HOMD Banner
Taxonomy: V4.3   |  16S rRNA RefSeq: V16.03   |  Genomic RefSeq: V11.03   |  Viruses: V1.2

BAKTAGenome Explorer: Megasphaera lornae (GCA_947254525.1)

Select a Genome:
BAKTA Annotations for GCA_947254525.1
Genome Selected: Megasphaera lornae
ContigsBases CDSrRNA tmRNAtRNA
14 1742612 1606 0 1 38
[Table]   [AA Fasta]      [Browser]   [Text]   [Excel]  
Search & Sort all 3323 Records
Search These Records: Clear
Sort Column:   Molecule   PID   NA   AA   Gene  Gene Product  Reverse
Annotation Table [page:6]    |    Number of Records Found: 3323 [7 Pages]    |    Previous Page <==> Next Page    |    Jump to Page: [ 1  2  3  4  5  6  7  ]
Notes:   1- Column headers only sort the current page. 2- Select [NA] or [AA] links to show sequences.
Region Protein-ID Type Genome
Viewer		 Range
(bp)		 Show Sequences
(length) NA / AA		 BAKTA
Gene		 BAKTA
GeneProduct
2501 CAMYEP010000008.1 GCA947254525_01280 CDS open 79815-81314 _na     499_aa Succinate CoA transferase
2502 CAMYEP010000008.1 GCA947254525_01281 CDS open 81736-82413 _na     225_aa Cyclic nucleotide-binding domain protein
2503 CAMYEP010000008.1 GCA947254525_01282 CDS open 82851-87737 _na     1628_aa TonB-dependent receptor plug domain protein
2504 CAMYEP010000008.1 GCA947254525_01283 CDS open 87909-90050 _na     713_aa uvrB excinuclease ABC subunit UvrB
2505 CAMYEP010000008.1 GCA947254525_01284 CDS open 90056-92920 _na     954_aa uvrA excinuclease ABC subunit UvrA
2506 CAMYEP010000008.1 GCA947254525_01285 CDS open 92910-94748 _na     612_aa uvrC excinuclease ABC subunit UvrC
2507 CAMYEP010000008.1 GCA947254525_01286 CDS open 94817-95452 _na     211_aa DUF3298 domain-containing protein
2508 CAMYEP010000008.1 GCA947254525_01287 CDS open 95807-95968 _na     53_aa Rubredoxin
2509 CAMYEP010000008.1 GCA947254525_01288 CDS open 96235-97428 _na     397_aa Aminotransferase%2C class I/II
2510 CAMYEP010000008.1 GCA947254525_01289 CDS open 98178-98603 _na     141_aa Integrase catalytic domain-containing protein
2511 CAMYEP010000008.1 GCA947254525_01205 gene open 131-631
2512 CAMYEP010000008.1 GCA947254525_01206 gene open 661-846 rpmF
2513 CAMYEP010000008.1 GCA947254525_01207 gene open 980-1480 ruvC
2514 CAMYEP010000008.1 GCA947254525_01208 gene open 1477-2079 ruvA
2515 CAMYEP010000008.1 GCA947254525_01209 gene open 2082-3098 ruvB
2516 CAMYEP010000008.1 GCA947254525_01210 gene open 3137-4378
2517 CAMYEP010000008.1 GCA947254525_01211 gene open 4392-5411 queA
2518 CAMYEP010000008.1 GCA947254525_01212 gene open 5424-6530 tgt
2519 CAMYEP010000008.1 GCA947254525_01213 gene open 6758-7027 yajC
2520 CAMYEP010000008.1 GCA947254525_01214 gene open 7032-7601
2521 CAMYEP010000008.1 GCA947254525_01215 gene open 7626-8927 secD
2522 CAMYEP010000008.1 GCA947254525_01216 gene open 8924-9883 secF
2523 CAMYEP010000008.1 GCA947254525_01217 gene open 9884-10291
2524 CAMYEP010000008.1 GCA947254525_01218 gene open 10414-10953
2525 CAMYEP010000008.1 GCA947254525_01219 gene open 11054-11761 deoD
2526 CAMYEP010000008.1 GCA947254525_01220 gene open 11776-12105 queD
2527 CAMYEP010000008.1 GCA947254525_01221 gene open 12095-12727
2528 CAMYEP010000008.1 GCA947254525_01222 gene open 12873-13706
2529 CAMYEP010000008.1 GCA947254525_01223 gene open 13710-14717 araC
2530 CAMYEP010000008.1 GCA947254525_01224 gene open 14789-15613
2531 CAMYEP010000008.1 GCA947254525_01225 gene open 15688-17196
2532 CAMYEP010000008.1 GCA947254525_01226 gene open 17578-18489 lysR
2533 CAMYEP010000008.1 GCA947254525_01227 gene open 18935-22456 nifJ
2534 CAMYEP010000008.1 GCA947254525_01228 gene open 22626-23096
2535 CAMYEP010000008.1 GCA947254525_01229 gene open 23175-23720
2536 CAMYEP010000008.1 GCA947254525_01230 gene open 24005-25477
2537 CAMYEP010000008.1 GCA947254525_01231 gene open 25461-26870
2538 CAMYEP010000008.1 GCA947254525_01232 gene open 27437-28012
2539 CAMYEP010000008.1 GCA947254525_01233 gene open 28070-29314
2540 CAMYEP010000008.1 GCA947254525_01234 gene open 29327-29554
2541 CAMYEP010000008.1 GCA947254525_01235 gene open 29632-29838
2542 CAMYEP010000008.1 GCA947254525_01236 gene open 30080-30511
2543 CAMYEP010000008.1 GCA947254525_01237 gene open 30511-32175 argS
2544 CAMYEP010000008.1 GCA947254525_01238 gene open 32238-33851
2545 CAMYEP010000008.1 GCA947254525_01239 gene open 34469-35809 rsxC
2546 CAMYEP010000008.1 GCA947254525_01240 gene open 35838-36863
2547 CAMYEP010000008.1 GCA947254525_01241 gene open 36865-37419
2548 CAMYEP010000008.1 GCA947254525_01242 gene open 37419-38042
2549 CAMYEP010000008.1 GCA947254525_01243 gene open 38042-38617
2550 CAMYEP010000008.1 GCA947254525_01244 gene open 38642-39490 rnfB
2551 CAMYEP010000008.1 GCA947254525_01245 gene open 39495-40556
2552 CAMYEP010000008.1 GCA947254525_01246 gene open 40703-41143 asnC
2553 CAMYEP010000008.1 GCA947254525_01247 gene open 41281-43182 abc-f
2554 CAMYEP010000008.1 GCA947254525_01248 gene open 43337-44746 glcD
2555 CAMYEP010000008.1 GCA947254525_01249 gene open 45063-46583
2556 CAMYEP010000008.1 GCA947254525_01250 gene open 46600-47979 fumC
2557 CAMYEP010000008.1 GCA947254525_01251 gene open 48188-48952
2558 CAMYEP010000008.1 GCA947254525_01252 gene open 48939-50108
2559 CAMYEP010000008.1 GCA947254525_01253 gene open 50096-50635 bioX
2560 CAMYEP010000008.1 GCA947254525_01254 gene open 50850-51335
2561 CAMYEP010000008.1 GCA947254525_01255 gene open 51351-51698 ylbF
2562 CAMYEP010000008.1 GCA947254525_01256 gene open 51688-52611 murB
2563 CAMYEP010000008.1 GCA947254525_01257 gene open 52762-54567 typA
2564 CAMYEP010000008.1 GCA947254525_01258 gene open 54700-54966
2565 CAMYEP010000008.1 GCA947254525_01259 gene open 55397-56818
2566 CAMYEP010000008.1 GCA947254525_01260 gene open 57144-58025
2567 CAMYEP010000008.1 GCA947254525_01261 gene open 58022-60076
2568 CAMYEP010000008.1 GCA947254525_01262 gene open 60371-61570 alr
2569 CAMYEP010000008.1 GCA947254525_01263 gene open 61835-63013
2570 CAMYEP010000008.1 GCA947254525_01264 gene open 63561-63962
2571 CAMYEP010000008.1 GCA947254525_01265 gene open 63978-64400 yhaI
2572 CAMYEP010000008.1 GCA947254525_01266 gene open 64701-64853
2573 CAMYEP010000008.1 GCA947254525_01267 gene open 64893-65453 araC
2574 CAMYEP010000008.1 GCA947254525_01268 gene open 65721-65936 feoA
2575 CAMYEP010000008.1 GCA947254525_01269 gene open 65954-66175 feoA
2576 CAMYEP010000008.1 GCA947254525_01270 gene open 66192-68375 feoB
2577 CAMYEP010000008.1 GCA947254525_01271 gene open 68403-68531
2578 CAMYEP010000008.1 GCA947254525_01272 gene open 68651-69964
2579 CAMYEP010000008.1 GCA947254525_01273 gene open 70025-72241 pcrA
2580 CAMYEP010000008.1 GCA947254525_01274 gene open 72261-74267 ligA
2581 CAMYEP010000008.1 GCA947254525_01275 gene open 74338-74628 gatC
2582 CAMYEP010000008.1 GCA947254525_01276 gene open 74640-76106 gatA
2583 CAMYEP010000008.1 GCA947254525_01277 gene open 76103-77545 gatB
2584 CAMYEP010000008.1 GCA947254525_01278 gene open 77750-79207 sdcS
2585 CAMYEP010000008.1 GCA947254525_01279 gene open 79226-79798
2586 CAMYEP010000008.1 GCA947254525_01280 gene open 79815-81314
2587 CAMYEP010000008.1 GCA947254525_01281 gene open 81736-82413
2588 CAMYEP010000008.1 GCA947254525_01282 gene open 82851-87737
2589 CAMYEP010000008.1 GCA947254525_01283 gene open 87909-90050 uvrB
2590 CAMYEP010000008.1 GCA947254525_01284 gene open 90056-92920 uvrA
2591 CAMYEP010000008.1 GCA947254525_01285 gene open 92910-94748 uvrC
2592 CAMYEP010000008.1 GCA947254525_01286 gene open 94817-95452
2593 CAMYEP010000008.1 GCA947254525_01287 gene open 95807-95968
2594 CAMYEP010000008.1 GCA947254525_01288 gene open 96235-97428
2595 CAMYEP010000008.1 GCA947254525_01289 gene open 98178-98603
2596 CAMYEP010000009.1 regulatory_region open 28383-28484 SAM riboswitch aptamer (S box leader)
2597 CAMYEP010000009.1 regulatory_region open 40436-40569 FMN riboswitch aptamer (RFN element)
2598 CAMYEP010000009.1 GCA947254525_01290 CDS open 96-329 _na     77_aa hypothetical protein
2599 CAMYEP010000009.1 GCA947254525_01291 CDS open 360-503 _na     47_aa hypothetical protein
2600 CAMYEP010000009.1 GCA947254525_01292 CDS open 546-779 _na     77_aa Conserved domain protein
2601 CAMYEP010000009.1 GCA947254525_01293 CDS open 873-1073 _na     66_aa Single-strand binding family protein
2602 CAMYEP010000009.1 GCA947254525_01294 CDS open 1264-1470 _na     68_aa HTH cro/C1-type domain-containing protein
2603 CAMYEP010000009.1 GCA947254525_01295 CDS open 1480-5256 _na     1258_aa YobI-like P-loop NTPase domain-containing protein
2604 CAMYEP010000009.1 GCA947254525_01296 CDS open 5413-6039 _na     208_aa Relaxase/mobilization nuclease domain protein
2605 CAMYEP010000009.1 GCA947254525_01297 CDS open 6055-6609 _na     184_aa Relaxase/mobilization nuclease domain protein
2606 CAMYEP010000009.1 GCA947254525_01298 CDS open 6610-6969 _na     119_aa plasmid mobilization protein
2607 CAMYEP010000009.1 GCA947254525_01299 CDS open 7354-7926 _na     190_aa acrR HTH tetR-type domain-containing protein
2608 CAMYEP010000009.1 GCA947254525_01300 CDS open 8030-9769 _na     579_aa mdlB ABC transporter
2609 CAMYEP010000009.1 GCA947254525_01301 CDS open 9762-11477 _na     571_aa mdlB ABC transporter
2610 CAMYEP010000009.1 GCA947254525_01302 CDS open 11474-11644 _na     56_aa ABC transporter domain-containing protein
2611 CAMYEP010000009.1 GCA947254525_01303 CDS open 11776-13047 _na     423_aa AAA family ATPase
2612 CAMYEP010000009.1 GCA947254525_01304 CDS open 13091-13603 _na     170_aa rlmD 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD
2613 CAMYEP010000009.1 GCA947254525_01305 CDS open 13929-14774 _na     281_aa Phosphate-binding protein
2614 CAMYEP010000009.1 GCA947254525_01306 CDS open 14839-15705 _na     288_aa pstC phosphate ABC transporter permease subunit PstC
2615 CAMYEP010000009.1 GCA947254525_01307 CDS open 15757-16569 _na     270_aa pstA phosphate ABC transporter permease PstA
2616 CAMYEP010000009.1 GCA947254525_01308 CDS open 16570-17346 _na     258_aa pstB phosphate ABC transporter ATP-binding protein PstB
2617 CAMYEP010000009.1 GCA947254525_01309 CDS open 17346-18017 _na     223_aa phoU phosphate signaling complex protein PhoU
2618 CAMYEP010000009.1 GCA947254525_01310 CDS open 17992-18672 _na     226_aa Stage 0 sporulation A-like protein
2619 CAMYEP010000009.1 GCA947254525_01311 CDS open 18662-20326 _na     554_aa histidine kinase
2620 CAMYEP010000009.1 GCA947254525_01312 CDS open 20887-23019 _na     710_aa Hep/Hag repeat protein
2621 CAMYEP010000009.1 GCA947254525_01313 CDS open 23425-24819 _na     464_aa Permease
2622 CAMYEP010000009.1 GCA947254525_01314 CDS open 25048-25938 _na     296_aa TIGR00255-like family protein
2623 CAMYEP010000009.1 GCA947254525_01315 CDS open 25948-26232 _na     94_aa remA extracellular matrix/biofilm regulator RemA
2624 CAMYEP010000009.1 GCA947254525_01316 CDS open 26202-26852 _na     216_aa gmk guanylate kinase
2625 CAMYEP010000009.1 GCA947254525_01317 CDS open 26870-27079 _na     69_aa rpoZ DNA-directed RNA polymerase subunit omega
2626 CAMYEP010000009.1 GCA947254525_01318 CDS open 27097-28326 _na     409_aa coaBC bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC
2627 CAMYEP010000009.1 GCA947254525_01319 CDS open 28537-29730 _na     397_aa metK methionine adenosyltransferase
2628 CAMYEP010000009.1 GCA947254525_01320 CDS open 29841-32201 _na     786_aa priA primosomal protein N'
2629 CAMYEP010000009.1 GCA947254525_01321 CDS open 32227-32742 _na     171_aa def peptide deformylase
2630 CAMYEP010000009.1 GCA947254525_01322 CDS open 32739-33677 _na     312_aa fmt methionyl-tRNA formyltransferase
2631 CAMYEP010000009.1 GCA947254525_01323 CDS open 33752-35080 _na     442_aa rsmB 16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB
2632 CAMYEP010000009.1 GCA947254525_01324 CDS open 35082-36119 _na     345_aa rlmN 23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN
2633 CAMYEP010000009.1 GCA947254525_01325 CDS open 36177-36887 _na     236_aa Stp1/IreP family PP2C-type Ser/Thr phosphatase
2634 CAMYEP010000009.1 GCA947254525_01326 CDS open 36898-38838 _na     646_aa pknB Stk1 family PASTA domain-containing Ser/Thr kinase
2635 CAMYEP010000009.1 GCA947254525_01327 CDS open 38858-39715 _na     285_aa rsgA ribosome small subunit-dependent GTPase A
2636 CAMYEP010000009.1 GCA947254525_01328 CDS open 39717-40364 _na     215_aa rpe ribulose-phosphate 3-epimerase
2637 CAMYEP010000009.1 GCA947254525_01329 CDS open 40523-41794 _na     423_aa ribD bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD
2638 CAMYEP010000009.1 GCA947254525_01330 CDS open 41775-42425 _na     216_aa ribE riboflavin synthase
2639 CAMYEP010000009.1 GCA947254525_01331 CDS open 42453-42917 _na     154_aa ribE 6%2C7-dimethyl-8-ribityllumazine synthase
2640 CAMYEP010000009.1 GCA947254525_01332 CDS open 43212-44075 _na     287_aa ylqF ribosome biogenesis GTPase YlqF
2641 CAMYEP010000009.1 GCA947254525_01333 CDS open 44072-44866 _na     264_aa ribonuclease HII
2642 CAMYEP010000009.1 GCA947254525_01334 CDS open 44877-45332 _na     151_aa Amidohydrolase
2643 CAMYEP010000009.1 GCA947254525_01335 CDS open 45329-45466 _na     45_aa hypothetical protein
2644 CAMYEP010000009.1 GCA947254525_01336 CDS open 45575-46066 _na     163_aa M20 family metallopeptidase
2645 CAMYEP010000009.1 GCA947254525_01337 CDS open 46276-48174 _na     632_aa Glutamine-dependent NAD(+) synthetase
2646 CAMYEP010000009.1 GCA947254525_01338 CDS open 48286-48849 _na     187_aa Flavin reductase
2647 CAMYEP010000009.1 GCA947254525_01339 CDS open 49068-49523 _na     151_aa Firmicute transcriptional repressor of class III stress
2648 CAMYEP010000009.1 GCA947254525_01340 CDS open 49537-49986 _na     149_aa UVR domain-containing protein
2649 CAMYEP010000009.1 GCA947254525_01341 CDS open 49999-51042 _na     347_aa ATP:guanido phosphotransferase%2C catalytic domain protein
2650 CAMYEP010000009.1 GCA947254525_01342 CDS open 51029-52420 _na     463_aa radA DNA repair protein RadA
2651 CAMYEP010000009.1 GCA947254525_01343 CDS open 52512-53696 _na     394_aa PIN domain protein
2652 CAMYEP010000009.1 GCA947254525_01344 CDS open 53704-54885 _na     393_aa Bifunctional enzyme IspD/IspF
2653 CAMYEP010000009.1 GCA947254525_01345 CDS open 54908-56365 _na     485_aa gltX glutamate--tRNA ligase
2654 CAMYEP010000009.1 GCA947254525_01346 CDS open 56680-58125 _na     481_aa cysS cysteine--tRNA ligase
2655 CAMYEP010000009.1 GCA947254525_01347 CDS open 58122-58598 _na     158_aa Mini-ribonuclease 3
2656 CAMYEP010000009.1 GCA947254525_01348 CDS open 58607-59359 _na     250_aa rlmB 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB
2657 CAMYEP010000009.1 GCA947254525_01349 CDS open 59356-59895 _na     179_aa YacP-like NYN domain protein
2658 CAMYEP010000009.1 GCA947254525_01350 CDS open 59902-60591 _na     229_aa sigH RNA polymerase sporulation sigma factor SigH
2659 CAMYEP010000009.1 GCA947254525_01351 CDS open 60636-60872 _na     78_aa secG preprotein translocase subunit SecG
2660 CAMYEP010000009.1 GCA947254525_01352 CDS open 60925-63228 _na     767_aa rnr ribonuclease R
2661 CAMYEP010000009.1 GCA947254525_01353 CDS open 63241-63711 _na     156_aa smpB SsrA-binding protein SmpB
2662 CAMYEP010000009.1 GCA947254525_01354 CDS open 63722-64069 _na     115_aa arsC ArsC family protein
2663 CAMYEP010000009.1 GCA947254525_01355 CDS open 64327-65211 _na     294_aa hslO Hsp33 family molecular chaperone HslO
2664 CAMYEP010000009.1 GCA947254525_01356 CDS open 65214-66008 _na     264_aa mtnP S-methyl-5'-thioadenosine phosphorylase
2665 CAMYEP010000009.1 GCA947254525_01357 CDS open 66063-67073 _na     336_aa mtnA S-methyl-5-thioribose-1-phosphate isomerase
2666 CAMYEP010000009.1 GCA947254525_01358 CDS open 67094-68335 _na     413_aa adenosylhomocysteinase
2667 CAMYEP010000009.1 GCA947254525_01359 CDS open 68352-69635 _na     427_aa 5-methylthioadenosine/S-adenosylhomocysteine deaminase
2668 CAMYEP010000009.1 GCA947254525_01360 CDS open 69806-70423 _na     205_aa lexA transcriptional repressor LexA
2669 CAMYEP010000009.1 GCA947254525_01361 CDS open 70593-70952 _na     119_aa lysM LysM domain protein
2670 CAMYEP010000009.1 GCA947254525_01362 CDS open 71179-72231 _na     350_aa Endolytic murein transglycosylase
2671 CAMYEP010000009.1 GCA947254525_01363 CDS open 72228-72818 _na     196_aa O-methyltransferase
2672 CAMYEP010000009.1 GCA947254525_01364 CDS open 72822-74051 _na     409_aa Peptidase%2C U32 family
2673 CAMYEP010000009.1 GCA947254525_01365 CDS open 74048-74299 _na     83_aa DUF4911 domain-containing protein
2674 CAMYEP010000009.1 GCA947254525_01366 CDS open 74391-76067 _na     558_aa DUF2813 domain-containing protein
2675 CAMYEP010000009.1 GCA947254525_01367 CDS open 76064-78208 _na     714_aa DNA topoisomerase
2676 CAMYEP010000009.1 GCA947254525_01368 CDS open 78195-79469 _na     424_aa Tetratricopeptide repeat protein
2677 CAMYEP010000009.1 GCA947254525_01369 CDS open 79466-79990 _na     174_aa dcd dCTP deaminase
2678 CAMYEP010000009.1 GCA947254525_01370 CDS open 80003-80980 _na     325_aa Peptidase family T4
2679 CAMYEP010000009.1 GCA947254525_01371 CDS open 81084-81626 _na     180_aa hypothetical protein
2680 CAMYEP010000009.1 GCA947254525_01372 CDS open 81820-82224 _na     134_aa Cupin type-2 domain-containing protein
2681 CAMYEP010000009.1 GCA947254525_01373 CDS open 82404-83420 _na     338_aa gap type I glyceraldehyde-3-phosphate dehydrogenase
2682 CAMYEP010000009.1 GCA947254525_01374 CDS open 83593-84618 _na     341_aa Glyceraldehyde 3-phosphate dehydrogenase domain protein
2683 CAMYEP010000009.1 GCA947254525_01375 CDS open 84649-85830 _na     393_aa Phosphoglycerate kinase
2684 CAMYEP010000009.1 GCA947254525_01376 CDS open 85848-86606 _na     252_aa tpiA triose-phosphate isomerase
2685 CAMYEP010000009.1 GCA947254525_01377 CDS open 88536-88712 _na     58_aa hypothetical protein
2686 CAMYEP010000009.1 GCA947254525_01378 CDS open 91027-91587 _na     186_aa hypothetical protein
2687 CAMYEP010000009.1 GCA947254525_01379 CDS open 92044-93102 _na     352_aa hypothetical protein
2688 CAMYEP010000009.1 GCA947254525_01290 gene open 96-329
2689 CAMYEP010000009.1 GCA947254525_01291 gene open 360-503
2690 CAMYEP010000009.1 GCA947254525_01292 gene open 546-779
2691 CAMYEP010000009.1 GCA947254525_01293 gene open 873-1073
2692 CAMYEP010000009.1 GCA947254525_01294 gene open 1264-1470
2693 CAMYEP010000009.1 GCA947254525_01295 gene open 1480-5256
2694 CAMYEP010000009.1 GCA947254525_01296 gene open 5413-6039
2695 CAMYEP010000009.1 GCA947254525_01297 gene open 6055-6609
2696 CAMYEP010000009.1 GCA947254525_01298 gene open 6610-6969
2697 CAMYEP010000009.1 GCA947254525_01299 gene open 7354-7926 acrR
2698 CAMYEP010000009.1 GCA947254525_01300 gene open 8030-9769 mdlB
2699 CAMYEP010000009.1 GCA947254525_01301 gene open 9762-11477 mdlB
2700 CAMYEP010000009.1 GCA947254525_01302 gene open 11474-11644
2701 CAMYEP010000009.1 GCA947254525_01303 gene open 11776-13047
2702 CAMYEP010000009.1 GCA947254525_01304 gene open 13091-13603 rlmD
2703 CAMYEP010000009.1 GCA947254525_01305 gene open 13929-14774
2704 CAMYEP010000009.1 GCA947254525_01306 gene open 14839-15705 pstC
2705 CAMYEP010000009.1 GCA947254525_01307 gene open 15757-16569 pstA
2706 CAMYEP010000009.1 GCA947254525_01308 gene open 16570-17346 pstB
2707 CAMYEP010000009.1 GCA947254525_01309 gene open 17346-18017 phoU
2708 CAMYEP010000009.1 GCA947254525_01310 gene open 17992-18672
2709 CAMYEP010000009.1 GCA947254525_01311 gene open 18662-20326
2710 CAMYEP010000009.1 GCA947254525_01312 gene open 20887-23019
2711 CAMYEP010000009.1 GCA947254525_01313 gene open 23425-24819
2712 CAMYEP010000009.1 GCA947254525_01314 gene open 25048-25938
2713 CAMYEP010000009.1 GCA947254525_01315 gene open 25948-26232 remA
2714 CAMYEP010000009.1 GCA947254525_01316 gene open 26202-26852 gmk
2715 CAMYEP010000009.1 GCA947254525_01317 gene open 26870-27079 rpoZ
2716 CAMYEP010000009.1 GCA947254525_01318 gene open 27097-28326 coaBC
2717 CAMYEP010000009.1 GCA947254525_01319 gene open 28537-29730 metK
2718 CAMYEP010000009.1 GCA947254525_01320 gene open 29841-32201 priA
2719 CAMYEP010000009.1 GCA947254525_01321 gene open 32227-32742 def
2720 CAMYEP010000009.1 GCA947254525_01322 gene open 32739-33677 fmt
2721 CAMYEP010000009.1 GCA947254525_01323 gene open 33752-35080 rsmB
2722 CAMYEP010000009.1 GCA947254525_01324 gene open 35082-36119 rlmN
2723 CAMYEP010000009.1 GCA947254525_01325 gene open 36177-36887
2724 CAMYEP010000009.1 GCA947254525_01326 gene open 36898-38838 pknB
2725 CAMYEP010000009.1 GCA947254525_01327 gene open 38858-39715 rsgA
2726 CAMYEP010000009.1 GCA947254525_01328 gene open 39717-40364 rpe
2727 CAMYEP010000009.1 GCA947254525_01329 gene open 40523-41794 ribD
2728 CAMYEP010000009.1 GCA947254525_01330 gene open 41775-42425 ribE
2729 CAMYEP010000009.1 GCA947254525_01331 gene open 42453-42917 ribE
2730 CAMYEP010000009.1 GCA947254525_01332 gene open 43212-44075 ylqF
2731 CAMYEP010000009.1 GCA947254525_01333 gene open 44072-44866
2732 CAMYEP010000009.1 GCA947254525_01334 gene open 44877-45332
2733 CAMYEP010000009.1 GCA947254525_01335 gene open 45329-45466
2734 CAMYEP010000009.1 GCA947254525_01336 gene open 45575-46066
2735 CAMYEP010000009.1 GCA947254525_01337 gene open 46276-48174
2736 CAMYEP010000009.1 GCA947254525_01338 gene open 48286-48849
2737 CAMYEP010000009.1 GCA947254525_01339 gene open 49068-49523
2738 CAMYEP010000009.1 GCA947254525_01340 gene open 49537-49986
2739 CAMYEP010000009.1 GCA947254525_01341 gene open 49999-51042
2740 CAMYEP010000009.1 GCA947254525_01342 gene open 51029-52420 radA
2741 CAMYEP010000009.1 GCA947254525_01343 gene open 52512-53696
2742 CAMYEP010000009.1 GCA947254525_01344 gene open 53704-54885
2743 CAMYEP010000009.1 GCA947254525_01345 gene open 54908-56365 gltX
2744 CAMYEP010000009.1 GCA947254525_01346 gene open 56680-58125 cysS
2745 CAMYEP010000009.1 GCA947254525_01347 gene open 58122-58598
2746 CAMYEP010000009.1 GCA947254525_01348 gene open 58607-59359 rlmB
2747 CAMYEP010000009.1 GCA947254525_01349 gene open 59356-59895
2748 CAMYEP010000009.1 GCA947254525_01350 gene open 59902-60591 sigH
2749 CAMYEP010000009.1 GCA947254525_01351 gene open 60636-60872 secG
2750 CAMYEP010000009.1 GCA947254525_01352 gene open 60925-63228 rnr
2751 CAMYEP010000009.1 GCA947254525_01353 gene open 63241-63711 smpB
2752 CAMYEP010000009.1 GCA947254525_01354 gene open 63722-64069 arsC
2753 CAMYEP010000009.1 GCA947254525_01355 gene open 64327-65211 hslO
2754 CAMYEP010000009.1 GCA947254525_01356 gene open 65214-66008 mtnP
2755 CAMYEP010000009.1 GCA947254525_01357 gene open 66063-67073 mtnA
2756 CAMYEP010000009.1 GCA947254525_01358 gene open 67094-68335
2757 CAMYEP010000009.1 GCA947254525_01359 gene open 68352-69635
2758 CAMYEP010000009.1 GCA947254525_01360 gene open 69806-70423 lexA
2759 CAMYEP010000009.1 GCA947254525_01361 gene open 70593-70952 lysM
2760 CAMYEP010000009.1 GCA947254525_01362 gene open 71179-72231
2761 CAMYEP010000009.1 GCA947254525_01363 gene open 72228-72818
2762 CAMYEP010000009.1 GCA947254525_01364 gene open 72822-74051
2763 CAMYEP010000009.1 GCA947254525_01365 gene open 74048-74299
2764 CAMYEP010000009.1 GCA947254525_01366 gene open 74391-76067
2765 CAMYEP010000009.1 GCA947254525_01367 gene open 76064-78208
2766 CAMYEP010000009.1 GCA947254525_01368 gene open 78195-79469
2767 CAMYEP010000009.1 GCA947254525_01369 gene open 79466-79990 dcd
2768 CAMYEP010000009.1 GCA947254525_01370 gene open 80003-80980
2769 CAMYEP010000009.1 GCA947254525_01371 gene open 81084-81626
2770 CAMYEP010000009.1 GCA947254525_01372 gene open 81820-82224
2771 CAMYEP010000009.1 GCA947254525_01373 gene open 82404-83420 gap
2772 CAMYEP010000009.1 GCA947254525_01374 gene open 83593-84618
2773 CAMYEP010000009.1 GCA947254525_01375 gene open 84649-85830
2774 CAMYEP010000009.1 GCA947254525_01376 gene open 85848-86606 tpiA
2775 CAMYEP010000009.1 GCA947254525_01377 gene open 88536-88712
2776 CAMYEP010000009.1 GCA947254525_01378 gene open 91027-91587
2777 CAMYEP010000009.1 GCA947254525_01379 gene open 92044-93102
2778 CAMYEP010000010.1 regulatory_region open 14561-14658 SAM riboswitch aptamer (S box leader)
2779 CAMYEP010000010.1 regulatory_region open 44945-45187 T-box leader
2780 CAMYEP010000010.1 repeat_region open 35138-38128 CRISPR array with 49 repeats of length 28%2C consensus sequence GTTCTTCCCGCACACGCGGGGGTGATCC and spacer length 33
2781 CAMYEP010000010.1 GCA947254525_01380 CDS open 346-1536 _na     396_aa site-specific integrase
2782 CAMYEP010000010.1 GCA947254525_01381 CDS open 1885-3342 _na     485_aa RelA/SpoT domain-containing protein
2783 CAMYEP010000010.1 GCA947254525_01382 CDS open 3347-3574 _na     75_aa Phage protein
2784 CAMYEP010000010.1 GCA947254525_01383 CDS open 3928-4257 _na     109_aa hypothetical protein
2785 CAMYEP010000010.1 GCA947254525_01384 CDS open 4257-4424 _na     55_aa hypothetical protein
2786 CAMYEP010000010.1 GCA947254525_01385 CDS open 4426-4890 _na     154_aa hypothetical protein
2787 CAMYEP010000010.1 GCA947254525_01386 CDS open 4941-5141 _na     66_aa helix-turn-helix domain-containing protein
2788 CAMYEP010000010.1 GCA947254525_01387 CDS open 5807-5968 _na     53_aa hypothetical protein
2789 CAMYEP010000010.1 GCA947254525_01388 CDS open 5926-6291 _na     121_aa DUF695 domain-containing protein
2790 CAMYEP010000010.1 GCA947254525_01389 CDS open 6281-6868 _na     195_aa DUF4417 domain-containing protein
2791 CAMYEP010000010.1 GCA947254525_01390 CDS open 6946-7200 _na     84_aa Lipoprotein
2792 CAMYEP010000010.1 GCA947254525_01391 CDS open 7197-7313 _na     38_aa hypothetical protein
2793 CAMYEP010000010.1 GCA947254525_01392 CDS open 7457-9853 _na     798_aa Hep/Hag repeat protein
2794 CAMYEP010000010.1 GCA947254525_01393 CDS open 10575-10835 _na     86_aa Lipoprotein
2795 CAMYEP010000010.1 GCA947254525_01394 CDS open 10825-11139 _na     104_aa hypothetical protein
2796 CAMYEP010000010.1 GCA947254525_01395 CDS open 11152-11760 _na     202_aa Type VI secretion system spike protein VgrG3-like C-terminal domain-containing protein
2797 CAMYEP010000010.1 GCA947254525_01396 CDS open 11761-12195 _na     144_aa hypothetical protein
2798 CAMYEP010000010.1 GCA947254525_01398 CDS open 12809-13462 _na     217_aa ABC transporter%2C permease protein
2799 CAMYEP010000010.1 GCA947254525_01399 CDS open 13443-14690 _na     415_aa Methionine ABC transporter ATP-binding protein
2800 CAMYEP010000010.1 GCA947254525_01400 CDS open 14732-15400 _na     222_aa yigZ YigZ family protein
2801 CAMYEP010000010.1 GCA947254525_01401 CDS open 15427-15780 _na     117_aa DNA-binding helix-turn-helix protein
2802 CAMYEP010000010.1 GCA947254525_01402 CDS open 15975-17258 _na     427_aa M18 family aminopeptidase
2803 CAMYEP010000010.1 GCA947254525_01403 CDS open 17479-18510 _na     343_aa hrcA heat-inducible transcriptional repressor HrcA
2804 CAMYEP010000010.1 GCA947254525_01404 CDS open 18525-19097 _na     190_aa grpE nucleotide exchange factor GrpE
2805 CAMYEP010000010.1 GCA947254525_01405 CDS open 19128-20981 _na     617_aa dnaK molecular chaperone DnaK
2806 CAMYEP010000010.1 GCA947254525_01406 CDS open 21008-22240 _na     410_aa dnaJ molecular chaperone DnaJ
2807 CAMYEP010000010.1 GCA947254525_01407 CDS open 22258-23139 _na     293_aa prmA 50S ribosomal protein L11 methyltransferase
2808 CAMYEP010000010.1 GCA947254525_01408 CDS open 23140-23865 _na     241_aa 16S rRNA (uracil(1498)-N(3))-methyltransferase
2809 CAMYEP010000010.1 GCA947254525_01409 CDS open 23869-25191 _na     440_aa mtaB tRNA (N(6)-L-threonylcarbamoyladenosine(37)-C(2))-methylthiotransferase MtaB
2810 CAMYEP010000010.1 GCA947254525_01410 CDS open 25188-25532 _na     114_aa Histidine triad domain protein
2811 CAMYEP010000010.1 GCA947254525_01411 CDS open 25781-28555 _na     924_aa CRISPR-associated helicase Cas3
2812 CAMYEP010000010.1 GCA947254525_01412 CDS open 28521-30269 _na     582_aa casA CRISPR system CASCADE complex protein CasA
2813 CAMYEP010000010.1 GCA947254525_01413 CDS open 30284-30871 _na     195_aa casB type I-E CRISPR-associated protein Cse2/CasB
2814 CAMYEP010000010.1 GCA947254525_01414 CDS open 30858-31931 _na     357_aa cas7e type I-E CRISPR-associated protein Cas7/Cse4/CasC
2815 CAMYEP010000010.1 GCA947254525_01415 CDS open 31941-32702 _na     253_aa cas5e type I-E CRISPR-associated protein Cas5/CasD
2816 CAMYEP010000010.1 GCA947254525_01416 CDS open 32674-33327 _na     217_aa cas6e type I-E CRISPR-associated protein Cas6/Cse3/CasE
2817 CAMYEP010000010.1 GCA947254525_01417 CDS open 33324-34274 _na     316_aa cas1e type I-E CRISPR-associated endonuclease Cas1e
2818 CAMYEP010000010.1 GCA947254525_01418 CDS open 34265-35119 _na     284_aa cas2e type I-E CRISPR-associated endoribonuclease Cas2e
2819 CAMYEP010000010.1 GCA947254525_01419 CDS open 38270-39205 _na     311_aa DUF2179 domain-containing protein
2820 CAMYEP010000010.1 GCA947254525_01420 CDS open 39383-40258 _na     291_aa ispE 4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase
2821 CAMYEP010000010.1 GCA947254525_01421 CDS open 40251-40979 _na     242_aa FCD domain protein
2822 CAMYEP010000010.1 GCA947254525_01422 CDS open 40991-41158 _na     55_aa hypothetical protein
2823 CAMYEP010000010.1 GCA947254525_01423 CDS open 41211-42608 _na     465_aa glcD Glycolate oxidase%2C subunit GlcD
2824 CAMYEP010000010.1 GCA947254525_01424 CDS open 42658-43584 _na     308_aa metA homoserine O-succinyltransferase
2825 CAMYEP010000010.1 GCA947254525_01425 CDS open 43604-44890 _na     428_aa O-acetylhomoserine aminocarboxypropyltransferase/cysteine synthase
2826 CAMYEP010000010.1 GCA947254525_01426 CDS open 45376-45807 _na     143_aa hypothetical protein
2827 CAMYEP010000010.1 GCA947254525_01427 CDS open 45891-47828 _na     645_aa OPT family oligopeptide transporter
2828 CAMYEP010000010.1 GCA947254525_01428 CDS open 48161-49486 _na     441_aa potE putrescine-ornithine antiporter
2829 CAMYEP010000010.1 GCA947254525_01429 CDS open 49676-50857 _na     393_aa acetyl-CoA C-acetyltransferase
2830 CAMYEP010000010.1 GCA947254525_01430 CDS open 51126-51281 _na     51_aa hypothetical protein
2831 CAMYEP010000010.1 GCA947254525_01431 CDS open 51547-52011 _na     154_aa infC translation initiation factor IF-3
2832 CAMYEP010000010.1 GCA947254525_01432 CDS open 52030-52227 _na     65_aa rpmI 50S ribosomal protein L35
2833 CAMYEP010000010.1 GCA947254525_01433 CDS open 52268-52618 _na     116_aa rplT 50S ribosomal protein L20
2834 CAMYEP010000010.1 GCA947254525_01434 CDS open 52694-53308 _na     204_aa DUF4125 domain-containing protein
2835 CAMYEP010000010.1 GCA947254525_01435 CDS open 53738-56956 _na     1072_aa Hep/Hag repeat protein
2836 CAMYEP010000010.1 GCA947254525_01436 CDS open 57187-57885 _na     232_aa TVP38/TMEM64 family membrane protein
2837 CAMYEP010000010.1 GCA947254525_01437 CDS open 57929-63061 _na     1710_aa TonB-dependent receptor
2838 CAMYEP010000010.1 GCA947254525_01438 CDS open 63000-63245 _na     81_aa hypothetical protein
2839 CAMYEP010000010.1 GCA947254525_01439 CDS open 63153-64118 _na     321_aa Exonuclease domain-containing protein
2840 CAMYEP010000010.1 GCA947254525_01440 CDS open 64353-64841 _na     162_aa Molybdenum cofactor biosynthesis protein B
2841 CAMYEP010000010.1 GCA947254525_01441 CDS open 64990-65643 _na     217_aa cobC alpha-ribazole phosphatase
2842 CAMYEP010000010.1 GCA947254525_01442 CDS open 65653-66369 _na     238_aa Pseudouridine synthase
2843 CAMYEP010000010.1 GCA947254525_01443 CDS open 66431-67492 _na     353_aa Creatinase
2844 CAMYEP010000010.1 GCA947254525_01444 CDS open 67507-68064 _na     185_aa efp elongation factor P
2845 CAMYEP010000010.1 GCA947254525_01445 CDS open 68140-68529 _na     129_aa Asp23/Gls24 family envelope stress response protein
2846 CAMYEP010000010.1 GCA947254525_01446 CDS open 68513-68818 _na     101_aa Asp23/Gls24 family envelope stress response protein
2847 CAMYEP010000010.1 GCA947254525_01447 CDS open 68828-69253 _na     141_aa nusB transcription antitermination factor NusB
2848 CAMYEP010000010.1 GCA947254525_01448 CDS open 69250-70197 _na     315_aa N(6)-L-threonylcarbamoyladenine synthase
2849 CAMYEP010000010.1 GCA947254525_01449 CDS open 70199-71404 _na     401_aa xseA exodeoxyribonuclease VII large subunit
2850 CAMYEP010000010.1 GCA947254525_01450 CDS open 71391-71639 _na     82_aa xseB exodeoxyribonuclease VII small subunit
2851 CAMYEP010000010.1 GCA947254525_01451 CDS open 71626-72513 _na     295_aa Polyprenyl synthetase
2852 CAMYEP010000010.1 GCA947254525_01452 CDS open 72530-73327 _na     265_aa Ribosomal RNA large subunit methyltransferase J
2853 CAMYEP010000010.1 GCA947254525_01453 CDS open 73339-74211 _na     290_aa NAD kinase
2854 CAMYEP010000010.1 GCA947254525_01454 CDS open 74213-74785 _na     190_aa rRNA methylase
2855 CAMYEP010000010.1 GCA947254525_01455 CDS open 74825-75280 _na     151_aa argR arginine repressor
2856 CAMYEP010000010.1 GCA947254525_01456 CDS open 75288-76994 _na     568_aa recN DNA repair protein RecN
2857 CAMYEP010000010.1 GCA947254525_01457 CDS open 77061-77858 _na     265_aa dapB 4-hydroxy-tetrahydrodipicolinate reductase
2858 CAMYEP010000010.1 GCA947254525_01458 CDS open 77880-78914 _na     344_aa aspartate-semialdehyde dehydrogenase
2859 CAMYEP010000010.1 GCA947254525_01459 CDS open 78935-79822 _na     295_aa dapA 4-hydroxy-tetrahydrodipicolinate synthase
2860 CAMYEP010000010.1 GCA947254525_01460 CDS open 79927-80184 _na     85_aa copZ Copper chaperone CopZ
2861 CAMYEP010000010.1 GCA947254525_01461 CDS open 80294-81151 _na     285_aa lysR Transcriptional regulator%2C LysR family
2862 CAMYEP010000010.1 GCA947254525_01462 CDS open 81297-82550 _na     417_aa Diaminopimelate decarboxylase
2863 CAMYEP010000010.1 GCA947254525_01463 CDS open 82674-83189 _na     171_aa HTH domain protein
2864 CAMYEP010000010.1 GCA947254525_01464 CDS open 83283-84599 _na     438_aa Transporter%2C major facilitator family protein
2865 CAMYEP010000010.1 GCA947254525_01380 gene open 346-1536
2866 CAMYEP010000010.1 GCA947254525_01381 gene open 1885-3342
2867 CAMYEP010000010.1 GCA947254525_01382 gene open 3347-3574
2868 CAMYEP010000010.1 GCA947254525_01383 gene open 3928-4257
2869 CAMYEP010000010.1 GCA947254525_01384 gene open 4257-4424
2870 CAMYEP010000010.1 GCA947254525_01385 gene open 4426-4890
2871 CAMYEP010000010.1 GCA947254525_01386 gene open 4941-5141
2872 CAMYEP010000010.1 GCA947254525_01387 gene open 5807-5968
2873 CAMYEP010000010.1 GCA947254525_01388 gene open 5926-6291
2874 CAMYEP010000010.1 GCA947254525_01389 gene open 6281-6868
2875 CAMYEP010000010.1 GCA947254525_01390 gene open 6946-7200
2876 CAMYEP010000010.1 GCA947254525_01391 gene open 7197-7313
2877 CAMYEP010000010.1 GCA947254525_01392 gene open 7457-9853
2878 CAMYEP010000010.1 GCA947254525_01393 gene open 10575-10835
2879 CAMYEP010000010.1 GCA947254525_01394 gene open 10825-11139
2880 CAMYEP010000010.1 GCA947254525_01395 gene open 11152-11760
2881 CAMYEP010000010.1 GCA947254525_01396 gene open 11761-12195
2882 CAMYEP010000010.1 GCA947254525_01398 gene open 12809-13462
2883 CAMYEP010000010.1 GCA947254525_01399 gene open 13443-14690
2884 CAMYEP010000010.1 GCA947254525_01400 gene open 14732-15400 yigZ
2885 CAMYEP010000010.1 GCA947254525_01401 gene open 15427-15780
2886 CAMYEP010000010.1 GCA947254525_01402 gene open 15975-17258
2887 CAMYEP010000010.1 GCA947254525_01403 gene open 17479-18510 hrcA
2888 CAMYEP010000010.1 GCA947254525_01404 gene open 18525-19097 grpE
2889 CAMYEP010000010.1 GCA947254525_01405 gene open 19128-20981 dnaK
2890 CAMYEP010000010.1 GCA947254525_01406 gene open 21008-22240 dnaJ
2891 CAMYEP010000010.1 GCA947254525_01407 gene open 22258-23139 prmA
2892 CAMYEP010000010.1 GCA947254525_01408 gene open 23140-23865
2893 CAMYEP010000010.1 GCA947254525_01409 gene open 23869-25191 mtaB
2894 CAMYEP010000010.1 GCA947254525_01410 gene open 25188-25532
2895 CAMYEP010000010.1 GCA947254525_01411 gene open 25781-28555
2896 CAMYEP010000010.1 GCA947254525_01412 gene open 28521-30269 casA
2897 CAMYEP010000010.1 GCA947254525_01413 gene open 30284-30871 casB
2898 CAMYEP010000010.1 GCA947254525_01414 gene open 30858-31931 cas7e
2899 CAMYEP010000010.1 GCA947254525_01415 gene open 31941-32702 cas5e
2900 CAMYEP010000010.1 GCA947254525_01416 gene open 32674-33327 cas6e
2901 CAMYEP010000010.1 GCA947254525_01417 gene open 33324-34274 cas1e
2902 CAMYEP010000010.1 GCA947254525_01418 gene open 34265-35119 cas2e
2903 CAMYEP010000010.1 GCA947254525_01419 gene open 38270-39205
2904 CAMYEP010000010.1 GCA947254525_01420 gene open 39383-40258 ispE
2905 CAMYEP010000010.1 GCA947254525_01421 gene open 40251-40979
2906 CAMYEP010000010.1 GCA947254525_01422 gene open 40991-41158
2907 CAMYEP010000010.1 GCA947254525_01423 gene open 41211-42608 glcD
2908 CAMYEP010000010.1 GCA947254525_01424 gene open 42658-43584 metA
2909 CAMYEP010000010.1 GCA947254525_01425 gene open 43604-44890
2910 CAMYEP010000010.1 GCA947254525_01426 gene open 45376-45807
2911 CAMYEP010000010.1 GCA947254525_01427 gene open 45891-47828
2912 CAMYEP010000010.1 GCA947254525_01428 gene open 48161-49486 potE
2913 CAMYEP010000010.1 GCA947254525_01429 gene open 49676-50857
2914 CAMYEP010000010.1 GCA947254525_01430 gene open 51126-51281
2915 CAMYEP010000010.1 GCA947254525_01431 gene open 51547-52011 infC
2916 CAMYEP010000010.1 GCA947254525_01432 gene open 52030-52227 rpmI
2917 CAMYEP010000010.1 GCA947254525_01433 gene open 52268-52618 rplT
2918 CAMYEP010000010.1 GCA947254525_01434 gene open 52694-53308
2919 CAMYEP010000010.1 GCA947254525_01435 gene open 53738-56956
2920 CAMYEP010000010.1 GCA947254525_01436 gene open 57187-57885
2921 CAMYEP010000010.1 GCA947254525_01437 gene open 57929-63061
2922 CAMYEP010000010.1 GCA947254525_01438 gene open 63000-63245
2923 CAMYEP010000010.1 GCA947254525_01439 gene open 63153-64118
2924 CAMYEP010000010.1 GCA947254525_01440 gene open 64353-64841
2925 CAMYEP010000010.1 GCA947254525_01441 gene open 64990-65643 cobC
2926 CAMYEP010000010.1 GCA947254525_01442 gene open 65653-66369
2927 CAMYEP010000010.1 GCA947254525_01443 gene open 66431-67492
2928 CAMYEP010000010.1 GCA947254525_01444 gene open 67507-68064 efp
2929 CAMYEP010000010.1 GCA947254525_01445 gene open 68140-68529
2930 CAMYEP010000010.1 GCA947254525_01446 gene open 68513-68818
2931 CAMYEP010000010.1 GCA947254525_01447 gene open 68828-69253 nusB
2932 CAMYEP010000010.1 GCA947254525_01448 gene open 69250-70197
2933 CAMYEP010000010.1 GCA947254525_01449 gene open 70199-71404 xseA
2934 CAMYEP010000010.1 GCA947254525_01450 gene open 71391-71639 xseB
2935 CAMYEP010000010.1 GCA947254525_01451 gene open 71626-72513
2936 CAMYEP010000010.1 GCA947254525_01452 gene open 72530-73327
2937 CAMYEP010000010.1 GCA947254525_01453 gene open 73339-74211
2938 CAMYEP010000010.1 GCA947254525_01454 gene open 74213-74785
2939 CAMYEP010000010.1 GCA947254525_01455 gene open 74825-75280 argR
2940 CAMYEP010000010.1 GCA947254525_01456 gene open 75288-76994 recN
2941 CAMYEP010000010.1 GCA947254525_01457 gene open 77061-77858 dapB
2942 CAMYEP010000010.1 GCA947254525_01458 gene open 77880-78914
2943 CAMYEP010000010.1 GCA947254525_01459 gene open 78935-79822 dapA
2944 CAMYEP010000010.1 GCA947254525_01460 gene open 79927-80184 copZ
2945 CAMYEP010000010.1 GCA947254525_01461 gene open 80294-81151 lysR
2946 CAMYEP010000010.1 GCA947254525_01462 gene open 81297-82550
2947 CAMYEP010000010.1 GCA947254525_01463 gene open 82674-83189
2948 CAMYEP010000010.1 GCA947254525_01464 gene open 83283-84599
2949 CAMYEP010000010.1 GCA947254525_01397 gene open 12606-12694 trnS
2950 CAMYEP010000010.1 GCA947254525_01397 tRNA open 12606-12694 trnS tRNA-Ser(cga)
2951 CAMYEP010000011.1 regulatory_region open 41965-42209 T-box leader
2952 CAMYEP010000011.1 GCA947254525_01465 CDS open 36-2639 _na     867_aa Putative Hep/Hag repeat protein
2953 CAMYEP010000011.1 GCA947254525_01466 CDS open 2737-3639 _na     300_aa FAH family protein
2954 CAMYEP010000011.1 GCA947254525_01467 CDS open 3797-5470 _na     557_aa glutamine--tRNA ligase/YqeY domain fusion protein
2955 CAMYEP010000011.1 GCA947254525_01468 CDS open 5611-5883 _na     90_aa DUF4321 domain-containing protein
2956 CAMYEP010000011.1 GCA947254525_01469 CDS open 5962-6456 _na     164_aa Nucleoside triphosphate pyrophosphatase
2957 CAMYEP010000011.1 GCA947254525_01470 CDS open 6453-7142 _na     229_aa radC DNA repair protein RadC
2958 CAMYEP010000011.1 GCA947254525_01471 CDS open 7302-8348 _na     348_aa L-lactate oxidase
2959 CAMYEP010000011.1 GCA947254525_01472 CDS open 8678-10090 _na     470_aa scfB thioether cross-link-forming SCIFF peptide maturase
2960 CAMYEP010000011.1 GCA947254525_01473 CDS open 10087-10284 _na     65_aa hypothetical protein
2961 CAMYEP010000011.1 GCA947254525_01474 CDS open 10506-11252 _na     248_aa sufC Fe-S cluster assembly ATPase SufC
2962 CAMYEP010000011.1 GCA947254525_01475 CDS open 11267-12694 _na     475_aa sufB Fe-S cluster assembly protein SufB
2963 CAMYEP010000011.1 GCA947254525_01476 CDS open 12712-13809 _na     365_aa SufB/sufD domain protein
2964 CAMYEP010000011.1 GCA947254525_01477 CDS open 13802-15022 _na     406_aa Cysteine desulfurase
2965 CAMYEP010000011.1 GCA947254525_01478 CDS open 15040-15474 _na     144_aa sufU Fe-S cluster assembly sulfur transfer protein SufU
2966 CAMYEP010000011.1 GCA947254525_01479 CDS open 15868-18123 _na     751_aa pflB formate C-acetyltransferase
2967 CAMYEP010000011.1 GCA947254525_01480 CDS open 18209-18958 _na     249_aa pflA pyruvate formate-lyase-activating protein
2968 CAMYEP010000011.1 GCA947254525_01481 CDS open 19161-20615 _na     484_aa putative cytosol aminopeptidase
2969 CAMYEP010000011.1 GCA947254525_01482 CDS open 20605-21420 _na     271_aa PHP domain protein
2970 CAMYEP010000011.1 GCA947254525_01483 CDS open 21417-22301 _na     294_aa Asp23/Gls24 family envelope stress response protein
2971 CAMYEP010000011.1 GCA947254525_01484 CDS open 22465-24027 _na     520_aa DEAD/DEAH box helicase
2972 CAMYEP010000011.1 GCA947254525_01486 CDS open 24501-29264 _na     1587_aa TonB-dependent siderophore receptor
2973 CAMYEP010000011.1 GCA947254525_01487 CDS open 29355-29585 _na     76_aa Nudix hydrolase domain-containing protein
2974 CAMYEP010000011.1 GCA947254525_01488 CDS open 29569-30309 _na     246_aa Ser/Thr phosphatase family protein
2975 CAMYEP010000011.1 GCA947254525_01489 CDS open 30322-31107 _na     261_aa Galactose-1-phosphate uridylyltransferase
2976 CAMYEP010000011.1 GCA947254525_01490 CDS open 31213-32280 _na     355_aa mutY A/G-specific adenine glycosylase
2977 CAMYEP010000011.1 GCA947254525_01491 CDS open 32277-33512 _na     411_aa Tat pathway signal sequence domain protein
2978 CAMYEP010000011.1 GCA947254525_01492 CDS open 33533-34624 _na     363_aa dprA DNA-processing protein DprA
2979 CAMYEP010000011.1 GCA947254525_01493 CDS open 34645-36162 _na     505_aa Mg chelatase-like protein
2980 CAMYEP010000011.1 GCA947254525_01494 CDS open 36171-36539 _na     122_aa yraN YraN family protein
2981 CAMYEP010000011.1 GCA947254525_01495 CDS open 36709-38991 _na     760_aa metE 5-methyltetrahydropteroyltriglutamate--homocysteine S-methyltransferase
2982 CAMYEP010000011.1 GCA947254525_01496 CDS open 39102-40013 _na     303_aa lysR Transcriptional regulator%2C LysR family
2983 CAMYEP010000011.1 GCA947254525_01497 CDS open 40041-41762 _na     573_aa Fibronectin-binding protein A domain protein
2984 CAMYEP010000011.1 GCA947254525_01498 CDS open 42263-43984 _na     573_aa 2-isopropylmalate synthase
2985 CAMYEP010000011.1 GCA947254525_01499 CDS open 43997-45253 _na     418_aa leuC 3-isopropylmalate dehydratase large subunit
2986 CAMYEP010000011.1 GCA947254525_01500 CDS open 45256-45774 _na     172_aa 3-isopropylmalate dehydratase small subunit
2987 CAMYEP010000011.1 GCA947254525_01501 CDS open 45746-46810 _na     354_aa leuB 3-isopropylmalate dehydrogenase
2988 CAMYEP010000011.1 GCA947254525_01502 CDS open 46892-47047 _na     51_aa hypothetical protein
2989 CAMYEP010000011.1 GCA947254525_01503 CDS open 47208-49793 _na     861_aa clpB ATP-dependent chaperone ClpB
2990 CAMYEP010000011.1 GCA947254525_01504 CDS open 50008-50859 _na     283_aa Sel1 repeat protein
2991 CAMYEP010000011.1 GCA947254525_01505 CDS open 50879-50968 _na     29_aa hypothetical protein
2992 CAMYEP010000011.1 GCA947254525_01506 CDS open 51217-52227 _na     336_aa ABC transporter%2C permease protein
2993 CAMYEP010000011.1 GCA947254525_01507 CDS open 52194-53096 _na     300_aa ABC transporter%2C permease protein
2994 CAMYEP010000011.1 GCA947254525_01508 CDS open 53120-54688 _na     522_aa ABC transporter%2C substrate-binding protein%2C family 5
2995 CAMYEP010000011.1 GCA947254525_01509 CDS open 54681-55697 _na     338_aa ABC transporter%2C ATP-binding protein
2996 CAMYEP010000011.1 GCA947254525_01510 CDS open 55690-56562 _na     290_aa ABC transporter%2C ATP-binding protein
2997 CAMYEP010000011.1 GCA947254525_01511 CDS open 56732-57694 _na     320_aa Heptosyltransferase
2998 CAMYEP010000011.1 GCA947254525_01512 CDS open 57726-58769 _na     347_aa Glycosyltransferase%2C group 2 family protein
2999 CAMYEP010000011.1 GCA947254525_01513 CDS open 58732-58962 _na     76_aa hypothetical protein
3000 CAMYEP010000011.1 GCA947254525_01514 CDS open 58962-60971 _na     669_aa Arylsulfatase