BAKTAGenome Explorer: Corynebacterium tuscaniense (GCA_947252405.1)
Select a Genome:
|
BAKTA Annotations for GCA_947252405.1
|
Search & Sort all 4055 Records
| ||||||||||||||||||
Notes: 1- Column headers only sort the current page. 2- Select [NA] or [AA] links to show sequences.
| Region | Protein-ID | Type | Genome Viewer |
Range (bp) |
Show Sequences (length) NA / AA |
BAKTA Gene |
BAKTA GeneProduct |
|
|---|---|---|---|---|---|---|---|---|
| 3501 | CAMXVP010000059.1 | regulatory_region | open | 6992-7115 | atpB RNA | |||
| 3502 | CAMXVP010000059.1 | GCA947252405_01748 | CDS | open | 695-2494 | _na 599_aa | rho | transcription termination factor Rho |
| 3503 | CAMXVP010000059.1 | GCA947252405_01749 | CDS | open | 2495-3574 | _na 359_aa | prfA | peptide chain release factor 1 |
| 3504 | CAMXVP010000059.1 | GCA947252405_01750 | CDS | open | 3579-4484 | _na 301_aa | prmC | peptide chain release factor N(5)-glutamine methyltransferase |
| 3505 | CAMXVP010000059.1 | GCA947252405_01751 | CDS | open | 4502-5167 | _na 221_aa | L-threonylcarbamoyladenylate synthase | |
| 3506 | CAMXVP010000059.1 | GCA947252405_01752 | CDS | open | 5171-6319 | _na 382_aa | Undecaprenyl-phosphate alpha-N-acetylglucosaminyl 1-phosphate transferase | |
| 3507 | CAMXVP010000059.1 | GCA947252405_01753 | CDS | open | 6325-6768 | _na 147_aa | Integral membrane protein | |
| 3508 | CAMXVP010000059.1 | GCA947252405_01754 | CDS | open | 7123-7920 | _na 265_aa | atpB | F0F1 ATP synthase subunit A |
| 3509 | CAMXVP010000059.1 | GCA947252405_01755 | CDS | open | 8029-8271 | _na 80_aa | ATP synthase F0 subunit C | |
| 3510 | CAMXVP010000059.1 | GCA947252405_01756 | CDS | open | 8325-8906 | _na 193_aa | F0F1 ATP synthase subunit B | |
| 3511 | CAMXVP010000059.1 | GCA947252405_01757 | CDS | open | 8915-9754 | _na 279_aa | F0F1 ATP synthase subunit delta | |
| 3512 | CAMXVP010000059.1 | GCA947252405_01758 | CDS | open | 9929-10594 | _na 221_aa | hypothetical protein | |
| 3513 | CAMXVP010000059.1 | GCA947252405_01748 | gene | open | 695-2494 | rho | ||
| 3514 | CAMXVP010000059.1 | GCA947252405_01749 | gene | open | 2495-3574 | prfA | ||
| 3515 | CAMXVP010000059.1 | GCA947252405_01750 | gene | open | 3579-4484 | prmC | ||
| 3516 | CAMXVP010000059.1 | GCA947252405_01751 | gene | open | 4502-5167 | |||
| 3517 | CAMXVP010000059.1 | GCA947252405_01752 | gene | open | 5171-6319 | |||
| 3518 | CAMXVP010000059.1 | GCA947252405_01753 | gene | open | 6325-6768 | |||
| 3519 | CAMXVP010000059.1 | GCA947252405_01754 | gene | open | 7123-7920 | atpB | ||
| 3520 | CAMXVP010000059.1 | GCA947252405_01755 | gene | open | 8029-8271 | |||
| 3521 | CAMXVP010000059.1 | GCA947252405_01756 | gene | open | 8325-8906 | |||
| 3522 | CAMXVP010000059.1 | GCA947252405_01757 | gene | open | 8915-9754 | |||
| 3523 | CAMXVP010000059.1 | GCA947252405_01758 | gene | open | 9929-10594 | |||
| 3524 | CAMXVP010000060.1 | GCA947252405_01759 | gene | open | 182-280 | Bacteria_small_SRP | ||
| 3525 | CAMXVP010000060.1 | GCA947252405_01759 | ncRNA | open | 182-280 | Bacterial small signal recognition particle RNA | ||
| 3526 | CAMXVP010000060.1 | GCA947252405_01760 | CDS | open | 362-1633 | _na 423_aa | Aminotransferase | |
| 3527 | CAMXVP010000060.1 | GCA947252405_01761 | CDS | open | 1633-2178 | _na 181_aa | Suppressor of fused-like domain-containing protein | |
| 3528 | CAMXVP010000060.1 | GCA947252405_01762 | CDS | open | 2193-2837 | _na 214_aa | DNA-binding response regulator | |
| 3529 | CAMXVP010000060.1 | GCA947252405_01763 | CDS | open | 2834-3511 | _na 225_aa | histidine kinase | |
| 3530 | CAMXVP010000060.1 | GCA947252405_01764 | CDS | open | 3603-4283 | _na 226_aa | Putative ABC transport system ATP-binding protein | |
| 3531 | CAMXVP010000060.1 | GCA947252405_01765 | CDS | open | 4280-5671 | _na 463_aa | FtsX-like permease family protein | |
| 3532 | CAMXVP010000060.1 | GCA947252405_01766 | CDS | open | 6012-6257 | _na 81_aa | copG | Ribbon-helix-helix protein%2C copG family |
| 3533 | CAMXVP010000060.1 | GCA947252405_01767 | CDS | open | 6351-8522 | _na 723_aa | DNA polymerase III subunit gamma and tau | |
| 3534 | CAMXVP010000060.1 | GCA947252405_01768 | CDS | open | 8580-8939 | _na 119_aa | YbaB/EbfC family nucleoid-associated protein | |
| 3535 | CAMXVP010000060.1 | GCA947252405_01769 | CDS | open | 8999-9634 | _na 211_aa | recR | recombination mediator RecR |
| 3536 | CAMXVP010000060.1 | GCA947252405_01760 | gene | open | 362-1633 | |||
| 3537 | CAMXVP010000060.1 | GCA947252405_01761 | gene | open | 1633-2178 | |||
| 3538 | CAMXVP010000060.1 | GCA947252405_01762 | gene | open | 2193-2837 | |||
| 3539 | CAMXVP010000060.1 | GCA947252405_01763 | gene | open | 2834-3511 | |||
| 3540 | CAMXVP010000060.1 | GCA947252405_01764 | gene | open | 3603-4283 | |||
| 3541 | CAMXVP010000060.1 | GCA947252405_01765 | gene | open | 4280-5671 | |||
| 3542 | CAMXVP010000060.1 | GCA947252405_01766 | gene | open | 6012-6257 | copG | ||
| 3543 | CAMXVP010000060.1 | GCA947252405_01767 | gene | open | 6351-8522 | |||
| 3544 | CAMXVP010000060.1 | GCA947252405_01768 | gene | open | 8580-8939 | |||
| 3545 | CAMXVP010000060.1 | GCA947252405_01769 | gene | open | 8999-9634 | recR | ||
| 3546 | CAMXVP010000061.1 | GCA947252405_01770 | CDS | open | 17-1627 | _na 536_aa | hypothetical protein | |
| 3547 | CAMXVP010000061.1 | GCA947252405_01771 | CDS | open | 1631-2101 | _na 156_aa | MaoC-like domain-containing protein | |
| 3548 | CAMXVP010000061.1 | GCA947252405_01772 | CDS | open | 2681-3319 | _na 212_aa | DUF3558 domain-containing protein | |
| 3549 | CAMXVP010000061.1 | GCA947252405_01773 | CDS | open | 3341-3478 | _na 45_aa | hypothetical protein | |
| 3550 | CAMXVP010000061.1 | GCA947252405_01774 | CDS | open | 3629-4261 | _na 210_aa | DUF3558 domain-containing protein | |
| 3551 | CAMXVP010000061.1 | GCA947252405_01775 | CDS | open | 4285-5952 | _na 555_aa | PPE family protein | |
| 3552 | CAMXVP010000061.1 | GCA947252405_01776 | CDS | open | 6014-6262 | _na 82_aa | transposase | |
| 3553 | CAMXVP010000061.1 | GCA947252405_01777 | CDS | open | 6314-7447 | _na 377_aa | ATP-binding protein | |
| 3554 | CAMXVP010000061.1 | GCA947252405_01778 | CDS | open | 7588-7866 | _na 92_aa | hypothetical protein | |
| 3555 | CAMXVP010000061.1 | GCA947252405_01779 | CDS | open | 7948-8322 | _na 124_aa | Roadblock/LAMTOR2 domain-containing protein | |
| 3556 | CAMXVP010000061.1 | GCA947252405_01780 | CDS | open | 8494-9144 | _na 216_aa | ATP-binding protein | |
| 3557 | CAMXVP010000061.1 | GCA947252405_01781 | CDS | open | 9141-9644 | _na 167_aa | Roadblock/LAMTOR2 domain-containing protein | |
| 3558 | CAMXVP010000061.1 | GCA947252405_01782 | CDS | open | 9692-9871 | _na 59_aa | hypothetical protein | |
| 3559 | CAMXVP010000061.1 | GCA947252405_01770 | gene | open | 17-1627 | |||
| 3560 | CAMXVP010000061.1 | GCA947252405_01771 | gene | open | 1631-2101 | |||
| 3561 | CAMXVP010000061.1 | GCA947252405_01772 | gene | open | 2681-3319 | |||
| 3562 | CAMXVP010000061.1 | GCA947252405_01773 | gene | open | 3341-3478 | |||
| 3563 | CAMXVP010000061.1 | GCA947252405_01774 | gene | open | 3629-4261 | |||
| 3564 | CAMXVP010000061.1 | GCA947252405_01775 | gene | open | 4285-5952 | |||
| 3565 | CAMXVP010000061.1 | GCA947252405_01776 | gene | open | 6014-6262 | |||
| 3566 | CAMXVP010000061.1 | GCA947252405_01777 | gene | open | 6314-7447 | |||
| 3567 | CAMXVP010000061.1 | GCA947252405_01778 | gene | open | 7588-7866 | |||
| 3568 | CAMXVP010000061.1 | GCA947252405_01779 | gene | open | 7948-8322 | |||
| 3569 | CAMXVP010000061.1 | GCA947252405_01780 | gene | open | 8494-9144 | |||
| 3570 | CAMXVP010000061.1 | GCA947252405_01781 | gene | open | 9141-9644 | |||
| 3571 | CAMXVP010000061.1 | GCA947252405_01782 | gene | open | 9692-9871 | |||
| 3572 | CAMXVP010000062.1 | GCA947252405_01783 | CDS | open | 43-1011 | _na 322_aa | hypothetical protein | |
| 3573 | CAMXVP010000062.1 | GCA947252405_01784 | CDS | open | 1228-1884 | _na 218_aa | Tat pathway signal sequence domain protein | |
| 3574 | CAMXVP010000062.1 | GCA947252405_01785 | CDS | open | 1885-2460 | _na 191_aa | TetR/AcrR family transcriptional regulator | |
| 3575 | CAMXVP010000062.1 | GCA947252405_01786 | CDS | open | 2566-3258 | _na 230_aa | ABC transporter domain-containing protein | |
| 3576 | CAMXVP010000062.1 | GCA947252405_01787 | CDS | open | 3255-5399 | _na 714_aa | YhgE/Pip domain-containing protein | |
| 3577 | CAMXVP010000062.1 | GCA947252405_01788 | CDS | open | 5693-6991 | _na 432_aa | Alpha/beta hydrolase | |
| 3578 | CAMXVP010000062.1 | GCA947252405_01789 | CDS | open | 7167-7820 | _na 217_aa | DNA-binding response regulator | |
| 3579 | CAMXVP010000062.1 | GCA947252405_01790 | CDS | open | 7817-8848 | _na 343_aa | Signal transduction histidine kinase subgroup 3 dimerisation and phosphoacceptor domain-containing protein | |
| 3580 | CAMXVP010000062.1 | GCA947252405_01791 | CDS | open | 8845-9471 | _na 208_aa | CPBP family intramembrane metalloprotease | |
| 3581 | CAMXVP010000062.1 | GCA947252405_01792 | CDS | open | 9410-9682 | _na 90_aa | hypothetical protein | |
| 3582 | CAMXVP010000062.1 | GCA947252405_01783 | gene | open | 43-1011 | |||
| 3583 | CAMXVP010000062.1 | GCA947252405_01784 | gene | open | 1228-1884 | |||
| 3584 | CAMXVP010000062.1 | GCA947252405_01785 | gene | open | 1885-2460 | |||
| 3585 | CAMXVP010000062.1 | GCA947252405_01786 | gene | open | 2566-3258 | |||
| 3586 | CAMXVP010000062.1 | GCA947252405_01787 | gene | open | 3255-5399 | |||
| 3587 | CAMXVP010000062.1 | GCA947252405_01788 | gene | open | 5693-6991 | |||
| 3588 | CAMXVP010000062.1 | GCA947252405_01789 | gene | open | 7167-7820 | |||
| 3589 | CAMXVP010000062.1 | GCA947252405_01790 | gene | open | 7817-8848 | |||
| 3590 | CAMXVP010000062.1 | GCA947252405_01791 | gene | open | 8845-9471 | |||
| 3591 | CAMXVP010000062.1 | GCA947252405_01792 | gene | open | 9410-9682 | |||
| 3592 | CAMXVP010000063.1 | GCA947252405_01793 | CDS | open | 63-575 | _na 170_aa | hypothetical protein | |
| 3593 | CAMXVP010000063.1 | GCA947252405_01794 | CDS | open | 1119-1589 | _na 156_aa | hypothetical protein | |
| 3594 | CAMXVP010000063.1 | GCA947252405_01795 | CDS | open | 1827-2219 | _na 130_aa | hypothetical protein | |
| 3595 | CAMXVP010000063.1 | GCA947252405_01796 | CDS | open | 2857-3486 | _na 209_aa | TIGR03085 family protein | |
| 3596 | CAMXVP010000063.1 | GCA947252405_01797 | CDS | open | 3562-5586 | _na 674_aa | Ribonuclease J | |
| 3597 | CAMXVP010000063.1 | GCA947252405_01798 | CDS | open | 5589-6530 | _na 313_aa | dapA | 4-hydroxy-tetrahydrodipicolinate synthase |
| 3598 | CAMXVP010000063.1 | GCA947252405_01799 | CDS | open | 6556-7308 | _na 250_aa | thyX | FAD-dependent thymidylate synthase |
| 3599 | CAMXVP010000063.1 | GCA947252405_01800 | CDS | open | 7309-8055 | _na 248_aa | dapB | 4-hydroxy-tetrahydrodipicolinate reductase |
| 3600 | CAMXVP010000063.1 | GCA947252405_01801 | CDS | open | 8188-8796 | _na 202_aa | AMIN domain-containing protein | |
| 3601 | CAMXVP010000063.1 | GCA947252405_01802 | CDS | open | 8858-9406 | _na 182_aa | Secreted protein | |
| 3602 | CAMXVP010000063.1 | GCA947252405_01793 | gene | open | 63-575 | |||
| 3603 | CAMXVP010000063.1 | GCA947252405_01794 | gene | open | 1119-1589 | |||
| 3604 | CAMXVP010000063.1 | GCA947252405_01795 | gene | open | 1827-2219 | |||
| 3605 | CAMXVP010000063.1 | GCA947252405_01796 | gene | open | 2857-3486 | |||
| 3606 | CAMXVP010000063.1 | GCA947252405_01797 | gene | open | 3562-5586 | |||
| 3607 | CAMXVP010000063.1 | GCA947252405_01798 | gene | open | 5589-6530 | dapA | ||
| 3608 | CAMXVP010000063.1 | GCA947252405_01799 | gene | open | 6556-7308 | thyX | ||
| 3609 | CAMXVP010000063.1 | GCA947252405_01800 | gene | open | 7309-8055 | dapB | ||
| 3610 | CAMXVP010000063.1 | GCA947252405_01801 | gene | open | 8188-8796 | |||
| 3611 | CAMXVP010000063.1 | GCA947252405_01802 | gene | open | 8858-9406 | |||
| 3612 | CAMXVP010000064.1 | GCA947252405_01803 | CDS | open | 4-192 | _na 62_aa | hypothetical protein | |
| 3613 | CAMXVP010000064.1 | GCA947252405_01804 | CDS | open | 189-1412 | _na 407_aa | acetylornithine transaminase | |
| 3614 | CAMXVP010000064.1 | GCA947252405_01805 | CDS | open | 1415-2365 | _na 316_aa | argF | ornithine carbamoyltransferase |
| 3615 | CAMXVP010000064.1 | GCA947252405_01806 | CDS | open | 2367-2885 | _na 172_aa | arginine repressor | |
| 3616 | CAMXVP010000064.1 | GCA947252405_01807 | CDS | open | 2944-4146 | _na 400_aa | argininosuccinate synthase | |
| 3617 | CAMXVP010000064.1 | GCA947252405_01808 | CDS | open | 4198-5634 | _na 478_aa | argH | argininosuccinate lyase |
| 3618 | CAMXVP010000064.1 | GCA947252405_01809 | CDS | open | 5693-6937 | _na 414_aa | Secreted protein | |
| 3619 | CAMXVP010000064.1 | GCA947252405_01810 | CDS | open | 6952-8526 | _na 524_aa | VWA domain-containing protein | |
| 3620 | CAMXVP010000064.1 | GCA947252405_01811 | CDS | open | 8513-9142 | _na 209_aa | Secreted protein | |
| 3621 | CAMXVP010000064.1 | GCA947252405_01812 | CDS | open | 9163-9354 | _na 63_aa | UPF0434 protein CJ203_01990 | |
| 3622 | CAMXVP010000064.1 | GCA947252405_01803 | gene | open | 4-192 | |||
| 3623 | CAMXVP010000064.1 | GCA947252405_01804 | gene | open | 189-1412 | |||
| 3624 | CAMXVP010000064.1 | GCA947252405_01805 | gene | open | 1415-2365 | argF | ||
| 3625 | CAMXVP010000064.1 | GCA947252405_01806 | gene | open | 2367-2885 | |||
| 3626 | CAMXVP010000064.1 | GCA947252405_01807 | gene | open | 2944-4146 | |||
| 3627 | CAMXVP010000064.1 | GCA947252405_01808 | gene | open | 4198-5634 | argH | ||
| 3628 | CAMXVP010000064.1 | GCA947252405_01809 | gene | open | 5693-6937 | |||
| 3629 | CAMXVP010000064.1 | GCA947252405_01810 | gene | open | 6952-8526 | |||
| 3630 | CAMXVP010000064.1 | GCA947252405_01811 | gene | open | 8513-9142 | |||
| 3631 | CAMXVP010000064.1 | GCA947252405_01812 | gene | open | 9163-9354 | |||
| 3632 | CAMXVP010000065.1 | GCA947252405_01813 | CDS | open | 87-1628 | _na 513_aa | hypothetical protein | |
| 3633 | CAMXVP010000065.1 | GCA947252405_01814 | CDS | open | 1625-2188 | _na 187_aa | amaP | Alkaline shock response membrane anchor protein AmaP |
| 3634 | CAMXVP010000065.1 | GCA947252405_01815 | CDS | open | 2185-2763 | _na 192_aa | amaP | Alkaline shock response membrane anchor protein AmaP |
| 3635 | CAMXVP010000065.1 | GCA947252405_01816 | CDS | open | 2768-3616 | _na 282_aa | Asp23/Gls24 family envelope stress response protein | |
| 3636 | CAMXVP010000065.1 | GCA947252405_01817 | CDS | open | 3616-3816 | _na 66_aa | DUF2273 domain-containing protein | |
| 3637 | CAMXVP010000065.1 | GCA947252405_01818 | CDS | open | 3832-4173 | _na 113_aa | Asp23/Gls24 family envelope stress response protein | |
| 3638 | CAMXVP010000065.1 | GCA947252405_01819 | CDS | open | 4174-4671 | _na 165_aa | Asp23/Gls24 family envelope stress response protein | |
| 3639 | CAMXVP010000065.1 | GCA947252405_01820 | CDS | open | 4749-5261 | _na 170_aa | hypothetical protein | |
| 3640 | CAMXVP010000065.1 | GCA947252405_01821 | CDS | open | 5510-5815 | _na 101_aa | rpsJ | 30S ribosomal protein S10 |
| 3641 | CAMXVP010000065.1 | GCA947252405_01822 | CDS | open | 5839-6492 | _na 217_aa | rplC | 50S ribosomal protein L3 |
| 3642 | CAMXVP010000065.1 | GCA947252405_01823 | CDS | open | 6489-7142 | _na 217_aa | rplD | 50S ribosomal protein L4 |
| 3643 | CAMXVP010000065.1 | GCA947252405_01824 | CDS | open | 7142-7444 | _na 100_aa | rplW | 50S ribosomal protein L23 |
| 3644 | CAMXVP010000065.1 | GCA947252405_01825 | CDS | open | 7487-8320 | _na 277_aa | rplB | 50S ribosomal protein L2 |
| 3645 | CAMXVP010000065.1 | GCA947252405_01826 | CDS | open | 8337-8612 | _na 91_aa | rpsS | 30S ribosomal protein S19 |
| 3646 | CAMXVP010000065.1 | GCA947252405_01813 | gene | open | 87-1628 | |||
| 3647 | CAMXVP010000065.1 | GCA947252405_01814 | gene | open | 1625-2188 | amaP | ||
| 3648 | CAMXVP010000065.1 | GCA947252405_01815 | gene | open | 2185-2763 | amaP | ||
| 3649 | CAMXVP010000065.1 | GCA947252405_01816 | gene | open | 2768-3616 | |||
| 3650 | CAMXVP010000065.1 | GCA947252405_01817 | gene | open | 3616-3816 | |||
| 3651 | CAMXVP010000065.1 | GCA947252405_01818 | gene | open | 3832-4173 | |||
| 3652 | CAMXVP010000065.1 | GCA947252405_01819 | gene | open | 4174-4671 | |||
| 3653 | CAMXVP010000065.1 | GCA947252405_01820 | gene | open | 4749-5261 | |||
| 3654 | CAMXVP010000065.1 | GCA947252405_01821 | gene | open | 5510-5815 | rpsJ | ||
| 3655 | CAMXVP010000065.1 | GCA947252405_01822 | gene | open | 5839-6492 | rplC | ||
| 3656 | CAMXVP010000065.1 | GCA947252405_01823 | gene | open | 6489-7142 | rplD | ||
| 3657 | CAMXVP010000065.1 | GCA947252405_01824 | gene | open | 7142-7444 | rplW | ||
| 3658 | CAMXVP010000065.1 | GCA947252405_01825 | gene | open | 7487-8320 | rplB | ||
| 3659 | CAMXVP010000065.1 | GCA947252405_01826 | gene | open | 8337-8612 | rpsS | ||
| 3660 | CAMXVP010000066.1 | GCA947252405_01827 | CDS | open | 382-1590 | _na 402_aa | Nif3-like dinuclear metal center hexameric protein | |
| 3661 | CAMXVP010000066.1 | GCA947252405_01828 | CDS | open | 1627-2094 | _na 155_aa | protein-tyrosine-phosphatase | |
| 3662 | CAMXVP010000066.1 | GCA947252405_01829 | CDS | open | 2100-3062 | _na 320_aa | SURF1-like protein | |
| 3663 | CAMXVP010000066.1 | GCA947252405_01831 | CDS | open | 3479-6832 | _na 1117_aa | aceE | pyruvate dehydrogenase (acetyl-transferring)%2C homodimeric type |
| 3664 | CAMXVP010000066.1 | GCA947252405_01827 | gene | open | 382-1590 | |||
| 3665 | CAMXVP010000066.1 | GCA947252405_01828 | gene | open | 1627-2094 | |||
| 3666 | CAMXVP010000066.1 | GCA947252405_01829 | gene | open | 2100-3062 | |||
| 3667 | CAMXVP010000066.1 | GCA947252405_01831 | gene | open | 3479-6832 | aceE | ||
| 3668 | CAMXVP010000066.1 | GCA947252405_01830 | gene | open | 3263-3338 | trnV | ||
| 3669 | CAMXVP010000066.1 | GCA947252405_01830 | tRNA | open | 3263-3338 | trnV | tRNA-Val(tac) | |
| 3670 | CAMXVP010000067.1 | regulatory_region | open | 4457-4553 | TPP riboswitch aptamer (THI element) | |||
| 3671 | CAMXVP010000067.1 | GCA947252405_01832 | CDS | open | 342-1220 | _na 292_aa | hypothetical protein | |
| 3672 | CAMXVP010000067.1 | GCA947252405_01833 | CDS | open | 1342-2241 | _na 299_aa | Alpha/beta hydrolase | |
| 3673 | CAMXVP010000067.1 | GCA947252405_01834 | CDS | open | 2292-2957 | _na 221_aa | tenA | thiaminase II |
| 3674 | CAMXVP010000067.1 | GCA947252405_01835 | CDS | open | 2962-3621 | _na 219_aa | Aminopyrimidine aminohydrolase | |
| 3675 | CAMXVP010000067.1 | GCA947252405_01836 | CDS | open | 3614-4468 | _na 284_aa | Bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase | |
| 3676 | CAMXVP010000067.1 | GCA947252405_01837 | CDS | open | 4604-5047 | _na 147_aa | DUF2267 domain-containing protein | |
| 3677 | CAMXVP010000067.1 | GCA947252405_01838 | CDS | open | 5310-5657 | _na 115_aa | Secreted protein | |
| 3678 | CAMXVP010000067.1 | GCA947252405_01839 | CDS | open | 5717-5974 | _na 85_aa | tetR | TetR family transcriptional regulator |
| 3679 | CAMXVP010000067.1 | GCA947252405_01840 | CDS | open | 5987-6211 | _na 74_aa | copG | CopG family transcriptional regulator |
| 3680 | CAMXVP010000067.1 | GCA947252405_01841 | CDS | open | 6430-7776 | _na 448_aa | hypothetical protein | |
| 3681 | CAMXVP010000067.1 | GCA947252405_01832 | gene | open | 342-1220 | |||
| 3682 | CAMXVP010000067.1 | GCA947252405_01833 | gene | open | 1342-2241 | |||
| 3683 | CAMXVP010000067.1 | GCA947252405_01834 | gene | open | 2292-2957 | tenA | ||
| 3684 | CAMXVP010000067.1 | GCA947252405_01835 | gene | open | 2962-3621 | |||
| 3685 | CAMXVP010000067.1 | GCA947252405_01836 | gene | open | 3614-4468 | |||
| 3686 | CAMXVP010000067.1 | GCA947252405_01837 | gene | open | 4604-5047 | |||
| 3687 | CAMXVP010000067.1 | GCA947252405_01838 | gene | open | 5310-5657 | |||
| 3688 | CAMXVP010000067.1 | GCA947252405_01839 | gene | open | 5717-5974 | tetR | ||
| 3689 | CAMXVP010000067.1 | GCA947252405_01840 | gene | open | 5987-6211 | copG | ||
| 3690 | CAMXVP010000067.1 | GCA947252405_01841 | gene | open | 6430-7776 | |||
| 3691 | CAMXVP010000068.1 | GCA947252405_01842 | CDS | open | 809-1792 | _na 327_aa | malate dehydrogenase | |
| 3692 | CAMXVP010000068.1 | GCA947252405_01843 | CDS | open | 2050-2904 | _na 284_aa | TetR/AcrR family transcriptional regulator | |
| 3693 | CAMXVP010000068.1 | GCA947252405_01844 | CDS | open | 2940-4211 | _na 423_aa | clpX | ATP-dependent Clp protease ATP-binding subunit ClpX |
| 3694 | CAMXVP010000068.1 | GCA947252405_01845 | CDS | open | 4461-4934 | _na 157_aa | DUF3558 domain-containing protein | |
| 3695 | CAMXVP010000068.1 | GCA947252405_01846 | CDS | open | 5011-5631 | _na 206_aa | ATP-dependent Clp protease proteolytic subunit | |
| 3696 | CAMXVP010000068.1 | GCA947252405_01847 | CDS | open | 5663-6244 | _na 193_aa | ATP-dependent Clp protease proteolytic subunit | |
| 3697 | CAMXVP010000068.1 | GCA947252405_01848 | CDS | open | 6435-7793 | _na 452_aa | tig | trigger factor |
| 3698 | CAMXVP010000068.1 | GCA947252405_01842 | gene | open | 809-1792 | |||
| 3699 | CAMXVP010000068.1 | GCA947252405_01843 | gene | open | 2050-2904 | |||
| 3700 | CAMXVP010000068.1 | GCA947252405_01844 | gene | open | 2940-4211 | clpX | ||
| 3701 | CAMXVP010000068.1 | GCA947252405_01845 | gene | open | 4461-4934 | |||
| 3702 | CAMXVP010000068.1 | GCA947252405_01846 | gene | open | 5011-5631 | |||
| 3703 | CAMXVP010000068.1 | GCA947252405_01847 | gene | open | 5663-6244 | |||
| 3704 | CAMXVP010000068.1 | GCA947252405_01848 | gene | open | 6435-7793 | tig | ||
| 3705 | CAMXVP010000069.1 | GCA947252405_01849 | CDS | open | 69-251 | _na 60_aa | hypothetical protein | |
| 3706 | CAMXVP010000069.1 | GCA947252405_01850 | CDS | open | 542-1552 | _na 336_aa | Acyl-CoA:diacylglycerol acyltransferase | |
| 3707 | CAMXVP010000069.1 | GCA947252405_01851 | CDS | open | 1665-3479 | _na 604_aa | Arabinofuranosyltransferase | |
| 3708 | CAMXVP010000069.1 | GCA947252405_01852 | CDS | open | 3490-4488 | _na 332_aa | decaprenyl-phosphate phosphoribosyltransferase | |
| 3709 | CAMXVP010000069.1 | GCA947252405_01853 | CDS | open | 4485-4658 | _na 57_aa | hypothetical protein | |
| 3710 | CAMXVP010000069.1 | GCA947252405_01854 | CDS | open | 4740-4967 | _na 75_aa | hypothetical protein | |
| 3711 | CAMXVP010000069.1 | GCA947252405_01855 | CDS | open | 4999-6903 | _na 634_aa | Glycosyltransferase | |
| 3712 | CAMXVP010000069.1 | GCA947252405_01856 | CDS | open | 7158-7391 | _na 77_aa | three-helix bundle dimerization domain-containing protein | |
| 3713 | CAMXVP010000069.1 | GCA947252405_01849 | gene | open | 69-251 | |||
| 3714 | CAMXVP010000069.1 | GCA947252405_01850 | gene | open | 542-1552 | |||
| 3715 | CAMXVP010000069.1 | GCA947252405_01851 | gene | open | 1665-3479 | |||
| 3716 | CAMXVP010000069.1 | GCA947252405_01852 | gene | open | 3490-4488 | |||
| 3717 | CAMXVP010000069.1 | GCA947252405_01853 | gene | open | 4485-4658 | |||
| 3718 | CAMXVP010000069.1 | GCA947252405_01854 | gene | open | 4740-4967 | |||
| 3719 | CAMXVP010000069.1 | GCA947252405_01855 | gene | open | 4999-6903 | |||
| 3720 | CAMXVP010000069.1 | GCA947252405_01856 | gene | open | 7158-7391 | |||
| 3721 | CAMXVP010000070.1 | GCA947252405_01858 | CDS | open | 1287-1670 | _na 127_aa | Phage holin family protein | |
| 3722 | CAMXVP010000070.1 | GCA947252405_01859 | CDS | open | 1840-2364 | _na 174_aa | DUF3800 domain-containing protein | |
| 3723 | CAMXVP010000070.1 | GCA947252405_01860 | CDS | open | 2380-3300 | _na 306_aa | IS256 family transposase | |
| 3724 | CAMXVP010000070.1 | GCA947252405_01861 | CDS | open | 3670-4080 | _na 136_aa | ATP-binding protein | |
| 3725 | CAMXVP010000070.1 | GCA947252405_01862 | CDS | open | 4077-4724 | _na 215_aa | response regulator | |
| 3726 | CAMXVP010000070.1 | GCA947252405_01863 | CDS | open | 4928-6448 | _na 506_aa | Aldehyde dehydrogenase family protein | |
| 3727 | CAMXVP010000070.1 | GCA947252405_01864 | CDS | open | 6625-7062 | _na 145_aa | MFS transporter | |
| 3728 | CAMXVP010000070.1 | GCA947252405_01865 | CDS | open | 7397-7492 | _na 31_aa | hypothetical protein | |
| 3729 | CAMXVP010000070.1 | GCA947252405_01858 | gene | open | 1287-1670 | |||
| 3730 | CAMXVP010000070.1 | GCA947252405_01859 | gene | open | 1840-2364 | |||
| 3731 | CAMXVP010000070.1 | GCA947252405_01860 | gene | open | 2380-3300 | |||
| 3732 | CAMXVP010000070.1 | GCA947252405_01861 | gene | open | 3670-4080 | |||
| 3733 | CAMXVP010000070.1 | GCA947252405_01862 | gene | open | 4077-4724 | |||
| 3734 | CAMXVP010000070.1 | GCA947252405_01863 | gene | open | 4928-6448 | |||
| 3735 | CAMXVP010000070.1 | GCA947252405_01864 | gene | open | 6625-7062 | |||
| 3736 | CAMXVP010000070.1 | GCA947252405_01865 | gene | open | 7397-7492 | |||
| 3737 | CAMXVP010000070.1 | GCA947252405_01857 | gene | open | 55-144 | trnS | ||
| 3738 | CAMXVP010000070.1 | GCA947252405_01866 | gene | open | 7594-7669 | trnS | ||
| 3739 | CAMXVP010000070.1 | GCA947252405_01857 | tRNA | open | 55-144 | trnS | tRNA-Ser(gct) | |
| 3740 | CAMXVP010000070.1 | GCA947252405_01866 | tRNA | open | 7594-7669 | trnS | tRNA-Ser(tga) | |
| 3741 | CAMXVP010000071.1 | GCA947252405_01867 | CDS | open | 78-266 | _na 62_aa | HNH endonuclease | |
| 3742 | CAMXVP010000071.1 | GCA947252405_01868 | CDS | open | 375-1304 | _na 309_aa | Putative fimbrial associated sortase | |
| 3743 | CAMXVP010000071.1 | GCA947252405_01869 | CDS | open | 1387-4893 | _na 1168_aa | LPXTG-motif protein cell wall anchor domain protein | |
| 3744 | CAMXVP010000071.1 | GCA947252405_01870 | CDS | open | 4893-5744 | _na 283_aa | Surface anchored protein | |
| 3745 | CAMXVP010000071.1 | GCA947252405_01871 | CDS | open | 5749-6510 | _na 253_aa | Putative fimbrial associated sortase-like protein | |
| 3746 | CAMXVP010000071.1 | GCA947252405_01872 | CDS | open | 6851-7636 | _na 261_aa | hypothetical protein | |
| 3747 | CAMXVP010000071.1 | GCA947252405_01867 | gene | open | 78-266 | |||
| 3748 | CAMXVP010000071.1 | GCA947252405_01868 | gene | open | 375-1304 | |||
| 3749 | CAMXVP010000071.1 | GCA947252405_01869 | gene | open | 1387-4893 | |||
| 3750 | CAMXVP010000071.1 | GCA947252405_01870 | gene | open | 4893-5744 | |||
| 3751 | CAMXVP010000071.1 | GCA947252405_01871 | gene | open | 5749-6510 | |||
| 3752 | CAMXVP010000071.1 | GCA947252405_01872 | gene | open | 6851-7636 | |||
| 3753 | CAMXVP010000072.1 | GCA947252405_01875 | gene | open | 1544-1948 | RNaseP_bact_a | ||
| 3754 | CAMXVP010000072.1 | GCA947252405_01875 | ncRNA | open | 1544-1948 | Bacterial RNase P class A | ||
| 3755 | CAMXVP010000072.1 | GCA947252405_01873 | CDS | open | 75-368 | _na 97_aa | hypothetical protein | |
| 3756 | CAMXVP010000072.1 | GCA947252405_01874 | CDS | open | 372-1499 | _na 375_aa | bifunctional RNase H/acid phosphatase | |
| 3757 | CAMXVP010000072.1 | GCA947252405_01876 | CDS | open | 1933-3372 | _na 479_aa | Exoribonuclease | |
| 3758 | CAMXVP010000072.1 | GCA947252405_01877 | CDS | open | 3369-4625 | _na 418_aa | Galactokinase | |
| 3759 | CAMXVP010000072.1 | GCA947252405_01878 | CDS | open | 4738-4944 | _na 68_aa | SPOR domain-containing protein | |
| 3760 | CAMXVP010000072.1 | GCA947252405_01879 | CDS | open | 4980-6593 | _na 537_aa | Metal-chelation protein CHAD | |
| 3761 | CAMXVP010000072.1 | GCA947252405_01880 | CDS | open | 6598-6771 | _na 57_aa | hypothetical protein | |
| 3762 | CAMXVP010000072.1 | GCA947252405_01873 | gene | open | 75-368 | |||
| 3763 | CAMXVP010000072.1 | GCA947252405_01874 | gene | open | 372-1499 | |||
| 3764 | CAMXVP010000072.1 | GCA947252405_01876 | gene | open | 1933-3372 | |||
| 3765 | CAMXVP010000072.1 | GCA947252405_01877 | gene | open | 3369-4625 | |||
| 3766 | CAMXVP010000072.1 | GCA947252405_01878 | gene | open | 4738-4944 | |||
| 3767 | CAMXVP010000072.1 | GCA947252405_01879 | gene | open | 4980-6593 | |||
| 3768 | CAMXVP010000072.1 | GCA947252405_01880 | gene | open | 6598-6771 | |||
| 3769 | CAMXVP010000073.1 | GCA947252405_01881 | CDS | open | 71-871 | _na 266_aa | cmrA | mycolate reductase |
| 3770 | CAMXVP010000073.1 | GCA947252405_01882 | CDS | open | 882-1514 | _na 210_aa | orn | oligoribonuclease |
| 3771 | CAMXVP010000073.1 | GCA947252405_01884 | CDS | open | 1713-2906 | _na 397_aa | Transpeptidase | |
| 3772 | CAMXVP010000073.1 | GCA947252405_01886 | CDS | open | 3370-4002 | _na 210_aa | Cytokinin riboside 5'-monophosphate phosphoribohydrolase | |
| 3773 | CAMXVP010000073.1 | GCA947252405_01887 | CDS | open | 4014-4586 | _na 190_aa | nicotinamidase | |
| 3774 | CAMXVP010000073.1 | GCA947252405_01888 | CDS | open | 4636-4914 | _na 92_aa | DUF3618 domain-containing protein | |
| 3775 | CAMXVP010000073.1 | GCA947252405_01889 | CDS | open | 5025-5501 | _na 158_aa | bcp | thioredoxin-dependent thiol peroxidase |
| 3776 | CAMXVP010000073.1 | GCA947252405_01891 | CDS | open | 5752-6204 | _na 150_aa | Transcriptional regulator | |
| 3777 | CAMXVP010000073.1 | GCA947252405_01892 | CDS | open | 6270-6659 | _na 129_aa | DUF3817 domain-containing protein | |
| 3778 | CAMXVP010000073.1 | GCA947252405_01881 | gene | open | 71-871 | cmrA | ||
| 3779 | CAMXVP010000073.1 | GCA947252405_01882 | gene | open | 882-1514 | orn | ||
| 3780 | CAMXVP010000073.1 | GCA947252405_01884 | gene | open | 1713-2906 | |||
| 3781 | CAMXVP010000073.1 | GCA947252405_01886 | gene | open | 3370-4002 | |||
| 3782 | CAMXVP010000073.1 | GCA947252405_01887 | gene | open | 4014-4586 | |||
| 3783 | CAMXVP010000073.1 | GCA947252405_01888 | gene | open | 4636-4914 | |||
| 3784 | CAMXVP010000073.1 | GCA947252405_01889 | gene | open | 5025-5501 | bcp | ||
| 3785 | CAMXVP010000073.1 | GCA947252405_01891 | gene | open | 5752-6204 | |||
| 3786 | CAMXVP010000073.1 | GCA947252405_01892 | gene | open | 6270-6659 | |||
| 3787 | CAMXVP010000073.1 | GCA947252405_01883 | gene | open | 1563-1635 | trnH | ||
| 3788 | CAMXVP010000073.1 | GCA947252405_01885 | gene | open | 3213-3285 | trnK | ||
| 3789 | CAMXVP010000073.1 | GCA947252405_01890 | gene | open | 5606-5687 | trnL | ||
| 3790 | CAMXVP010000073.1 | GCA947252405_01883 | tRNA | open | 1563-1635 | trnH | tRNA-His(gtg) | |
| 3791 | CAMXVP010000073.1 | GCA947252405_01885 | tRNA | open | 3213-3285 | trnK | tRNA-Lys(ctt) | |
| 3792 | CAMXVP010000073.1 | GCA947252405_01890 | tRNA | open | 5606-5687 | trnL | tRNA-Leu(tag) | |
| 3793 | CAMXVP010000074.1 | GCA947252405_01893 | CDS | open | 122-943 | _na 273_aa | hypothetical protein | |
| 3794 | CAMXVP010000074.1 | GCA947252405_01894 | CDS | open | 897-1844 | _na 315_aa | aspartate carbamoyltransferase catalytic subunit | |
| 3795 | CAMXVP010000074.1 | GCA947252405_01895 | CDS | open | 1844-2395 | _na 183_aa | pyrR | bifunctional pyr operon transcriptional regulator/uracil phosphoribosyltransferase PyrR |
| 3796 | CAMXVP010000074.1 | GCA947252405_01896 | CDS | open | 2594-3064 | _na 156_aa | ybjN | YbjN domain-containing protein |
| 3797 | CAMXVP010000074.1 | GCA947252405_01897 | CDS | open | 3066-3530 | _na 154_aa | ybjN | YbjN domain-containing protein |
| 3798 | CAMXVP010000074.1 | GCA947252405_01898 | CDS | open | 3546-3866 | _na 106_aa | hypothetical protein | |
| 3799 | CAMXVP010000074.1 | GCA947252405_01899 | CDS | open | 3970-5175 | _na 401_aa | SAM-dependent DNA methyltransferase | |
| 3800 | CAMXVP010000074.1 | GCA947252405_01900 | CDS | open | 5202-5831 | _na 209_aa | DUF4062 domain-containing protein | |
| 3801 | CAMXVP010000074.1 | GCA947252405_01901 | CDS | open | 6055-6360 | _na 101_aa | hypothetical protein | |
| 3802 | CAMXVP010000074.1 | GCA947252405_01902 | CDS | open | 6357-6512 | _na 51_aa | eamA | EamA domain-containing protein |
| 3803 | CAMXVP010000074.1 | GCA947252405_01893 | gene | open | 122-943 | |||
| 3804 | CAMXVP010000074.1 | GCA947252405_01894 | gene | open | 897-1844 | |||
| 3805 | CAMXVP010000074.1 | GCA947252405_01895 | gene | open | 1844-2395 | pyrR | ||
| 3806 | CAMXVP010000074.1 | GCA947252405_01896 | gene | open | 2594-3064 | ybjN | ||
| 3807 | CAMXVP010000074.1 | GCA947252405_01897 | gene | open | 3066-3530 | ybjN | ||
| 3808 | CAMXVP010000074.1 | GCA947252405_01898 | gene | open | 3546-3866 | |||
| 3809 | CAMXVP010000074.1 | GCA947252405_01899 | gene | open | 3970-5175 | |||
| 3810 | CAMXVP010000074.1 | GCA947252405_01900 | gene | open | 5202-5831 | |||
| 3811 | CAMXVP010000074.1 | GCA947252405_01901 | gene | open | 6055-6360 | |||
| 3812 | CAMXVP010000074.1 | GCA947252405_01902 | gene | open | 6357-6512 | eamA | ||
| 3813 | CAMXVP010000075.1 | GCA947252405_01903 | CDS | open | 4-681 | _na 225_aa | TIGR03089 family protein | |
| 3814 | CAMXVP010000075.1 | GCA947252405_01904 | CDS | open | 701-1111 | _na 136_aa | ydcF | YdcF family protein |
| 3815 | CAMXVP010000075.1 | GCA947252405_01905 | CDS | open | 1169-1669 | _na 166_aa | N5-carboxyaminoimidazole ribonucleotide mutase | |
| 3816 | CAMXVP010000075.1 | GCA947252405_01906 | CDS | open | 1689-2906 | _na 405_aa | 5-(carboxyamino)imidazole ribonucleotide synthase | |
| 3817 | CAMXVP010000075.1 | GCA947252405_01907 | CDS | open | 3068-3286 | _na 72_aa | hypothetical protein | |
| 3818 | CAMXVP010000075.1 | GCA947252405_01908 | CDS | open | 3283-4008 | _na 241_aa | budA | acetolactate decarboxylase |
| 3819 | CAMXVP010000075.1 | GCA947252405_01909 | CDS | open | 4020-4424 | _na 134_aa | DUF304 domain-containing protein | |
| 3820 | CAMXVP010000075.1 | GCA947252405_01910 | CDS | open | 4468-5199 | _na 243_aa | Biotin--[acetyl-CoA-carboxylase] ligase | |
| 3821 | CAMXVP010000075.1 | GCA947252405_01911 | CDS | open | 5755-6420 | _na 221_aa | hypothetical protein | |
| 3822 | CAMXVP010000075.1 | GCA947252405_01903 | gene | open | 4-681 | |||
| 3823 | CAMXVP010000075.1 | GCA947252405_01904 | gene | open | 701-1111 | ydcF | ||
| 3824 | CAMXVP010000075.1 | GCA947252405_01905 | gene | open | 1169-1669 | |||
| 3825 | CAMXVP010000075.1 | GCA947252405_01906 | gene | open | 1689-2906 | |||
| 3826 | CAMXVP010000075.1 | GCA947252405_01907 | gene | open | 3068-3286 | |||
| 3827 | CAMXVP010000075.1 | GCA947252405_01908 | gene | open | 3283-4008 | budA | ||
| 3828 | CAMXVP010000075.1 | GCA947252405_01909 | gene | open | 4020-4424 | |||
| 3829 | CAMXVP010000075.1 | GCA947252405_01910 | gene | open | 4468-5199 | |||
| 3830 | CAMXVP010000075.1 | GCA947252405_01911 | gene | open | 5755-6420 | |||
| 3831 | CAMXVP010000076.1 | GCA947252405_01912 | CDS | open | 512-856 | _na 114_aa | FeS cluster biogenesis domain-containing protein | |
| 3832 | CAMXVP010000076.1 | GCA947252405_01913 | CDS | open | 933-1925 | _na 330_aa | Tail specific protease domain-containing protein | |
| 3833 | CAMXVP010000076.1 | GCA947252405_01914 | CDS | open | 1939-3861 | _na 640_aa | asnB | asparagine synthase (glutamine-hydrolyzing) |
| 3834 | CAMXVP010000076.1 | GCA947252405_01915 | CDS | open | 4453-5430 | _na 325_aa | cytochrome-c oxidase | |
| 3835 | CAMXVP010000076.1 | GCA947252405_01916 | CDS | open | 5450-5881 | _na 143_aa | Cytochrome c oxidase polypeptide 4 | |
| 3836 | CAMXVP010000076.1 | GCA947252405_01912 | gene | open | 512-856 | |||
| 3837 | CAMXVP010000076.1 | GCA947252405_01913 | gene | open | 933-1925 | |||
| 3838 | CAMXVP010000076.1 | GCA947252405_01914 | gene | open | 1939-3861 | asnB | ||
| 3839 | CAMXVP010000076.1 | GCA947252405_01915 | gene | open | 4453-5430 | |||
| 3840 | CAMXVP010000076.1 | GCA947252405_01916 | gene | open | 5450-5881 | |||
| 3841 | CAMXVP010000077.1 | GCA947252405_01917 | CDS | open | 362-1168 | _na 268_aa | thymidylate synthase | |
| 3842 | CAMXVP010000077.1 | GCA947252405_01918 | CDS | open | 1165-1938 | _na 257_aa | 3'(2')%2C5-bisphosphonucleoside 3'(2')-phosphohydrolase | |
| 3843 | CAMXVP010000077.1 | GCA947252405_01919 | CDS | open | 2286-3161 | _na 291_aa | hypothetical protein | |
| 3844 | CAMXVP010000077.1 | GCA947252405_01920 | CDS | open | 4364-4915 | _na 183_aa | hypothetical protein | |
| 3845 | CAMXVP010000077.1 | GCA947252405_01921 | CDS | open | 5038-5361 | _na 107_aa | hypothetical protein | |
| 3846 | CAMXVP010000077.1 | GCA947252405_01917 | gene | open | 362-1168 | |||
| 3847 | CAMXVP010000077.1 | GCA947252405_01918 | gene | open | 1165-1938 | |||
| 3848 | CAMXVP010000077.1 | GCA947252405_01919 | gene | open | 2286-3161 | |||
| 3849 | CAMXVP010000077.1 | GCA947252405_01920 | gene | open | 4364-4915 | |||
| 3850 | CAMXVP010000077.1 | GCA947252405_01921 | gene | open | 5038-5361 | |||
| 3851 | CAMXVP010000078.1 | GCA947252405_01922 | CDS | open | 179-793 | _na 204_aa | DUF1541 domain-containing protein | |
| 3852 | CAMXVP010000078.1 | GCA947252405_01923 | CDS | open | 932-1489 | _na 185_aa | DDE domain | |
| 3853 | CAMXVP010000078.1 | GCA947252405_01924 | CDS | open | 1721-2317 | _na 198_aa | cadD | Cadmium resistance transporter |
| 3854 | CAMXVP010000078.1 | GCA947252405_01925 | CDS | open | 2317-2676 | _na 119_aa | arsR | HTH-type transcriptional regulator CmtR |
| 3855 | CAMXVP010000078.1 | GCA947252405_01926 | CDS | open | 2913-3377 | _na 154_aa | hypothetical protein | |
| 3856 | CAMXVP010000078.1 | GCA947252405_01927 | CDS | open | 4189-5949 | _na 586_aa | Transposase | |
| 3857 | CAMXVP010000078.1 | GCA947252405_01922 | gene | open | 179-793 | |||
| 3858 | CAMXVP010000078.1 | GCA947252405_01923 | gene | open | 932-1489 | |||
| 3859 | CAMXVP010000078.1 | GCA947252405_01924 | gene | open | 1721-2317 | cadD | ||
| 3860 | CAMXVP010000078.1 | GCA947252405_01925 | gene | open | 2317-2676 | arsR | ||
| 3861 | CAMXVP010000078.1 | GCA947252405_01926 | gene | open | 2913-3377 | |||
| 3862 | CAMXVP010000078.1 | GCA947252405_01927 | gene | open | 4189-5949 | |||
| 3863 | CAMXVP010000079.1 | GCA947252405_01928 | CDS | open | 141-1151 | _na 336_aa | ABC transporter permease | |
| 3864 | CAMXVP010000079.1 | GCA947252405_01929 | CDS | open | 1152-1910 | _na 252_aa | ABC-2 type transport system ATP-binding protein | |
| 3865 | CAMXVP010000079.1 | GCA947252405_01930 | CDS | open | 1907-2221 | _na 104_aa | gntR | DNA-binding transcriptional regulator YhcF%2C GntR family |
| 3866 | CAMXVP010000079.1 | GCA947252405_01931 | CDS | open | 2492-3631 | _na 379_aa | NYN domain-containing protein | |
| 3867 | CAMXVP010000079.1 | GCA947252405_01932 | CDS | open | 3634-4407 | _na 257_aa | PspA/IM30 family protein | |
| 3868 | CAMXVP010000079.1 | GCA947252405_01933 | CDS | open | 4493-4870 | _na 125_aa | trxA | thioredoxin |
| 3869 | CAMXVP010000079.1 | GCA947252405_01934 | CDS | open | 4967-5170 | _na 67_aa | Transporter | |
| 3870 | CAMXVP010000079.1 | GCA947252405_01935 | CDS | open | 5192-5398 | _na 68_aa | heavy-metal-associated domain-containing protein | |
| 3871 | CAMXVP010000079.1 | GCA947252405_01936 | CDS | open | 5395-5622 | _na 75_aa | hypothetical protein | |
| 3872 | CAMXVP010000079.1 | GCA947252405_01928 | gene | open | 141-1151 | |||
| 3873 | CAMXVP010000079.1 | GCA947252405_01929 | gene | open | 1152-1910 | |||
| 3874 | CAMXVP010000079.1 | GCA947252405_01930 | gene | open | 1907-2221 | gntR | ||
| 3875 | CAMXVP010000079.1 | GCA947252405_01931 | gene | open | 2492-3631 | |||
| 3876 | CAMXVP010000079.1 | GCA947252405_01932 | gene | open | 3634-4407 | |||
| 3877 | CAMXVP010000079.1 | GCA947252405_01933 | gene | open | 4493-4870 | trxA | ||
| 3878 | CAMXVP010000079.1 | GCA947252405_01934 | gene | open | 4967-5170 | |||
| 3879 | CAMXVP010000079.1 | GCA947252405_01935 | gene | open | 5192-5398 | |||
| 3880 | CAMXVP010000079.1 | GCA947252405_01936 | gene | open | 5395-5622 | |||
| 3881 | CAMXVP010000080.1 | GCA947252405_01937 | CDS | open | 81-1067 | _na 328_aa | 23S rRNA pseudouridylate synthase | |
| 3882 | CAMXVP010000080.1 | GCA947252405_01938 | CDS | open | 1057-1191 | _na 44_aa | hypothetical protein | |
| 3883 | CAMXVP010000080.1 | GCA947252405_01939 | CDS | open | 1292-2200 | _na 302_aa | Universal stress protein | |
| 3884 | CAMXVP010000080.1 | GCA947252405_01940 | CDS | open | 2373-2639 | _na 88_aa | GlsB/YeaQ/YmgE family stress response membrane protein | |
| 3885 | CAMXVP010000080.1 | GCA947252405_01941 | CDS | open | 2699-3337 | _na 212_aa | tetR | TetR family transcriptional regulator |
| 3886 | CAMXVP010000080.1 | GCA947252405_01942 | CDS | open | 3276-4430 | _na 384_aa | yidC | membrane protein insertase YidC |
| 3887 | CAMXVP010000080.1 | GCA947252405_01943 | CDS | open | 4498-5259 | _na 253_aa | Class E sortase | |
| 3888 | CAMXVP010000080.1 | GCA947252405_01944 | CDS | open | 5265-5435 | _na 56_aa | Secreted protein | |
| 3889 | CAMXVP010000080.1 | GCA947252405_01945 | CDS | open | 5416-5766 | _na 116_aa | DUF2020 domain-containing protein | |
| 3890 | CAMXVP010000080.1 | GCA947252405_01937 | gene | open | 81-1067 | |||
| 3891 | CAMXVP010000080.1 | GCA947252405_01938 | gene | open | 1057-1191 | |||
| 3892 | CAMXVP010000080.1 | GCA947252405_01939 | gene | open | 1292-2200 | |||
| 3893 | CAMXVP010000080.1 | GCA947252405_01940 | gene | open | 2373-2639 | |||
| 3894 | CAMXVP010000080.1 | GCA947252405_01941 | gene | open | 2699-3337 | tetR | ||
| 3895 | CAMXVP010000080.1 | GCA947252405_01942 | gene | open | 3276-4430 | yidC | ||
| 3896 | CAMXVP010000080.1 | GCA947252405_01943 | gene | open | 4498-5259 | |||
| 3897 | CAMXVP010000080.1 | GCA947252405_01944 | gene | open | 5265-5435 | |||
| 3898 | CAMXVP010000080.1 | GCA947252405_01945 | gene | open | 5416-5766 | |||
| 3899 | CAMXVP010000081.1 | GCA947252405_01946 | CDS | open | 183-653 | _na 156_aa | hypothetical protein | |
| 3900 | CAMXVP010000081.1 | GCA947252405_01947 | CDS | open | 508-1701 | _na 397_aa | Acyltransferase | |
| 3901 | CAMXVP010000081.1 | GCA947252405_01948 | CDS | open | 1742-2299 | _na 185_aa | DUF3068 domain-containing protein | |
| 3902 | CAMXVP010000081.1 | GCA947252405_01949 | CDS | open | 2283-3887 | _na 534_aa | Integral membrane protein | |
| 3903 | CAMXVP010000081.1 | GCA947252405_01950 | CDS | open | 3766-4839 | _na 357_aa | Glycosyl transferase | |
| 3904 | CAMXVP010000081.1 | GCA947252405_01951 | CDS | open | 4876-5619 | _na 247_aa | SAM-dependent methyltransferase | |
| 3905 | CAMXVP010000081.1 | GCA947252405_01946 | gene | open | 183-653 | |||
| 3906 | CAMXVP010000081.1 | GCA947252405_01947 | gene | open | 508-1701 | |||
| 3907 | CAMXVP010000081.1 | GCA947252405_01948 | gene | open | 1742-2299 | |||
| 3908 | CAMXVP010000081.1 | GCA947252405_01949 | gene | open | 2283-3887 | |||
| 3909 | CAMXVP010000081.1 | GCA947252405_01950 | gene | open | 3766-4839 | |||
| 3910 | CAMXVP010000081.1 | GCA947252405_01951 | gene | open | 4876-5619 | |||
| 3911 | CAMXVP010000082.1 | GCA947252405_01952 | CDS | open | 523-1704 | _na 393_aa | Peptidase M20 | |
| 3912 | CAMXVP010000082.1 | GCA947252405_01953 | CDS | open | 1835-3487 | _na 550_aa | PPE family protein | |
| 3913 | CAMXVP010000082.1 | GCA947252405_01954 | CDS | open | 3506-4153 | _na 215_aa | DUF3558 domain-containing protein | |
| 3914 | CAMXVP010000082.1 | GCA947252405_01955 | CDS | open | 4403-5224 | _na 273_aa | Serine hydrolase | |
| 3915 | CAMXVP010000082.1 | GCA947252405_01952 | gene | open | 523-1704 | |||
| 3916 | CAMXVP010000082.1 | GCA947252405_01953 | gene | open | 1835-3487 | |||
| 3917 | CAMXVP010000082.1 | GCA947252405_01954 | gene | open | 3506-4153 | |||
| 3918 | CAMXVP010000082.1 | GCA947252405_01955 | gene | open | 4403-5224 | |||
| 3919 | CAMXVP010000083.1 | GCA947252405_01956 | CDS | open | 156-1772 | _na 538_aa | YcaO-like family protein | |
| 3920 | CAMXVP010000083.1 | GCA947252405_01957 | CDS | open | 1800-3617 | _na 605_aa | cydD | ABC transporter ATP-binding protein/permease |
| 3921 | CAMXVP010000083.1 | GCA947252405_01958 | CDS | open | 3619-5346 | _na 575_aa | mdlB | ABC transporter ATP-binding protein |
| 3922 | CAMXVP010000083.1 | GCA947252405_01956 | gene | open | 156-1772 | |||
| 3923 | CAMXVP010000083.1 | GCA947252405_01957 | gene | open | 1800-3617 | cydD | ||
| 3924 | CAMXVP010000083.1 | GCA947252405_01958 | gene | open | 3619-5346 | mdlB | ||
| 3925 | CAMXVP010000084.1 | GCA947252405_01959 | CDS | open | 288-1184 | _na 298_aa | L-ribulose-5-phosphate 3-epimerase | |
| 3926 | CAMXVP010000084.1 | GCA947252405_01960 | CDS | open | 1181-1834 | _na 217_aa | 3-dehydro-L-gulonate-6-phosphate decarboxylase | |
| 3927 | CAMXVP010000084.1 | GCA947252405_01961 | CDS | open | 1835-2824 | _na 329_aa | php | Phosphotriesterase-related protein |
| 3928 | CAMXVP010000084.1 | GCA947252405_01962 | CDS | open | 2891-3988 | _na 365_aa | sugar-binding transcriptional regulator | |
| 3929 | CAMXVP010000084.1 | GCA947252405_01963 | CDS | open | 4201-4443 | _na 80_aa | type II toxin-antitoxin system Phd/YefM family antitoxin | |
| 3930 | CAMXVP010000084.1 | GCA947252405_01964 | CDS | open | 4440-4817 | _na 125_aa | type II toxin-antitoxin system death-on-curing family toxin | |
| 3931 | CAMXVP010000084.1 | GCA947252405_01965 | CDS | open | 4818-5165 | _na 115_aa | Winged helix DNA-binding domain-containing protein | |
| 3932 | CAMXVP010000084.1 | GCA947252405_01966 | CDS | open | 5183-5425 | _na 80_aa | hypothetical protein | |
| 3933 | CAMXVP010000084.1 | GCA947252405_01959 | gene | open | 288-1184 | |||
| 3934 | CAMXVP010000084.1 | GCA947252405_01960 | gene | open | 1181-1834 | |||
| 3935 | CAMXVP010000084.1 | GCA947252405_01961 | gene | open | 1835-2824 | php | ||
| 3936 | CAMXVP010000084.1 | GCA947252405_01962 | gene | open | 2891-3988 | |||
| 3937 | CAMXVP010000084.1 | GCA947252405_01963 | gene | open | 4201-4443 | |||
| 3938 | CAMXVP010000084.1 | GCA947252405_01964 | gene | open | 4440-4817 | |||
| 3939 | CAMXVP010000084.1 | GCA947252405_01965 | gene | open | 4818-5165 | |||
| 3940 | CAMXVP010000084.1 | GCA947252405_01966 | gene | open | 5183-5425 | |||
| 3941 | CAMXVP010000085.1 | GCA947252405_01967 | CDS | open | 326-964 | _na 212_aa | rdgB | RdgB/HAM1 family non-canonical purine NTP pyrophosphatase |
| 3942 | CAMXVP010000085.1 | GCA947252405_01968 | CDS | open | 958-1695 | _na 245_aa | rph | ribonuclease PH |
| 3943 | CAMXVP010000085.1 | GCA947252405_01969 | CDS | open | 1720-2496 | _na 258_aa | Metallo-beta-lactamase domain-containing protein | |
| 3944 | CAMXVP010000085.1 | GCA947252405_01970 | CDS | open | 2586-3383 | _na 265_aa | murI | glutamate racemase |
| 3945 | CAMXVP010000085.1 | GCA947252405_01971 | CDS | open | 3460-3969 | _na 169_aa | marR | MarR family transcriptional regulator |
| 3946 | CAMXVP010000085.1 | GCA947252405_01972 | CDS | open | 4157-4927 | _na 256_aa | Rhomboid family intramembrane serine protease | |
| 3947 | CAMXVP010000085.1 | GCA947252405_01967 | gene | open | 326-964 | rdgB | ||
| 3948 | CAMXVP010000085.1 | GCA947252405_01968 | gene | open | 958-1695 | rph | ||
| 3949 | CAMXVP010000085.1 | GCA947252405_01969 | gene | open | 1720-2496 | |||
| 3950 | CAMXVP010000085.1 | GCA947252405_01970 | gene | open | 2586-3383 | murI | ||
| 3951 | CAMXVP010000085.1 | GCA947252405_01971 | gene | open | 3460-3969 | marR | ||
| 3952 | CAMXVP010000085.1 | GCA947252405_01972 | gene | open | 4157-4927 | |||
| 3953 | CAMXVP010000086.1 | GCA947252405_01973 | CDS | open | 128-703 | _na 191_aa | Septum formation initiator | |
| 3954 | CAMXVP010000086.1 | GCA947252405_01974 | CDS | open | 709-1278 | _na 189_aa | DUF501 domain-containing protein | |
| 3955 | CAMXVP010000086.1 | GCA947252405_01975 | CDS | open | 1278-2231 | _na 317_aa | Exopolyphosphatase | |
| 3956 | CAMXVP010000086.1 | GCA947252405_01976 | CDS | open | 2240-2509 | _na 89_aa | ytxH | YtxH domain-containing protein |
| 3957 | CAMXVP010000086.1 | GCA947252405_01979 | CDS | open | 3992-4729 | _na 245_aa | hypothetical protein | |
| 3958 | CAMXVP010000086.1 | GCA947252405_01973 | gene | open | 128-703 | |||
| 3959 | CAMXVP010000086.1 | GCA947252405_01974 | gene | open | 709-1278 | |||
| 3960 | CAMXVP010000086.1 | GCA947252405_01975 | gene | open | 1278-2231 | |||
| 3961 | CAMXVP010000086.1 | GCA947252405_01976 | gene | open | 2240-2509 | ytxH | ||
| 3962 | CAMXVP010000086.1 | GCA947252405_01979 | gene | open | 3992-4729 | |||
| 3963 | CAMXVP010000086.1 | GCA947252405_01977 | gene | open | 2598-2670 | trnN | ||
| 3964 | CAMXVP010000086.1 | GCA947252405_01978 | gene | open | 2874-2947 | trnI | ||
| 3965 | CAMXVP010000086.1 | GCA947252405_01977 | tRNA | open | 2598-2670 | trnN | tRNA-Asn(gtt) | |
| 3966 | CAMXVP010000086.1 | GCA947252405_01978 | tRNA | open | 2874-2947 | trnI | tRNA-Ile2(cat) | |
| 3967 | CAMXVP010000087.1 | GCA947252405_01980 | CDS | open | 266-1474 | _na 402_aa | MFS transporter | |
| 3968 | CAMXVP010000087.1 | GCA947252405_01981 | CDS | open | 1463-3040 | _na 525_aa | recB | Recombinase RecB |
| 3969 | CAMXVP010000087.1 | GCA947252405_01982 | CDS | open | 3067-3705 | _na 212_aa | DUF3618 domain-containing protein | |
| 3970 | CAMXVP010000087.1 | GCA947252405_01983 | CDS | open | 4284-4466 | _na 60_aa | hypothetical protein | |
| 3971 | CAMXVP010000087.1 | GCA947252405_01980 | gene | open | 266-1474 | |||
| 3972 | CAMXVP010000087.1 | GCA947252405_01981 | gene | open | 1463-3040 | recB | ||
| 3973 | CAMXVP010000087.1 | GCA947252405_01982 | gene | open | 3067-3705 | |||
| 3974 | CAMXVP010000087.1 | GCA947252405_01983 | gene | open | 4284-4466 | |||
| 3975 | CAMXVP010000088.1 | repeat_region | open | 3383-4448 | CRISPR array with 18 repeats of length 28%2C consensus sequence GGACCACCCCCGCGCATGCGGGGAAGAC and spacer length 33 | |||
| 3976 | CAMXVP010000088.1 | GCA947252405_01984 | CDS | open | 76-1548 | _na 490_aa | APC family permease | |
| 3977 | CAMXVP010000088.1 | GCA947252405_01985 | CDS | open | 1720-2154 | _na 144_aa | DUF488 domain-containing protein | |
| 3978 | CAMXVP010000088.1 | GCA947252405_01986 | CDS | open | 2236-3132 | _na 298_aa | acetamidase/formamidase family protein | |
| 3979 | CAMXVP010000088.1 | GCA947252405_01984 | gene | open | 76-1548 | |||
| 3980 | CAMXVP010000088.1 | GCA947252405_01985 | gene | open | 1720-2154 | |||
| 3981 | CAMXVP010000088.1 | GCA947252405_01986 | gene | open | 2236-3132 | |||
| 3982 | CAMXVP010000089.1 | GCA947252405_01987 | CDS | open | 395-823 | _na 142_aa | hypothetical protein | |
| 3983 | CAMXVP010000089.1 | GCA947252405_01988 | CDS | open | 1343-1612 | _na 89_aa | hypothetical protein | |
| 3984 | CAMXVP010000089.1 | GCA947252405_01989 | CDS | open | 2216-2974 | _na 252_aa | Sugar ABC transporter ATP-binding protein | |
| 3985 | CAMXVP010000089.1 | GCA947252405_01990 | CDS | open | 2978-3511 | _na 177_aa | xylH | Xylose transport system permease protein XylH |
| 3986 | CAMXVP010000089.1 | GCA947252405_01987 | gene | open | 395-823 | |||
| 3987 | CAMXVP010000089.1 | GCA947252405_01988 | gene | open | 1343-1612 | |||
| 3988 | CAMXVP010000089.1 | GCA947252405_01989 | gene | open | 2216-2974 | |||
| 3989 | CAMXVP010000089.1 | GCA947252405_01990 | gene | open | 2978-3511 | xylH | ||
| 3990 | CAMXVP010000090.1 | GCA947252405_01991 | CDS | open | 51-416 | _na 121_aa | hypothetical protein | |
| 3991 | CAMXVP010000090.1 | GCA947252405_01992 | CDS | open | 1482-3452 | _na 656_aa | Arabinosyltransferase | |
| 3992 | CAMXVP010000090.1 | GCA947252405_01991 | gene | open | 51-416 | |||
| 3993 | CAMXVP010000090.1 | GCA947252405_01992 | gene | open | 1482-3452 | |||
| 3994 | CAMXVP010000091.1 | GCA947252405_01993 | CDS | open | 259-1065 | _na 268_aa | hypothetical protein | |
| 3995 | CAMXVP010000091.1 | GCA947252405_01994 | CDS | open | 1124-3187 | _na 687_aa | Galactan 5-O-arabinofuranosyltransferase | |
| 3996 | CAMXVP010000091.1 | GCA947252405_01993 | gene | open | 259-1065 | |||
| 3997 | CAMXVP010000091.1 | GCA947252405_01994 | gene | open | 1124-3187 | |||
| 3998 | CAMXVP010000092.1 | GCA947252405_01995 | CDS | open | 281-529 | _na 82_aa | hypothetical protein | |
| 3999 | CAMXVP010000092.1 | GCA947252405_01996 | CDS | open | 1547-2206 | _na 219_aa | hypothetical protein | |
| 4000 | CAMXVP010000092.1 | GCA947252405_01997 | CDS | open | 2311-2814 | _na 167_aa | carbamoyl-phosphate synthase domain-containing protein |

