BAKTAGenome Explorer: Dialister invisus (GCA_958424575.1)
Select a Genome:
|
BAKTA Annotations for GCA_958424575.1
|
Search & Sort all 3957 Records
| ||||||||||||||||||
Notes: 1- Column headers only sort the current page. 2- Select [NA] or [AA] links to show sequences.
| Region | Protein-ID | Type | Genome Viewer |
Range (bp) |
Show Sequences (length) NA / AA |
BAKTA Gene |
BAKTA GeneProduct |
|
|---|---|---|---|---|---|---|---|---|
| 3501 | CATZUD010000032.1 | GCA958424575_01732 | gene | open | 2021-2497 | |||
| 3502 | CATZUD010000032.1 | GCA958424575_01733 | gene | open | 2494-3861 | |||
| 3503 | CATZUD010000032.1 | GCA958424575_01734 | gene | open | 3935-4330 | |||
| 3504 | CATZUD010000032.1 | GCA958424575_01735 | gene | open | 4348-4500 | |||
| 3505 | CATZUD010000032.1 | GCA958424575_01736 | gene | open | 4606-4977 | |||
| 3506 | CATZUD010000032.1 | GCA958424575_01737 | gene | open | 4977-7382 | |||
| 3507 | CATZUD010000032.1 | GCA958424575_01738 | gene | open | 7401-7889 | |||
| 3508 | CATZUD010000032.1 | GCA958424575_01739 | gene | open | 7886-9295 | |||
| 3509 | CATZUD010000032.1 | GCA958424575_01740 | gene | open | 9306-9782 | |||
| 3510 | CATZUD010000032.1 | GCA958424575_01741 | gene | open | 9798-10265 | |||
| 3511 | CATZUD010000032.1 | GCA958424575_01742 | gene | open | 10315-10716 | |||
| 3512 | CATZUD010000032.1 | GCA958424575_01743 | gene | open | 10793-12496 | |||
| 3513 | CATZUD010000032.1 | GCA958424575_01744 | gene | open | 12487-12606 | |||
| 3514 | CATZUD010000032.1 | GCA958424575_01745 | gene | open | 12603-12884 | |||
| 3515 | CATZUD010000032.1 | GCA958424575_01746 | gene | open | 13028-13585 | |||
| 3516 | CATZUD010000033.1 | GCA958424575_01756 | CDS | open | 957-2255 | _na 432_aa | H(+)-transporting ATPase | |
| 3517 | CATZUD010000033.1 | GCA958424575_01757 | CDS | open | 2267-2962 | _na 231_aa | trkA | TrkA N-terminal domain protein |
| 3518 | CATZUD010000033.1 | GCA958424575_01758 | CDS | open | 3125-3547 | _na 140_aa | Acyl-CoA thioester hydrolase%2C YbgC/YbaW family | |
| 3519 | CATZUD010000033.1 | GCA958424575_01759 | CDS | open | 3540-4316 | _na 258_aa | Glutamate racemase | |
| 3520 | CATZUD010000033.1 | GCA958424575_01760 | CDS | open | 4320-4877 | _na 185_aa | DUF58 domain-containing protein | |
| 3521 | CATZUD010000033.1 | GCA958424575_01761 | CDS | open | 4879-5529 | _na 216_aa | Coenzyme F420:L-glutamate ligase-like domain-containing protein | |
| 3522 | CATZUD010000033.1 | GCA958424575_01762 | CDS | open | 5638-5829 | _na 63_aa | rpmB | 50S ribosomal protein L28 |
| 3523 | CATZUD010000033.1 | GCA958424575_01763 | CDS | open | 5909-8002 | _na 697_aa | recG | ATP-dependent DNA helicase RecG |
| 3524 | CATZUD010000033.1 | GCA958424575_01764 | CDS | open | 8154-9611 | _na 485_aa | guaB | IMP dehydrogenase |
| 3525 | CATZUD010000033.1 | GCA958424575_01765 | CDS | open | 9611-10369 | _na 252_aa | Glycosyltransferase%2C WecB/TagA/CpsF family | |
| 3526 | CATZUD010000033.1 | GCA958424575_01766 | CDS | open | 10363-11016 | _na 217_aa | phosphatidylserine decarboxylase | |
| 3527 | CATZUD010000033.1 | GCA958424575_01767 | CDS | open | 11013-11723 | _na 236_aa | pssA | CDP-diacylglycerol--serine O-phosphatidyltransferase |
| 3528 | CATZUD010000033.1 | GCA958424575_01768 | CDS | open | 11725-12984 | _na 419_aa | Glycosyltransferase%2C group 2 family protein | |
| 3529 | CATZUD010000033.1 | GCA958424575_01756 | gene | open | 957-2255 | |||
| 3530 | CATZUD010000033.1 | GCA958424575_01757 | gene | open | 2267-2962 | trkA | ||
| 3531 | CATZUD010000033.1 | GCA958424575_01758 | gene | open | 3125-3547 | |||
| 3532 | CATZUD010000033.1 | GCA958424575_01759 | gene | open | 3540-4316 | |||
| 3533 | CATZUD010000033.1 | GCA958424575_01760 | gene | open | 4320-4877 | |||
| 3534 | CATZUD010000033.1 | GCA958424575_01761 | gene | open | 4879-5529 | |||
| 3535 | CATZUD010000033.1 | GCA958424575_01762 | gene | open | 5638-5829 | rpmB | ||
| 3536 | CATZUD010000033.1 | GCA958424575_01763 | gene | open | 5909-8002 | recG | ||
| 3537 | CATZUD010000033.1 | GCA958424575_01764 | gene | open | 8154-9611 | guaB | ||
| 3538 | CATZUD010000033.1 | GCA958424575_01765 | gene | open | 9611-10369 | |||
| 3539 | CATZUD010000033.1 | GCA958424575_01766 | gene | open | 10363-11016 | |||
| 3540 | CATZUD010000033.1 | GCA958424575_01767 | gene | open | 11013-11723 | pssA | ||
| 3541 | CATZUD010000033.1 | GCA958424575_01768 | gene | open | 11725-12984 | |||
| 3542 | CATZUD010000033.1 | GCA958424575_01747 | gene | open | 89-164 | trnN | ||
| 3543 | CATZUD010000033.1 | GCA958424575_01748 | gene | open | 167-241 | trnQ | ||
| 3544 | CATZUD010000033.1 | GCA958424575_01749 | gene | open | 246-321 | trnK | ||
| 3545 | CATZUD010000033.1 | GCA958424575_01750 | gene | open | 327-401 | trnE | ||
| 3546 | CATZUD010000033.1 | GCA958424575_01751 | gene | open | 405-480 | trnV | ||
| 3547 | CATZUD010000033.1 | GCA958424575_01752 | gene | open | 485-561 | trnD | ||
| 3548 | CATZUD010000033.1 | GCA958424575_01753 | gene | open | 569-644 | trnF | ||
| 3549 | CATZUD010000033.1 | GCA958424575_01754 | gene | open | 650-734 | trnL | ||
| 3550 | CATZUD010000033.1 | GCA958424575_01755 | gene | open | 768-852 | trnL | ||
| 3551 | CATZUD010000033.1 | GCA958424575_01747 | tRNA | open | 89-164 | trnN | tRNA-Asn(gtt) | |
| 3552 | CATZUD010000033.1 | GCA958424575_01748 | tRNA | open | 167-241 | trnQ | tRNA-Gln(ctg) | |
| 3553 | CATZUD010000033.1 | GCA958424575_01749 | tRNA | open | 246-321 | trnK | tRNA-Lys(ttt) | |
| 3554 | CATZUD010000033.1 | GCA958424575_01750 | tRNA | open | 327-401 | trnE | tRNA-Glu(ttc) | |
| 3555 | CATZUD010000033.1 | GCA958424575_01751 | tRNA | open | 405-480 | trnV | tRNA-Val(tac) | |
| 3556 | CATZUD010000033.1 | GCA958424575_01752 | tRNA | open | 485-561 | trnD | tRNA-Asp(gtc) | |
| 3557 | CATZUD010000033.1 | GCA958424575_01753 | tRNA | open | 569-644 | trnF | tRNA-Phe(gaa) | |
| 3558 | CATZUD010000033.1 | GCA958424575_01754 | tRNA | open | 650-734 | trnL | tRNA-Leu(gag) | |
| 3559 | CATZUD010000033.1 | GCA958424575_01755 | tRNA | open | 768-852 | trnL | tRNA-Leu(cag) | |
| 3560 | CATZUD010000034.1 | GCA958424575_01769 | CDS | open | 340-951 | _na 203_aa | SprT-like domain-containing protein | |
| 3561 | CATZUD010000034.1 | GCA958424575_01770 | CDS | open | 1102-1599 | _na 165_aa | hypothetical protein | |
| 3562 | CATZUD010000034.1 | GCA958424575_01771 | CDS | open | 1754-2455 | _na 233_aa | SPOR domain-containing protein | |
| 3563 | CATZUD010000034.1 | GCA958424575_01772 | CDS | open | 2656-2835 | _na 59_aa | DNA-binding protein | |
| 3564 | CATZUD010000034.1 | GCA958424575_01773 | CDS | open | 2839-3729 | _na 296_aa | lysR | LysR family transcriptional regulator |
| 3565 | CATZUD010000034.1 | GCA958424575_01774 | CDS | open | 3884-4306 | _na 140_aa | cupin domain-containing protein | |
| 3566 | CATZUD010000034.1 | GCA958424575_01775 | CDS | open | 4303-5448 | _na 381_aa | iron-containing alcohol dehydrogenase | |
| 3567 | CATZUD010000034.1 | GCA958424575_01776 | CDS | open | 5484-6761 | _na 425_aa | flavodoxin | |
| 3568 | CATZUD010000034.1 | GCA958424575_01777 | CDS | open | 6825-7373 | _na 182_aa | cyclophilin-like fold protein | |
| 3569 | CATZUD010000034.1 | GCA958424575_01778 | CDS | open | 7404-7937 | _na 177_aa | flavodoxin family protein | |
| 3570 | CATZUD010000034.1 | GCA958424575_01779 | CDS | open | 7915-8547 | _na 210_aa | cyclophilin-like fold protein | |
| 3571 | CATZUD010000034.1 | GCA958424575_01780 | CDS | open | 8565-9551 | _na 328_aa | aldo/keto reductase | |
| 3572 | CATZUD010000034.1 | GCA958424575_01781 | CDS | open | 9763-10455 | _na 230_aa | DUF4405 domain-containing protein | |
| 3573 | CATZUD010000034.1 | GCA958424575_01782 | CDS | open | 10672-11094 | _na 140_aa | RNA polymerase sigma factor | |
| 3574 | CATZUD010000034.1 | GCA958424575_01783 | CDS | open | 11069-11311 | _na 80_aa | helix-turn-helix domain-containing protein | |
| 3575 | CATZUD010000034.1 | GCA958424575_01784 | CDS | open | 11308-12120 | _na 270_aa | DUF3825 domain-containing protein | |
| 3576 | CATZUD010000034.1 | GCA958424575_01769 | gene | open | 340-951 | |||
| 3577 | CATZUD010000034.1 | GCA958424575_01770 | gene | open | 1102-1599 | |||
| 3578 | CATZUD010000034.1 | GCA958424575_01771 | gene | open | 1754-2455 | |||
| 3579 | CATZUD010000034.1 | GCA958424575_01772 | gene | open | 2656-2835 | |||
| 3580 | CATZUD010000034.1 | GCA958424575_01773 | gene | open | 2839-3729 | lysR | ||
| 3581 | CATZUD010000034.1 | GCA958424575_01774 | gene | open | 3884-4306 | |||
| 3582 | CATZUD010000034.1 | GCA958424575_01775 | gene | open | 4303-5448 | |||
| 3583 | CATZUD010000034.1 | GCA958424575_01776 | gene | open | 5484-6761 | |||
| 3584 | CATZUD010000034.1 | GCA958424575_01777 | gene | open | 6825-7373 | |||
| 3585 | CATZUD010000034.1 | GCA958424575_01778 | gene | open | 7404-7937 | |||
| 3586 | CATZUD010000034.1 | GCA958424575_01779 | gene | open | 7915-8547 | |||
| 3587 | CATZUD010000034.1 | GCA958424575_01780 | gene | open | 8565-9551 | |||
| 3588 | CATZUD010000034.1 | GCA958424575_01781 | gene | open | 9763-10455 | |||
| 3589 | CATZUD010000034.1 | GCA958424575_01782 | gene | open | 10672-11094 | |||
| 3590 | CATZUD010000034.1 | GCA958424575_01783 | gene | open | 11069-11311 | |||
| 3591 | CATZUD010000034.1 | GCA958424575_01784 | gene | open | 11308-12120 | |||
| 3592 | CATZUD010000035.1 | GCA958424575_01785 | CDS | open | 385-1023 | _na 212_aa | CpXC domain-containing protein | |
| 3593 | CATZUD010000035.1 | GCA958424575_01786 | CDS | open | 1033-1692 | _na 219_aa | CpXC domain-containing protein | |
| 3594 | CATZUD010000035.1 | GCA958424575_01787 | CDS | open | 1835-2377 | _na 180_aa | Nitroreductase family protein | |
| 3595 | CATZUD010000035.1 | GCA958424575_01788 | CDS | open | 2509-3579 | _na 356_aa | Alanine racemase domain protein | |
| 3596 | CATZUD010000035.1 | GCA958424575_01789 | CDS | open | 3643-5046 | _na 467_aa | Amino acid carrier protein | |
| 3597 | CATZUD010000035.1 | GCA958424575_01790 | CDS | open | 5306-5950 | _na 214_aa | yigZ | YigZ family protein |
| 3598 | CATZUD010000035.1 | GCA958424575_01791 | CDS | open | 6028-7086 | _na 352_aa | Sel1 repeat protein | |
| 3599 | CATZUD010000035.1 | GCA958424575_01792 | CDS | open | 7238-8104 | _na 288_aa | 2-oxoglutarate ferredoxin oxidoreductase subunit beta | |
| 3600 | CATZUD010000035.1 | GCA958424575_01793 | CDS | open | 8107-9945 | _na 612_aa | 2-oxoacid:acceptor oxidoreductase%2C alpha subunit | |
| 3601 | CATZUD010000035.1 | GCA958424575_01794 | CDS | open | 10274-10468 | _na 64_aa | GIY-YIG nuclease family protein | |
| 3602 | CATZUD010000035.1 | GCA958424575_01795 | CDS | open | 10573-10806 | _na 77_aa | hypothetical protein | |
| 3603 | CATZUD010000035.1 | GCA958424575_01796 | CDS | open | 11407-11961 | _na 184_aa | S-layer-like y domain-containing protein | |
| 3604 | CATZUD010000035.1 | GCA958424575_01785 | gene | open | 385-1023 | |||
| 3605 | CATZUD010000035.1 | GCA958424575_01786 | gene | open | 1033-1692 | |||
| 3606 | CATZUD010000035.1 | GCA958424575_01787 | gene | open | 1835-2377 | |||
| 3607 | CATZUD010000035.1 | GCA958424575_01788 | gene | open | 2509-3579 | |||
| 3608 | CATZUD010000035.1 | GCA958424575_01789 | gene | open | 3643-5046 | |||
| 3609 | CATZUD010000035.1 | GCA958424575_01790 | gene | open | 5306-5950 | yigZ | ||
| 3610 | CATZUD010000035.1 | GCA958424575_01791 | gene | open | 6028-7086 | |||
| 3611 | CATZUD010000035.1 | GCA958424575_01792 | gene | open | 7238-8104 | |||
| 3612 | CATZUD010000035.1 | GCA958424575_01793 | gene | open | 8107-9945 | |||
| 3613 | CATZUD010000035.1 | GCA958424575_01794 | gene | open | 10274-10468 | |||
| 3614 | CATZUD010000035.1 | GCA958424575_01795 | gene | open | 10573-10806 | |||
| 3615 | CATZUD010000035.1 | GCA958424575_01796 | gene | open | 11407-11961 | |||
| 3616 | CATZUD010000036.1 | GCA958424575_01797 | CDS | open | 30-1631 | _na 533_aa | yloV | DAK2 domain fusion protein YloV |
| 3617 | CATZUD010000036.1 | GCA958424575_01798 | CDS | open | 1648-2478 | _na 276_aa | degV | EDD domain protein%2C DegV family |
| 3618 | CATZUD010000036.1 | GCA958424575_01799 | CDS | open | 2497-2859 | _na 120_aa | hypothetical protein | |
| 3619 | CATZUD010000036.1 | GCA958424575_01800 | CDS | open | 2940-5342 | _na 800_aa | mutS2 | endonuclease MutS2 |
| 3620 | CATZUD010000036.1 | GCA958424575_01801 | CDS | open | 5447-5950 | _na 167_aa | Corrinoid adenosyltransferase | |
| 3621 | CATZUD010000036.1 | GCA958424575_01802 | CDS | open | 5965-6381 | _na 138_aa | ndk | nucleoside-diphosphate kinase |
| 3622 | CATZUD010000036.1 | GCA958424575_01803 | CDS | open | 6395-7261 | _na 288_aa | Protease HtpX-like protein | |
| 3623 | CATZUD010000036.1 | GCA958424575_01805 | CDS | open | 7441-8379 | _na 312_aa | thrB | homoserine kinase |
| 3624 | CATZUD010000036.1 | GCA958424575_01806 | CDS | open | 8381-9667 | _na 428_aa | Homoserine dehydrogenase | |
| 3625 | CATZUD010000036.1 | GCA958424575_01807 | CDS | open | 9664-10119 | _na 151_aa | ACT domain-containing protein | |
| 3626 | CATZUD010000036.1 | GCA958424575_01808 | CDS | open | 10116-10988 | _na 290_aa | ChbG/HpnK family deacetylase | |
| 3627 | CATZUD010000036.1 | GCA958424575_01809 | CDS | open | 11063-11752 | _na 229_aa | trmH | RNA methyltransferase%2C TrmH family |
| 3628 | CATZUD010000036.1 | GCA958424575_01797 | gene | open | 30-1631 | yloV | ||
| 3629 | CATZUD010000036.1 | GCA958424575_01798 | gene | open | 1648-2478 | degV | ||
| 3630 | CATZUD010000036.1 | GCA958424575_01799 | gene | open | 2497-2859 | |||
| 3631 | CATZUD010000036.1 | GCA958424575_01800 | gene | open | 2940-5342 | mutS2 | ||
| 3632 | CATZUD010000036.1 | GCA958424575_01801 | gene | open | 5447-5950 | |||
| 3633 | CATZUD010000036.1 | GCA958424575_01802 | gene | open | 5965-6381 | ndk | ||
| 3634 | CATZUD010000036.1 | GCA958424575_01803 | gene | open | 6395-7261 | |||
| 3635 | CATZUD010000036.1 | GCA958424575_01805 | gene | open | 7441-8379 | thrB | ||
| 3636 | CATZUD010000036.1 | GCA958424575_01806 | gene | open | 8381-9667 | |||
| 3637 | CATZUD010000036.1 | GCA958424575_01807 | gene | open | 9664-10119 | |||
| 3638 | CATZUD010000036.1 | GCA958424575_01808 | gene | open | 10116-10988 | |||
| 3639 | CATZUD010000036.1 | GCA958424575_01809 | gene | open | 11063-11752 | trmH | ||
| 3640 | CATZUD010000036.1 | GCA958424575_01804 | gene | open | 7331-7407 | trnP | ||
| 3641 | CATZUD010000036.1 | GCA958424575_01804 | tRNA | open | 7331-7407 | trnP | tRNA-Pro(ggg) | |
| 3642 | CATZUD010000037.1 | GCA958424575_01810 | CDS | open | 43-444 | _na 133_aa | surE | 5'/3'-nucleotidase SurE |
| 3643 | CATZUD010000037.1 | GCA958424575_01812 | CDS | open | 748-1998 | _na 416_aa | Amidohydrolase | |
| 3644 | CATZUD010000037.1 | GCA958424575_01813 | CDS | open | 2136-3410 | _na 424_aa | DEAD/DEAH box helicase | |
| 3645 | CATZUD010000037.1 | GCA958424575_01814 | CDS | open | 3418-4362 | _na 314_aa | Beta-carotene 15%2C15'-monooxygenase | |
| 3646 | CATZUD010000037.1 | GCA958424575_01815 | CDS | open | 4605-5282 | _na 225_aa | ECF transporter S component | |
| 3647 | CATZUD010000037.1 | GCA958424575_01816 | CDS | open | 5481-6437 | _na 318_aa | Hydrid cluster protein-associated redox disulfide domain protein | |
| 3648 | CATZUD010000037.1 | GCA958424575_01817 | CDS | open | 6620-7771 | _na 383_aa | Peptidase%2C M48 family | |
| 3649 | CATZUD010000037.1 | GCA958424575_01818 | CDS | open | 7798-8790 | _na 330_aa | Serine-type D-Ala-D-Ala carboxypeptidase | |
| 3650 | CATZUD010000037.1 | GCA958424575_01819 | CDS | open | 8760-9059 | _na 99_aa | Septum formation initiator | |
| 3651 | CATZUD010000037.1 | GCA958424575_01820 | CDS | open | 9178-9702 | _na 174_aa | S1 RNA binding domain protein | |
| 3652 | CATZUD010000037.1 | GCA958424575_01821 | CDS | open | 9850-10761 | _na 303_aa | Ppx/GppA phosphatase family protein | |
| 3653 | CATZUD010000037.1 | GCA958424575_01810 | gene | open | 43-444 | surE | ||
| 3654 | CATZUD010000037.1 | GCA958424575_01812 | gene | open | 748-1998 | |||
| 3655 | CATZUD010000037.1 | GCA958424575_01813 | gene | open | 2136-3410 | |||
| 3656 | CATZUD010000037.1 | GCA958424575_01814 | gene | open | 3418-4362 | |||
| 3657 | CATZUD010000037.1 | GCA958424575_01815 | gene | open | 4605-5282 | |||
| 3658 | CATZUD010000037.1 | GCA958424575_01816 | gene | open | 5481-6437 | |||
| 3659 | CATZUD010000037.1 | GCA958424575_01817 | gene | open | 6620-7771 | |||
| 3660 | CATZUD010000037.1 | GCA958424575_01818 | gene | open | 7798-8790 | |||
| 3661 | CATZUD010000037.1 | GCA958424575_01819 | gene | open | 8760-9059 | |||
| 3662 | CATZUD010000037.1 | GCA958424575_01820 | gene | open | 9178-9702 | |||
| 3663 | CATZUD010000037.1 | GCA958424575_01821 | gene | open | 9850-10761 | |||
| 3664 | CATZUD010000037.1 | GCA958424575_01811 | gene | open | 481-566 | trnL | ||
| 3665 | CATZUD010000037.1 | GCA958424575_01811 | tRNA | open | 481-566 | trnL | tRNA-Leu(caa) | |
| 3666 | CATZUD010000038.1 | GCA958424575_01822 | CDS | open | 44-847 | _na 267_aa | hypothetical protein | |
| 3667 | CATZUD010000038.1 | GCA958424575_01823 | CDS | open | 968-1744 | _na 258_aa | Siphovirus-type tail component RIFT-related domain-containing protein | |
| 3668 | CATZUD010000038.1 | GCA958424575_01824 | CDS | open | 1749-4274 | _na 841_aa | Phage minor structural protein | |
| 3669 | CATZUD010000038.1 | GCA958424575_01825 | CDS | open | 4290-4484 | _na 64_aa | hypothetical protein | |
| 3670 | CATZUD010000038.1 | GCA958424575_01826 | CDS | open | 4600-5181 | _na 193_aa | SAF domain-containing protein | |
| 3671 | CATZUD010000038.1 | GCA958424575_01827 | CDS | open | 5261-6091 | _na 276_aa | hypothetical protein | |
| 3672 | CATZUD010000038.1 | GCA958424575_01828 | CDS | open | 6159-8627 | _na 822_aa | GH18 domain-containing protein | |
| 3673 | CATZUD010000038.1 | GCA958424575_01829 | CDS | open | 8694-9122 | _na 142_aa | Toxin secretion/phage lysis holin | |
| 3674 | CATZUD010000038.1 | GCA958424575_01830 | CDS | open | 9119-10651 | _na 510_aa | N-acetylmuramoyl-L-alanine amidase | |
| 3675 | CATZUD010000038.1 | GCA958424575_01831 | CDS | open | 10703-10864 | _na 53_aa | SHOCT-like domain-containing protein | |
| 3676 | CATZUD010000038.1 | GCA958424575_01822 | gene | open | 44-847 | |||
| 3677 | CATZUD010000038.1 | GCA958424575_01823 | gene | open | 968-1744 | |||
| 3678 | CATZUD010000038.1 | GCA958424575_01824 | gene | open | 1749-4274 | |||
| 3679 | CATZUD010000038.1 | GCA958424575_01825 | gene | open | 4290-4484 | |||
| 3680 | CATZUD010000038.1 | GCA958424575_01826 | gene | open | 4600-5181 | |||
| 3681 | CATZUD010000038.1 | GCA958424575_01827 | gene | open | 5261-6091 | |||
| 3682 | CATZUD010000038.1 | GCA958424575_01828 | gene | open | 6159-8627 | |||
| 3683 | CATZUD010000038.1 | GCA958424575_01829 | gene | open | 8694-9122 | |||
| 3684 | CATZUD010000038.1 | GCA958424575_01830 | gene | open | 9119-10651 | |||
| 3685 | CATZUD010000038.1 | GCA958424575_01831 | gene | open | 10703-10864 | |||
| 3686 | CATZUD010000039.1 | repeat_region | open | 4000-4263 | CRISPR array with 4 repeats of length 36%2C consensus sequence ATTATACCTTAGCGAGAGATAGTAGGGAATTACAAC and spacer length 30 | |||
| 3687 | CATZUD010000039.1 | GCA958424575_01832 | CDS | open | 147-326 | _na 59_aa | hypothetical protein | |
| 3688 | CATZUD010000039.1 | GCA958424575_01833 | CDS | open | 463-2418 | _na 651_aa | cas9 | type II CRISPR RNA-guided endonuclease Cas9 |
| 3689 | CATZUD010000039.1 | GCA958424575_01834 | CDS | open | 2430-3320 | _na 296_aa | cas1 | type II CRISPR-associated endonuclease Cas1 |
| 3690 | CATZUD010000039.1 | GCA958424575_01835 | CDS | open | 3313-3636 | _na 107_aa | cas2 | CRISPR-associated endonuclease Cas2 |
| 3691 | CATZUD010000039.1 | GCA958424575_01838 | CDS | open | 4991-6286 | _na 431_aa | Citrate transporter | |
| 3692 | CATZUD010000039.1 | GCA958424575_01839 | CDS | open | 6589-8979 | _na 796_aa | ppsA | phosphoenolpyruvate synthase |
| 3693 | CATZUD010000039.1 | GCA958424575_01840 | CDS | open | 9066-9701 | _na 211_aa | CBS domain protein | |
| 3694 | CATZUD010000039.1 | GCA958424575_01841 | CDS | open | 9705-10532 | _na 275_aa | Putative pyruvate%2C phosphate dikinase regulatory protein | |
| 3695 | CATZUD010000039.1 | GCA958424575_01832 | gene | open | 147-326 | |||
| 3696 | CATZUD010000039.1 | GCA958424575_01833 | gene | open | 463-2418 | cas9 | ||
| 3697 | CATZUD010000039.1 | GCA958424575_01834 | gene | open | 2430-3320 | cas1 | ||
| 3698 | CATZUD010000039.1 | GCA958424575_01835 | gene | open | 3313-3636 | cas2 | ||
| 3699 | CATZUD010000039.1 | GCA958424575_01838 | gene | open | 4991-6286 | |||
| 3700 | CATZUD010000039.1 | GCA958424575_01839 | gene | open | 6589-8979 | ppsA | ||
| 3701 | CATZUD010000039.1 | GCA958424575_01840 | gene | open | 9066-9701 | |||
| 3702 | CATZUD010000039.1 | GCA958424575_01841 | gene | open | 9705-10532 | |||
| 3703 | CATZUD010000039.1 | GCA958424575_01836 | gene | open | 4464-4539 | trnH | ||
| 3704 | CATZUD010000039.1 | GCA958424575_01837 | gene | open | 4592-4665 | trnQ | ||
| 3705 | CATZUD010000039.1 | GCA958424575_01836 | tRNA | open | 4464-4539 | trnH | tRNA-His(gtg) | |
| 3706 | CATZUD010000039.1 | GCA958424575_01837 | tRNA | open | 4592-4665 | trnQ | tRNA-Gln(ttg) | |
| 3707 | CATZUD010000040.1 | GCA958424575_01842 | CDS | open | 467-1129 | _na 220_aa | sdaAB | L-serine ammonia-lyase%2C iron-sulfur-dependent subunit beta |
| 3708 | CATZUD010000040.1 | GCA958424575_01843 | CDS | open | 1141-2028 | _na 295_aa | sdaAA | L-serine ammonia-lyase%2C iron-sulfur-dependent%2C subunit alpha |
| 3709 | CATZUD010000040.1 | GCA958424575_01846 | CDS | open | 2391-3062 | _na 223_aa | hypothetical protein | |
| 3710 | CATZUD010000040.1 | GCA958424575_01847 | CDS | open | 3146-3307 | _na 53_aa | scfA | six-cysteine ranthipeptide SCIFF |
| 3711 | CATZUD010000040.1 | GCA958424575_01848 | CDS | open | 3392-4828 | _na 478_aa | scfB | thioether cross-link-forming SCIFF peptide maturase |
| 3712 | CATZUD010000040.1 | GCA958424575_01849 | CDS | open | 4980-5426 | _na 148_aa | Secreted protein | |
| 3713 | CATZUD010000040.1 | GCA958424575_01850 | CDS | open | 5441-6637 | _na 398_aa | PEGA domain-containing protein | |
| 3714 | CATZUD010000040.1 | GCA958424575_01851 | CDS | open | 6630-8234 | _na 534_aa | ostA | Organic solvent tolerance protein OstA |
| 3715 | CATZUD010000040.1 | GCA958424575_01852 | CDS | open | 8261-9652 | _na 463_aa | Glucose-6-phosphate isomerase | |
| 3716 | CATZUD010000040.1 | GCA958424575_01853 | CDS | open | 9657-10166 | _na 169_aa | Tat pathway signal sequence domain protein | |
| 3717 | CATZUD010000040.1 | GCA958424575_01842 | gene | open | 467-1129 | sdaAB | ||
| 3718 | CATZUD010000040.1 | GCA958424575_01843 | gene | open | 1141-2028 | sdaAA | ||
| 3719 | CATZUD010000040.1 | GCA958424575_01846 | gene | open | 2391-3062 | |||
| 3720 | CATZUD010000040.1 | GCA958424575_01847 | gene | open | 3146-3307 | scfA | ||
| 3721 | CATZUD010000040.1 | GCA958424575_01848 | gene | open | 3392-4828 | scfB | ||
| 3722 | CATZUD010000040.1 | GCA958424575_01849 | gene | open | 4980-5426 | |||
| 3723 | CATZUD010000040.1 | GCA958424575_01850 | gene | open | 5441-6637 | |||
| 3724 | CATZUD010000040.1 | GCA958424575_01851 | gene | open | 6630-8234 | ostA | ||
| 3725 | CATZUD010000040.1 | GCA958424575_01852 | gene | open | 8261-9652 | |||
| 3726 | CATZUD010000040.1 | GCA958424575_01853 | gene | open | 9657-10166 | |||
| 3727 | CATZUD010000040.1 | GCA958424575_01844 | gene | open | 2141-2217 | trnP | ||
| 3728 | CATZUD010000040.1 | GCA958424575_01845 | gene | open | 2221-2294 | trnG | ||
| 3729 | CATZUD010000040.1 | GCA958424575_01844 | tRNA | open | 2141-2217 | trnP | tRNA-Pro(cgg) | |
| 3730 | CATZUD010000040.1 | GCA958424575_01845 | tRNA | open | 2221-2294 | trnG | tRNA-Gly(tcc) | |
| 3731 | CATZUD010000041.1 | GCA958424575_01854 | CDS | open | 181-1569 | _na 462_aa | fumC | class II fumarate hydratase |
| 3732 | CATZUD010000041.1 | GCA958424575_01855 | CDS | open | 1749-2654 | _na 301_aa | murB | UDP-N-acetylmuramate dehydrogenase |
| 3733 | CATZUD010000041.1 | GCA958424575_01856 | CDS | open | 2704-3537 | _na 277_aa | Asp23/Gls24 family envelope stress response protein | |
| 3734 | CATZUD010000041.1 | GCA958424575_01857 | CDS | open | 3634-4974 | _na 446_aa | miaB | tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB |
| 3735 | CATZUD010000041.1 | GCA958424575_01858 | CDS | open | 4980-7538 | _na 852_aa | mutS | DNA mismatch repair protein MutS |
| 3736 | CATZUD010000041.1 | GCA958424575_01859 | CDS | open | 7538-9475 | _na 645_aa | mutL | DNA mismatch repair endonuclease MutL |
| 3737 | CATZUD010000041.1 | GCA958424575_01854 | gene | open | 181-1569 | fumC | ||
| 3738 | CATZUD010000041.1 | GCA958424575_01855 | gene | open | 1749-2654 | murB | ||
| 3739 | CATZUD010000041.1 | GCA958424575_01856 | gene | open | 2704-3537 | |||
| 3740 | CATZUD010000041.1 | GCA958424575_01857 | gene | open | 3634-4974 | miaB | ||
| 3741 | CATZUD010000041.1 | GCA958424575_01858 | gene | open | 4980-7538 | mutS | ||
| 3742 | CATZUD010000041.1 | GCA958424575_01859 | gene | open | 7538-9475 | mutL | ||
| 3743 | CATZUD010000042.1 | GCA958424575_01860 | CDS | open | 100-528 | _na 142_aa | phage tail assembly protein | |
| 3744 | CATZUD010000042.1 | GCA958424575_01861 | CDS | open | 602-1120 | _na 172_aa | Phage tail protein | |
| 3745 | CATZUD010000042.1 | GCA958424575_01862 | CDS | open | 1135-2562 | _na 475_aa | Phage tail protein | |
| 3746 | CATZUD010000042.1 | GCA958424575_01863 | CDS | open | 2566-2943 | _na 125_aa | hypothetical protein | |
| 3747 | CATZUD010000042.1 | GCA958424575_01864 | CDS | open | 2934-3425 | _na 163_aa | Phage protein | |
| 3748 | CATZUD010000042.1 | GCA958424575_01865 | CDS | open | 3430-3990 | _na 186_aa | phage tail protein | |
| 3749 | CATZUD010000042.1 | GCA958424575_01866 | CDS | open | 3987-4331 | _na 114_aa | Large polyvalent protein associated domain-containing protein | |
| 3750 | CATZUD010000042.1 | GCA958424575_01867 | CDS | open | 4331-5386 | _na 351_aa | Phage capsid protein | |
| 3751 | CATZUD010000042.1 | GCA958424575_01868 | CDS | open | 5402-5749 | _na 115_aa | Head decoration protein | |
| 3752 | CATZUD010000042.1 | GCA958424575_01869 | CDS | open | 5764-6906 | _na 380_aa | ATP-dependent Clp protease proteolytic subunit | |
| 3753 | CATZUD010000042.1 | GCA958424575_01870 | CDS | open | 6848-8482 | _na 544_aa | phage portal protein | |
| 3754 | CATZUD010000042.1 | GCA958424575_01871 | CDS | open | 8628-8864 | _na 78_aa | DUF6148 domain-containing protein | |
| 3755 | CATZUD010000042.1 | GCA958424575_01860 | gene | open | 100-528 | |||
| 3756 | CATZUD010000042.1 | GCA958424575_01861 | gene | open | 602-1120 | |||
| 3757 | CATZUD010000042.1 | GCA958424575_01862 | gene | open | 1135-2562 | |||
| 3758 | CATZUD010000042.1 | GCA958424575_01863 | gene | open | 2566-2943 | |||
| 3759 | CATZUD010000042.1 | GCA958424575_01864 | gene | open | 2934-3425 | |||
| 3760 | CATZUD010000042.1 | GCA958424575_01865 | gene | open | 3430-3990 | |||
| 3761 | CATZUD010000042.1 | GCA958424575_01866 | gene | open | 3987-4331 | |||
| 3762 | CATZUD010000042.1 | GCA958424575_01867 | gene | open | 4331-5386 | |||
| 3763 | CATZUD010000042.1 | GCA958424575_01868 | gene | open | 5402-5749 | |||
| 3764 | CATZUD010000042.1 | GCA958424575_01869 | gene | open | 5764-6906 | |||
| 3765 | CATZUD010000042.1 | GCA958424575_01870 | gene | open | 6848-8482 | |||
| 3766 | CATZUD010000042.1 | GCA958424575_01871 | gene | open | 8628-8864 | |||
| 3767 | CATZUD010000043.1 | GCA958424575_01872 | CDS | open | 34-1185 | _na 383_aa | hypothetical protein | |
| 3768 | CATZUD010000043.1 | GCA958424575_01873 | CDS | open | 1172-1723 | _na 183_aa | hpt | hypoxanthine phosphoribosyltransferase |
| 3769 | CATZUD010000043.1 | GCA958424575_01874 | CDS | open | 1869-3755 | _na 628_aa | ftsH | ATP-dependent zinc metalloprotease FtsH |
| 3770 | CATZUD010000043.1 | GCA958424575_01875 | CDS | open | 4017-4457 | _na 146_aa | rplM | 50S ribosomal protein L13 |
| 3771 | CATZUD010000043.1 | GCA958424575_01876 | CDS | open | 4473-4871 | _na 132_aa | rpsI | 30S ribosomal protein S9 |
| 3772 | CATZUD010000043.1 | GCA958424575_01877 | CDS | open | 5030-6508 | _na 492_aa | Type I restriction modification DNA specificity domain-containing protein | |
| 3773 | CATZUD010000043.1 | GCA958424575_01878 | CDS | open | 6534-7127 | _na 197_aa | XTP/dITP diphosphatase | |
| 3774 | CATZUD010000043.1 | GCA958424575_01872 | gene | open | 34-1185 | |||
| 3775 | CATZUD010000043.1 | GCA958424575_01873 | gene | open | 1172-1723 | hpt | ||
| 3776 | CATZUD010000043.1 | GCA958424575_01874 | gene | open | 1869-3755 | ftsH | ||
| 3777 | CATZUD010000043.1 | GCA958424575_01875 | gene | open | 4017-4457 | rplM | ||
| 3778 | CATZUD010000043.1 | GCA958424575_01876 | gene | open | 4473-4871 | rpsI | ||
| 3779 | CATZUD010000043.1 | GCA958424575_01877 | gene | open | 5030-6508 | |||
| 3780 | CATZUD010000043.1 | GCA958424575_01878 | gene | open | 6534-7127 | |||
| 3781 | CATZUD010000044.1 | GCA958424575_01879 | CDS | open | 405-977 | _na 190_aa | hypothetical protein | |
| 3782 | CATZUD010000044.1 | GCA958424575_01880 | CDS | open | 1034-1240 | _na 68_aa | histidine kinase | |
| 3783 | CATZUD010000044.1 | GCA958424575_01881 | CDS | open | 1241-3028 | _na 595_aa | histidine kinase | |
| 3784 | CATZUD010000044.1 | GCA958424575_01882 | CDS | open | 3159-3974 | _na 271_aa | DNA-(apurinic or apyrimidinic site) lyase | |
| 3785 | CATZUD010000044.1 | GCA958424575_01883 | CDS | open | 4014-4379 | _na 121_aa | hypothetical protein | |
| 3786 | CATZUD010000044.1 | GCA958424575_01884 | CDS | open | 4391-6274 | _na 627_aa | abc-f | ribosomal protection-like ABC-F family protein |
| 3787 | CATZUD010000044.1 | GCA958424575_01885 | CDS | open | 6303-7409 | _na 368_aa | Bacterial type II/III secretion system short domain protein | |
| 3788 | CATZUD010000044.1 | GCA958424575_01879 | gene | open | 405-977 | |||
| 3789 | CATZUD010000044.1 | GCA958424575_01880 | gene | open | 1034-1240 | |||
| 3790 | CATZUD010000044.1 | GCA958424575_01881 | gene | open | 1241-3028 | |||
| 3791 | CATZUD010000044.1 | GCA958424575_01882 | gene | open | 3159-3974 | |||
| 3792 | CATZUD010000044.1 | GCA958424575_01883 | gene | open | 4014-4379 | |||
| 3793 | CATZUD010000044.1 | GCA958424575_01884 | gene | open | 4391-6274 | abc-f | ||
| 3794 | CATZUD010000044.1 | GCA958424575_01885 | gene | open | 6303-7409 | |||
| 3795 | CATZUD010000045.1 | GCA958424575_01891 | gene | open | 4479-4823 | ssrA | ||
| 3796 | CATZUD010000045.1 | GCA958424575_01891 | tmRNA | open | 4479-4823 | ssrA | transfer-messenger RNA%2C SsrA | |
| 3797 | CATZUD010000045.1 | GCA958424575_01886 | CDS | open | 11-397 | _na 128_aa | hypothetical protein | |
| 3798 | CATZUD010000045.1 | GCA958424575_01887 | CDS | open | 1026-2003 | _na 325_aa | G5 domain-containing protein | |
| 3799 | CATZUD010000045.1 | GCA958424575_01888 | CDS | open | 2119-2550 | _na 143_aa | lspA | signal peptidase II |
| 3800 | CATZUD010000045.1 | GCA958424575_01889 | CDS | open | 2551-3477 | _na 308_aa | Pseudouridine synthase | |
| 3801 | CATZUD010000045.1 | GCA958424575_01890 | CDS | open | 3477-4433 | _na 318_aa | Peptidase family T4 | |
| 3802 | CATZUD010000045.1 | GCA958424575_01892 | CDS | open | 5390-6202 | _na 270_aa | thiM | hydroxyethylthiazole kinase |
| 3803 | CATZUD010000045.1 | GCA958424575_01893 | CDS | open | 6192-6845 | _na 217_aa | Thiamine-phosphate synthase | |
| 3804 | CATZUD010000045.1 | GCA958424575_01886 | gene | open | 11-397 | |||
| 3805 | CATZUD010000045.1 | GCA958424575_01887 | gene | open | 1026-2003 | |||
| 3806 | CATZUD010000045.1 | GCA958424575_01888 | gene | open | 2119-2550 | lspA | ||
| 3807 | CATZUD010000045.1 | GCA958424575_01889 | gene | open | 2551-3477 | |||
| 3808 | CATZUD010000045.1 | GCA958424575_01890 | gene | open | 3477-4433 | |||
| 3809 | CATZUD010000045.1 | GCA958424575_01892 | gene | open | 5390-6202 | thiM | ||
| 3810 | CATZUD010000045.1 | GCA958424575_01893 | gene | open | 6192-6845 | |||
| 3811 | CATZUD010000046.1 | GCA958424575_01894 | CDS | open | 149-835 | _na 228_aa | hypothetical protein | |
| 3812 | CATZUD010000046.1 | GCA958424575_01895 | CDS | open | 832-1089 | _na 85_aa | hypothetical protein | |
| 3813 | CATZUD010000046.1 | GCA958424575_01896 | CDS | open | 1086-1655 | _na 189_aa | DUF2786 domain-containing protein | |
| 3814 | CATZUD010000046.1 | GCA958424575_01897 | CDS | open | 1659-2207 | _na 182_aa | hypothetical protein | |
| 3815 | CATZUD010000046.1 | GCA958424575_01898 | CDS | open | 2167-2439 | _na 90_aa | hypothetical protein | |
| 3816 | CATZUD010000046.1 | GCA958424575_01899 | CDS | open | 2442-3833 | _na 463_aa | DNA (cytosine-5-)-methyltransferase | |
| 3817 | CATZUD010000046.1 | GCA958424575_01900 | CDS | open | 3830-4387 | _na 185_aa | HD domain-containing protein | |
| 3818 | CATZUD010000046.1 | GCA958424575_01901 | CDS | open | 4384-4779 | _na 131_aa | Nuclease | |
| 3819 | CATZUD010000046.1 | GCA958424575_01902 | CDS | open | 4776-5030 | _na 84_aa | hypothetical protein | |
| 3820 | CATZUD010000046.1 | GCA958424575_01903 | CDS | open | 5027-5197 | _na 56_aa | hypothetical protein | |
| 3821 | CATZUD010000046.1 | GCA958424575_01904 | CDS | open | 5208-5510 | _na 100_aa | hypothetical protein | |
| 3822 | CATZUD010000046.1 | GCA958424575_01905 | CDS | open | 5524-5868 | _na 114_aa | hypothetical protein | |
| 3823 | CATZUD010000046.1 | GCA958424575_01906 | CDS | open | 5891-6295 | _na 134_aa | hypothetical protein | |
| 3824 | CATZUD010000046.1 | GCA958424575_01894 | gene | open | 149-835 | |||
| 3825 | CATZUD010000046.1 | GCA958424575_01895 | gene | open | 832-1089 | |||
| 3826 | CATZUD010000046.1 | GCA958424575_01896 | gene | open | 1086-1655 | |||
| 3827 | CATZUD010000046.1 | GCA958424575_01897 | gene | open | 1659-2207 | |||
| 3828 | CATZUD010000046.1 | GCA958424575_01898 | gene | open | 2167-2439 | |||
| 3829 | CATZUD010000046.1 | GCA958424575_01899 | gene | open | 2442-3833 | |||
| 3830 | CATZUD010000046.1 | GCA958424575_01900 | gene | open | 3830-4387 | |||
| 3831 | CATZUD010000046.1 | GCA958424575_01901 | gene | open | 4384-4779 | |||
| 3832 | CATZUD010000046.1 | GCA958424575_01902 | gene | open | 4776-5030 | |||
| 3833 | CATZUD010000046.1 | GCA958424575_01903 | gene | open | 5027-5197 | |||
| 3834 | CATZUD010000046.1 | GCA958424575_01904 | gene | open | 5208-5510 | |||
| 3835 | CATZUD010000046.1 | GCA958424575_01905 | gene | open | 5524-5868 | |||
| 3836 | CATZUD010000046.1 | GCA958424575_01906 | gene | open | 5891-6295 | |||
| 3837 | CATZUD010000047.1 | GCA958424575_01907 | CDS | open | 1660-2145 | _na 161_aa | Phage DNA packaging protein%2C Nu1 subunit of terminase | |
| 3838 | CATZUD010000047.1 | GCA958424575_01908 | CDS | open | 2286-3101 | _na 271_aa | PBSX phage terminase small subunit-like N-terminal domain-containing protein | |
| 3839 | CATZUD010000047.1 | GCA958424575_01909 | CDS | open | 3232-3744 | _na 170_aa | RNA polymerase subunit sigma-70 | |
| 3840 | CATZUD010000047.1 | GCA958424575_01910 | CDS | open | 3731-3874 | _na 47_aa | hypothetical protein | |
| 3841 | CATZUD010000047.1 | GCA958424575_01911 | CDS | open | 3886-5217 | _na 443_aa | DUF3850 domain-containing protein | |
| 3842 | CATZUD010000047.1 | GCA958424575_01912 | CDS | open | 5247-6011 | _na 254_aa | Cobyrinic acid a%2Cc-diamide synthase | |
| 3843 | CATZUD010000047.1 | GCA958424575_01907 | gene | open | 1660-2145 | |||
| 3844 | CATZUD010000047.1 | GCA958424575_01908 | gene | open | 2286-3101 | |||
| 3845 | CATZUD010000047.1 | GCA958424575_01909 | gene | open | 3232-3744 | |||
| 3846 | CATZUD010000047.1 | GCA958424575_01910 | gene | open | 3731-3874 | |||
| 3847 | CATZUD010000047.1 | GCA958424575_01911 | gene | open | 3886-5217 | |||
| 3848 | CATZUD010000047.1 | GCA958424575_01912 | gene | open | 5247-6011 | |||
| 3849 | CATZUD010000047.1 | GCA958424575_01913 | gene | open | 6057-6124 | trnL | ||
| 3850 | CATZUD010000047.1 | GCA958424575_01913 | tRNA | open | 6057-6124 | trnL | tRNA-Leu(taa) | |
| 3851 | CATZUD010000048.1 | regulatory_region | open | 3942-4141 | T-box leader | |||
| 3852 | CATZUD010000048.1 | GCA958424575_01914 | CDS | open | 268-432 | _na 54_aa | hypothetical protein | |
| 3853 | CATZUD010000048.1 | GCA958424575_01915 | CDS | open | 398-1117 | _na 239_aa | ABC transporter%2C ATP-binding protein | |
| 3854 | CATZUD010000048.1 | GCA958424575_01916 | CDS | open | 1114-1878 | _na 254_aa | ABC transporter%2C ATP-binding protein | |
| 3855 | CATZUD010000048.1 | GCA958424575_01917 | CDS | open | 1878-2840 | _na 320_aa | Branched-chain amino acid ABC transporter%2C permease protein | |
| 3856 | CATZUD010000048.1 | GCA958424575_01918 | CDS | open | 2840-3721 | _na 293_aa | livH | Branched-chain amino acid ABC transporter permease |
| 3857 | CATZUD010000048.1 | GCA958424575_01919 | CDS | open | 3835-4128 | _na 97_aa | hypothetical protein | |
| 3858 | CATZUD010000048.1 | GCA958424575_01920 | CDS | open | 4432-5937 | _na 501_aa | IMP dehydrogenase | |
| 3859 | CATZUD010000048.1 | GCA958424575_01914 | gene | open | 268-432 | |||
| 3860 | CATZUD010000048.1 | GCA958424575_01915 | gene | open | 398-1117 | |||
| 3861 | CATZUD010000048.1 | GCA958424575_01916 | gene | open | 1114-1878 | |||
| 3862 | CATZUD010000048.1 | GCA958424575_01917 | gene | open | 1878-2840 | |||
| 3863 | CATZUD010000048.1 | GCA958424575_01918 | gene | open | 2840-3721 | livH | ||
| 3864 | CATZUD010000048.1 | GCA958424575_01919 | gene | open | 3835-4128 | |||
| 3865 | CATZUD010000048.1 | GCA958424575_01920 | gene | open | 4432-5937 | |||
| 3866 | CATZUD010000049.1 | GCA958424575_01921 | CDS | open | 806-2725 | _na 639_aa | DNA topoisomerase (ATP-hydrolyzing) | |
| 3867 | CATZUD010000049.1 | GCA958424575_01922 | CDS | open | 3100-5514 | _na 804_aa | luxR | LuxR C-terminal-related transcriptional regulator |
| 3868 | CATZUD010000049.1 | GCA958424575_01921 | gene | open | 806-2725 | |||
| 3869 | CATZUD010000049.1 | GCA958424575_01922 | gene | open | 3100-5514 | luxR | ||
| 3870 | CATZUD010000050.1 | GCA958424575_01923 | CDS | open | 144-746 | _na 200_aa | Phage holin | |
| 3871 | CATZUD010000050.1 | GCA958424575_01924 | CDS | open | 780-2285 | _na 501_aa | lysM | LysM peptidoglycan-binding domain-containing protein |
| 3872 | CATZUD010000050.1 | GCA958424575_01925 | CDS | open | 2297-2683 | _na 128_aa | DUF3784 domain-containing protein | |
| 3873 | CATZUD010000050.1 | GCA958424575_01926 | CDS | open | 2697-3251 | _na 184_aa | hypothetical protein | |
| 3874 | CATZUD010000050.1 | GCA958424575_01927 | CDS | open | 3236-4333 | _na 365_aa | RNA-dependent DNA polymerase | |
| 3875 | CATZUD010000050.1 | GCA958424575_01923 | gene | open | 144-746 | |||
| 3876 | CATZUD010000050.1 | GCA958424575_01924 | gene | open | 780-2285 | lysM | ||
| 3877 | CATZUD010000050.1 | GCA958424575_01925 | gene | open | 2297-2683 | |||
| 3878 | CATZUD010000050.1 | GCA958424575_01926 | gene | open | 2697-3251 | |||
| 3879 | CATZUD010000050.1 | GCA958424575_01927 | gene | open | 3236-4333 | |||
| 3880 | CATZUD010000051.1 | GCA958424575_01928 | CDS | open | 1164-1517 | _na 117_aa | helix-turn-helix domain-containing protein | |
| 3881 | CATZUD010000051.1 | GCA958424575_01929 | CDS | open | 1668-1859 | _na 63_aa | helix-turn-helix domain-containing protein | |
| 3882 | CATZUD010000051.1 | GCA958424575_01930 | CDS | open | 1828-2520 | _na 230_aa | hypothetical protein | |
| 3883 | CATZUD010000051.1 | GCA958424575_01931 | CDS | open | 2598-3044 | _na 148_aa | Phage protein | |
| 3884 | CATZUD010000051.1 | GCA958424575_01932 | CDS | open | 3103-3285 | _na 60_aa | Complexin-2 | |
| 3885 | CATZUD010000051.1 | GCA958424575_01933 | CDS | open | 3337-3771 | _na 144_aa | hypothetical protein | |
| 3886 | CATZUD010000051.1 | GCA958424575_01928 | gene | open | 1164-1517 | |||
| 3887 | CATZUD010000051.1 | GCA958424575_01929 | gene | open | 1668-1859 | |||
| 3888 | CATZUD010000051.1 | GCA958424575_01930 | gene | open | 1828-2520 | |||
| 3889 | CATZUD010000051.1 | GCA958424575_01931 | gene | open | 2598-3044 | |||
| 3890 | CATZUD010000051.1 | GCA958424575_01932 | gene | open | 3103-3285 | |||
| 3891 | CATZUD010000051.1 | GCA958424575_01933 | gene | open | 3337-3771 | |||
| 3892 | CATZUD010000052.1 | GCA958424575_01934 | CDS | open | 93-4295 | _na 1400_aa | Hep/Hag repeat protein | |
| 3893 | CATZUD010000052.1 | GCA958424575_01934 | gene | open | 93-4295 | |||
| 3894 | CATZUD010000053.1 | GCA958424575_01935 | CDS | open | 152-391 | _na 79_aa | hypothetical protein | |
| 3895 | CATZUD010000053.1 | GCA958424575_01936 | CDS | open | 775-1206 | _na 143_aa | DNA-directed RNA polymerase specialized sigma subunit%2C sigma24-like protein | |
| 3896 | CATZUD010000053.1 | GCA958424575_01937 | CDS | open | 1196-1453 | _na 85_aa | RNA polymerase subunit sigma | |
| 3897 | CATZUD010000053.1 | GCA958424575_01938 | CDS | open | 1570-2133 | _na 187_aa | ahpC | alkyl hydroperoxide reductase subunit C |
| 3898 | CATZUD010000053.1 | GCA958424575_01939 | CDS | open | 2145-3782 | _na 545_aa | Thioredoxin reductase | |
| 3899 | CATZUD010000053.1 | GCA958424575_01940 | CDS | open | 4091-4225 | _na 44_aa | Transposase | |
| 3900 | CATZUD010000053.1 | GCA958424575_01935 | gene | open | 152-391 | |||
| 3901 | CATZUD010000053.1 | GCA958424575_01936 | gene | open | 775-1206 | |||
| 3902 | CATZUD010000053.1 | GCA958424575_01937 | gene | open | 1196-1453 | |||
| 3903 | CATZUD010000053.1 | GCA958424575_01938 | gene | open | 1570-2133 | ahpC | ||
| 3904 | CATZUD010000053.1 | GCA958424575_01939 | gene | open | 2145-3782 | |||
| 3905 | CATZUD010000053.1 | GCA958424575_01940 | gene | open | 4091-4225 | |||
| 3906 | CATZUD010000054.1 | GCA958424575_01941 | CDS | open | 481-1779 | _na 432_aa | Resolvase/invertase-type recombinase catalytic domain-containing protein | |
| 3907 | CATZUD010000054.1 | GCA958424575_01942 | CDS | open | 1767-3383 | _na 538_aa | Recombinase family protein | |
| 3908 | CATZUD010000054.1 | GCA958424575_01943 | CDS | open | 3387-3680 | _na 97_aa | hypothetical protein | |
| 3909 | CATZUD010000054.1 | GCA958424575_01944 | CDS | open | 3890-4138 | _na 82_aa | Sporulation initiation factor Spo0A C-terminal domain-containing protein | |
| 3910 | CATZUD010000054.1 | GCA958424575_01941 | gene | open | 481-1779 | |||
| 3911 | CATZUD010000054.1 | GCA958424575_01942 | gene | open | 1767-3383 | |||
| 3912 | CATZUD010000054.1 | GCA958424575_01943 | gene | open | 3387-3680 | |||
| 3913 | CATZUD010000054.1 | GCA958424575_01944 | gene | open | 3890-4138 | |||
| 3914 | CATZUD010000055.1 | GCA958424575_01945 | CDS | open | 504-1034 | _na 176_aa | DUF308 domain-containing protein | |
| 3915 | CATZUD010000055.1 | GCA958424575_01946 | CDS | open | 1025-1666 | _na 213_aa | J domain-containing protein | |
| 3916 | CATZUD010000055.1 | GCA958424575_01947 | CDS | open | 1678-2520 | _na 280_aa | DUF5685 domain-containing protein | |
| 3917 | CATZUD010000055.1 | GCA958424575_01948 | CDS | open | 2876-3337 | _na 153_aa | hypothetical protein | |
| 3918 | CATZUD010000055.1 | GCA958424575_01945 | gene | open | 504-1034 | |||
| 3919 | CATZUD010000055.1 | GCA958424575_01946 | gene | open | 1025-1666 | |||
| 3920 | CATZUD010000055.1 | GCA958424575_01947 | gene | open | 1678-2520 | |||
| 3921 | CATZUD010000055.1 | GCA958424575_01948 | gene | open | 2876-3337 | |||
| 3922 | CATZUD010000056.1 | GCA958424575_01949 | CDS | open | 72-1067 | _na 331_aa | MFS transporter | |
| 3923 | CATZUD010000056.1 | GCA958424575_01950 | CDS | open | 1060-2103 | _na 347_aa | Ribosylpyrimidine nucleosidase | |
| 3924 | CATZUD010000056.1 | GCA958424575_01951 | CDS | open | 2169-3167 | _na 332_aa | Ribosylpyrimidine nucleosidase | |
| 3925 | CATZUD010000056.1 | GCA958424575_01949 | gene | open | 72-1067 | |||
| 3926 | CATZUD010000056.1 | GCA958424575_01950 | gene | open | 1060-2103 | |||
| 3927 | CATZUD010000056.1 | GCA958424575_01951 | gene | open | 2169-3167 | |||
| 3928 | CATZUD010000057.1 | GCA958424575_01952 | CDS | open | 50-742 | _na 230_aa | Putative membrane protein | |
| 3929 | CATZUD010000057.1 | GCA958424575_01955 | CDS | open | 1119-2279 | _na 386_aa | double-cubane-cluster-containing anaerobic reductase | |
| 3930 | CATZUD010000057.1 | GCA958424575_01956 | CDS | open | 2272-3126 | _na 284_aa | uroporphyrinogen decarboxylase family protein | |
| 3931 | CATZUD010000057.1 | GCA958424575_01952 | gene | open | 50-742 | |||
| 3932 | CATZUD010000057.1 | GCA958424575_01955 | gene | open | 1119-2279 | |||
| 3933 | CATZUD010000057.1 | GCA958424575_01956 | gene | open | 2272-3126 | |||
| 3934 | CATZUD010000057.1 | GCA958424575_01953 | gene | open | 850-920 | trnC | ||
| 3935 | CATZUD010000057.1 | GCA958424575_01954 | gene | open | 951-1022 | trnE | ||
| 3936 | CATZUD010000057.1 | GCA958424575_01953 | tRNA | open | 850-920 | trnC | tRNA-Cys(gca) | |
| 3937 | CATZUD010000057.1 | GCA958424575_01954 | tRNA | open | 951-1022 | trnE | tRNA-Glu(ttc) | |
| 3938 | CATZUD010000058.1 | GCA958424575_01957 | CDS | open | 5-613 | _na 202_aa | HAD family phosphatase | |
| 3939 | CATZUD010000058.1 | GCA958424575_01958 | CDS | open | 692-1498 | _na 268_aa | Hydroxymethylpyrimidine/phosphomethylpyrimidine kinase | |
| 3940 | CATZUD010000058.1 | GCA958424575_01959 | CDS | open | 1498-2160 | _na 220_aa | tenA | thiaminase II |
| 3941 | CATZUD010000058.1 | GCA958424575_01960 | CDS | open | 2427-2711 | _na 94_aa | MATE family efflux transporter | |
| 3942 | CATZUD010000058.1 | GCA958424575_01961 | CDS | open | 2733-2936 | _na 67_aa | hypothetical protein | |
| 3943 | CATZUD010000058.1 | GCA958424575_01957 | gene | open | 5-613 | |||
| 3944 | CATZUD010000058.1 | GCA958424575_01958 | gene | open | 692-1498 | |||
| 3945 | CATZUD010000058.1 | GCA958424575_01959 | gene | open | 1498-2160 | tenA | ||
| 3946 | CATZUD010000058.1 | GCA958424575_01960 | gene | open | 2427-2711 | |||
| 3947 | CATZUD010000058.1 | GCA958424575_01961 | gene | open | 2733-2936 | |||
| 3948 | CATZUD010000059.1 | GCA958424575_01962 | CDS | open | 395-634 | _na 79_aa | hypothetical protein | |
| 3949 | CATZUD010000059.1 | GCA958424575_01963 | CDS | open | 868-2157 | _na 429_aa | Transporter%2C DASS family | |
| 3950 | CATZUD010000059.1 | GCA958424575_01964 | CDS | open | 2249-2506 | _na 85_aa | hypothetical protein | |
| 3951 | CATZUD010000059.1 | GCA958424575_01965 | CDS | open | 2538-2903 | _na 121_aa | hypothetical protein | |
| 3952 | CATZUD010000059.1 | GCA958424575_01962 | gene | open | 395-634 | |||
| 3953 | CATZUD010000059.1 | GCA958424575_01963 | gene | open | 868-2157 | |||
| 3954 | CATZUD010000059.1 | GCA958424575_01964 | gene | open | 2249-2506 | |||
| 3955 | CATZUD010000059.1 | GCA958424575_01965 | gene | open | 2538-2903 | |||
| 3956 | CATZUD010000060.1 | GCA958424575_01966 | CDS | open | 861-2492 | _na 543_aa | GH3 auxin-responsive promoter family protein | |
| 3957 | CATZUD010000060.1 | GCA958424575_01966 | gene | open | 861-2492 |

