7495 | _na 429_aa | Type I-U CRISPR-associated protein Cas7 | |
| 3492 | CAMXVP010000058.1 | GCA947252405_01745 | CDS | open | 7529-8269 | _na 246_aa | Type I-E CRISPR-associated protein Cas6/Cse3/CasE | |
| 3493 | CAMXVP010000058.1 | GCA947252405_01746 | CDS | open | 8409-10373 | _na 654_aa | DNA helicase | |
| 3494 | CAMXVP010000058.1 | GCA947252405_01747 | CDS | open | 10332-11681 | _na 449_aa | Mutator family transposase | |
| 3495 | CAMXVP010000058.1 | GCA947252405_01742 | gene | open | 1597-4959 | cas3u | ||
| 3496 | CAMXVP010000058.1 | GCA947252405_01743 | gene | open | 4956-6206 | csb2 | ||
| 3497 | CAMXVP010000058.1 | GCA947252405_01744 | gene | open | 6206-7495 | |||
| 3498 | CAMXVP010000058.1 | GCA947252405_01745 | gene | open | 7529-8269 | |||
| 3499 | CAMXVP010000058.1 | GCA947252405_01746 | gene | open | 8409-10373 | |||
| 3500 | CAMXVP010000058.1 | GCA947252405_01747 | gene | open | 10332-11681 |

