BAKTAGenome Explorer: Haemophilus parainfluenzae (GCA_947253865.1)
Select a Genome:
|
BAKTA Annotations for GCA_947253865.1
|
Search & Sort all 4358 Records
| ||||||||||||||||||
Notes: 1- Column headers only sort the current page. 2- Select [NA] or [AA] links to show sequences.
| Region | Protein-ID | Type | Genome Viewer |
Range (bp) |
Show Sequences (length) NA / AA |
BAKTA Gene |
BAKTA GeneProduct |
|
|---|---|---|---|---|---|---|---|---|
| 1 | CAMYAP010000001.1 | GCA947253865_00021 | gene | open | 16894-17091 | 6S | ||
| 2 | CAMYAP010000001.1 | GCA947253865_00021 | ncRNA | open | 16894-17091 | 6S / SsrS RNA | ||
| 3 | CAMYAP010000001.1 | GCA947253865_00001 | CDS | open | 90-227 | _na 45_aa | ykgO | type B 50S ribosomal protein L36 |
| 4 | CAMYAP010000001.1 | GCA947253865_00002 | CDS | open | 237-503 | _na 88_aa | type B 50S ribosomal protein L31 | |
| 5 | CAMYAP010000001.1 | GCA947253865_00003 | CDS | open | 548-712 | _na 54_aa | hypothetical protein | |
| 6 | CAMYAP010000001.1 | GCA947253865_00004 | CDS | open | 664-1146 | _na 160_aa | smpB | SsrA-binding protein SmpB |
| 7 | CAMYAP010000001.1 | GCA947253865_00005 | CDS | open | 1259-1972 | _na 237_aa | arcA | two-component system response regulator ArcA |
| 8 | CAMYAP010000001.1 | GCA947253865_00006 | CDS | open | 2150-3919 | _na 589_aa | dsbD | Thiol:disulfide interchange protein DsbD |
| 9 | CAMYAP010000001.1 | GCA947253865_00007 | CDS | open | 4037-4435 | _na 132_aa | Membrane protein | |
| 10 | CAMYAP010000001.1 | GCA947253865_00008 | CDS | open | 4616-6214 | _na 532_aa | purH | bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase |
| 11 | CAMYAP010000001.1 | GCA947253865_00009 | CDS | open | 6403-7692 | _na 429_aa | purD | Phosphoribosylamine--glycine ligase |
| 12 | CAMYAP010000001.1 | GCA947253865_00010 | CDS | open | 7816-9078 | _na 420_aa | glyA | Serine hydroxymethyltransferase |
| 13 | CAMYAP010000001.1 | GCA947253865_00011 | CDS | open | 9078-9353 | _na 91_aa | DUF1294 domain-containing protein | |
| 14 | CAMYAP010000001.1 | GCA947253865_00012 | CDS | open | 9428-9961 | _na 177_aa | dsbB | disulfide bond formation protein DsbB |
| 15 | CAMYAP010000001.1 | GCA947253865_00013 | CDS | open | 9981-11519 | _na 512_aa | nhaB | Na(+)/H(+) antiporter NhaB |
| 16 | CAMYAP010000001.1 | GCA947253865_00014 | CDS | open | 11642-12370 | _na 242_aa | fadR | fatty acid metabolism transcriptional regulator FadR |
| 17 | CAMYAP010000001.1 | GCA947253865_00015 | CDS | open | 12429-13163 | _na 244_aa | rsmE | 16S rRNA (uracil(1498)-N(3))-methyltransferase |
| 18 | CAMYAP010000001.1 | GCA947253865_00016 | CDS | open | 13163-13723 | _na 186_aa | YqgE/AlgH family protein | |
| 19 | CAMYAP010000001.1 | GCA947253865_00017 | CDS | open | 13723-14142 | _na 139_aa | ruvX | Holliday junction resolvase RuvX |
| 20 | CAMYAP010000001.1 | GCA947253865_00018 | CDS | open | 14191-14928 | _na 245_aa | pgeF | peptidoglycan editing factor PgeF |
| 21 | CAMYAP010000001.1 | GCA947253865_00019 | CDS | open | 14930-15904 | _na 324_aa | rluD | 23S rRNA pseudouridine(1911/1915/1917) synthase RluD |
| 22 | CAMYAP010000001.1 | GCA947253865_00020 | CDS | open | 16013-16801 | _na 262_aa | bamD | Outer membrane protein assembly factor BamD |
| 23 | CAMYAP010000001.1 | GCA947253865_00022 | CDS | open | 17118-17690 | _na 190_aa | 5-formyltetrahydrofolate cyclo-ligase | |
| 24 | CAMYAP010000001.1 | GCA947253865_00023 | CDS | open | 17826-20396 | _na 856_aa | clpB | ATP-dependent chaperone ClpB |
| 25 | CAMYAP010000001.1 | GCA947253865_00024 | CDS | open | 20509-21102 | _na 197_aa | mog | molybdopterin adenylyltransferase |
| 26 | CAMYAP010000001.1 | GCA947253865_00025 | CDS | open | 21104-21442 | _na 112_aa | glnB | nitrogen regulatory protein P-II |
| 27 | CAMYAP010000001.1 | GCA947253865_00026 | CDS | open | 21442-22482 | _na 346_aa | tqsA | Autoinducer 2 exporter TqsA |
| 28 | CAMYAP010000001.1 | GCA947253865_00027 | CDS | open | 22564-23538 | _na 324_aa | secF | Protein-export membrane protein SecF |
| 29 | CAMYAP010000001.1 | GCA947253865_00028 | CDS | open | 23549-25399 | _na 616_aa | secD | Protein translocase subunit SecD |
| 30 | CAMYAP010000001.1 | GCA947253865_00029 | CDS | open | 25423-25713 | _na 96_aa | yajC | preprotein translocase subunit YajC |
| 31 | CAMYAP010000001.1 | GCA947253865_00030 | CDS | open | 25816-26043 | _na 75_aa | UPF0033 domain-containing protein | |
| 32 | CAMYAP010000001.1 | GCA947253865_00031 | CDS | open | 26047-26559 | _na 170_aa | Hemerythrin HHE cation-binding domain-containing protein | |
| 33 | CAMYAP010000001.1 | GCA947253865_00032 | CDS | open | 26624-27772 | _na 382_aa | tgt | tRNA guanosine(34) transglycosylase Tgt |
| 34 | CAMYAP010000001.1 | GCA947253865_00033 | CDS | open | 27885-28976 | _na 363_aa | queA | tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA |
| 35 | CAMYAP010000001.1 | GCA947253865_00034 | CDS | open | 29170-30549 | _na 459_aa | yegQ | tRNA 5-hydroxyuridine modification protein YegQ |
| 36 | CAMYAP010000001.1 | GCA947253865_00035 | CDS | open | 30729-32045 | _na 438_aa | nCS2 | Putative permease HI_0125 |
| 37 | CAMYAP010000001.1 | GCA947253865_00036 | CDS | open | 32253-32783 | _na 176_aa | ppa | Inorganic pyrophosphatase |
| 38 | CAMYAP010000001.1 | GCA947253865_00037 | CDS | open | 32896-33303 | _na 135_aa | soxR | putative HTH-type transcriptional regulator HI_0186 |
| 39 | CAMYAP010000001.1 | GCA947253865_00038 | CDS | open | 33425-34561 | _na 378_aa | frmA | S-(hydroxymethyl)glutathione dehydrogenase/class III alcohol dehydrogenase |
| 40 | CAMYAP010000001.1 | GCA947253865_00039 | CDS | open | 34570-35397 | _na 275_aa | fghA | S-formylglutathione hydrolase |
| 41 | CAMYAP010000001.1 | GCA947253865_00040 | CDS | open | 35448-38681 | _na 1077_aa | Outer membrane autotransporter barrel domain protein | |
| 42 | CAMYAP010000001.1 | GCA947253865_00041 | CDS | open | 38886-39902 | _na 338_aa | galE | UDP-glucose 4-epimerase |
| 43 | CAMYAP010000001.1 | GCA947253865_00042 | CDS | open | 39982-41256 | _na 424_aa | AmpG-related permease | |
| 44 | CAMYAP010000001.1 | GCA947253865_00043 | CDS | open | 41355-41999 | _na 214_aa | adk | adenylate kinase |
| 45 | CAMYAP010000001.1 | GCA947253865_00044 | CDS | open | 42097-44121 | _na 674_aa | DUF945 domain-containing protein | |
| 46 | CAMYAP010000001.1 | GCA947253865_00045 | CDS | open | 44191-45153 | _na 320_aa | lipA | lipoyl synthase |
| 47 | CAMYAP010000001.1 | GCA947253865_00046 | CDS | open | 45215-45856 | _na 213_aa | lipB | lipoyl(octanoyl) transferase LipB |
| 48 | CAMYAP010000001.1 | GCA947253865_00047 | CDS | open | 45858-46136 | _na 92_aa | ybeD | DUF493 domain-containing protein |
| 49 | CAMYAP010000001.1 | GCA947253865_00048 | CDS | open | 46243-47430 | _na 395_aa | serine-type D-Ala-D-Ala carboxypeptidase | |
| 50 | CAMYAP010000001.1 | GCA947253865_00049 | CDS | open | 47561-48232 | _na 223_aa | rlpA | Endolytic peptidoglycan transglycosylase RlpA |
| 51 | CAMYAP010000001.1 | GCA947253865_00050 | CDS | open | 48328-49443 | _na 371_aa | rodA | rod shape-determining protein RodA |
| 52 | CAMYAP010000001.1 | GCA947253865_00051 | CDS | open | 49461-51419 | _na 652_aa | mrdA | penicillin-binding protein 2 |
| 53 | CAMYAP010000001.1 | GCA947253865_00052 | CDS | open | 51435-51902 | _na 155_aa | rlmH | 23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH |
| 54 | CAMYAP010000001.1 | GCA947253865_00053 | CDS | open | 51942-52250 | _na 102_aa | rsfS | ribosome silencing factor |
| 55 | CAMYAP010000001.1 | GCA947253865_00054 | CDS | open | 52401-54053 | _na 550_aa | putative transporter | |
| 56 | CAMYAP010000001.1 | GCA947253865_00055 | CDS | open | 54219-56009 | _na 596_aa | Multidrug ABC transporter membrane protein/ATP-binding protein | |
| 57 | CAMYAP010000001.1 | GCA947253865_00056 | CDS | open | 56178-57233 | _na 351_aa | mreB | Cell shape-determining protein MreB |
| 58 | CAMYAP010000001.1 | GCA947253865_00057 | CDS | open | 57320-58384 | _na 354_aa | mreC | rod shape-determining protein MreC |
| 59 | CAMYAP010000001.1 | GCA947253865_00058 | CDS | open | 58384-58872 | _na 162_aa | mreD | rod shape-determining protein MreD |
| 60 | CAMYAP010000001.1 | GCA947253865_00059 | CDS | open | 58913-60217 | _na 434_aa | rhlB | ATP-dependent RNA helicase RhlB |
| 61 | CAMYAP010000001.1 | GCA947253865_00060 | CDS | open | 60263-60544 | _na 93_aa | N-acetyltransferase domain-containing protein | |
| 62 | CAMYAP010000001.1 | GCA947253865_00061 | CDS | open | 60541-60747 | _na 68_aa | yacG | DNA gyrase inhibitor YacG |
| 63 | CAMYAP010000001.1 | GCA947253865_00062 | CDS | open | 60740-61360 | _na 206_aa | coaE | dephospho-CoA kinase |
| 64 | CAMYAP010000001.1 | GCA947253865_00063 | CDS | open | 61446-62123 | _na 225_aa | Peptidase%2C A24 family | |
| 65 | CAMYAP010000001.1 | GCA947253865_00064 | CDS | open | 62120-63343 | _na 407_aa | Bacterial type II secretion system domain protein F | |
| 66 | CAMYAP010000001.1 | GCA947253865_00065 | CDS | open | 63352-64734 | _na 460_aa | Type II/IV secretion system protein | |
| 67 | CAMYAP010000001.1 | GCA947253865_00066 | CDS | open | 64741-65184 | _na 147_aa | ppdD | prepilin peptidase-dependent pilin |
| 68 | CAMYAP010000001.1 | GCA947253865_00067 | CDS | open | 65326-65889 | _na 187_aa | ampD | 1%2C6-anhydro-N-acetylmuramyl-L-alanine amidase AmpD |
| 69 | CAMYAP010000001.1 | GCA947253865_00068 | CDS | open | 66094-66243 | _na 49_aa | hypothetical protein | |
| 70 | CAMYAP010000001.1 | GCA947253865_00069 | CDS | open | 66374-66967 | _na 197_aa | rppH | RNA pyrophosphohydrolase |
| 71 | CAMYAP010000001.1 | GCA947253865_00070 | CDS | open | 66967-67761 | _na 264_aa | sulfite exporter TauE/SafE family protein | |
| 72 | CAMYAP010000001.1 | GCA947253865_00071 | CDS | open | 67770-68579 | _na 269_aa | lgt | prolipoprotein diacylglyceryl transferase |
| 73 | CAMYAP010000001.1 | GCA947253865_00072 | CDS | open | 68590-69441 | _na 283_aa | thyA | thymidylate synthase |
| 74 | CAMYAP010000001.1 | GCA947253865_00073 | CDS | open | 69451-69969 | _na 172_aa | tadA | tRNA adenosine(34) deaminase TadA |
| 75 | CAMYAP010000001.1 | GCA947253865_00074 | CDS | open | 69966-70625 | _na 219_aa | ung | uracil-DNA glycosylase |
| 76 | CAMYAP010000001.1 | GCA947253865_00075 | CDS | open | 70890-71273 | _na 127_aa | grcA | autonomous glycyl radical cofactor GrcA |
| 77 | CAMYAP010000001.1 | GCA947253865_00076 | CDS | open | 71414-73237 | _na 607_aa | lepA | translation elongation factor 4 |
| 78 | CAMYAP010000001.1 | GCA947253865_00077 | CDS | open | 73250-74299 | _na 349_aa | lepB | signal peptidase I |
| 79 | CAMYAP010000001.1 | GCA947253865_00078 | CDS | open | 74301-74984 | _na 227_aa | rnc | ribonuclease III |
| 80 | CAMYAP010000001.1 | GCA947253865_00079 | CDS | open | 74981-75895 | _na 304_aa | era | GTPase Era |
| 81 | CAMYAP010000001.1 | GCA947253865_00080 | CDS | open | 76181-77395 | _na 404_aa | alaA | Glutamate-pyruvate aminotransferase AlaA |
| 82 | CAMYAP010000001.1 | GCA947253865_00081 | CDS | open | 77550-78830 | _na 426_aa | menF | Isochorismate synthase MenF |
| 83 | CAMYAP010000001.1 | GCA947253865_00082 | CDS | open | 78836-80542 | _na 568_aa | menD | 2-succinyl-5-enolpyruvyl-6-hydroxy-3-cyclohexene-1-carboxylic-acid synthase |
| 84 | CAMYAP010000001.1 | GCA947253865_00083 | CDS | open | 80592-81335 | _na 247_aa | menH | 2-succinyl-6-hydroxy-2%2C4-cyclohexadiene-1-carboxylate synthase |
| 85 | CAMYAP010000001.1 | GCA947253865_00084 | CDS | open | 81401-82603 | _na 400_aa | BaiN-like insert domain-containing protein | |
| 86 | CAMYAP010000001.1 | GCA947253865_00085 | CDS | open | 82607-83662 | _na 351_aa | nrfF | heme lyase NrfEFG subunit NrfF |
| 87 | CAMYAP010000001.1 | GCA947253865_00086 | CDS | open | 83664-84194 | _na 176_aa | dsbE | Periplasmic protein thiol:disulfide oxidoreductase%2C DsbE subfamily |
| 88 | CAMYAP010000001.1 | GCA947253865_00087 | CDS | open | 84187-86091 | _na 634_aa | nrfE | Heme lyase NrfEFG subunit NrfE |
| 89 | CAMYAP010000001.1 | GCA947253865_00088 | CDS | open | 86239-87204 | _na 321_aa | nrfD | cytochrome c nitrite reductase subunit NrfD |
| 90 | CAMYAP010000001.1 | GCA947253865_00089 | CDS | open | 87201-87878 | _na 225_aa | nrfC | cytochrome c nitrite reductase Fe-S protein |
| 91 | CAMYAP010000001.1 | GCA947253865_00090 | CDS | open | 87878-88543 | _na 221_aa | nrfB | cytochrome c nitrite reductase pentaheme subunit |
| 92 | CAMYAP010000001.1 | GCA947253865_00091 | CDS | open | 88616-90214 | _na 532_aa | nrfA | ammonia-forming nitrite reductase cytochrome c552 subunit |
| 93 | CAMYAP010000001.1 | GCA947253865_00092 | CDS | open | 90498-92738 | _na 746_aa | ESPR-type extended signal peptide-containing protein | |
| 94 | CAMYAP010000001.1 | GCA947253865_00093 | CDS | open | 92735-94774 | _na 679_aa | YadA-like family protein | |
| 95 | CAMYAP010000001.1 | GCA947253865_00094 | CDS | open | 94855-95670 | _na 271_aa | mutM | DNA-formamidopyrimidine glycosylase |
| 96 | CAMYAP010000001.1 | GCA947253865_00095 | CDS | open | 95743-95913 | _na 56_aa | rpmG | 50S ribosomal protein L33 |
| 97 | CAMYAP010000001.1 | GCA947253865_00096 | CDS | open | 95925-96161 | _na 78_aa | rpmB | 50S ribosomal protein L28 |
| 98 | CAMYAP010000001.1 | GCA947253865_00097 | CDS | open | 96379-97083 | _na 234_aa | radC | DNA repair protein RadC |
| 99 | CAMYAP010000001.1 | GCA947253865_00098 | CDS | open | 97249-98451 | _na 400_aa | coaBC | bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC |
| 100 | CAMYAP010000001.1 | GCA947253865_00099 | CDS | open | 98525-98980 | _na 151_aa | dut | dUTP diphosphatase |
| 101 | CAMYAP010000001.1 | GCA947253865_00100 | CDS | open | 98984-99637 | _na 217_aa | slmA | nucleoid occlusion factor SlmA |
| 102 | CAMYAP010000001.1 | GCA947253865_00101 | CDS | open | 99659-99877 | _na 72_aa | yheU | YheU family protein |
| 103 | CAMYAP010000001.1 | GCA947253865_00102 | CDS | open | 99894-100562 | _na 222_aa | crp | cAMP-activated global transcriptional regulator CRP |
| 104 | CAMYAP010000001.1 | GCA947253865_00103 | CDS | open | 101072-102538 | _na 488_aa | PTS system%2C N-acetylglucosamine-specific IIBC component | |
| 105 | CAMYAP010000001.1 | GCA947253865_00104 | CDS | open | 102754-103443 | _na 229_aa | Putative N-acetylmannosamine-6-phosphate 2-epimerase | |
| 106 | CAMYAP010000001.1 | GCA947253865_00105 | CDS | open | 103455-104393 | _na 312_aa | N-acetylmannosamine kinase | |
| 107 | CAMYAP010000001.1 | GCA947253865_00106 | CDS | open | 104386-105252 | _na 288_aa | Putative HTH-type transcriptional regulator | |
| 108 | CAMYAP010000001.1 | GCA947253865_00107 | CDS | open | 105262-106140 | _na 292_aa | nanA | N-acetylneuraminate lyase |
| 109 | CAMYAP010000001.1 | GCA947253865_00108 | CDS | open | 106231-107034 | _na 267_aa | nagB | glucosamine-6-phosphate deaminase |
| 110 | CAMYAP010000001.1 | GCA947253865_00109 | CDS | open | 107071-108216 | _na 381_aa | nagA | N-acetylglucosamine-6-phosphate deacetylase |
| 111 | CAMYAP010000001.1 | GCA947253865_00110 | CDS | open | 108280-109362 | _na 360_aa | recF | DNA replication/repair protein RecF |
| 112 | CAMYAP010000001.1 | GCA947253865_00111 | CDS | open | 109368-110468 | _na 366_aa | dnaN | DNA polymerase III subunit beta |
| 113 | CAMYAP010000001.1 | GCA947253865_00112 | CDS | open | 110479-111846 | _na 455_aa | dnaA | chromosomal replication initiator protein DnaA |
| 114 | CAMYAP010000001.1 | GCA947253865_00113 | CDS | open | 112165-112299 | _na 44_aa | rpmH | 50S ribosomal protein L34 |
| 115 | CAMYAP010000001.1 | GCA947253865_00114 | CDS | open | 112312-112680 | _na 122_aa | rnpA | ribonuclease P protein component |
| 116 | CAMYAP010000001.1 | GCA947253865_00115 | CDS | open | 112635-112898 | _na 87_aa | yidD | membrane protein insertion efficiency factor YidD |
| 117 | CAMYAP010000001.1 | GCA947253865_00116 | CDS | open | 112898-114526 | _na 542_aa | yidC | membrane protein insertase YidC |
| 118 | CAMYAP010000001.1 | GCA947253865_00117 | CDS | open | 114654-116012 | _na 452_aa | mnmE | tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE |
| 119 | CAMYAP010000001.1 | GCA947253865_00118 | CDS | open | 116023-116580 | _na 185_aa | mntP | Putative manganese efflux pump MntP |
| 120 | CAMYAP010000001.1 | GCA947253865_00119 | CDS | open | 116649-118526 | _na 625_aa | ppiD | peptidylprolyl isomerase |
| 121 | CAMYAP010000001.1 | GCA947253865_00120 | CDS | open | 118627-118977 | _na 116_aa | hinT | purine nucleoside phosphoramidase |
| 122 | CAMYAP010000001.1 | GCA947253865_00121 | CDS | open | 118977-119324 | _na 115_aa | DUF1425 domain-containing protein | |
| 123 | CAMYAP010000001.1 | GCA947253865_00122 | CDS | open | 119328-120371 | _na 347_aa | nagZ | beta-N-acetylhexosaminidase |
| 124 | CAMYAP010000001.1 | GCA947253865_00123 | CDS | open | 120368-121561 | _na 397_aa | rlmC | 23S rRNA (uracil(747)-C(5))-methyltransferase RlmC |
| 125 | CAMYAP010000001.1 | GCA947253865_00124 | CDS | open | 122022-123062 | _na 346_aa | arsB | ACR3 family arsenite efflux transporter |
| 126 | CAMYAP010000001.1 | GCA947253865_00125 | CDS | open | 123128-123409 | _na 93_aa | Arsenical resistance operon repressor | |
| 127 | CAMYAP010000001.1 | GCA947253865_00126 | CDS | open | 123952-124785 | _na 277_aa | Putative ABC-type chelated iron transport system%2C permease component | |
| 128 | CAMYAP010000001.1 | GCA947253865_00127 | CDS | open | 124778-125629 | _na 283_aa | Iron ABC transporter permease | |
| 129 | CAMYAP010000001.1 | GCA947253865_00128 | CDS | open | 125633-126529 | _na 298_aa | Iron ABC transporter permease | |
| 130 | CAMYAP010000001.1 | GCA947253865_00129 | CDS | open | 126529-127410 | _na 293_aa | ABC transporter%2C substrate-binding protein | |
| 131 | CAMYAP010000001.1 | GCA947253865_00130 | CDS | open | 127565-128440 | _na 291_aa | D-alanyl-D-alanine endopeptidase | |
| 132 | CAMYAP010000001.1 | GCA947253865_00131 | CDS | open | 128560-128715 | _na 51_aa | hypothetical protein | |
| 133 | CAMYAP010000001.1 | GCA947253865_00132 | CDS | open | 128743-129891 | _na 382_aa | rlmN | bifunctional tRNA (adenosine(37)-C2)-methyltransferase TrmG/ribosomal RNA large subunit methyltransferase RlmN |
| 134 | CAMYAP010000001.1 | GCA947253865_00133 | CDS | open | 129961-130503 | _na 180_aa | pilW | type IV pilus biogenesis/stability protein PilW |
| 135 | CAMYAP010000001.1 | GCA947253865_00134 | CDS | open | 130578-131606 | _na 342_aa | HTH cro/C1-type domain-containing protein | |
| 136 | CAMYAP010000001.1 | GCA947253865_00135 | CDS | open | 131625-132731 | _na 368_aa | ispG | flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase |
| 137 | CAMYAP010000001.1 | GCA947253865_00136 | CDS | open | 132741-134012 | _na 423_aa | hisS | histidine--tRNA ligase |
| 138 | CAMYAP010000001.1 | GCA947253865_00137 | CDS | open | 134031-134645 | _na 204_aa | Ancillary SecYEG translocon subunit | |
| 139 | CAMYAP010000001.1 | GCA947253865_00138 | CDS | open | 134697-135140 | _na 147_aa | Isoprenylcysteine carboxylmethyltransferase family protein | |
| 140 | CAMYAP010000001.1 | GCA947253865_00139 | CDS | open | 135192-135842 | _na 216_aa | sodA | superoxide dismutase [Mn] |
| 141 | CAMYAP010000001.1 | GCA947253865_00140 | CDS | open | 136126-136767 | _na 213_aa | ccmA | cytochrome c biogenesis heme-transporting ATPase CcmA |
| 142 | CAMYAP010000001.1 | GCA947253865_00141 | CDS | open | 136774-137439 | _na 221_aa | ccmB | heme exporter protein CcmB |
| 143 | CAMYAP010000001.1 | GCA947253865_00142 | CDS | open | 137507-138247 | _na 246_aa | Heme exporter protein C | |
| 144 | CAMYAP010000001.1 | GCA947253865_00143 | CDS | open | 138277-138480 | _na 67_aa | ccmD | heme exporter protein CcmD |
| 145 | CAMYAP010000001.1 | GCA947253865_00144 | CDS | open | 138477-139007 | _na 176_aa | ccmE | cytochrome c maturation protein CcmE |
| 146 | CAMYAP010000001.1 | GCA947253865_00145 | CDS | open | 139007-140956 | _na 649_aa | ccmF | Heme lyase%2C CcmF subunit |
| 147 | CAMYAP010000001.1 | GCA947253865_00146 | CDS | open | 141011-141556 | _na 181_aa | Periplasmic thioredoxin of cytochrome c-type biogenesis | |
| 148 | CAMYAP010000001.1 | GCA947253865_00147 | CDS | open | 141556-142020 | _na 154_aa | Cytochrome c-type biogenesis protein | |
| 149 | CAMYAP010000001.1 | GCA947253865_00148 | CDS | open | 142020-142937 | _na 305_aa | ccmH2 | Cytochrome c maturation heme lyase subunit CcmH2 |
| 150 | CAMYAP010000001.1 | GCA947253865_00149 | CDS | open | 142937-143335 | _na 132_aa | VOC family protein | |
| 151 | CAMYAP010000001.1 | GCA947253865_00150 | CDS | open | 143355-143948 | _na 197_aa | hypothetical protein | |
| 152 | CAMYAP010000001.1 | GCA947253865_00151 | CDS | open | 143953-144255 | _na 100_aa | Lipoprotein | |
| 153 | CAMYAP010000001.1 | GCA947253865_00152 | CDS | open | 144312-145007 | _na 231_aa | hda | DnaA regulatory inactivator Hda |
| 154 | CAMYAP010000001.1 | GCA947253865_00153 | CDS | open | 145078-146322 | _na 414_aa | uraA | putative uracil permease |
| 155 | CAMYAP010000001.1 | GCA947253865_00154 | CDS | open | 146444-147070 | _na 208_aa | upp | uracil phosphoribosyltransferase |
| 156 | CAMYAP010000001.1 | GCA947253865_00155 | CDS | open | 147192-147530 | _na 112_aa | hypothetical protein | |
| 157 | CAMYAP010000001.1 | GCA947253865_00156 | CDS | open | 147707-149947 | _na 746_aa | Nitric oxide reductase | |
| 158 | CAMYAP010000001.1 | GCA947253865_00157 | CDS | open | 150292-151641 | _na 449_aa | Gluconate permease | |
| 159 | CAMYAP010000001.1 | GCA947253865_00158 | CDS | open | 151869-152399 | _na 176_aa | Gluconokinase | |
| 160 | CAMYAP010000001.1 | GCA947253865_00159 | CDS | open | 152448-153443 | _na 331_aa | gntR | gluconate operon transcriptional repressor GntR |
| 161 | CAMYAP010000001.1 | GCA947253865_00160 | CDS | open | 153621-155012 | _na 463_aa | ffh | signal recognition particle protein |
| 162 | CAMYAP010000001.1 | GCA947253865_00161 | CDS | open | 155152-155937 | _na 261_aa | Cytochrome c assembly protein | |
| 163 | CAMYAP010000001.1 | GCA947253865_00162 | CDS | open | 156015-156368 | _na 117_aa | Helix-turn-helix domain-containing protein | |
| 164 | CAMYAP010000001.1 | GCA947253865_00163 | CDS | open | 156662-156859 | _na 65_aa | phosphoribosyl-ATP diphosphatase | |
| 165 | CAMYAP010000001.1 | GCA947253865_00164 | CDS | open | 156887-157228 | _na 113_aa | Integrase catalytic domain-containing protein | |
| 166 | CAMYAP010000001.1 | GCA947253865_00165 | CDS | open | 157313-157849 | _na 178_aa | hypothetical protein | |
| 167 | CAMYAP010000001.1 | GCA947253865_00166 | CDS | open | 157863-158213 | _na 116_aa | hypothetical protein | |
| 168 | CAMYAP010000001.1 | GCA947253865_00167 | CDS | open | 158329-159102 | _na 257_aa | hisF | Imidazole glycerol phosphate synthase subunit HisF |
| 169 | CAMYAP010000001.1 | GCA947253865_00168 | CDS | open | 159197-159823 | _na 208_aa | 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino] imidazole-4-carboxamide isomerase | |
| 170 | CAMYAP010000001.1 | GCA947253865_00169 | CDS | open | 159913-160368 | _na 151_aa | tnpA | IS200/IS605 family transposase |
| 171 | CAMYAP010000001.1 | GCA947253865_00170 | CDS | open | 160489-161082 | _na 197_aa | hisH | imidazole glycerol phosphate synthase subunit HisH |
| 172 | CAMYAP010000001.1 | GCA947253865_00171 | CDS | open | 161095-161508 | _na 137_aa | hypothetical protein | |
| 173 | CAMYAP010000001.1 | GCA947253865_00001 | gene | open | 90-227 | ykgO | ||
| 174 | CAMYAP010000001.1 | GCA947253865_00002 | gene | open | 237-503 | |||
| 175 | CAMYAP010000001.1 | GCA947253865_00003 | gene | open | 548-712 | |||
| 176 | CAMYAP010000001.1 | GCA947253865_00004 | gene | open | 664-1146 | smpB | ||
| 177 | CAMYAP010000001.1 | GCA947253865_00005 | gene | open | 1259-1972 | arcA | ||
| 178 | CAMYAP010000001.1 | GCA947253865_00006 | gene | open | 2150-3919 | dsbD | ||
| 179 | CAMYAP010000001.1 | GCA947253865_00007 | gene | open | 4037-4435 | |||
| 180 | CAMYAP010000001.1 | GCA947253865_00008 | gene | open | 4616-6214 | purH | ||
| 181 | CAMYAP010000001.1 | GCA947253865_00009 | gene | open | 6403-7692 | purD | ||
| 182 | CAMYAP010000001.1 | GCA947253865_00010 | gene | open | 7816-9078 | glyA | ||
| 183 | CAMYAP010000001.1 | GCA947253865_00011 | gene | open | 9078-9353 | |||
| 184 | CAMYAP010000001.1 | GCA947253865_00012 | gene | open | 9428-9961 | dsbB | ||
| 185 | CAMYAP010000001.1 | GCA947253865_00013 | gene | open | 9981-11519 | nhaB | ||
| 186 | CAMYAP010000001.1 | GCA947253865_00014 | gene | open | 11642-12370 | fadR | ||
| 187 | CAMYAP010000001.1 | GCA947253865_00015 | gene | open | 12429-13163 | rsmE | ||
| 188 | CAMYAP010000001.1 | GCA947253865_00016 | gene | open | 13163-13723 | |||
| 189 | CAMYAP010000001.1 | GCA947253865_00017 | gene | open | 13723-14142 | ruvX | ||
| 190 | CAMYAP010000001.1 | GCA947253865_00018 | gene | open | 14191-14928 | pgeF | ||
| 191 | CAMYAP010000001.1 | GCA947253865_00019 | gene | open | 14930-15904 | rluD | ||
| 192 | CAMYAP010000001.1 | GCA947253865_00020 | gene | open | 16013-16801 | bamD | ||
| 193 | CAMYAP010000001.1 | GCA947253865_00022 | gene | open | 17118-17690 | |||
| 194 | CAMYAP010000001.1 | GCA947253865_00023 | gene | open | 17826-20396 | clpB | ||
| 195 | CAMYAP010000001.1 | GCA947253865_00024 | gene | open | 20509-21102 | mog | ||
| 196 | CAMYAP010000001.1 | GCA947253865_00025 | gene | open | 21104-21442 | glnB | ||
| 197 | CAMYAP010000001.1 | GCA947253865_00026 | gene | open | 21442-22482 | tqsA | ||
| 198 | CAMYAP010000001.1 | GCA947253865_00027 | gene | open | 22564-23538 | secF | ||
| 199 | CAMYAP010000001.1 | GCA947253865_00028 | gene | open | 23549-25399 | secD | ||
| 200 | CAMYAP010000001.1 | GCA947253865_00029 | gene | open | 25423-25713 | yajC | ||
| 201 | CAMYAP010000001.1 | GCA947253865_00030 | gene | open | 25816-26043 | |||
| 202 | CAMYAP010000001.1 | GCA947253865_00031 | gene | open | 26047-26559 | |||
| 203 | CAMYAP010000001.1 | GCA947253865_00032 | gene | open | 26624-27772 | tgt | ||
| 204 | CAMYAP010000001.1 | GCA947253865_00033 | gene | open | 27885-28976 | queA | ||
| 205 | CAMYAP010000001.1 | GCA947253865_00034 | gene | open | 29170-30549 | yegQ | ||
| 206 | CAMYAP010000001.1 | GCA947253865_00035 | gene | open | 30729-32045 | nCS2 | ||
| 207 | CAMYAP010000001.1 | GCA947253865_00036 | gene | open | 32253-32783 | ppa | ||
| 208 | CAMYAP010000001.1 | GCA947253865_00037 | gene | open | 32896-33303 | soxR | ||
| 209 | CAMYAP010000001.1 | GCA947253865_00038 | gene | open | 33425-34561 | frmA | ||
| 210 | CAMYAP010000001.1 | GCA947253865_00039 | gene | open | 34570-35397 | fghA | ||
| 211 | CAMYAP010000001.1 | GCA947253865_00040 | gene | open | 35448-38681 | |||
| 212 | CAMYAP010000001.1 | GCA947253865_00041 | gene | open | 38886-39902 | galE | ||
| 213 | CAMYAP010000001.1 | GCA947253865_00042 | gene | open | 39982-41256 | |||
| 214 | CAMYAP010000001.1 | GCA947253865_00043 | gene | open | 41355-41999 | adk | ||
| 215 | CAMYAP010000001.1 | GCA947253865_00044 | gene | open | 42097-44121 | |||
| 216 | CAMYAP010000001.1 | GCA947253865_00045 | gene | open | 44191-45153 | lipA | ||
| 217 | CAMYAP010000001.1 | GCA947253865_00046 | gene | open | 45215-45856 | lipB | ||
| 218 | CAMYAP010000001.1 | GCA947253865_00047 | gene | open | 45858-46136 | ybeD | ||
| 219 | CAMYAP010000001.1 | GCA947253865_00048 | gene | open | 46243-47430 | |||
| 220 | CAMYAP010000001.1 | GCA947253865_00049 | gene | open | 47561-48232 | rlpA | ||
| 221 | CAMYAP010000001.1 | GCA947253865_00050 | gene | open | 48328-49443 | rodA | ||
| 222 | CAMYAP010000001.1 | GCA947253865_00051 | gene | open | 49461-51419 | mrdA | ||
| 223 | CAMYAP010000001.1 | GCA947253865_00052 | gene | open | 51435-51902 | rlmH | ||
| 224 | CAMYAP010000001.1 | GCA947253865_00053 | gene | open | 51942-52250 | rsfS | ||
| 225 | CAMYAP010000001.1 | GCA947253865_00054 | gene | open | 52401-54053 | |||
| 226 | CAMYAP010000001.1 | GCA947253865_00055 | gene | open | 54219-56009 | |||
| 227 | CAMYAP010000001.1 | GCA947253865_00056 | gene | open | 56178-57233 | mreB | ||
| 228 | CAMYAP010000001.1 | GCA947253865_00057 | gene | open | 57320-58384 | mreC | ||
| 229 | CAMYAP010000001.1 | GCA947253865_00058 | gene | open | 58384-58872 | mreD | ||
| 230 | CAMYAP010000001.1 | GCA947253865_00059 | gene | open | 58913-60217 | rhlB | ||
| 231 | CAMYAP010000001.1 | GCA947253865_00060 | gene | open | 60263-60544 | |||
| 232 | CAMYAP010000001.1 | GCA947253865_00061 | gene | open | 60541-60747 | yacG | ||
| 233 | CAMYAP010000001.1 | GCA947253865_00062 | gene | open | 60740-61360 | coaE | ||
| 234 | CAMYAP010000001.1 | GCA947253865_00063 | gene | open | 61446-62123 | |||
| 235 | CAMYAP010000001.1 | GCA947253865_00064 | gene | open | 62120-63343 | |||
| 236 | CAMYAP010000001.1 | GCA947253865_00065 | gene | open | 63352-64734 | |||
| 237 | CAMYAP010000001.1 | GCA947253865_00066 | gene | open | 64741-65184 | ppdD | ||
| 238 | CAMYAP010000001.1 | GCA947253865_00067 | gene | open | 65326-65889 | ampD | ||
| 239 | CAMYAP010000001.1 | GCA947253865_00068 | gene | open | 66094-66243 | |||
| 240 | CAMYAP010000001.1 | GCA947253865_00069 | gene | open | 66374-66967 | rppH | ||
| 241 | CAMYAP010000001.1 | GCA947253865_00070 | gene | open | 66967-67761 | |||
| 242 | CAMYAP010000001.1 | GCA947253865_00071 | gene | open | 67770-68579 | lgt | ||
| 243 | CAMYAP010000001.1 | GCA947253865_00072 | gene | open | 68590-69441 | thyA | ||
| 244 | CAMYAP010000001.1 | GCA947253865_00073 | gene | open | 69451-69969 | tadA | ||
| 245 | CAMYAP010000001.1 | GCA947253865_00074 | gene | open | 69966-70625 | ung | ||
| 246 | CAMYAP010000001.1 | GCA947253865_00075 | gene | open | 70890-71273 | grcA | ||
| 247 | CAMYAP010000001.1 | GCA947253865_00076 | gene | open | 71414-73237 | lepA | ||
| 248 | CAMYAP010000001.1 | GCA947253865_00077 | gene | open | 73250-74299 | lepB | ||
| 249 | CAMYAP010000001.1 | GCA947253865_00078 | gene | open | 74301-74984 | rnc | ||
| 250 | CAMYAP010000001.1 | GCA947253865_00079 | gene | open | 74981-75895 | era | ||
| 251 | CAMYAP010000001.1 | GCA947253865_00080 | gene | open | 76181-77395 | alaA | ||
| 252 | CAMYAP010000001.1 | GCA947253865_00081 | gene | open | 77550-78830 | menF | ||
| 253 | CAMYAP010000001.1 | GCA947253865_00082 | gene | open | 78836-80542 | menD | ||
| 254 | CAMYAP010000001.1 | GCA947253865_00083 | gene | open | 80592-81335 | menH | ||
| 255 | CAMYAP010000001.1 | GCA947253865_00084 | gene | open | 81401-82603 | |||
| 256 | CAMYAP010000001.1 | GCA947253865_00085 | gene | open | 82607-83662 | nrfF | ||
| 257 | CAMYAP010000001.1 | GCA947253865_00086 | gene | open | 83664-84194 | dsbE | ||
| 258 | CAMYAP010000001.1 | GCA947253865_00087 | gene | open | 84187-86091 | nrfE | ||
| 259 | CAMYAP010000001.1 | GCA947253865_00088 | gene | open | 86239-87204 | nrfD | ||
| 260 | CAMYAP010000001.1 | GCA947253865_00089 | gene | open | 87201-87878 | nrfC | ||
| 261 | CAMYAP010000001.1 | GCA947253865_00090 | gene | open | 87878-88543 | nrfB | ||
| 262 | CAMYAP010000001.1 | GCA947253865_00091 | gene | open | 88616-90214 | nrfA | ||
| 263 | CAMYAP010000001.1 | GCA947253865_00092 | gene | open | 90498-92738 | |||
| 264 | CAMYAP010000001.1 | GCA947253865_00093 | gene | open | 92735-94774 | |||
| 265 | CAMYAP010000001.1 | GCA947253865_00094 | gene | open | 94855-95670 | mutM | ||
| 266 | CAMYAP010000001.1 | GCA947253865_00095 | gene | open | 95743-95913 | rpmG | ||
| 267 | CAMYAP010000001.1 | GCA947253865_00096 | gene | open | 95925-96161 | rpmB | ||
| 268 | CAMYAP010000001.1 | GCA947253865_00097 | gene | open | 96379-97083 | radC | ||
| 269 | CAMYAP010000001.1 | GCA947253865_00098 | gene | open | 97249-98451 | coaBC | ||
| 270 | CAMYAP010000001.1 | GCA947253865_00099 | gene | open | 98525-98980 | dut | ||
| 271 | CAMYAP010000001.1 | GCA947253865_00100 | gene | open | 98984-99637 | slmA | ||
| 272 | CAMYAP010000001.1 | GCA947253865_00101 | gene | open | 99659-99877 | yheU | ||
| 273 | CAMYAP010000001.1 | GCA947253865_00102 | gene | open | 99894-100562 | crp | ||
| 274 | CAMYAP010000001.1 | GCA947253865_00103 | gene | open | 101072-102538 | |||
| 275 | CAMYAP010000001.1 | GCA947253865_00104 | gene | open | 102754-103443 | |||
| 276 | CAMYAP010000001.1 | GCA947253865_00105 | gene | open | 103455-104393 | |||
| 277 | CAMYAP010000001.1 | GCA947253865_00106 | gene | open | 104386-105252 | |||
| 278 | CAMYAP010000001.1 | GCA947253865_00107 | gene | open | 105262-106140 | nanA | ||
| 279 | CAMYAP010000001.1 | GCA947253865_00108 | gene | open | 106231-107034 | nagB | ||
| 280 | CAMYAP010000001.1 | GCA947253865_00109 | gene | open | 107071-108216 | nagA | ||
| 281 | CAMYAP010000001.1 | GCA947253865_00110 | gene | open | 108280-109362 | recF | ||
| 282 | CAMYAP010000001.1 | GCA947253865_00111 | gene | open | 109368-110468 | dnaN | ||
| 283 | CAMYAP010000001.1 | GCA947253865_00112 | gene | open | 110479-111846 | dnaA | ||
| 284 | CAMYAP010000001.1 | GCA947253865_00113 | gene | open | 112165-112299 | rpmH | ||
| 285 | CAMYAP010000001.1 | GCA947253865_00114 | gene | open | 112312-112680 | rnpA | ||
| 286 | CAMYAP010000001.1 | GCA947253865_00115 | gene | open | 112635-112898 | yidD | ||
| 287 | CAMYAP010000001.1 | GCA947253865_00116 | gene | open | 112898-114526 | yidC | ||
| 288 | CAMYAP010000001.1 | GCA947253865_00117 | gene | open | 114654-116012 | mnmE | ||
| 289 | CAMYAP010000001.1 | GCA947253865_00118 | gene | open | 116023-116580 | mntP | ||
| 290 | CAMYAP010000001.1 | GCA947253865_00119 | gene | open | 116649-118526 | ppiD | ||
| 291 | CAMYAP010000001.1 | GCA947253865_00120 | gene | open | 118627-118977 | hinT | ||
| 292 | CAMYAP010000001.1 | GCA947253865_00121 | gene | open | 118977-119324 | |||
| 293 | CAMYAP010000001.1 | GCA947253865_00122 | gene | open | 119328-120371 | nagZ | ||
| 294 | CAMYAP010000001.1 | GCA947253865_00123 | gene | open | 120368-121561 | rlmC | ||
| 295 | CAMYAP010000001.1 | GCA947253865_00124 | gene | open | 122022-123062 | arsB | ||
| 296 | CAMYAP010000001.1 | GCA947253865_00125 | gene | open | 123128-123409 | |||
| 297 | CAMYAP010000001.1 | GCA947253865_00126 | gene | open | 123952-124785 | |||
| 298 | CAMYAP010000001.1 | GCA947253865_00127 | gene | open | 124778-125629 | |||
| 299 | CAMYAP010000001.1 | GCA947253865_00128 | gene | open | 125633-126529 | |||
| 300 | CAMYAP010000001.1 | GCA947253865_00129 | gene | open | 126529-127410 | |||
| 301 | CAMYAP010000001.1 | GCA947253865_00130 | gene | open | 127565-128440 | |||
| 302 | CAMYAP010000001.1 | GCA947253865_00131 | gene | open | 128560-128715 | |||
| 303 | CAMYAP010000001.1 | GCA947253865_00132 | gene | open | 128743-129891 | rlmN | ||
| 304 | CAMYAP010000001.1 | GCA947253865_00133 | gene | open | 129961-130503 | pilW | ||
| 305 | CAMYAP010000001.1 | GCA947253865_00134 | gene | open | 130578-131606 | |||
| 306 | CAMYAP010000001.1 | GCA947253865_00135 | gene | open | 131625-132731 | ispG | ||
| 307 | CAMYAP010000001.1 | GCA947253865_00136 | gene | open | 132741-134012 | hisS | ||
| 308 | CAMYAP010000001.1 | GCA947253865_00137 | gene | open | 134031-134645 | |||
| 309 | CAMYAP010000001.1 | GCA947253865_00138 | gene | open | 134697-135140 | |||
| 310 | CAMYAP010000001.1 | GCA947253865_00139 | gene | open | 135192-135842 | sodA | ||
| 311 | CAMYAP010000001.1 | GCA947253865_00140 | gene | open | 136126-136767 | ccmA | ||
| 312 | CAMYAP010000001.1 | GCA947253865_00141 | gene | open | 136774-137439 | ccmB | ||
| 313 | CAMYAP010000001.1 | GCA947253865_00142 | gene | open | 137507-138247 | |||
| 314 | CAMYAP010000001.1 | GCA947253865_00143 | gene | open | 138277-138480 | ccmD | ||
| 315 | CAMYAP010000001.1 | GCA947253865_00144 | gene | open | 138477-139007 | ccmE | ||
| 316 | CAMYAP010000001.1 | GCA947253865_00145 | gene | open | 139007-140956 | ccmF | ||
| 317 | CAMYAP010000001.1 | GCA947253865_00146 | gene | open | 141011-141556 | |||
| 318 | CAMYAP010000001.1 | GCA947253865_00147 | gene | open | 141556-142020 | |||
| 319 | CAMYAP010000001.1 | GCA947253865_00148 | gene | open | 142020-142937 | ccmH2 | ||
| 320 | CAMYAP010000001.1 | GCA947253865_00149 | gene | open | 142937-143335 | |||
| 321 | CAMYAP010000001.1 | GCA947253865_00150 | gene | open | 143355-143948 | |||
| 322 | CAMYAP010000001.1 | GCA947253865_00151 | gene | open | 143953-144255 | |||
| 323 | CAMYAP010000001.1 | GCA947253865_00152 | gene | open | 144312-145007 | hda | ||
| 324 | CAMYAP010000001.1 | GCA947253865_00153 | gene | open | 145078-146322 | uraA | ||
| 325 | CAMYAP010000001.1 | GCA947253865_00154 | gene | open | 146444-147070 | upp | ||
| 326 | CAMYAP010000001.1 | GCA947253865_00155 | gene | open | 147192-147530 | |||
| 327 | CAMYAP010000001.1 | GCA947253865_00156 | gene | open | 147707-149947 | |||
| 328 | CAMYAP010000001.1 | GCA947253865_00157 | gene | open | 150292-151641 | |||
| 329 | CAMYAP010000001.1 | GCA947253865_00158 | gene | open | 151869-152399 | |||
| 330 | CAMYAP010000001.1 | GCA947253865_00159 | gene | open | 152448-153443 | gntR | ||
| 331 | CAMYAP010000001.1 | GCA947253865_00160 | gene | open | 153621-155012 | ffh | ||
| 332 | CAMYAP010000001.1 | GCA947253865_00161 | gene | open | 155152-155937 | |||
| 333 | CAMYAP010000001.1 | GCA947253865_00162 | gene | open | 156015-156368 | |||
| 334 | CAMYAP010000001.1 | GCA947253865_00163 | gene | open | 156662-156859 | |||
| 335 | CAMYAP010000001.1 | GCA947253865_00164 | gene | open | 156887-157228 | |||
| 336 | CAMYAP010000001.1 | GCA947253865_00165 | gene | open | 157313-157849 | |||
| 337 | CAMYAP010000001.1 | GCA947253865_00166 | gene | open | 157863-158213 | |||
| 338 | CAMYAP010000001.1 | GCA947253865_00167 | gene | open | 158329-159102 | hisF | ||
| 339 | CAMYAP010000001.1 | GCA947253865_00168 | gene | open | 159197-159823 | |||
| 340 | CAMYAP010000001.1 | GCA947253865_00169 | gene | open | 159913-160368 | tnpA | ||
| 341 | CAMYAP010000001.1 | GCA947253865_00170 | gene | open | 160489-161082 | hisH | ||
| 342 | CAMYAP010000001.1 | GCA947253865_00171 | gene | open | 161095-161508 | |||
| 343 | CAMYAP010000002.1 | GCA947253865_00225 | gene | open | 39710-40075 | ssrA | ||
| 344 | CAMYAP010000002.1 | GCA947253865_00225 | tmRNA | open | 39710-40075 | ssrA | transfer-messenger RNA%2C SsrA | |
| 345 | CAMYAP010000002.1 | GCA947253865_00214 | gene | open | 32195-32280 | C4 | ||
| 346 | CAMYAP010000002.1 | GCA947253865_00228 | gene | open | 41931-42307 | RNaseP_bact_a | ||
| 347 | CAMYAP010000002.1 | GCA947253865_00256 | gene | open | 73959-74037 | AaHKsRNA20 | ||
| 348 | CAMYAP010000002.1 | GCA947253865_00276 | gene | open | 95233-95423 | gcvB | ||
| 349 | CAMYAP010000002.1 | GCA947253865_00214 | ncRNA | open | 32195-32280 | C4 antisense RNA | ||
| 350 | CAMYAP010000002.1 | GCA947253865_00228 | ncRNA | open | 41931-42307 | Bacterial RNase P class A | ||
| 351 | CAMYAP010000002.1 | GCA947253865_00256 | ncRNA | open | 73959-74037 | Aggregatibacter sRNA 20 | ||
| 352 | CAMYAP010000002.1 | GCA947253865_00276 | ncRNA | open | 95233-95423 | gcvB | GcvB RNA | |
| 353 | CAMYAP010000002.1 | regulatory_region | open | 80187-80212 | L25-Gammaproteobacteria ribosomal protein leader | |||
| 354 | CAMYAP010000002.1 | regulatory_region | open | 103130-103250 | Ribosomal S15 leader | |||
| 355 | CAMYAP010000002.1 | repeat_region | open | 86030-86558 | CRISPR array with 8 repeats of length 36%2C consensus sequence ATTATAGCACTGCGAAATAAAAAAGGGAGCTACAAC and spacer length 30 | |||
| 356 | CAMYAP010000002.1 | GCA947253865_00172 | CDS | open | 104-1120 | _na 338_aa | yeiH | UPF0324 membrane protein NMA0465 |
| 357 | CAMYAP010000002.1 | GCA947253865_00173 | CDS | open | 1422-1559 | _na 45_aa | hypothetical protein | |
| 358 | CAMYAP010000002.1 | GCA947253865_00174 | CDS | open | 1513-1752 | _na 79_aa | Transposase-like protein | |
| 359 | CAMYAP010000002.1 | GCA947253865_00175 | CDS | open | 2171-3043 | _na 290_aa | Metallo-beta-lactamase domain-containing protein | |
| 360 | CAMYAP010000002.1 | GCA947253865_00176 | CDS | open | 3184-4137 | _na 317_aa | araC | AraC family transcriptional regulator |
| 361 | CAMYAP010000002.1 | GCA947253865_00177 | CDS | open | 4320-4898 | _na 192_aa | mdaB | NAD(P)H-dependent oxidoreductase |
| 362 | CAMYAP010000002.1 | GCA947253865_00178 | CDS | open | 5580-6590 | _na 336_aa | phage portal protein | |
| 363 | CAMYAP010000002.1 | GCA947253865_00179 | CDS | open | 6603-8381 | _na 592_aa | yjcR | Terminase |
| 364 | CAMYAP010000002.1 | GCA947253865_00180 | CDS | open | 8546-9373 | _na 275_aa | Phage capsid scaffolding protein (GPO) serine peptidase | |
| 365 | CAMYAP010000002.1 | GCA947253865_00181 | CDS | open | 9384-10445 | _na 353_aa | phage major capsid protein%2C P2 family | |
| 366 | CAMYAP010000002.1 | GCA947253865_00182 | CDS | open | 10445-11431 | _na 328_aa | hypothetical protein | |
| 367 | CAMYAP010000002.1 | GCA947253865_00183 | CDS | open | 11431-11889 | _na 152_aa | phage virion morphogenesis protein | |
| 368 | CAMYAP010000002.1 | GCA947253865_00184 | CDS | open | 11890-12135 | _na 81_aa | ABC transmembrane type-1 domain-containing protein | |
| 369 | CAMYAP010000002.1 | GCA947253865_00185 | CDS | open | 12204-15809 | _na 1201_aa | phage tail tape measure protein | |
| 370 | CAMYAP010000002.1 | GCA947253865_00186 | CDS | open | 15822-16439 | _na 205_aa | hypothetical protein | |
| 371 | CAMYAP010000002.1 | GCA947253865_00187 | CDS | open | 16418-16696 | _na 92_aa | uvrD | DNA helicase UvrD |
| 372 | CAMYAP010000002.1 | GCA947253865_00188 | CDS | open | 16819-17166 | _na 115_aa | hypothetical protein | |
| 373 | CAMYAP010000002.1 | GCA947253865_00189 | CDS | open | 17317-18501 | _na 394_aa | phage tail sheath subtilisin-like domain-containing protein | |
| 374 | CAMYAP010000002.1 | GCA947253865_00190 | CDS | open | 18505-19011 | _na 168_aa | phage major tail tube protein | |
| 375 | CAMYAP010000002.1 | GCA947253865_00191 | CDS | open | 19097-19396 | _na 99_aa | Tail protein | |
| 376 | CAMYAP010000002.1 | GCA947253865_00192 | CDS | open | 19396-19542 | _na 48_aa | Phage tail protein | |
| 377 | CAMYAP010000002.1 | GCA947253865_00193 | CDS | open | 19709-19870 | _na 53_aa | Lipoprotein | |
| 378 | CAMYAP010000002.1 | GCA947253865_00194 | CDS | open | 19870-20472 | _na 200_aa | hypothetical protein | |
| 379 | CAMYAP010000002.1 | GCA947253865_00195 | CDS | open | 20495-20767 | _na 90_aa | hypothetical protein | |
| 380 | CAMYAP010000002.1 | GCA947253865_00196 | CDS | open | 20801-21469 | _na 222_aa | hypothetical protein | |
| 381 | CAMYAP010000002.1 | GCA947253865_00197 | CDS | open | 21472-21699 | _na 75_aa | excalibur calcium-binding domain-containing protein | |
| 382 | CAMYAP010000002.1 | GCA947253865_00198 | CDS | open | 21710-22882 | _na 390_aa | Lipoprotein | |
| 383 | CAMYAP010000002.1 | GCA947253865_00199 | CDS | open | 22879-23706 | _na 275_aa | BRCT domain-containing protein | |
| 384 | CAMYAP010000002.1 | GCA947253865_00200 | CDS | open | 23711-24385 | _na 224_aa | Putative HTH-type transcriptional regulator | |
| 385 | CAMYAP010000002.1 | GCA947253865_00201 | CDS | open | 24507-24722 | _na 71_aa | Helix-turn-helix domain-containing protein | |
| 386 | CAMYAP010000002.1 | GCA947253865_00202 | CDS | open | 24741-25313 | _na 190_aa | hypothetical protein | |
| 387 | CAMYAP010000002.1 | GCA947253865_00203 | CDS | open | 25325-25573 | _na 82_aa | ogr/Delta-like zinc finger family protein | |
| 388 | CAMYAP010000002.1 | GCA947253865_00204 | CDS | open | 25669-26058 | _na 129_aa | integrase arm-type DNA-binding domain-containing protein | |
| 389 | CAMYAP010000002.1 | GCA947253865_00205 | CDS | open | 26332-26568 | _na 78_aa | hypothetical protein | |
| 390 | CAMYAP010000002.1 | GCA947253865_00206 | CDS | open | 26707-27015 | _na 102_aa | Helix-turn-helix domain-containing protein | |
| 391 | CAMYAP010000002.1 | GCA947253865_00207 | CDS | open | 27012-27359 | _na 115_aa | Type II toxin-antitoxin system RelE/ParE family toxin | |
| 392 | CAMYAP010000002.1 | GCA947253865_00208 | CDS | open | 27992-30184 | _na 730_aa | DUF927 domain-containing protein | |
| 393 | CAMYAP010000002.1 | GCA947253865_00209 | CDS | open | 30172-30564 | _na 130_aa | hypothetical protein | |
| 394 | CAMYAP010000002.1 | GCA947253865_00210 | CDS | open | 30557-31057 | _na 166_aa | Bacterial mobilisation domain-containing protein | |
| 395 | CAMYAP010000002.1 | GCA947253865_00211 | CDS | open | 31044-31244 | _na 66_aa | hypothetical protein | |
| 396 | CAMYAP010000002.1 | GCA947253865_00212 | CDS | open | 31244-31573 | _na 109_aa | hypothetical protein | |
| 397 | CAMYAP010000002.1 | GCA947253865_00213 | CDS | open | 31566-32528 | _na 320_aa | host cell division inhibitor Icd-like protein | |
| 398 | CAMYAP010000002.1 | GCA947253865_00215 | CDS | open | 33402-33827 | _na 141_aa | arsR | ArsR family transcriptional regulator |
| 399 | CAMYAP010000002.1 | GCA947253865_00216 | CDS | open | 33995-34768 | _na 257_aa | Putative anti-repressor protein | |
| 400 | CAMYAP010000002.1 | GCA947253865_00217 | CDS | open | 34890-35186 | _na 98_aa | hypothetical protein | |
| 401 | CAMYAP010000002.1 | GCA947253865_00218 | CDS | open | 35228-35614 | _na 128_aa | Terminase small subunit | |
| 402 | CAMYAP010000002.1 | GCA947253865_00219 | CDS | open | 35692-36003 | _na 103_aa | hypothetical protein | |
| 403 | CAMYAP010000002.1 | GCA947253865_00220 | CDS | open | 36028-36480 | _na 150_aa | hypothetical protein | |
| 404 | CAMYAP010000002.1 | GCA947253865_00221 | CDS | open | 36494-36754 | _na 86_aa | helix-turn-helix domain-containing protein | |
| 405 | CAMYAP010000002.1 | GCA947253865_00222 | CDS | open | 36765-36974 | _na 69_aa | alpA | CP4-57 prophage DNA-binding transcriptional activator |
| 406 | CAMYAP010000002.1 | GCA947253865_00223 | CDS | open | 37163-38089 | _na 308_aa | hypothetical protein | |
| 407 | CAMYAP010000002.1 | GCA947253865_00224 | CDS | open | 38180-39424 | _na 414_aa | fimB | Prophage CP4-57 integrase |
| 408 | CAMYAP010000002.1 | GCA947253865_00226 | CDS | open | 40184-40666 | _na 160_aa | DUF1573 domain-containing protein | |
| 409 | CAMYAP010000002.1 | GCA947253865_00227 | CDS | open | 40688-41842 | _na 384_aa | dinB | DNA polymerase IV |
| 410 | CAMYAP010000002.1 | GCA947253865_00229 | CDS | open | 42432-43367 | _na 311_aa | Arabinose 5-phosphate isomerase | |
| 411 | CAMYAP010000002.1 | GCA947253865_00230 | CDS | open | 43367-43912 | _na 181_aa | kdsC | 3-deoxy-D-manno-octulosonate 8-phosphate phosphatase KdsC |
| 412 | CAMYAP010000002.1 | GCA947253865_00231 | CDS | open | 43984-46641 | _na 885_aa | Mce/MlaD domain-containing protein | |
| 413 | CAMYAP010000002.1 | GCA947253865_00232 | CDS | open | 46625-47878 | _na 417_aa | Paraquat-inducible protein A | |
| 414 | CAMYAP010000002.1 | GCA947253865_00233 | CDS | open | 48048-48695 | _na 215_aa | proQ | RNA chaperone ProQ |
| 415 | CAMYAP010000002.1 | GCA947253865_00234 | CDS | open | 48725-50794 | _na 689_aa | prc | carboxy terminal-processing peptidase |
| 416 | CAMYAP010000002.1 | GCA947253865_00235 | CDS | open | 50849-52342 | _na 497_aa | ldtD | L%2CD-transpeptidase |
| 417 | CAMYAP010000002.1 | GCA947253865_00236 | CDS | open | 52416-52976 | _na 186_aa | DUF882 domain-containing protein | |
| 418 | CAMYAP010000002.1 | GCA947253865_00237 | CDS | open | 53038-53667 | _na 209_aa | MBL fold metallo-hydrolase | |
| 419 | CAMYAP010000002.1 | GCA947253865_00238 | CDS | open | 53823-55061 | _na 412_aa | pepT | peptidase T |
| 420 | CAMYAP010000002.1 | GCA947253865_00239 | CDS | open | 55201-56454 | _na 417_aa | potA | spermidine/putrescine ABC transporter ATP-binding protein PotA |
| 421 | CAMYAP010000002.1 | GCA947253865_00240 | CDS | open | 56438-57298 | _na 286_aa | potB | spermidine/putrescine ABC transporter permease PotB |
| 422 | CAMYAP010000002.1 | GCA947253865_00241 | CDS | open | 57298-58068 | _na 256_aa | potC | spermidine/putrescine ABC transporter permease PotC |
| 423 | CAMYAP010000002.1 | GCA947253865_00242 | CDS | open | 58203-59285 | _na 360_aa | Putrescine-binding periplasmic protein | |
| 424 | CAMYAP010000002.1 | GCA947253865_00243 | CDS | open | 59363-60703 | _na 446_aa | rarA | Replication-associated recombination protein A |
| 425 | CAMYAP010000002.1 | GCA947253865_00244 | CDS | open | 60757-61383 | _na 208_aa | lolA | outer membrane lipoprotein chaperone LolA |
| 426 | CAMYAP010000002.1 | GCA947253865_00245 | CDS | open | 61420-64209 | _na 929_aa | ftsK | DNA translocase FtsK |
| 427 | CAMYAP010000002.1 | GCA947253865_00246 | CDS | open | 64212-64691 | _na 159_aa | lrp | leucine-responsive transcriptional regulator Lrp |
| 428 | CAMYAP010000002.1 | GCA947253865_00247 | CDS | open | 64774-66153 | _na 459_aa | radA | DNA repair protein RadA |
| 429 | CAMYAP010000002.1 | GCA947253865_00248 | CDS | open | 66180-67202 | _na 340_aa | Adenylate cyclase | |
| 430 | CAMYAP010000002.1 | GCA947253865_00249 | CDS | open | 67341-68021 | _na 226_aa | ykaA | UPF0111 protein HI_1603 |
| 431 | CAMYAP010000002.1 | GCA947253865_00250 | CDS | open | 68057-69319 | _na 420_aa | Phosphate transporter | |
| 432 | CAMYAP010000002.1 | GCA947253865_00251 | CDS | open | 69398-70006 | _na 202_aa | TIGR04211 family SH3 domain-containing protein | |
| 433 | CAMYAP010000002.1 | GCA947253865_00252 | CDS | open | 70068-71312 | _na 414_aa | multifunctional CCA addition/repair protein | |
| 434 | CAMYAP010000002.1 | GCA947253865_00253 | CDS | open | 71305-72000 | _na 231_aa | lolB | lipoprotein insertase outer membrane protein LolB |
| 435 | CAMYAP010000002.1 | GCA947253865_00254 | CDS | open | 72000-72893 | _na 297_aa | ispE | 4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase |
| 436 | CAMYAP010000002.1 | GCA947253865_00255 | CDS | open | 72925-73872 | _na 315_aa | prs | Ribose-phosphate pyrophosphokinase |
| 437 | CAMYAP010000002.1 | GCA947253865_00257 | CDS | open | 74195-75130 | _na 311_aa | mdh | malate dehydrogenase |
| 438 | CAMYAP010000002.1 | GCA947253865_00258 | CDS | open | 75317-75775 | _na 152_aa | argR | transcriptional regulator ArgR |
| 439 | CAMYAP010000002.1 | GCA947253865_00259 | CDS | open | 75772-76656 | _na 294_aa | sulA | Cell division inhibitor SulA |
| 440 | CAMYAP010000002.1 | GCA947253865_00260 | CDS | open | 76703-78007 | _na 434_aa | folC | bifunctional tetrahydrofolate synthase/dihydrofolate synthase |
| 441 | CAMYAP010000002.1 | GCA947253865_00261 | CDS | open | 78012-78902 | _na 296_aa | accD | acetyl-CoA carboxylase%2C carboxyltransferase subunit beta |
| 442 | CAMYAP010000002.1 | GCA947253865_00262 | CDS | open | 78968-79762 | _na 264_aa | truA | tRNA pseudouridine(38-40) synthase TruA |
| 443 | CAMYAP010000002.1 | GCA947253865_00263 | CDS | open | 79866-80153 | _na 95_aa | rplY | 50S ribosomal protein L25 |
| 444 | CAMYAP010000002.1 | GCA947253865_00264 | CDS | open | 80380-80985 | _na 201_aa | dedA | SNARE-like domain protein |
| 445 | CAMYAP010000002.1 | GCA947253865_00265 | CDS | open | 81314-84481 | _na 1055_aa | cas9 | type II CRISPR RNA-guided endonuclease Cas9 |
| 446 | CAMYAP010000002.1 | GCA947253865_00266 | CDS | open | 84535-85452 | _na 305_aa | cas1 | type II CRISPR-associated endonuclease Cas1 |
| 447 | CAMYAP010000002.1 | GCA947253865_00267 | CDS | open | 85445-85873 | _na 142_aa | CRISPR-associated endoribonuclease Cas2 | |
| 448 | CAMYAP010000002.1 | GCA947253865_00268 | CDS | open | 86613-86888 | _na 91_aa | hypothetical protein | |
| 449 | CAMYAP010000002.1 | GCA947253865_00269 | CDS | open | 86917-87531 | _na 204_aa | riboflavin synthase subunit alpha | |
| 450 | CAMYAP010000002.1 | GCA947253865_00270 | CDS | open | 87577-88974 | _na 465_aa | Multidrug-efflux transporter | |
| 451 | CAMYAP010000002.1 | GCA947253865_00271 | CDS | open | 89019-90494 | _na 491_aa | rng | ribonuclease G |
| 452 | CAMYAP010000002.1 | GCA947253865_00272 | CDS | open | 90612-92126 | _na 504_aa | putP | sodium/proline symporter PutP |
| 453 | CAMYAP010000002.1 | GCA947253865_00273 | CDS | open | 92126-93091 | _na 321_aa | cmoB | tRNA 5-methoxyuridine(34)/uridine 5-oxyacetic acid(34) synthase CmoB |
| 454 | CAMYAP010000002.1 | GCA947253865_00274 | CDS | open | 93151-94239 | _na 362_aa | rlmM | 23S rRNA (cytidine(2498)-2'-O)-methyltransferase RlmM |
| 455 | CAMYAP010000002.1 | GCA947253865_00275 | CDS | open | 94232-95125 | _na 297_aa | lysR | LysR substrate binding domain protein |
| 456 | CAMYAP010000002.1 | GCA947253865_00277 | CDS | open | 95607-96638 | _na 343_aa | ilvE | branched-chain amino acid aminotransferase |
| 457 | CAMYAP010000002.1 | GCA947253865_00278 | CDS | open | 96706-97221 | _na 171_aa | hypothetical protein | |
| 458 | CAMYAP010000002.1 | GCA947253865_00279 | CDS | open | 97173-97838 | _na 221_aa | 2-acyl-glycerophospho-ethanolamine acyltransferase | |
| 459 | CAMYAP010000002.1 | GCA947253865_00280 | CDS | open | 97835-98476 | _na 213_aa | merR | Transcriptional regulator%2C MerR family |
| 460 | CAMYAP010000002.1 | GCA947253865_00281 | CDS | open | 98613-100178 | _na 521_aa | Putative ABC-type oligopeptide transport system%2C periplasmic component | |
| 461 | CAMYAP010000002.1 | GCA947253865_00282 | CDS | open | 100171-100647 | _na 158_aa | ybaN | Inner membrane protein ybaN |
| 462 | CAMYAP010000002.1 | GCA947253865_00283 | CDS | open | 100764-102803 | _na 679_aa | prlC | oligopeptidase A |
| 463 | CAMYAP010000002.1 | GCA947253865_00284 | CDS | open | 102917-103186 | _na 89_aa | rpsO | 30S ribosomal protein S15 |
| 464 | CAMYAP010000002.1 | GCA947253865_00285 | CDS | open | 103319-104035 | _na 238_aa | modA | molybdate ABC transporter substrate-binding protein |
| 465 | CAMYAP010000002.1 | GCA947253865_00286 | CDS | open | 104028-104804 | _na 258_aa | ABC transporter%2C ATP-binding protein | |
| 466 | CAMYAP010000002.1 | GCA947253865_00287 | CDS | open | 104797-105810 | _na 337_aa | Iron chelate uptake ABC transporter%2C FeCT family%2C permease protein | |
| 467 | CAMYAP010000002.1 | GCA947253865_00288 | CDS | open | 105800-106840 | _na 346_aa | Fe/B12 periplasmic-binding domain-containing protein | |
| 468 | CAMYAP010000002.1 | GCA947253865_00289 | CDS | open | 106930-107577 | _na 215_aa | modD | ModD protein |
| 469 | CAMYAP010000002.1 | GCA947253865_00290 | CDS | open | 107617-107775 | _na 52_aa | hypothetical protein | |
| 470 | CAMYAP010000002.1 | GCA947253865_00291 | CDS | open | 107785-108534 | _na 249_aa | ABC transporter%2C ATP-binding protein | |
| 471 | CAMYAP010000002.1 | GCA947253865_00292 | CDS | open | 108531-109544 | _na 337_aa | Iron chelate uptake ABC transporter%2C FeCT family%2C permease protein | |
| 472 | CAMYAP010000002.1 | GCA947253865_00293 | CDS | open | 109547-110545 | _na 332_aa | Periplasmic binding protein | |
| 473 | CAMYAP010000002.1 | GCA947253865_00294 | CDS | open | 110691-111206 | _na 171_aa | Chemotaxis protein | |
| 474 | CAMYAP010000002.1 | GCA947253865_00295 | CDS | open | 111175-113163 | _na 662_aa | TonB-dependent receptor | |
| 475 | CAMYAP010000002.1 | GCA947253865_00296 | CDS | open | 113217-114647 | _na 476_aa | rfaE | ADP-heptose synthase |
| 476 | CAMYAP010000002.1 | GCA947253865_00297 | CDS | open | 114745-115680 | _na 311_aa | Lipid A biosynthesis acyltransferase | |
| 477 | CAMYAP010000002.1 | GCA947253865_00298 | CDS | open | 115924-116679 | _na 251_aa | Nif3-like dinuclear metal center hexameric protein | |
| 478 | CAMYAP010000002.1 | GCA947253865_00299 | CDS | open | 116765-117553 | _na 262_aa | fabI | Enoyl-[acyl-carrier-protein] reductase [NADH] FabI |
| 479 | CAMYAP010000002.1 | GCA947253865_00300 | CDS | open | 117620-119599 | _na 659_aa | rnb | exoribonuclease II |
| 480 | CAMYAP010000002.1 | GCA947253865_00301 | CDS | open | 119686-120630 | _na 314_aa | tehA | dicarboxylate transporter/tellurite-resistance protein TehA |
| 481 | CAMYAP010000002.1 | GCA947253865_00302 | CDS | open | 120795-122084 | _na 429_aa | serS | serine--tRNA ligase |
| 482 | CAMYAP010000002.1 | GCA947253865_00303 | CDS | open | 122323-122541 | _na 72_aa | DUF465 domain-containing protein | |
| 483 | CAMYAP010000002.1 | GCA947253865_00304 | CDS | open | 122796-123596 | _na 266_aa | Gamma-glutamyl phosphate reductase | |
| 484 | CAMYAP010000002.1 | GCA947253865_00305 | CDS | open | 123730-124392 | _na 220_aa | Glycine transporter domain-containing protein | |
| 485 | CAMYAP010000002.1 | GCA947253865_00306 | CDS | open | 124408-125661 | _na 417_aa | glutamate-5-semialdehyde dehydrogenase | |
| 486 | CAMYAP010000002.1 | GCA947253865_00307 | CDS | open | 125728-126576 | _na 282_aa | DUF808 domain-containing protein | |
| 487 | CAMYAP010000002.1 | GCA947253865_00308 | CDS | open | 126617-128761 | _na 714_aa | dnaX | DNA polymerase III subunit gamma/tau |
| 488 | CAMYAP010000002.1 | GCA947253865_00309 | CDS | open | 128778-129320 | _na 180_aa | apt | adenine phosphoribosyltransferase |
| 489 | CAMYAP010000002.1 | GCA947253865_00310 | CDS | open | 129434-130393 | _na 319_aa | lpxM | lauroyl-Kdo(2)-lipid IV(A) myristoyltransferase |
| 490 | CAMYAP010000002.1 | GCA947253865_00311 | CDS | open | 130403-131170 | _na 255_aa | putative membrane transporter protein | |
| 491 | CAMYAP010000002.1 | GCA947253865_00312 | CDS | open | 131181-132053 | _na 290_aa | mepA | penicillin-insensitive murein endopeptidase |
| 492 | CAMYAP010000002.1 | GCA947253865_00313 | CDS | open | 132117-133190 | _na 357_aa | aroC | chorismate synthase |
| 493 | CAMYAP010000002.1 | GCA947253865_00314 | CDS | open | 133206-136547 | _na 1113_aa | mscK | mechanosensitive channel MscK |
| 494 | CAMYAP010000002.1 | GCA947253865_00315 | CDS | open | 136561-137913 | _na 450_aa | menE | o-succinylbenzoate--CoA ligase |
| 495 | CAMYAP010000002.1 | GCA947253865_00316 | CDS | open | 137918-138559 | _na 213_aa | seqA | replication initiation negative regulator SeqA |
| 496 | CAMYAP010000002.1 | GCA947253865_00317 | CDS | open | 138630-139415 | _na 261_aa | Esterase | |
| 497 | CAMYAP010000002.1 | GCA947253865_00318 | CDS | open | 139518-140042 | _na 174_aa | fldA | flavodoxin FldA |
| 498 | CAMYAP010000002.1 | GCA947253865_00319 | CDS | open | 140075-140509 | _na 144_aa | fur | ferric iron uptake transcriptional regulator |
| 499 | CAMYAP010000002.1 | GCA947253865_00320 | CDS | open | 140616-141950 | _na 444_aa | argG | argininosuccinate synthase |
| 500 | CAMYAP010000002.1 | GCA947253865_00321 | CDS | open | 142002-142832 | _na 276_aa | Epimerase%2C with NAD(P)-binding Rossmann-fold domain |

