BAKTAGenome Explorer: Faecalibacterium prausnitzii (GCA_000154385.1)
Select a Genome:
|
BAKTA Annotations for GCA_000154385.1
|
Search & Sort all 5991 Records
| ||||||||||||||||||
Notes: 1- Column headers only sort the current page. 2- Select [NA] or [AA] links to show sequences.
| Region | Protein-ID | Type | Genome Viewer |
Range (bp) |
Show Sequences (length) NA / AA |
BAKTA Gene |
BAKTA GeneProduct |
|
|---|---|---|---|---|---|---|---|---|
| 1 | DS483480.1 | GCA000154385_02933 | gene | open | 1456-2966 | rrs | ||
| 2 | DS483480.1 | GCA000154385_02936 | gene | open | 3455-6289 | rrl | ||
| 3 | DS483480.1 | GCA000154385_02937 | gene | open | 6416-6532 | rrf | ||
| 4 | DS483480.1 | GCA000154385_02933 | rRNA | open | 1456-2966 | rrs | 16S ribosomal RNA | |
| 5 | DS483480.1 | GCA000154385_02936 | rRNA | open | 3455-6289 | rrl | 23S ribosomal RNA | |
| 6 | DS483480.1 | GCA000154385_02937 | rRNA | open | 6416-6532 | rrf | 5S ribosomal RNA | |
| 7 | DS483480.1 | GCA000154385_02931 | CDS | open | 67-486 | _na 139_aa | Gram-positive signal peptide protein%2C YSIRK family | |
| 8 | DS483480.1 | GCA000154385_02932 | CDS | open | 506-817 | _na 103_aa | ybjQ | UPF0145 protein CRH10_05070 |
| 9 | DS483480.1 | GCA000154385_02940 | CDS | open | 6856-8244 | _na 462_aa | xerC | Tyrosine recombinase XerC |
| 10 | DS483480.1 | GCA000154385_02941 | CDS | open | 8260-8574 | _na 104_aa | Helix-turn-helix domain-containing protein | |
| 11 | DS483480.1 | GCA000154385_02942 | CDS | open | 8617-9882 | _na 421_aa | Plasmid recombination enzyme | |
| 12 | DS483480.1 | GCA000154385_02943 | CDS | open | 10337-11653 | _na 438_aa | Phage/plasmid primase%2C P4 family%2C C-terminal domain | |
| 13 | DS483480.1 | GCA000154385_02944 | CDS | open | 11727-12329 | _na 200_aa | DNA primase | |
| 14 | DS483480.1 | GCA000154385_02945 | CDS | open | 12583-13413 | _na 276_aa | hipB | DNA-binding helix-turn-helix protein |
| 15 | DS483480.1 | GCA000154385_02946 | CDS | open | 13397-14062 | _na 221_aa | rpoD | RNA polymerase sigma factor rpoD |
| 16 | DS483480.1 | GCA000154385_02947 | CDS | open | 14768-15742 | _na 324_aa | DUF4367 domain-containing protein | |
| 17 | DS483480.1 | GCA000154385_02948 | CDS | open | 16755-17111 | _na 118_aa | hypothetical protein | |
| 18 | DS483480.1 | GCA000154385_02949 | CDS | open | 17195-17443 | _na 82_aa | DUF2442 domain-containing protein | |
| 19 | DS483480.1 | GCA000154385_02950 | CDS | open | 17870-18562 | _na 230_aa | argininosuccinate synthase | |
| 20 | DS483480.1 | GCA000154385_02951 | CDS | open | 18766-19518 | _na 250_aa | DUF4866 domain-containing protein | |
| 21 | DS483480.1 | GCA000154385_02952 | CDS | open | 19632-20966 | _na 444_aa | Threonine/serine exporter family protein | |
| 22 | DS483480.1 | GCA000154385_02953 | CDS | open | 21076-21726 | _na 216_aa | lysR | Bacterial regulatory helix-turn-helix protein%2C lysR family |
| 23 | DS483480.1 | GCA000154385_02954 | CDS | open | 21917-23320 | _na 467_aa | Tat pathway signal sequence domain protein | |
| 24 | DS483480.1 | GCA000154385_02955 | CDS | open | 23322-24116 | _na 264_aa | F5/8 type C domain protein | |
| 25 | DS483480.1 | GCA000154385_02956 | CDS | open | 24128-25924 | _na 598_aa | Heparinase II/III-like protein | |
| 26 | DS483480.1 | GCA000154385_02957 | CDS | open | 25939-27201 | _na 420_aa | Stage 0 sporulation A-like protein | |
| 27 | DS483480.1 | GCA000154385_02958 | CDS | open | 27176-28993 | _na 605_aa | ypdA | Sensor histidine kinase YpdA |
| 28 | DS483480.1 | GCA000154385_02959 | CDS | open | 29338-30657 | _na 439_aa | Sugar ABC transporter substrate-binding protein | |
| 29 | DS483480.1 | GCA000154385_02960 | CDS | open | 30835-31761 | _na 308_aa | lacF | Lactose transport system permease protein LacF |
| 30 | DS483480.1 | GCA000154385_02961 | CDS | open | 31778-32638 | _na 286_aa | Sugar ABC transporter ATP-binding protein | |
| 31 | DS483480.1 | GCA000154385_02962 | CDS | open | 32712-33110 | _na 132_aa | Glycosyl hydrolase family 2%2C sugar binding domain protein | |
| 32 | DS483480.1 | GCA000154385_02963 | CDS | open | 33141-34508 | _na 455_aa | Beta-glucuronidase | |
| 33 | DS483480.1 | GCA000154385_02964 | CDS | open | 34511-35674 | _na 387_aa | Unsaturated chondroitin disaccharide hydrolase | |
| 34 | DS483480.1 | GCA000154385_02965 | CDS | open | 35674-37362 | _na 562_aa | DUF2264 domain-containing protein | |
| 35 | DS483480.1 | GCA000154385_02966 | CDS | open | 37459-40473 | _na 1004_aa | Beta-galactosidase | |
| 36 | DS483480.1 | GCA000154385_02967 | CDS | open | 40478-40669 | _na 63_aa | hypothetical protein | |
| 37 | DS483480.1 | GCA000154385_02968 | CDS | open | 40825-41736 | _na 303_aa | HTH araC/xylS-type domain-containing protein | |
| 38 | DS483480.1 | GCA000154385_02969 | CDS | open | 42077-43108 | _na 343_aa | dctP | Tripartite ATP-independent periplasmic transporter solute receptor%2C DctP family |
| 39 | DS483480.1 | GCA000154385_02970 | CDS | open | 43127-43636 | _na 169_aa | TRAP transporter small permease | |
| 40 | DS483480.1 | GCA000154385_02971 | CDS | open | 43657-44958 | _na 433_aa | dctM | TRAP C4-dicarboxylate transport system permease DctM subunit domain-containing protein |
| 41 | DS483480.1 | GCA000154385_02972 | CDS | open | 44983-46356 | _na 457_aa | Endopolygalacturonase | |
| 42 | DS483480.1 | GCA000154385_02973 | CDS | open | 46449-47618 | _na 389_aa | Transporter%2C major facilitator family protein | |
| 43 | DS483480.1 | GCA000154385_02974 | CDS | open | 47901-50516 | _na 871_aa | alpha-L-rhamnosidase | |
| 44 | DS483480.1 | GCA000154385_02975 | CDS | open | 50627-51475 | _na 282_aa | Xylose isomerase-like TIM barrel | |
| 45 | DS483480.1 | GCA000154385_02976 | CDS | open | 51479-53293 | _na 604_aa | Beta-xylosidase | |
| 46 | DS483480.1 | GCA000154385_02977 | CDS | open | 53300-55507 | _na 735_aa | Beta-glucuronidase | |
| 47 | DS483480.1 | GCA000154385_02978 | CDS | open | 55589-57079 | _na 496_aa | Na+/melibiose symporter and related transporters | |
| 48 | DS483480.1 | GCA000154385_02979 | CDS | open | 57315-58616 | _na 433_aa | beta-glucosidase | |
| 49 | DS483480.1 | GCA000154385_02980 | CDS | open | 58671-59207 | _na 178_aa | TetR/AcrR family transcriptional regulator | |
| 50 | DS483480.1 | GCA000154385_02981 | CDS | open | 59412-60428 | _na 338_aa | Oxidoreductase%2C short chain dehydrogenase/reductase family protein | |
| 51 | DS483480.1 | GCA000154385_02982 | CDS | open | 60502-61848 | _na 448_aa | norM | putative multidrug resistance protein NorM |
| 52 | DS483480.1 | GCA000154385_02983 | CDS | open | 61893-63092 | _na 399_aa | Bacillibactin transport regulator | |
| 53 | DS483480.1 | GCA000154385_02984 | CDS | open | 63180-64007 | _na 275_aa | rhaD | rhamnulose-1-phosphate aldolase |
| 54 | DS483480.1 | GCA000154385_02985 | CDS | open | 64027-65286 | _na 419_aa | L-rhamnose isomerase | |
| 55 | DS483480.1 | GCA000154385_02986 | CDS | open | 65301-66605 | _na 434_aa | Sugar (Pentulose and hexulose) kinases | |
| 56 | DS483480.1 | GCA000154385_02987 | CDS | open | 66760-67635 | _na 291_aa | AraC-type DNA-binding domain-containing proteins | |
| 57 | DS483480.1 | GCA000154385_02988 | CDS | open | 67675-68190 | _na 171_aa | C_GCAxxG_C_C family protein | |
| 58 | DS483480.1 | GCA000154385_02931 | gene | open | 67-486 | |||
| 59 | DS483480.1 | GCA000154385_02932 | gene | open | 506-817 | ybjQ | ||
| 60 | DS483480.1 | GCA000154385_02940 | gene | open | 6856-8244 | xerC | ||
| 61 | DS483480.1 | GCA000154385_02941 | gene | open | 8260-8574 | |||
| 62 | DS483480.1 | GCA000154385_02942 | gene | open | 8617-9882 | |||
| 63 | DS483480.1 | GCA000154385_02943 | gene | open | 10337-11653 | |||
| 64 | DS483480.1 | GCA000154385_02944 | gene | open | 11727-12329 | |||
| 65 | DS483480.1 | GCA000154385_02945 | gene | open | 12583-13413 | hipB | ||
| 66 | DS483480.1 | GCA000154385_02946 | gene | open | 13397-14062 | rpoD | ||
| 67 | DS483480.1 | GCA000154385_02947 | gene | open | 14768-15742 | |||
| 68 | DS483480.1 | GCA000154385_02948 | gene | open | 16755-17111 | |||
| 69 | DS483480.1 | GCA000154385_02949 | gene | open | 17195-17443 | |||
| 70 | DS483480.1 | GCA000154385_02950 | gene | open | 17870-18562 | |||
| 71 | DS483480.1 | GCA000154385_02951 | gene | open | 18766-19518 | |||
| 72 | DS483480.1 | GCA000154385_02952 | gene | open | 19632-20966 | |||
| 73 | DS483480.1 | GCA000154385_02953 | gene | open | 21076-21726 | lysR | ||
| 74 | DS483480.1 | GCA000154385_02954 | gene | open | 21917-23320 | |||
| 75 | DS483480.1 | GCA000154385_02955 | gene | open | 23322-24116 | |||
| 76 | DS483480.1 | GCA000154385_02956 | gene | open | 24128-25924 | |||
| 77 | DS483480.1 | GCA000154385_02957 | gene | open | 25939-27201 | |||
| 78 | DS483480.1 | GCA000154385_02958 | gene | open | 27176-28993 | ypdA | ||
| 79 | DS483480.1 | GCA000154385_02959 | gene | open | 29338-30657 | |||
| 80 | DS483480.1 | GCA000154385_02960 | gene | open | 30835-31761 | lacF | ||
| 81 | DS483480.1 | GCA000154385_02961 | gene | open | 31778-32638 | |||
| 82 | DS483480.1 | GCA000154385_02962 | gene | open | 32712-33110 | |||
| 83 | DS483480.1 | GCA000154385_02963 | gene | open | 33141-34508 | |||
| 84 | DS483480.1 | GCA000154385_02964 | gene | open | 34511-35674 | |||
| 85 | DS483480.1 | GCA000154385_02965 | gene | open | 35674-37362 | |||
| 86 | DS483480.1 | GCA000154385_02966 | gene | open | 37459-40473 | |||
| 87 | DS483480.1 | GCA000154385_02967 | gene | open | 40478-40669 | |||
| 88 | DS483480.1 | GCA000154385_02968 | gene | open | 40825-41736 | |||
| 89 | DS483480.1 | GCA000154385_02969 | gene | open | 42077-43108 | dctP | ||
| 90 | DS483480.1 | GCA000154385_02970 | gene | open | 43127-43636 | |||
| 91 | DS483480.1 | GCA000154385_02971 | gene | open | 43657-44958 | dctM | ||
| 92 | DS483480.1 | GCA000154385_02972 | gene | open | 44983-46356 | |||
| 93 | DS483480.1 | GCA000154385_02973 | gene | open | 46449-47618 | |||
| 94 | DS483480.1 | GCA000154385_02974 | gene | open | 47901-50516 | |||
| 95 | DS483480.1 | GCA000154385_02975 | gene | open | 50627-51475 | |||
| 96 | DS483480.1 | GCA000154385_02976 | gene | open | 51479-53293 | |||
| 97 | DS483480.1 | GCA000154385_02977 | gene | open | 53300-55507 | |||
| 98 | DS483480.1 | GCA000154385_02978 | gene | open | 55589-57079 | |||
| 99 | DS483480.1 | GCA000154385_02979 | gene | open | 57315-58616 | |||
| 100 | DS483480.1 | GCA000154385_02980 | gene | open | 58671-59207 | |||
| 101 | DS483480.1 | GCA000154385_02981 | gene | open | 59412-60428 | |||
| 102 | DS483480.1 | GCA000154385_02982 | gene | open | 60502-61848 | norM | ||
| 103 | DS483480.1 | GCA000154385_02983 | gene | open | 61893-63092 | |||
| 104 | DS483480.1 | GCA000154385_02984 | gene | open | 63180-64007 | rhaD | ||
| 105 | DS483480.1 | GCA000154385_02985 | gene | open | 64027-65286 | |||
| 106 | DS483480.1 | GCA000154385_02986 | gene | open | 65301-66605 | |||
| 107 | DS483480.1 | GCA000154385_02987 | gene | open | 66760-67635 | |||
| 108 | DS483480.1 | GCA000154385_02988 | gene | open | 67675-68190 | |||
| 109 | DS483480.1 | GCA000154385_02934 | gene | open | 3093-3168 | trnA | ||
| 110 | DS483480.1 | GCA000154385_02935 | gene | open | 3172-3248 | trnI | ||
| 111 | DS483480.1 | GCA000154385_02938 | gene | open | 6540-6614 | trnE | ||
| 112 | DS483480.1 | GCA000154385_02939 | gene | open | 6618-6693 | trnK | ||
| 113 | DS483480.1 | GCA000154385_02934 | tRNA | open | 3093-3168 | trnA | tRNA-Ala(tgc) | |
| 114 | DS483480.1 | GCA000154385_02935 | tRNA | open | 3172-3248 | trnI | tRNA-Ile(gat) | |
| 115 | DS483480.1 | GCA000154385_02938 | tRNA | open | 6540-6614 | trnE | tRNA-Glu(ctc) | |
| 116 | DS483480.1 | GCA000154385_02939 | tRNA | open | 6618-6693 | trnK | tRNA-Lys(ctt) | |
| 117 | DS483481.1 | GCA000154385_02928 | CDS | open | 141-590 | _na 149_aa | tnpX | TnpX site-specific recombinase |
| 118 | DS483481.1 | GCA000154385_02929 | CDS | open | 701-889 | _na 62_aa | Chorismate synthase | |
| 119 | DS483481.1 | GCA000154385_02930 | CDS | open | 1122-1640 | _na 172_aa | Relaxase/mobilization nuclease domain protein | |
| 120 | DS483481.1 | GCA000154385_02928 | gene | open | 141-590 | tnpX | ||
| 121 | DS483481.1 | GCA000154385_02929 | gene | open | 701-889 | |||
| 122 | DS483481.1 | GCA000154385_02930 | gene | open | 1122-1640 | |||
| 123 | DS483482.1 | GCA000154385_02627 | gene | open | 88408-88524 | rrf | ||
| 124 | DS483482.1 | GCA000154385_02628 | gene | open | 88651-91484 | rrl | ||
| 125 | DS483482.1 | GCA000154385_02629 | gene | open | 91754-93264 | rrs | ||
| 126 | DS483482.1 | regulatory_region | open | 37174-37440 | T-box leader | |||
| 127 | DS483482.1 | regulatory_region | open | 76614-76722 | TPP riboswitch aptamer (THI element) | |||
| 128 | DS483482.1 | regulatory_region | open | 138079-138342 | T-box leader | |||
| 129 | DS483482.1 | regulatory_region | open | 151019-151133 | FMN riboswitch aptamer (RFN element) | |||
| 130 | DS483482.1 | regulatory_region | open | 220618-220875 | T-box leader | |||
| 131 | DS483482.1 | GCA000154385_02627 | rRNA | open | 88408-88524 | rrf | 5S ribosomal RNA | |
| 132 | DS483482.1 | GCA000154385_02628 | rRNA | open | 88651-91484 | rrl | 23S ribosomal RNA | |
| 133 | DS483482.1 | GCA000154385_02629 | rRNA | open | 91754-93264 | rrs | 16S ribosomal RNA | |
| 134 | DS483482.1 | repeat_region | open | 255790-256011 | CRISPR array with 4 repeats of length 29%2C consensus sequence GGATCACCCCCGCGTATGCGGGGAAAAGG and spacer length 32 | |||
| 135 | DS483482.1 | GCA000154385_02546 | CDS | open | 47-901 | _na 284_aa | Ricin-type beta-trefoil lectin domain | |
| 136 | DS483482.1 | GCA000154385_02547 | CDS | open | 1181-2569 | _na 462_aa | mepA | Multidrug export protein MepA |
| 137 | DS483482.1 | GCA000154385_02548 | CDS | open | 2691-4319 | _na 542_aa | DUF5046 domain-containing protein | |
| 138 | DS483482.1 | GCA000154385_02549 | CDS | open | 4337-5341 | _na 334_aa | Tat pathway signal sequence domain protein | |
| 139 | DS483482.1 | GCA000154385_02550 | CDS | open | 5429-5959 | _na 176_aa | Transporter | |
| 140 | DS483482.1 | GCA000154385_02551 | CDS | open | 6029-6688 | _na 219_aa | plsY | glycerol-3-phosphate 1-O-acyltransferase PlsY |
| 141 | DS483482.1 | GCA000154385_02552 | CDS | open | 6710-8053 | _na 447_aa | der | ribosome biogenesis GTPase Der |
| 142 | DS483482.1 | GCA000154385_02553 | CDS | open | 8104-9441 | _na 445_aa | Fe-S oxidoreductase%2C related to NifB/MoaA family | |
| 143 | DS483482.1 | GCA000154385_02554 | CDS | open | 9534-9713 | _na 59_aa | rpmF | 50S ribosomal protein L32 |
| 144 | DS483482.1 | GCA000154385_02555 | CDS | open | 9737-10240 | _na 167_aa | putative metal-binding%2C possibly nucleic acid-binding protein | |
| 145 | DS483482.1 | GCA000154385_02556 | CDS | open | 10386-10790 | _na 134_aa | pilT | Twitching motility protein PilT |
| 146 | DS483482.1 | GCA000154385_02557 | CDS | open | 10853-12184 | _na 443_aa | pgi | glucose-6-phosphate isomerase |
| 147 | DS483482.1 | GCA000154385_02558 | CDS | open | 12410-13642 | _na 410_aa | serine-type D-Ala-D-Ala carboxypeptidase | |
| 148 | DS483482.1 | GCA000154385_02559 | CDS | open | 13808-15103 | _na 431_aa | mtaB | tRNA (N(6)-L-threonylcarbamoyladenosine(37)-C(2))-methylthiotransferase MtaB |
| 149 | DS483482.1 | GCA000154385_02560 | CDS | open | 15349-16902 | _na 517_aa | nar1 | Iron hydrogenase 1 |
| 150 | DS483482.1 | GCA000154385_02561 | CDS | open | 17444-17917 | _na 157_aa | Pilin | |
| 151 | DS483482.1 | GCA000154385_02562 | CDS | open | 17968-18174 | _na 68_aa | ytxH | YtxH domain-containing protein |
| 152 | DS483482.1 | GCA000154385_02563 | CDS | open | 18339-19187 | _na 282_aa | pyridoxal kinase | |
| 153 | DS483482.1 | GCA000154385_02564 | CDS | open | 19184-19690 | _na 168_aa | trmL | Putative tRNA (cytidine(34)-2'-O)-methyltransferase |
| 154 | DS483482.1 | GCA000154385_02565 | CDS | open | 19699-20571 | _na 290_aa | degV | DegV family protein |
| 155 | DS483482.1 | GCA000154385_02566 | CDS | open | 20740-21675 | _na 311_aa | metA | homoserine O-succinyltransferase |
| 156 | DS483482.1 | GCA000154385_02567 | CDS | open | 21772-23046 | _na 424_aa | mET17 | Methionine gamma-lyase |
| 157 | DS483482.1 | GCA000154385_02568 | CDS | open | 23139-23795 | _na 218_aa | metP | D-methionine transport system permease protein metI |
| 158 | DS483482.1 | GCA000154385_02569 | CDS | open | 23792-24805 | _na 337_aa | abcC | ATP-binding cassette domain-containing protein |
| 159 | DS483482.1 | GCA000154385_02570 | CDS | open | 24842-25756 | _na 304_aa | 29 kDa protein | |
| 160 | DS483482.1 | GCA000154385_02571 | CDS | open | 26646-27437 | _na 263_aa | Threonine/serine exporter-like N-terminal domain-containing protein | |
| 161 | DS483482.1 | GCA000154385_02572 | CDS | open | 27434-27883 | _na 149_aa | thrE | Threonine/Serine exporter ThrE domain-containing protein |
| 162 | DS483482.1 | GCA000154385_02573 | CDS | open | 28092-28673 | _na 193_aa | TAT (Twin-arginine translocation) pathway signal sequence | |
| 163 | DS483482.1 | GCA000154385_02574 | CDS | open | 28955-29530 | _na 191_aa | Nitroreductase | |
| 164 | DS483482.1 | GCA000154385_02575 | CDS | open | 29739-30575 | _na 278_aa | ABC transporter substrate-binding protein | |
| 165 | DS483482.1 | GCA000154385_02576 | CDS | open | 30688-31452 | _na 254_aa | hisM | Amino acid ABC transporter permease |
| 166 | DS483482.1 | GCA000154385_02577 | CDS | open | 31442-32206 | _na 254_aa | artM | Arginine transport ATP-binding protein ArtM |
| 167 | DS483482.1 | GCA000154385_02578 | CDS | open | 32282-33355 | _na 357_aa | leuB | 3-isopropylmalate dehydrogenase |
| 168 | DS483482.1 | GCA000154385_02579 | CDS | open | 33529-34011 | _na 160_aa | leuD | 3-isopropylmalate dehydratase small subunit |
| 169 | DS483482.1 | GCA000154385_02580 | CDS | open | 34030-35289 | _na 419_aa | leuC | 3-isopropylmalate dehydratase large subunit |
| 170 | DS483482.1 | GCA000154385_02581 | CDS | open | 35306-36958 | _na 550_aa | leuA | 2-isopropylmalate synthase |
| 171 | DS483482.1 | GCA000154385_02582 | CDS | open | 37760-39610 | _na 616_aa | ftsH | ATP-dependent zinc metalloprotease FtsH |
| 172 | DS483482.1 | GCA000154385_02583 | CDS | open | 39784-40398 | _na 204_aa | iclR | Transcriptional regulator%2C IclR family protein |
| 173 | DS483482.1 | GCA000154385_02584 | CDS | open | 40577-41866 | _na 429_aa | mET17 | Methionine gamma-lyase |
| 174 | DS483482.1 | GCA000154385_02585 | CDS | open | 42391-43647 | _na 418_aa | Permeases of the major facilitator superfamily | |
| 175 | DS483482.1 | GCA000154385_02586 | CDS | open | 43691-44488 | _na 265_aa | Phospholipase C/D domain-containing protein | |
| 176 | DS483482.1 | GCA000154385_02587 | CDS | open | 44715-45749 | _na 344_aa | Glycerol-3-phosphate dehydrogenase [NAD(P)+] | |
| 177 | DS483482.1 | GCA000154385_02588 | CDS | open | 46111-46794 | _na 227_aa | hisM | L-cystine transport system permease protein tcyB |
| 178 | DS483482.1 | GCA000154385_02589 | CDS | open | 46813-47613 | _na 266_aa | Amino acid ABC transporter ATP-binding protein%2C PAAT family (TC 3-A1-3-) | |
| 179 | DS483482.1 | GCA000154385_02590 | CDS | open | 47663-48490 | _na 275_aa | Amino acid ABC transporter substrate-binding protein%2C PAAT family (TC 3-A1-3-) | |
| 180 | DS483482.1 | GCA000154385_02591 | CDS | open | 48711-49028 | _na 105_aa | Lineage-specific thermal regulator protein | |
| 181 | DS483482.1 | GCA000154385_02592 | CDS | open | 49032-50138 | _na 368_aa | DUF4097 domain-containing protein | |
| 182 | DS483482.1 | GCA000154385_02593 | CDS | open | 50200-52053 | _na 617_aa | uvrC | excinuclease ABC subunit UvrC |
| 183 | DS483482.1 | GCA000154385_02594 | CDS | open | 52180-52443 | _na 87_aa | ptsH | Phosphocarrier protein HPr |
| 184 | DS483482.1 | GCA000154385_02595 | CDS | open | 52725-53972 | _na 415_aa | trmD | tRNA (guanosine(37)-N1)-methyltransferase TrmD |
| 185 | DS483482.1 | GCA000154385_02596 | CDS | open | 53976-54512 | _na 178_aa | rimM | Ribosome maturation factor RimM |
| 186 | DS483482.1 | GCA000154385_02597 | CDS | open | 54741-54974 | _na 77_aa | ylqC | RNA-binding protein KhpA |
| 187 | DS483482.1 | GCA000154385_02598 | CDS | open | 54992-55234 | _na 80_aa | rpsP | 30S ribosomal protein S16 |
| 188 | DS483482.1 | GCA000154385_02599 | CDS | open | 55304-56659 | _na 451_aa | ffh | signal recognition particle protein |
| 189 | DS483482.1 | GCA000154385_02600 | CDS | open | 56686-57069 | _na 127_aa | UPF0122 protein C4N21_06030 | |
| 190 | DS483482.1 | GCA000154385_02601 | CDS | open | 57296-58207 | _na 303_aa | Cysteine synthase | |
| 191 | DS483482.1 | GCA000154385_02602 | CDS | open | 58245-59573 | _na 442_aa | norM | putative multidrug resistance protein NorM |
| 192 | DS483482.1 | GCA000154385_02603 | CDS | open | 59768-60394 | _na 208_aa | upp | uracil phosphoribosyltransferase |
| 193 | DS483482.1 | GCA000154385_02604 | CDS | open | 60535-60981 | _na 148_aa | rpiB | ribose 5-phosphate isomerase B |
| 194 | DS483482.1 | GCA000154385_02605 | CDS | open | 61023-61733 | _na 236_aa | tsaB | tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB |
| 195 | DS483482.1 | GCA000154385_02606 | CDS | open | 61730-62155 | _na 141_aa | tsaE | tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE |
| 196 | DS483482.1 | GCA000154385_02607 | CDS | open | 62241-63452 | _na 403_aa | Gingipain domain-containing protein | |
| 197 | DS483482.1 | GCA000154385_02608 | CDS | open | 63699-64916 | _na 405_aa | Cell division protein | |
| 198 | DS483482.1 | GCA000154385_02609 | CDS | open | 65081-65665 | _na 194_aa | fbpC | Fe(3+) ions import ATP-binding protein FbpC |
| 199 | DS483482.1 | GCA000154385_02610 | CDS | open | 65659-66429 | _na 256_aa | Nitrate ABC transporter permease | |
| 200 | DS483482.1 | GCA000154385_02611 | CDS | open | 66641-67921 | _na 426_aa | brnQ | branched-chain amino acid transport system II carrier protein |
| 201 | DS483482.1 | GCA000154385_02612 | CDS | open | 67936-68346 | _na 136_aa | peptide deformylase | |
| 202 | DS483482.1 | GCA000154385_02613 | CDS | open | 68724-69590 | _na 288_aa | ugpE | Inner membrane ABC transporter permease protein ycjP |
| 203 | DS483482.1 | GCA000154385_02614 | CDS | open | 69593-70570 | _na 325_aa | ugpA | sn-glycerol-3-phosphate transport system permease protein ugpA |
| 204 | DS483482.1 | GCA000154385_02615 | CDS | open | 70668-72110 | _na 480_aa | ugpB | ABC transporter substrate-binding protein |
| 205 | DS483482.1 | GCA000154385_02616 | CDS | open | 72189-73196 | _na 335_aa | Ribose operon repressor | |
| 206 | DS483482.1 | GCA000154385_02617 | CDS | open | 73725-76160 | _na 811_aa | Cellobiose phosphorylase | |
| 207 | DS483482.1 | GCA000154385_02618 | CDS | open | 76986-77501 | _na 171_aa | thiW | energy coupling factor transporter S component ThiW |
| 208 | DS483482.1 | GCA000154385_02619 | CDS | open | 77517-78338 | _na 273_aa | thiM | hydroxyethylthiazole kinase |
| 209 | DS483482.1 | GCA000154385_02620 | CDS | open | 78325-78963 | _na 212_aa | Thiamine-phosphate synthase | |
| 210 | DS483482.1 | GCA000154385_02621 | CDS | open | 79296-80606 | _na 436_aa | thiC | phosphomethylpyrimidine synthase ThiC |
| 211 | DS483482.1 | GCA000154385_02622 | CDS | open | 80865-82250 | _na 461_aa | Amino acid carrier protein | |
| 212 | DS483482.1 | GCA000154385_02623 | CDS | open | 82317-85025 | _na 902_aa | ompA | Cell envelope biogenesis protein OmpA |
| 213 | DS483482.1 | GCA000154385_02624 | CDS | open | 85068-85874 | _na 268_aa | rlmB | 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB |
| 214 | DS483482.1 | GCA000154385_02625 | CDS | open | 86665-87528 | _na 287_aa | fba | class II fructose-1%2C6-bisphosphate aldolase |
| 215 | DS483482.1 | GCA000154385_02626 | CDS | open | 87616-88296 | _na 226_aa | DUF1287 domain-containing protein | |
| 216 | DS483482.1 | GCA000154385_02630 | CDS | open | 93870-94778 | _na 302_aa | CAAX amino terminal protease self-immunity | |
| 217 | DS483482.1 | GCA000154385_02631 | CDS | open | 94775-95086 | _na 103_aa | ybjQ | UPF0145 protein CRH10_05070 |
| 218 | DS483482.1 | GCA000154385_02632 | CDS | open | 95067-95720 | _na 217_aa | Copper export regulator | |
| 219 | DS483482.1 | GCA000154385_02633 | CDS | open | 95829-97016 | _na 395_aa | srmB | ATP-dependent helicase |
| 220 | DS483482.1 | GCA000154385_02634 | CDS | open | 97147-97449 | _na 100_aa | hupA | DNA-binding protein HU |
| 221 | DS483482.1 | GCA000154385_02635 | CDS | open | 97665-100916 | _na 1083_aa | carB | carbamoyl-phosphate synthase large subunit |
| 222 | DS483482.1 | GCA000154385_02636 | CDS | open | 100918-102024 | _na 368_aa | carA | carbamoyl phosphate synthase small subunit |
| 223 | DS483482.1 | GCA000154385_02637 | CDS | open | 102056-102649 | _na 197_aa | pyrE | orotate phosphoribosyltransferase |
| 224 | DS483482.1 | GCA000154385_02638 | CDS | open | 102787-103713 | _na 308_aa | pyrD | dihydroorotate dehydrogenase |
| 225 | DS483482.1 | GCA000154385_02639 | CDS | open | 103713-104486 | _na 257_aa | dihydroorotate dehydrogenase electron transfer subunit | |
| 226 | DS483482.1 | GCA000154385_02640 | CDS | open | 104467-105333 | _na 288_aa | pyrF | orotidine-5'-phosphate decarboxylase |
| 227 | DS483482.1 | GCA000154385_02641 | CDS | open | 105509-106699 | _na 396_aa | allB | Dihydroorotase |
| 228 | DS483482.1 | GCA000154385_02642 | CDS | open | 106785-106874 | _na 29_aa | hypothetical protein | |
| 229 | DS483482.1 | GCA000154385_02643 | CDS | open | 107168-107839 | _na 223_aa | epsC | serine O-acetyltransferase EpsC |
| 230 | DS483482.1 | GCA000154385_02644 | CDS | open | 107915-110290 | _na 791_aa | Stage 0 sporulation A-like protein | |
| 231 | DS483482.1 | GCA000154385_02645 | CDS | open | 110739-111296 | _na 185_aa | Chromosome segregation protein SMC | |
| 232 | DS483482.1 | GCA000154385_02646 | CDS | open | 111376-112551 | _na 391_aa | ftsZ | cell division protein FtsZ |
| 233 | DS483482.1 | GCA000154385_02647 | CDS | open | 112638-113969 | _na 443_aa | UDP-N-acetylglucosamine 1-carboxyvinyltransferase | |
| 234 | DS483482.1 | GCA000154385_02648 | CDS | open | 114149-115279 | _na 376_aa | ftsW | putative peptidoglycan glycosyltransferase FtsW |
| 235 | DS483482.1 | GCA000154385_02649 | CDS | open | 115381-117264 | _na 627_aa | Cell division protein FtsI/penicillin-binding protein 2 | |
| 236 | DS483482.1 | GCA000154385_02650 | CDS | open | 117805-118398 | _na 197_aa | apt | xanthine phosphoribosyltransferase |
| 237 | DS483482.1 | GCA000154385_02651 | CDS | open | 118765-119634 | _na 289_aa | Phospholipase%2C patatin family | |
| 238 | DS483482.1 | GCA000154385_02652 | CDS | open | 119819-120193 | _na 124_aa | rplL | 50S ribosomal protein L7/L12 |
| 239 | DS483482.1 | GCA000154385_02653 | CDS | open | 120264-120779 | _na 171_aa | rplJ | 50S ribosomal protein L10 |
| 240 | DS483482.1 | GCA000154385_02654 | CDS | open | 121054-121746 | _na 230_aa | rplA | 50S ribosomal protein L1 |
| 241 | DS483482.1 | GCA000154385_02655 | CDS | open | 121804-122229 | _na 141_aa | rplK | 50S ribosomal protein L11 |
| 242 | DS483482.1 | GCA000154385_02656 | CDS | open | 122366-122917 | _na 183_aa | nusG | transcription termination/antitermination protein NusG |
| 243 | DS483482.1 | GCA000154385_02657 | CDS | open | 122948-123199 | _na 83_aa | secE | preprotein translocase subunit SecE |
| 244 | DS483482.1 | GCA000154385_02658 | CDS | open | 123217-123366 | _na 49_aa | rpmG | 50S ribosomal protein L33 |
| 245 | DS483482.1 | GCA000154385_02659 | CDS | open | 123676-124770 | _na 364_aa | D-alanine--D-alanine ligase | |
| 246 | DS483482.1 | GCA000154385_02660 | CDS | open | 124763-125587 | _na 274_aa | murI | glutamate racemase |
| 247 | DS483482.1 | GCA000154385_02661 | CDS | open | 125602-126078 | _na 158_aa | DUF1934 domain-containing protein | |
| 248 | DS483482.1 | GCA000154385_02662 | CDS | open | 126114-127928 | _na 604_aa | argS | arginine--tRNA ligase |
| 249 | DS483482.1 | GCA000154385_02663 | CDS | open | 128005-129024 | _na 339_aa | tRNA-dihydrouridine synthase | |
| 250 | DS483482.1 | GCA000154385_02664 | CDS | open | 129083-129670 | _na 195_aa | yfbR | 5'-deoxynucleotidase |
| 251 | DS483482.1 | GCA000154385_02665 | CDS | open | 129809-132211 | _na 800_aa | yfhO | YfhO family protein |
| 252 | DS483482.1 | GCA000154385_02666 | CDS | open | 132637-133737 | _na 366_aa | ABC-type putative transport system%2C periplasmic component | |
| 253 | DS483482.1 | GCA000154385_02667 | CDS | open | 133902-134846 | _na 314_aa | ABC transporter permease | |
| 254 | DS483482.1 | GCA000154385_02668 | CDS | open | 134848-135666 | _na 272_aa | ABC transporter ATP-binding protein | |
| 255 | DS483482.1 | GCA000154385_02669 | CDS | open | 135690-136460 | _na 256_aa | Cof-type HAD-IIB family hydrolase | |
| 256 | DS483482.1 | GCA000154385_02670 | CDS | open | 136556-137215 | _na 219_aa | gntR | putative HTH-type transcriptional regulator ydfH |
| 257 | DS483482.1 | GCA000154385_02671 | CDS | open | 137580-138065 | _na 161_aa | fur | Fe2+/Zn2+ uptake regulation protein |
| 258 | DS483482.1 | GCA000154385_02672 | CDS | open | 138395-139981 | _na 528_aa | asnB | asparagine synthase B |
| 259 | DS483482.1 | GCA000154385_02673 | CDS | open | 140142-142226 | _na 694_aa | fusA | elongation factor G |
| 260 | DS483482.1 | GCA000154385_02674 | CDS | open | 142623-142724 | _na 33_aa | hypothetical protein | |
| 261 | DS483482.1 | GCA000154385_02675 | CDS | open | 142885-143364 | _na 159_aa | Cytidine deaminase | |
| 262 | DS483482.1 | GCA000154385_02676 | CDS | open | 143458-144453 | _na 331_aa | argF | ornithine carbamoyltransferase |
| 263 | DS483482.1 | GCA000154385_02677 | CDS | open | 144524-145093 | _na 189_aa | Biotin transporter | |
| 264 | DS483482.1 | GCA000154385_02678 | CDS | open | 145392-145529 | _na 45_aa | Holin-like toxin | |
| 265 | DS483482.1 | GCA000154385_02679 | CDS | open | 145658-146230 | _na 190_aa | sseB | SseB protein N-terminal domain-containing protein |
| 266 | DS483482.1 | GCA000154385_02680 | CDS | open | 146492-146986 | _na 164_aa | RNA polymerase sigma factor | |
| 267 | DS483482.1 | GCA000154385_02681 | CDS | open | 146973-148127 | _na 384_aa | DUF4349 domain-containing protein | |
| 268 | DS483482.1 | GCA000154385_02682 | CDS | open | 148270-149124 | _na 284_aa | fabG | putative oxidoreductase HI_0048 |
| 269 | DS483482.1 | GCA000154385_02684 | CDS | open | 149872-150264 | _na 130_aa | HTH araC/xylS-type domain-containing protein | |
| 270 | DS483482.1 | GCA000154385_02685 | CDS | open | 150341-150814 | _na 157_aa | hypothetical protein | |
| 271 | DS483482.1 | GCA000154385_02686 | CDS | open | 151285-152409 | _na 374_aa | ribD | bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD |
| 272 | DS483482.1 | GCA000154385_02687 | CDS | open | 152373-153014 | _na 213_aa | riboflavin synthase | |
| 273 | DS483482.1 | GCA000154385_02688 | CDS | open | 153027-154223 | _na 398_aa | bifunctional 3%2C4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II | |
| 274 | DS483482.1 | GCA000154385_02689 | CDS | open | 154245-154721 | _na 158_aa | ribE | 6%2C7-dimethyl-8-ribityllumazine synthase |
| 275 | DS483482.1 | GCA000154385_02690 | CDS | open | 154742-155158 | _na 138_aa | yedW | putative transcriptional regulatory protein YedW |
| 276 | DS483482.1 | GCA000154385_02691 | CDS | open | 155155-155604 | _na 149_aa | protein-tyrosine-phosphatase | |
| 277 | DS483482.1 | GCA000154385_02692 | CDS | open | 156155-157390 | _na 411_aa | Transposase from transposon Tn916 | |
| 278 | DS483482.1 | GCA000154385_02693 | CDS | open | 157427-157597 | _na 56_aa | copG | CopG family transcriptional regulator |
| 279 | DS483482.1 | GCA000154385_02694 | CDS | open | 157819-158700 | _na 293_aa | DNA-binding protein | |
| 280 | DS483482.1 | GCA000154385_02695 | CDS | open | 158796-159005 | _na 69_aa | Transcriptional regulator | |
| 281 | DS483482.1 | GCA000154385_02696 | CDS | open | 159139-160452 | _na 437_aa | DNA primase | |
| 282 | DS483482.1 | GCA000154385_02697 | CDS | open | 161036-162481 | _na 481_aa | Serine/arginine repetitive matrix protein 2 | |
| 283 | DS483482.1 | GCA000154385_02698 | CDS | open | 163752-164780 | _na 342_aa | HNH endonuclease | |
| 284 | DS483482.1 | GCA000154385_02699 | CDS | open | 164929-166128 | _na 399_aa | zorC | Zorya protein ZorC EH domain-containing protein |
| 285 | DS483482.1 | GCA000154385_02700 | CDS | open | 166125-166865 | _na 246_aa | ompA | OmpA family protein |
| 286 | DS483482.1 | GCA000154385_02701 | CDS | open | 166862-168871 | _na 669_aa | MotA/TolQ/ExbB proton channel domain-containing protein | |
| 287 | DS483482.1 | GCA000154385_02702 | CDS | open | 168887-169822 | _na 311_aa | Fibronectin type-III domain-containing protein | |
| 288 | DS483482.1 | GCA000154385_02703 | CDS | open | 169886-171115 | _na 409_aa | Protein phosphatase 2C domain-containing protein | |
| 289 | DS483482.1 | GCA000154385_02704 | CDS | open | 171144-171929 | _na 261_aa | VWA domain-containing protein | |
| 290 | DS483482.1 | GCA000154385_02705 | CDS | open | 171949-173271 | _na 440_aa | Protein kinase domain-containing protein | |
| 291 | DS483482.1 | GCA000154385_02706 | CDS | open | 173294-173803 | _na 169_aa | GRAM domain-containing protein | |
| 292 | DS483482.1 | GCA000154385_02707 | CDS | open | 174396-174779 | _na 127_aa | tnpV | TnpV protein |
| 293 | DS483482.1 | GCA000154385_02708 | CDS | open | 174788-175015 | _na 75_aa | DNA-binding protein | |
| 294 | DS483482.1 | GCA000154385_02709 | CDS | open | 175012-175278 | _na 88_aa | DNA-binding protein | |
| 295 | DS483482.1 | GCA000154385_02710 | CDS | open | 175726-176958 | _na 410_aa | Transposase from transposon Tn916 | |
| 296 | DS483482.1 | GCA000154385_02711 | CDS | open | 177067-177354 | _na 95_aa | Helix-turn-helix domain-containing protein | |
| 297 | DS483482.1 | GCA000154385_02712 | CDS | open | 177432-178772 | _na 446_aa | Serine/arginine repetitive matrix protein 2 | |
| 298 | DS483482.1 | GCA000154385_02713 | CDS | open | 179261-180580 | _na 439_aa | Phage/plasmid primase%2C P4 family%2C C-terminal domain | |
| 299 | DS483482.1 | GCA000154385_02714 | CDS | open | 181087-181488 | _na 133_aa | Phosphotyrosine protein phosphatase I domain-containing protein | |
| 300 | DS483482.1 | GCA000154385_02715 | CDS | open | 181485-182531 | _na 348_aa | arsB | ACR3 family arsenite efflux transporter |
| 301 | DS483482.1 | GCA000154385_02716 | CDS | open | 182528-182881 | _na 117_aa | Thioredoxin family protein | |
| 302 | DS483482.1 | GCA000154385_02717 | CDS | open | 182897-183892 | _na 331_aa | Permease | |
| 303 | DS483482.1 | GCA000154385_02718 | CDS | open | 183892-184200 | _na 102_aa | HTH arsR-type domain-containing protein | |
| 304 | DS483482.1 | GCA000154385_02719 | CDS | open | 184502-186013 | _na 503_aa | lysS | lysine--tRNA ligase |
| 305 | DS483482.1 | GCA000154385_02720 | CDS | open | 186026-186511 | _na 161_aa | greA | transcription elongation factor GreA |
| 306 | DS483482.1 | GCA000154385_02721 | CDS | open | 186833-189145 | _na 770_aa | Bacterial repeat domain-containing protein | |
| 307 | DS483482.1 | GCA000154385_02722 | CDS | open | 189230-189868 | _na 212_aa | GDSL-like Lipase/Acylhydrolase | |
| 308 | DS483482.1 | GCA000154385_02723 | CDS | open | 189876-190805 | _na 309_aa | Glucokinase | |
| 309 | DS483482.1 | GCA000154385_02724 | CDS | open | 190824-191528 | _na 234_aa | nanE | Putative N-acetylmannosamine-6-phosphate 2-epimerase |
| 310 | DS483482.1 | GCA000154385_02725 | CDS | open | 191531-191980 | _na 149_aa | tabA | Toxin-antitoxin biofilm protein TabA |
| 311 | DS483482.1 | GCA000154385_02726 | CDS | open | 192054-192983 | _na 309_aa | dapA | N-acetylneuraminate lyase |
| 312 | DS483482.1 | GCA000154385_02727 | CDS | open | 193103-194074 | _na 323_aa | ugpE | Carbohydrate ABC transporter permease |
| 313 | DS483482.1 | GCA000154385_02728 | CDS | open | 194089-194985 | _na 298_aa | ugpA | Inner membrane ABC transporter permease protein ycjO |
| 314 | DS483482.1 | GCA000154385_02729 | CDS | open | 195117-196472 | _na 451_aa | ABC transporter substrate-binding protein | |
| 315 | DS483482.1 | GCA000154385_02730 | CDS | open | 196959-197804 | _na 281_aa | Als operon repressor | |
| 316 | DS483482.1 | GCA000154385_02731 | CDS | open | 197939-198643 | _na 234_aa | BAX inhibitor (BI)-1/YccA family protein | |
| 317 | DS483482.1 | GCA000154385_02732 | CDS | open | 198753-199835 | _na 360_aa | hemW | radical SAM family heme chaperone HemW |
| 318 | DS483482.1 | GCA000154385_02733 | CDS | open | 200276-201799 | _na 507_aa | spoIVCA | Site-specific DNA recombinase |
| 319 | DS483482.1 | GCA000154385_02734 | CDS | open | 201818-202114 | _na 98_aa | RelE/ParE family toxin | |
| 320 | DS483482.1 | GCA000154385_02735 | CDS | open | 202104-202385 | _na 93_aa | Antitoxin | |
| 321 | DS483482.1 | GCA000154385_02736 | CDS | open | 202449-203315 | _na 288_aa | Fido domain-containing protein | |
| 322 | DS483482.1 | GCA000154385_02737 | CDS | open | 203328-203648 | _na 106_aa | parE | Plasmid stabilisation system protein |
| 323 | DS483482.1 | GCA000154385_02738 | CDS | open | 203645-203950 | _na 101_aa | relB | Addiction module antitoxin%2C RelB/DinJ family |
| 324 | DS483482.1 | GCA000154385_02739 | CDS | open | 204159-204836 | _na 225_aa | HEPN domain-containing protein | |
| 325 | DS483482.1 | GCA000154385_02740 | CDS | open | 205248-205496 | _na 82_aa | PTS EIIB type-2 domain-containing protein | |
| 326 | DS483482.1 | GCA000154385_02741 | CDS | open | 205902-206258 | _na 118_aa | hypothetical protein | |
| 327 | DS483482.1 | GCA000154385_02742 | CDS | open | 206438-206707 | _na 89_aa | hypothetical protein | |
| 328 | DS483482.1 | GCA000154385_02743 | CDS | open | 208944-209636 | _na 230_aa | DUF4367 domain-containing protein | |
| 329 | DS483482.1 | GCA000154385_02744 | CDS | open | 209629-210159 | _na 176_aa | sigX | RNA polymerase sigma factor sigX |
| 330 | DS483482.1 | GCA000154385_02745 | CDS | open | 210224-210889 | _na 221_aa | rpoD | RNA polymerase sigma factor rpoD |
| 331 | DS483482.1 | GCA000154385_02746 | CDS | open | 210873-211193 | _na 106_aa | hypothetical protein | |
| 332 | DS483482.1 | GCA000154385_02747 | CDS | open | 211337-211702 | _na 121_aa | DNA-binding helix-turn-helix protein | |
| 333 | DS483482.1 | GCA000154385_02748 | CDS | open | 212375-213640 | _na 421_aa | Plasmid recombination enzyme | |
| 334 | DS483482.1 | GCA000154385_02749 | CDS | open | 213658-213834 | _na 58_aa | Transposase | |
| 335 | DS483482.1 | GCA000154385_02750 | CDS | open | 213933-214184 | _na 83_aa | DUF397 domain-containing protein | |
| 336 | DS483482.1 | GCA000154385_02752 | CDS | open | 214627-215298 | _na 223_aa | Putative colanic biosynthesis UDP-glucose lipid carrier transferase | |
| 337 | DS483482.1 | GCA000154385_02753 | CDS | open | 215345-217003 | _na 552_aa | ilvD | dihydroxy-acid dehydratase |
| 338 | DS483482.1 | GCA000154385_02754 | CDS | open | 217169-218188 | _na 339_aa | ilvC | ketol-acid reductoisomerase |
| 339 | DS483482.1 | GCA000154385_02755 | CDS | open | 218287-218850 | _na 187_aa | ilvN | acetolactate synthase small subunit |
| 340 | DS483482.1 | GCA000154385_02756 | CDS | open | 218866-220530 | _na 554_aa | ilvB | biosynthetic-type acetolactate synthase large subunit |
| 341 | DS483482.1 | GCA000154385_02757 | CDS | open | 221058-222275 | _na 405_aa | AAA+ ATPase domain-containing protein | |
| 342 | DS483482.1 | GCA000154385_02758 | CDS | open | 222365-222739 | _na 124_aa | Enamine/imine deaminase | |
| 343 | DS483482.1 | GCA000154385_02759 | CDS | open | 222811-224016 | _na 401_aa | ilvA | threonine ammonia-lyase |
| 344 | DS483482.1 | GCA000154385_02760 | CDS | open | 224161-225075 | _na 304_aa | TPM domain-containing protein | |
| 345 | DS483482.1 | GCA000154385_02761 | CDS | open | 225072-225830 | _na 252_aa | lemA | LemA |
| 346 | DS483482.1 | GCA000154385_02762 | CDS | open | 225832-226983 | _na 383_aa | yaaN | Toxic anion resistance protein TelA |
| 347 | DS483482.1 | GCA000154385_02763 | CDS | open | 227027-227656 | _na 209_aa | 5-bromo-4-chloroindolyl phosphate hydrolysis protein | |
| 348 | DS483482.1 | GCA000154385_02764 | CDS | open | 227760-228248 | _na 162_aa | DNA-deoxyinosine glycosylase | |
| 349 | DS483482.1 | GCA000154385_02765 | CDS | open | 228245-229138 | _na 297_aa | yidA | Phosphatase YidA |
| 350 | DS483482.1 | GCA000154385_02766 | CDS | open | 229277-230164 | _na 295_aa | Arsenic efflux protein | |
| 351 | DS483482.1 | GCA000154385_02767 | CDS | open | 230465-231235 | _na 256_aa | tcdA | Sulfur carrier protein ThiS adenylyltransferase |
| 352 | DS483482.1 | GCA000154385_02768 | CDS | open | 231246-232349 | _na 367_aa | mnmA | tRNA 2-thiouridine(34) synthase MnmA |
| 353 | DS483482.1 | GCA000154385_02769 | CDS | open | 232418-233752 | _na 444_aa | CCA tRNA nucleotidyltransferase | |
| 354 | DS483482.1 | GCA000154385_02770 | CDS | open | 233749-234687 | _na 312_aa | ribonuclease Z | |
| 355 | DS483482.1 | GCA000154385_02771 | CDS | open | 234801-234983 | _na 60_aa | hypothetical protein | |
| 356 | DS483482.1 | GCA000154385_02772 | CDS | open | 235068-236018 | _na 316_aa | pyrB | aspartate carbamoyltransferase |
| 357 | DS483482.1 | GCA000154385_02773 | CDS | open | 236015-237316 | _na 433_aa | adenylosuccinate synthase | |
| 358 | DS483482.1 | GCA000154385_02774 | CDS | open | 237577-238488 | _na 303_aa | Cys regulon transcriptional activator | |
| 359 | DS483482.1 | GCA000154385_02775 | CDS | open | 238634-239425 | _na 263_aa | putative membrane protein | |
| 360 | DS483482.1 | GCA000154385_02776 | CDS | open | 239608-240018 | _na 136_aa | putative conserved protein | |
| 361 | DS483482.1 | GCA000154385_02777 | CDS | open | 240486-241367 | _na 293_aa | Aldose 1-epimerase | |
| 362 | DS483482.1 | GCA000154385_02778 | CDS | open | 241411-241563 | _na 50_aa | hypothetical protein | |
| 363 | DS483482.1 | GCA000154385_02779 | CDS | open | 241640-243130 | _na 496_aa | D-galactarate dehydratase | |
| 364 | DS483482.1 | GCA000154385_02780 | CDS | open | 243215-244729 | _na 504_aa | mtlD | Altronate oxidoreductase |
| 365 | DS483482.1 | GCA000154385_02781 | CDS | open | 245051-246484 | _na 477_aa | uxaC | glucuronate isomerase |
| 366 | DS483482.1 | GCA000154385_02782 | CDS | open | 246731-247615 | _na 294_aa | DUF2179 domain-containing protein | |
| 367 | DS483482.1 | GCA000154385_02783 | CDS | open | 247802-249460 | _na 552_aa | glnS | glutamine--tRNA ligase/YqeY domain fusion protein |
| 368 | DS483482.1 | GCA000154385_02784 | CDS | open | 249488-249877 | _na 129_aa | putative protein conserved in bacteria | |
| 369 | DS483482.1 | GCA000154385_02785 | CDS | open | 249933-250925 | _na 330_aa | 4-phosphoerythronate dehydrogenase | |
| 370 | DS483482.1 | GCA000154385_02786 | CDS | open | 251067-251414 | _na 115_aa | Hpt domain protein | |
| 371 | DS483482.1 | GCA000154385_02788 | CDS | open | 252053-252742 | _na 229_aa | Vitamin B12 dependent methionine synthase%2C activation domain | |
| 372 | DS483482.1 | GCA000154385_02789 | CDS | open | 252729-255152 | _na 807_aa | Methionine synthase | |
| 373 | DS483482.1 | GCA000154385_02790 | CDS | open | 255142-255684 | _na 180_aa | hypothetical protein | |
| 374 | DS483482.1 | GCA000154385_02791 | CDS | open | 256037-256177 | _na 46_aa | hypothetical protein | |
| 375 | DS483482.1 | GCA000154385_02792 | CDS | open | 256188-256820 | _na 210_aa | cas6e | type I-E CRISPR-associated protein Cas6/Cse3/CasE |
| 376 | DS483482.1 | GCA000154385_02793 | CDS | open | 256836-257498 | _na 220_aa | cas5e | type I-E CRISPR-associated protein Cas5/CasD |
| 377 | DS483482.1 | GCA000154385_02794 | CDS | open | 257498-258556 | _na 352_aa | cas7e | type I-E CRISPR-associated protein Cas7/Cse4/CasC |
| 378 | DS483482.1 | GCA000154385_02795 | CDS | open | 258559-259173 | _na 204_aa | casB | type I-E CRISPR-associated protein Cse2/CasB |
| 379 | DS483482.1 | GCA000154385_02796 | CDS | open | 259186-260799 | _na 537_aa | casA | type I-E CRISPR-associated protein Cse1/CasA |
| 380 | DS483482.1 | GCA000154385_02797 | CDS | open | 260786-263500 | _na 904_aa | CRISPR-associated helicase Cas3 | |
| 381 | DS483482.1 | GCA000154385_02798 | CDS | open | 263881-264243 | _na 120_aa | XRE family transcriptional regulator | |
| 382 | DS483482.1 | GCA000154385_02799 | CDS | open | 264340-264981 | _na 213_aa | Type VII secretion system protein EssD-like domain-containing protein | |
| 383 | DS483482.1 | GCA000154385_02800 | CDS | open | 264978-268352 | _na 1124_aa | herA | Helicase HerA central domain-containing protein |
| 384 | DS483482.1 | GCA000154385_02801 | CDS | open | 268384-269529 | _na 381_aa | Sel1 repeat family protein | |
| 385 | DS483482.1 | GCA000154385_02802 | CDS | open | 269545-270489 | _na 314_aa | HTH deoR-type domain-containing protein | |
| 386 | DS483482.1 | GCA000154385_02803 | CDS | open | 270668-270832 | _na 54_aa | hypothetical protein | |
| 387 | DS483482.1 | GCA000154385_02804 | CDS | open | 271094-271519 | _na 141_aa | Plasmid pRiA4b Orf3-like domain-containing protein | |
| 388 | DS483482.1 | GCA000154385_02805 | CDS | open | 271543-272505 | _na 320_aa | Translation initiation factor 2 | |
| 389 | DS483482.1 | GCA000154385_02806 | CDS | open | 272520-272957 | _na 145_aa | DUF4869 domain-containing protein | |
| 390 | DS483482.1 | GCA000154385_02807 | CDS | open | 273203-274441 | _na 412_aa | jetD | Wadjet protein JetD C-terminal domain-containing protein |
| 391 | DS483482.1 | GCA000154385_02808 | CDS | open | 274401-277784 | _na 1127_aa | SMC hinge domain-containing protein | |
| 392 | DS483482.1 | GCA000154385_02809 | CDS | open | 277735-278382 | _na 215_aa | DUF4194 domain-containing protein | |
| 393 | DS483482.1 | GCA000154385_02810 | CDS | open | 278379-279779 | _na 466_aa | TIGR02677 family protein | |
| 394 | DS483482.1 | GCA000154385_02811 | CDS | open | 280012-280869 | _na 285_aa | DUF2179 domain-containing protein | |
| 395 | DS483482.1 | GCA000154385_02812 | CDS | open | 280862-282289 | _na 475_aa | 6-phospho-beta-glucosidase | |
| 396 | DS483482.1 | GCA000154385_02813 | CDS | open | 282346-283944 | _na 532_aa | PTS system sac EIIBC component | |
| 397 | DS483482.1 | GCA000154385_02814 | CDS | open | 284139-284966 | _na 275_aa | licT | Transcription antiterminator LicT |
| 398 | DS483482.1 | GCA000154385_02815 | CDS | open | 285442-286329 | _na 295_aa | Putative transposase%2C YhgA-like | |
| 399 | DS483482.1 | GCA000154385_02816 | CDS | open | 287533-288087 | _na 184_aa | hypothetical protein | |
| 400 | DS483482.1 | GCA000154385_02817 | CDS | open | 288392-288889 | _na 165_aa | Recombinase | |
| 401 | DS483482.1 | GCA000154385_02818 | CDS | open | 288859-289245 | _na 128_aa | tnpA | IS200/IS605 family transposase |
| 402 | DS483482.1 | GCA000154385_02819 | CDS | open | 289463-290908 | _na 481_aa | Glycosyl hydrolase%2C family 1 | |
| 403 | DS483482.1 | GCA000154385_02820 | CDS | open | 290892-291227 | _na 111_aa | PTS system%2C Lactose/Cellobiose specific IIA subunit | |
| 404 | DS483482.1 | GCA000154385_02821 | CDS | open | 291267-292535 | _na 422_aa | Permease IIC component | |
| 405 | DS483482.1 | GCA000154385_02822 | CDS | open | 292551-292868 | _na 105_aa | PTS system%2C Lactose/Cellobiose specific IIB subunit | |
| 406 | DS483482.1 | GCA000154385_02823 | CDS | open | 293099-294997 | _na 632_aa | PRD domain protein | |
| 407 | DS483482.1 | GCA000154385_02824 | CDS | open | 295188-295640 | _na 150_aa | marR | Transcriptional regulator%2C MarR family |
| 408 | DS483482.1 | GCA000154385_02825 | CDS | open | 295630-295806 | _na 58_aa | MATE family efflux transporter | |
| 409 | DS483482.1 | GCA000154385_02826 | CDS | open | 295846-296910 | _na 354_aa | norM | putative multidrug resistance protein NorM |
| 410 | DS483482.1 | GCA000154385_02827 | CDS | open | 297122-297331 | _na 69_aa | Transposase IS200-like domain-containing protein | |
| 411 | DS483482.1 | GCA000154385_02828 | CDS | open | 297612-297791 | _na 59_aa | hypothetical protein | |
| 412 | DS483482.1 | GCA000154385_02829 | CDS | open | 298274-299317 | _na 347_aa | Tetratricopeptide repeat protein | |
| 413 | DS483482.1 | GCA000154385_02830 | CDS | open | 299337-300668 | _na 443_aa | SIR2-like domain-containing protein | |
| 414 | DS483482.1 | GCA000154385_02831 | CDS | open | 301237-301515 | _na 92_aa | hypothetical protein | |
| 415 | DS483482.1 | GCA000154385_02832 | CDS | open | 302012-302296 | _na 94_aa | hypothetical protein | |
| 416 | DS483482.1 | GCA000154385_02833 | CDS | open | 302367-302504 | _na 45_aa | hypothetical protein | |
| 417 | DS483482.1 | GCA000154385_02834 | CDS | open | 302778-303314 | _na 178_aa | RloB-like protein | |
| 418 | DS483482.1 | GCA000154385_02835 | CDS | open | 303311-304516 | _na 401_aa | RecF/RecN/SMC N-terminal domain protein | |
| 419 | DS483482.1 | GCA000154385_02836 | CDS | open | 305074-306183 | _na 369_aa | Replication initiation factor | |
| 420 | DS483482.1 | GCA000154385_02837 | CDS | open | 306255-306431 | _na 58_aa | Excisionase family DNA-binding protein | |
| 421 | DS483482.1 | GCA000154385_02838 | CDS | open | 306562-308166 | _na 534_aa | FMN-binding protein | |
| 422 | DS483482.1 | GCA000154385_02839 | CDS | open | 308183-308368 | _na 61_aa | hypothetical protein | |
| 423 | DS483482.1 | GCA000154385_02840 | CDS | open | 308585-308917 | _na 110_aa | Helix-turn-helix | |
| 424 | DS483482.1 | GCA000154385_02841 | CDS | open | 308980-309120 | _na 46_aa | hypothetical protein | |
| 425 | DS483482.1 | GCA000154385_02842 | CDS | open | 309117-309833 | _na 238_aa | pinR | Serine recombinase PinR |
| 426 | DS483482.1 | GCA000154385_02843 | CDS | open | 309984-310337 | _na 117_aa | Large polyvalent protein associated domain-containing protein | |
| 427 | DS483482.1 | GCA000154385_02844 | CDS | open | 310353-310691 | _na 112_aa | DUF3846 domain-containing protein | |
| 428 | DS483482.1 | GCA000154385_02845 | CDS | open | 310704-311420 | _na 238_aa | DUF1071 domain-containing protein | |
| 429 | DS483482.1 | GCA000154385_02846 | CDS | open | 311481-312413 | _na 310_aa | Putative phage-type endonuclease | |
| 430 | DS483482.1 | GCA000154385_02847 | CDS | open | 312410-312748 | _na 112_aa | DUF3848 domain-containing protein | |
| 431 | DS483482.1 | GCA000154385_02848 | CDS | open | 312759-313694 | _na 311_aa | DUF945 domain-containing protein | |
| 432 | DS483482.1 | GCA000154385_02849 | CDS | open | 313724-313828 | _na 34_aa | Cyclic lactone autoinducer peptide | |
| 433 | DS483482.1 | GCA000154385_02850 | CDS | open | 314094-315833 | _na 579_aa | Transposon Tn3 resolvase | |
| 434 | DS483482.1 | GCA000154385_02851 | CDS | open | 315915-316055 | _na 46_aa | hypothetical protein | |
| 435 | DS483482.1 | GCA000154385_02852 | CDS | open | 316130-317845 | _na 571_aa | Phage/plasmid primase%2C P4 family domain protein | |
| 436 | DS483482.1 | GCA000154385_02853 | CDS | open | 318091-319167 | _na 358_aa | hypothetical protein | |
| 437 | DS483482.1 | GCA000154385_02854 | CDS | open | 319299-321965 | _na 888_aa | ppdK | pyruvate%2C phosphate dikinase |
| 438 | DS483482.1 | GCA000154385_02855 | CDS | open | 322383-323141 | _na 252_aa | UDP-N-acetylglucosamine diphosphorylase | |
| 439 | DS483482.1 | GCA000154385_02856 | CDS | open | 323166-323687 | _na 173_aa | DUF4878 domain-containing protein | |
| 440 | DS483482.1 | GCA000154385_02857 | CDS | open | 323821-324399 | _na 192_aa | pth | aminoacyl-tRNA hydrolase |
| 441 | DS483482.1 | GCA000154385_02858 | CDS | open | 324441-327956 | _na 1171_aa | mfd | transcription-repair coupling factor |
| 442 | DS483482.1 | GCA000154385_02859 | CDS | open | 327992-329110 | _na 372_aa | Foldase | |
| 443 | DS483482.1 | GCA000154385_02860 | CDS | open | 329259-330902 | _na 547_aa | MBL fold metallo-hydrolase | |
| 444 | DS483482.1 | GCA000154385_02861 | CDS | open | 331387-333156 | _na 589_aa | Beta-galactosidase large subunit | |
| 445 | DS483482.1 | GCA000154385_02862 | CDS | open | 333403-335322 | _na 639_aa | yheH | putative multidrug resistance ABC transporter ATP-binding/permease protein YheH |
| 446 | DS483482.1 | GCA000154385_02863 | CDS | open | 335322-337073 | _na 583_aa | Putative multidrug export ATP-binding/permease protein SAV1866 | |
| 447 | DS483482.1 | GCA000154385_02864 | CDS | open | 337214-337696 | _na 160_aa | marR | MarR family transcriptional regulator |
| 448 | DS483482.1 | GCA000154385_02865 | CDS | open | 337854-338723 | _na 289_aa | phosphoribosylaminoimidazolesuccinocarboxamide synthase | |
| 449 | DS483482.1 | GCA000154385_02866 | CDS | open | 339064-340503 | _na 479_aa | bglH | Aryl-phospho-beta-D-glucosidase BglH |
| 450 | DS483482.1 | GCA000154385_02867 | CDS | open | 340584-341630 | _na 348_aa | Glycerophosphoryl diester phosphodiesterase | |
| 451 | DS483482.1 | GCA000154385_02868 | CDS | open | 341704-342174 | _na 156_aa | fabZ | 3-hydroxyacyl-ACP dehydratase FabZ |
| 452 | DS483482.1 | GCA000154385_02869 | CDS | open | 342178-343416 | _na 412_aa | fabF | beta-ketoacyl-ACP synthase II |
| 453 | DS483482.1 | GCA000154385_02870 | CDS | open | 343429-344178 | _na 249_aa | fabG | 3-oxoacyl-[acyl-carrier-protein] reductase |
| 454 | DS483482.1 | GCA000154385_02871 | CDS | open | 344175-345107 | _na 310_aa | fabD | ACP S-malonyltransferase |
| 455 | DS483482.1 | GCA000154385_02872 | CDS | open | 345104-346171 | _na 355_aa | Oxidoreductase%2C 2-nitropropane dioxygenase family protein | |
| 456 | DS483482.1 | GCA000154385_02873 | CDS | open | 346165-347100 | _na 311_aa | Nitronate monooxygenase | |
| 457 | DS483482.1 | GCA000154385_02874 | CDS | open | 347106-348056 | _na 316_aa | Beta-ketoacyl-[acyl-carrier-protein] synthase III | |
| 458 | DS483482.1 | GCA000154385_02875 | CDS | open | 348053-349012 | _na 319_aa | acetyl-CoA carboxylase carboxyltransferase subunit alpha | |
| 459 | DS483482.1 | GCA000154385_02876 | CDS | open | 349027-349884 | _na 285_aa | accD | acetyl-CoA carboxylase%2C carboxyltransferase subunit beta |
| 460 | DS483482.1 | GCA000154385_02877 | CDS | open | 349906-350133 | _na 75_aa | acpP | acyl carrier protein |
| 461 | DS483482.1 | GCA000154385_02878 | CDS | open | 350376-351854 | _na 492_aa | murE | UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2%2C6-diaminopimelate ligase |
| 462 | DS483482.1 | GCA000154385_02879 | CDS | open | 351878-353431 | _na 517_aa | POTRA domain-containing protein | |
| 463 | DS483482.1 | GCA000154385_02880 | CDS | open | 353469-354596 | _na 375_aa | UDP-N-acetylglucosamine--N-acetylmuramyl-(pentapeptide) pyrophosphoryl-undecaprenol N-acetylglucosamine transferase | |
| 464 | DS483482.1 | GCA000154385_02881 | CDS | open | 354652-355965 | _na 437_aa | ftsW | putative peptidoglycan glycosyltransferase FtsW |
| 465 | DS483482.1 | GCA000154385_02882 | CDS | open | 355994-356989 | _na 331_aa | Phospho-N-acetylmuramoyl-pentapeptide-transferase | |
| 466 | DS483482.1 | GCA000154385_02883 | CDS | open | 357018-358400 | _na 460_aa | UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase | |
| 467 | DS483482.1 | GCA000154385_02884 | CDS | open | 358507-360903 | _na 798_aa | Cell division protein FtsI/penicillin-binding protein 2 | |
| 468 | DS483482.1 | GCA000154385_02885 | CDS | open | 361097-361576 | _na 159_aa | ftsL | Cell division protein FtsL |
| 469 | DS483482.1 | GCA000154385_02886 | CDS | open | 361616-362581 | _na 321_aa | rsmH | 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH |
| 470 | DS483482.1 | GCA000154385_02887 | CDS | open | 362618-363037 | _na 139_aa | mraZ | division/cell wall cluster transcriptional repressor MraZ |
| 471 | DS483482.1 | GCA000154385_02888 | CDS | open | 363266-363727 | _na 153_aa | ATPase | |
| 472 | DS483482.1 | GCA000154385_02889 | CDS | open | 363724-364299 | _na 191_aa | rsmD | 16S rRNA (guanine(966)-N(2))-methyltransferase RsmD |
| 473 | DS483482.1 | GCA000154385_02890 | CDS | open | 364488-365108 | _na 206_aa | Flavodoxin family protein | |
| 474 | DS483482.1 | GCA000154385_02891 | CDS | open | 365341-367740 | _na 799_aa | Beta-galactosidase | |
| 475 | DS483482.1 | GCA000154385_02892 | CDS | open | 367888-368283 | _na 131_aa | Zn-finger containing protein | |
| 476 | DS483482.1 | GCA000154385_02893 | CDS | open | 368290-369135 | _na 281_aa | DUF5685 domain-containing protein | |
| 477 | DS483482.1 | GCA000154385_02894 | CDS | open | 369223-369966 | _na 247_aa | dnaJ | Chaperone protein DnaJ |
| 478 | DS483482.1 | GCA000154385_02895 | CDS | open | 370043-370537 | _na 164_aa | Cytochrome C | |
| 479 | DS483482.1 | GCA000154385_02896 | CDS | open | 370882-371439 | _na 185_aa | Transcriptional regulator | |
| 480 | DS483482.1 | GCA000154385_02897 | CDS | open | 371634-372308 | _na 224_aa | Hydrolase | |
| 481 | DS483482.1 | GCA000154385_02898 | CDS | open | 372449-373123 | _na 224_aa | ydfH | putative HTH-type transcriptional regulator ydfH |
| 482 | DS483482.1 | GCA000154385_02899 | CDS | open | 373247-373888 | _na 213_aa | Phosphatidic acid phosphatase type 2/haloperoxidase domain-containing protein | |
| 483 | DS483482.1 | GCA000154385_02900 | CDS | open | 374013-374921 | _na 302_aa | Putative hydrolase M6_Spy0533 | |
| 484 | DS483482.1 | GCA000154385_02901 | CDS | open | 375159-376121 | _na 320_aa | eda | 2-dehydro-3-deoxy-phosphogluconate aldolase |
| 485 | DS483482.1 | GCA000154385_02902 | CDS | open | 376214-377239 | _na 341_aa | rbsK | 5-dehydro-2-deoxygluconokinase |
| 486 | DS483482.1 | GCA000154385_02903 | CDS | open | 377259-378107 | _na 282_aa | kduI | 5-dehydro-4-deoxy-D-glucuronate isomerase |
| 487 | DS483482.1 | GCA000154385_02904 | CDS | open | 378198-378998 | _na 266_aa | fabG | gluconate 5-dehydrogenase |
| 488 | DS483482.1 | GCA000154385_02905 | CDS | open | 379166-380455 | _na 429_aa | corB | Putative Mg2+ and Co2+ transporter CorB |
| 489 | DS483482.1 | GCA000154385_02906 | CDS | open | 380700-383312 | _na 870_aa | clpB | ATP-dependent chaperone ClpB |
| 490 | DS483482.1 | GCA000154385_02907 | CDS | open | 384150-384548 | _na 132_aa | rpsI | 30S ribosomal protein S9 |
| 491 | DS483482.1 | GCA000154385_02908 | CDS | open | 384566-384994 | _na 142_aa | rplM | 50S ribosomal protein L13 |
| 492 | DS483482.1 | GCA000154385_02909 | CDS | open | 385308-385877 | _na 189_aa | DUF1795 domain-containing protein | |
| 493 | DS483482.1 | GCA000154385_02910 | CDS | open | 385874-386674 | _na 266_aa | ttcA | tRNA 2-thiocytidine biosynthesis protein TtcA |
| 494 | DS483482.1 | GCA000154385_02911 | CDS | open | 386655-387857 | _na 400_aa | alr | alanine racemase |
| 495 | DS483482.1 | GCA000154385_02912 | CDS | open | 387877-389688 | _na 603_aa | lepA | translation elongation factor 4 |
| 496 | DS483482.1 | GCA000154385_02913 | CDS | open | 389863-390849 | _na 328_aa | Ser/Thr phosphatase family protein | |
| 497 | DS483482.1 | GCA000154385_02914 | CDS | open | 390896-392194 | _na 432_aa | Chain-length determining protein | |
| 498 | DS483482.1 | GCA000154385_02915 | CDS | open | 392191-394029 | _na 612_aa | Diguanylate cyclase (GGDEF) domain protein | |
| 499 | DS483482.1 | GCA000154385_02916 | CDS | open | 394026-395225 | _na 399_aa | Glycosyltransferase%2C group 2 family protein | |
| 500 | DS483482.1 | GCA000154385_02917 | CDS | open | 395240-396352 | _na 370_aa | GDP-mannose-dependent alpha-(1-6)-phosphatidylinositol monomannoside mannosyltransferase |

