HOMD Banner
Taxonomy: V4.3   |  16S rRNA RefSeq: V16.03   |  Genomic RefSeq: V11.03   |  Viruses: V1.2

BAKTAGenome Explorer: Fusobacterium necrophorum (GCA_000292975.1)

Select a Genome:
BAKTA Annotations for GCA_000292975.1
Genome Selected: Fusobacterium necrophorum
ContigsBases CDSrRNA tmRNAtRNA
87 2166823 2090 3 1 32
[Table]   [AA Fasta]      [Browser]   [Text]   [Excel]  
Search & Sort all 4273 Records
Search These Records: Clear
Sort Column:   Molecule   PID   NA   AA   Gene  Gene Product  Reverse
Annotation Table [page:1]    |    Number of Records Found: 4273 [9 Pages]    |    Previous Page <==> Next Page    |    Jump to Page: [ 1  2  3  4  5  6  7  8  9  ]
Notes:   1- Column headers only sort the current page. 2- Select [NA] or [AA] links to show sequences.
Region Protein-ID Type Genome
Viewer
Range
(bp)
Show Sequences
(length) NA / AA
BAKTA
Gene
BAKTA
GeneProduct
1 ALKK01000001.1 GCA000292975_00001 CDS open 217-885 _na     222_aa Terminase
2 ALKK01000001.1 GCA000292975_00002 CDS open 1012-1455 _na     147_aa Terminase
3 ALKK01000001.1 GCA000292975_00003 CDS open 1442-3214 _na     590_aa Phage terminase large subunit family protein
4 ALKK01000001.1 GCA000292975_00004 CDS open 3211-3429 _na     72_aa head-tail adaptor
5 ALKK01000001.1 GCA000292975_00005 CDS open 3439-4980 _na     513_aa phage portal protein
6 ALKK01000001.1 GCA000292975_00006 CDS open 4967-6082 _na     371_aa ATP-dependent Clp protease proteolytic subunit
7 ALKK01000001.1 GCA000292975_00007 CDS open 6100-6420 _na     106_aa Phage protein
8 ALKK01000001.1 GCA000292975_00008 CDS open 6433-7440 _na     335_aa Phage capsid protein
9 ALKK01000001.1 GCA000292975_00009 CDS open 7482-7700 _na     72_aa Phage protein
10 ALKK01000001.1 GCA000292975_00010 CDS open 7697-8011 _na     104_aa minor tail protein
11 ALKK01000001.1 GCA000292975_00011 CDS open 8011-8601 _na     196_aa Phage tail protein
12 ALKK01000001.1 GCA000292975_00012 CDS open 8598-9065 _na     155_aa Antigen B
13 ALKK01000001.1 GCA000292975_00013 CDS open 9052-9321 _na     89_aa hypothetical protein
14 ALKK01000001.1 GCA000292975_00014 CDS open 9322-10722 _na     466_aa Phage tail sheath family protein
15 ALKK01000001.1 GCA000292975_00015 CDS open 10732-11265 _na     177_aa Tail tube protein
16 ALKK01000001.1 GCA000292975_00016 CDS open 11275-11610 _na     111_aa Phage tail assembly protein
17 ALKK01000001.1 GCA000292975_00017 CDS open 11785-12048 _na     87_aa hypothetical protein
18 ALKK01000001.1 GCA000292975_00018 CDS open 12116-14701 _na     861_aa Phage tail tape measure protein
19 ALKK01000001.1 GCA000292975_00019 CDS open 14691-14900 _na     69_aa Phage tail protein
20 ALKK01000001.1 GCA000292975_00020 CDS open 14903-15979 _na     358_aa Late control protein D
21 ALKK01000001.1 GCA000292975_00021 CDS open 15979-16494 _na     171_aa Phage baseplate assembly protein V
22 ALKK01000001.1 GCA000292975_00022 CDS open 16496-16882 _na     128_aa Phage tail protein
23 ALKK01000001.1 GCA000292975_00023 CDS open 16882-17193 _na     103_aa Asp23/Gls24 family envelope stress response protein
24 ALKK01000001.1 GCA000292975_00024 CDS open 17190-18290 _na     366_aa Baseplate J protein
25 ALKK01000001.1 GCA000292975_00025 CDS open 18283-18846 _na     187_aa phage tail protein I
26 ALKK01000001.1 GCA000292975_00026 CDS open 18851-20149 _na     432_aa Tail fiber protein
27 ALKK01000001.1 GCA000292975_00027 CDS open 21042-22019 _na     325_aa Site-specific recombinase%2C phage integrase family
28 ALKK01000001.1 GCA000292975_00028 CDS open 22234-22989 _na     251_aa DUF4376 domain-containing protein
29 ALKK01000001.1 GCA000292975_00029 CDS open 23006-23464 _na     152_aa Peptidase M15C domain-containing protein
30 ALKK01000001.1 GCA000292975_00030 CDS open 23478-23846 _na     122_aa Holin of 3TMs%2C for gene-transfer release
31 ALKK01000001.1 GCA000292975_00031 CDS open 23843-24094 _na     83_aa Lipoprotein
32 ALKK01000001.1 GCA000292975_00032 CDS open 24103-24480 _na     125_aa Toxin secretion/phage lysis holin
33 ALKK01000001.1 GCA000292975_00033 CDS open 24503-25066 _na     187_aa hypothetical protein
34 ALKK01000001.1 GCA000292975_00034 CDS open 25165-25923 _na     252_aa Guanylate cyclase domain-containing protein
35 ALKK01000001.1 GCA000292975_00035 CDS open 25946-26794 _na     282_aa hypothetical protein
36 ALKK01000001.1 GCA000292975_00036 CDS open 26796-27371 _na     191_aa hypothetical protein
37 ALKK01000001.1 GCA000292975_00001 gene open 217-885
38 ALKK01000001.1 GCA000292975_00002 gene open 1012-1455
39 ALKK01000001.1 GCA000292975_00003 gene open 1442-3214
40 ALKK01000001.1 GCA000292975_00004 gene open 3211-3429
41 ALKK01000001.1 GCA000292975_00005 gene open 3439-4980
42 ALKK01000001.1 GCA000292975_00006 gene open 4967-6082
43 ALKK01000001.1 GCA000292975_00007 gene open 6100-6420
44 ALKK01000001.1 GCA000292975_00008 gene open 6433-7440
45 ALKK01000001.1 GCA000292975_00009 gene open 7482-7700
46 ALKK01000001.1 GCA000292975_00010 gene open 7697-8011
47 ALKK01000001.1 GCA000292975_00011 gene open 8011-8601
48 ALKK01000001.1 GCA000292975_00012 gene open 8598-9065
49 ALKK01000001.1 GCA000292975_00013 gene open 9052-9321
50 ALKK01000001.1 GCA000292975_00014 gene open 9322-10722
51 ALKK01000001.1 GCA000292975_00015 gene open 10732-11265
52 ALKK01000001.1 GCA000292975_00016 gene open 11275-11610
53 ALKK01000001.1 GCA000292975_00017 gene open 11785-12048
54 ALKK01000001.1 GCA000292975_00018 gene open 12116-14701
55 ALKK01000001.1 GCA000292975_00019 gene open 14691-14900
56 ALKK01000001.1 GCA000292975_00020 gene open 14903-15979
57 ALKK01000001.1 GCA000292975_00021 gene open 15979-16494
58 ALKK01000001.1 GCA000292975_00022 gene open 16496-16882
59 ALKK01000001.1 GCA000292975_00023 gene open 16882-17193
60 ALKK01000001.1 GCA000292975_00024 gene open 17190-18290
61 ALKK01000001.1 GCA000292975_00025 gene open 18283-18846
62 ALKK01000001.1 GCA000292975_00026 gene open 18851-20149
63 ALKK01000001.1 GCA000292975_00027 gene open 21042-22019
64 ALKK01000001.1 GCA000292975_00028 gene open 22234-22989
65 ALKK01000001.1 GCA000292975_00029 gene open 23006-23464
66 ALKK01000001.1 GCA000292975_00030 gene open 23478-23846
67 ALKK01000001.1 GCA000292975_00031 gene open 23843-24094
68 ALKK01000001.1 GCA000292975_00032 gene open 24103-24480
69 ALKK01000001.1 GCA000292975_00033 gene open 24503-25066
70 ALKK01000001.1 GCA000292975_00034 gene open 25165-25923
71 ALKK01000001.1 GCA000292975_00035 gene open 25946-26794
72 ALKK01000001.1 GCA000292975_00036 gene open 26796-27371
73 ALKK01000002.1 GCA000292975_00037 CDS open 48-920 _na     290_aa ATPase
74 ALKK01000002.1 GCA000292975_00038 CDS open 920-1942 _na     340_aa mreB Cell shape-determining protein MreB
75 ALKK01000002.1 GCA000292975_00039 CDS open 1945-2331 _na     128_aa Mini-ribonuclease 3
76 ALKK01000002.1 GCA000292975_00040 CDS open 2319-3740 _na     473_aa cysS cysteine--tRNA ligase
77 ALKK01000002.1 GCA000292975_00041 CDS open 3801-4499 _na     232_aa 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase
78 ALKK01000002.1 GCA000292975_00042 CDS open 4475-6811 _na     778_aa mutS2 endonuclease MutS2
79 ALKK01000002.1 GCA000292975_00043 CDS open 6993-7250 _na     85_aa rpmB 50S ribosomal protein L28
80 ALKK01000002.1 GCA000292975_00044 CDS open 7410-8909 _na     499_aa yfcC putative basic amino acid antiporter YfcC
81 ALKK01000002.1 GCA000292975_00045 CDS open 8967-9956 _na     329_aa D-lactate dehydrogenase
82 ALKK01000002.1 GCA000292975_00046 CDS open 10095-10313 _na     72_aa rpsR 30S ribosomal protein S18
83 ALKK01000002.1 GCA000292975_00047 CDS open 10347-10631 _na     94_aa rpsF 30S ribosomal protein S6
84 ALKK01000002.1 GCA000292975_00048 CDS open 10726-11805 _na     359_aa ftsZ cell division protein FtsZ
85 ALKK01000002.1 GCA000292975_00049 CDS open 11831-13090 _na     419_aa ftsA cell division protein FtsA
86 ALKK01000002.1 GCA000292975_00050 CDS open 13080-13766 _na     228_aa FtsQ-type POTRA domain-containing protein
87 ALKK01000002.1 GCA000292975_00051 CDS open 13780-14646 _na     288_aa D-alanine--D-alanine ligase
88 ALKK01000002.1 GCA000292975_00052 CDS open 14660-15499 _na     279_aa murB UDP-N-acetylmuramate dehydrogenase
89 ALKK01000002.1 GCA000292975_00053 CDS open 15511-16854 _na     447_aa murC UDP-N-acetylmuramate--L-alanine ligase
90 ALKK01000002.1 GCA000292975_00054 CDS open 16862-17929 _na     355_aa murG undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase
91 ALKK01000002.1 GCA000292975_00055 CDS open 17943-19244 _na     433_aa murD UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase
92 ALKK01000002.1 GCA000292975_00056 CDS open 19261-20346 _na     361_aa mraY phospho-N-acetylmuramoyl-pentapeptide-transferase
93 ALKK01000002.1 GCA000292975_00057 CDS open 20346-21626 _na     426_aa UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase
94 ALKK01000002.1 GCA000292975_00058 CDS open 21628-22191 _na     187_aa gmhB D-glycero-beta-D-manno-heptose 1%2C7-bisphosphate 7-phosphatase
95 ALKK01000002.1 GCA000292975_00059 CDS open 22307-23389 _na     360_aa DHHA1 domain protein
96 ALKK01000002.1 GCA000292975_00060 CDS open 23402-25960 _na     852_aa leuS leucine--tRNA ligase
97 ALKK01000002.1 GCA000292975_00061 CDS open 25978-26571 _na     197_aa sigS RNA polymerase sigma factor SigS
98 ALKK01000002.1 GCA000292975_00062 CDS open 26581-27297 _na     238_aa rlmB 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB
99 ALKK01000002.1 GCA000292975_00063 CDS open 27307-28575 _na     422_aa murA UDP-N-acetylglucosamine 1-carboxyvinyltransferase
100 ALKK01000002.1 GCA000292975_00064 CDS open 28608-29264 _na     218_aa Carboxypeptidase
101 ALKK01000002.1 GCA000292975_00065 CDS open 29273-30280 _na     335_aa tsaD tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD
102 ALKK01000002.1 GCA000292975_00066 CDS open 30293-30841 _na     182_aa recX Regulatory protein RecX
103 ALKK01000002.1 GCA000292975_00067 CDS open 30813-31859 _na     348_aa recA recombinase RecA
104 ALKK01000002.1 GCA000292975_00068 CDS open 31804-32925 _na     373_aa Lipopolysaccharide biosynthesis protein
105 ALKK01000002.1 GCA000292975_00069 CDS open 32883-33572 _na     229_aa Lipopolysaccharide biosynthesis protein
106 ALKK01000002.1 GCA000292975_00070 CDS open 33569-34582 _na     337_aa ADP-heptose--LPS heptosyltransferase II
107 ALKK01000002.1 GCA000292975_00071 CDS open 34579-35610 _na     343_aa Heptosyltransferase domain protein
108 ALKK01000002.1 GCA000292975_00072 CDS open 35607-36377 _na     256_aa Glycosyltransferase%2C group 2 family protein
109 ALKK01000002.1 GCA000292975_00073 CDS open 36386-37465 _na     359_aa NodB-like y domain-containing protein
110 ALKK01000002.1 GCA000292975_00074 CDS open 37603-38274 _na     223_aa deoC deoxyribose-phosphate aldolase
111 ALKK01000002.1 GCA000292975_00075 CDS open 38288-39478 _na     396_aa phosphopentomutase
112 ALKK01000002.1 GCA000292975_00076 CDS open 39502-40215 _na     237_aa deoD purine-nucleoside phosphorylase
113 ALKK01000002.1 GCA000292975_00077 CDS open 40227-40625 _na     132_aa cdd cytidine deaminase
114 ALKK01000002.1 GCA000292975_00078 CDS open 40640-41863 _na     407_aa Na+ dependent nucleoside transporter C-terminal domain protein
115 ALKK01000002.1 GCA000292975_00079 CDS open 41902-42753 _na     283_aa 5'-nucleotidase%2C lipoprotein e(P4) family
116 ALKK01000002.1 GCA000292975_00080 CDS open 42786-43556 _na     256_aa udp uridine phosphorylase
117 ALKK01000002.1 GCA000292975_00081 CDS open 43667-44389 _na     240_aa gntR Transcriptional regulator%2C GntR family
118 ALKK01000002.1 GCA000292975_00082 CDS open 44608-44811 _na     67_aa YMGG-like Gly-zipper domain-containing protein
119 ALKK01000002.1 GCA000292975_00037 gene open 48-920
120 ALKK01000002.1 GCA000292975_00038 gene open 920-1942 mreB
121 ALKK01000002.1 GCA000292975_00039 gene open 1945-2331
122 ALKK01000002.1 GCA000292975_00040 gene open 2319-3740 cysS
123 ALKK01000002.1 GCA000292975_00041 gene open 3801-4499
124 ALKK01000002.1 GCA000292975_00042 gene open 4475-6811 mutS2
125 ALKK01000002.1 GCA000292975_00043 gene open 6993-7250 rpmB
126 ALKK01000002.1 GCA000292975_00044 gene open 7410-8909 yfcC
127 ALKK01000002.1 GCA000292975_00045 gene open 8967-9956
128 ALKK01000002.1 GCA000292975_00046 gene open 10095-10313 rpsR
129 ALKK01000002.1 GCA000292975_00047 gene open 10347-10631 rpsF
130 ALKK01000002.1 GCA000292975_00048 gene open 10726-11805 ftsZ
131 ALKK01000002.1 GCA000292975_00049 gene open 11831-13090 ftsA
132 ALKK01000002.1 GCA000292975_00050 gene open 13080-13766
133 ALKK01000002.1 GCA000292975_00051 gene open 13780-14646
134 ALKK01000002.1 GCA000292975_00052 gene open 14660-15499 murB
135 ALKK01000002.1 GCA000292975_00053 gene open 15511-16854 murC
136 ALKK01000002.1 GCA000292975_00054 gene open 16862-17929 murG
137 ALKK01000002.1 GCA000292975_00055 gene open 17943-19244 murD
138 ALKK01000002.1 GCA000292975_00056 gene open 19261-20346 mraY
139 ALKK01000002.1 GCA000292975_00057 gene open 20346-21626
140 ALKK01000002.1 GCA000292975_00058 gene open 21628-22191 gmhB
141 ALKK01000002.1 GCA000292975_00059 gene open 22307-23389
142 ALKK01000002.1 GCA000292975_00060 gene open 23402-25960 leuS
143 ALKK01000002.1 GCA000292975_00061 gene open 25978-26571 sigS
144 ALKK01000002.1 GCA000292975_00062 gene open 26581-27297 rlmB
145 ALKK01000002.1 GCA000292975_00063 gene open 27307-28575 murA
146 ALKK01000002.1 GCA000292975_00064 gene open 28608-29264
147 ALKK01000002.1 GCA000292975_00065 gene open 29273-30280 tsaD
148 ALKK01000002.1 GCA000292975_00066 gene open 30293-30841 recX
149 ALKK01000002.1 GCA000292975_00067 gene open 30813-31859 recA
150 ALKK01000002.1 GCA000292975_00068 gene open 31804-32925
151 ALKK01000002.1 GCA000292975_00069 gene open 32883-33572
152 ALKK01000002.1 GCA000292975_00070 gene open 33569-34582
153 ALKK01000002.1 GCA000292975_00071 gene open 34579-35610
154 ALKK01000002.1 GCA000292975_00072 gene open 35607-36377
155 ALKK01000002.1 GCA000292975_00073 gene open 36386-37465
156 ALKK01000002.1 GCA000292975_00074 gene open 37603-38274 deoC
157 ALKK01000002.1 GCA000292975_00075 gene open 38288-39478
158 ALKK01000002.1 GCA000292975_00076 gene open 39502-40215 deoD
159 ALKK01000002.1 GCA000292975_00077 gene open 40227-40625 cdd
160 ALKK01000002.1 GCA000292975_00078 gene open 40640-41863
161 ALKK01000002.1 GCA000292975_00079 gene open 41902-42753
162 ALKK01000002.1 GCA000292975_00080 gene open 42786-43556 udp
163 ALKK01000002.1 GCA000292975_00081 gene open 43667-44389 gntR
164 ALKK01000002.1 GCA000292975_00082 gene open 44608-44811
165 ALKK01000004.1 GCA000292975_00083 CDS open 32-448 _na     138_aa Glycine zipper
166 ALKK01000004.1 GCA000292975_00084 CDS open 445-621 _na     58_aa hypothetical protein
167 ALKK01000004.1 GCA000292975_00085 CDS open 770-895 _na     41_aa hypothetical protein
168 ALKK01000004.1 GCA000292975_00086 CDS open 962-1318 _na     118_aa hypothetical protein
169 ALKK01000004.1 GCA000292975_00088 CDS open 1624-2445 _na     273_aa pyridoxamine kinase
170 ALKK01000004.1 GCA000292975_00089 CDS open 2614-2814 _na     66_aa Hydrid cluster protein-associated redox disulfide domain protein
171 ALKK01000004.1 GCA000292975_00090 CDS open 2930-3535 _na     201_aa Membrane protein
172 ALKK01000004.1 GCA000292975_00091 CDS open 3560-4564 _na     334_aa ruvB Holliday junction branch migration DNA helicase RuvB
173 ALKK01000004.1 GCA000292975_00092 CDS open 4554-4970 _na     138_aa Transcriptional regulator%2C Rrf2 family
174 ALKK01000004.1 GCA000292975_00093 CDS open 4985-5698 _na     237_aa Ribosomal RNA small subunit methyltransferase E
175 ALKK01000004.1 GCA000292975_00094 CDS open 5685-6995 _na     436_aa mtaB tRNA (N(6)-L-threonylcarbamoyladenosine(37)-C(2))-methylthiotransferase MtaB
176 ALKK01000004.1 GCA000292975_00095 CDS open 6973-7935 _na     320_aa LytR/CpsA/Psr regulator C-terminal domain-containing protein
177 ALKK01000004.1 GCA000292975_00096 CDS open 7953-8351 _na     132_aa Integral membrane protein
178 ALKK01000004.1 GCA000292975_00097 CDS open 8361-10190 _na     609_aa mrdA penicillin-binding protein 2
179 ALKK01000004.1 GCA000292975_00098 CDS open 10183-12051 _na     622_aa Ribonuclease J
180 ALKK01000004.1 GCA000292975_00099 CDS open 12072-12377 _na     101_aa yhbY ribosome assembly RNA-binding protein YhbY
181 ALKK01000004.1 GCA000292975_00100 CDS open 12401-14182 _na     593_aa dxs 1-deoxy-D-xylulose-5-phosphate synthase
182 ALKK01000004.1 GCA000292975_00101 CDS open 14166-14996 _na     276_aa HD domain-containing protein
183 ALKK01000004.1 GCA000292975_00102 CDS open 15005-15808 _na     267_aa Ribosomal RNA large subunit methyltransferase J
184 ALKK01000004.1 GCA000292975_00103 CDS open 15805-17091 _na     428_aa Peptidase%2C S41 family
185 ALKK01000004.1 GCA000292975_00104 CDS open 17092-17775 _na     227_aa rsmI 16S rRNA (cytidine(1402)-2'-O)-methyltransferase
186 ALKK01000004.1 GCA000292975_00105 CDS open 17750-18646 _na     298_aa ylqF ribosome biogenesis GTPase YlqF
187 ALKK01000004.1 GCA000292975_00106 CDS open 18643-19422 _na     259_aa NAD+ synthase
188 ALKK01000004.1 GCA000292975_00107 CDS open 19435-19794 _na     119_aa Cyanobacterial aminoacyl-tRNA synthetase CAAD domain-containing protein
189 ALKK01000004.1 GCA000292975_00108 CDS open 19889-21043 _na     384_aa RNA polymerase subunit sigma-54
190 ALKK01000004.1 GCA000292975_00109 CDS open 21104-22495 _na     463_aa Fis family transcriptional regulator
191 ALKK01000004.1 GCA000292975_00110 CDS open 22692-24140 _na     482_aa Gamma-aminobutyrate metabolism dehydratase/isomerase
192 ALKK01000004.1 GCA000292975_00111 CDS open 24158-24439 _na     93_aa NifU-like protein
193 ALKK01000004.1 GCA000292975_00112 CDS open 24444-25754 _na     436_aa 4-hydroxybutyrate coenzyme A transferase
194 ALKK01000004.1 GCA000292975_00113 CDS open 25763-26878 _na     371_aa 4-hydroxybutyrate dehydrogenase
195 ALKK01000004.1 GCA000292975_00114 CDS open 26895-28328 _na     477_aa DUF3360 domain-containing protein
196 ALKK01000004.1 GCA000292975_00115 CDS open 28359-29720 _na     453_aa Permease family protein
197 ALKK01000004.1 GCA000292975_00116 CDS open 29724-29963 _na     79_aa CGGC domain-containing protein
198 ALKK01000004.1 GCA000292975_00117 CDS open 30057-30560 _na     167_aa flavodoxin
199 ALKK01000004.1 GCA000292975_00118 CDS open 30576-31256 _na     226_aa moeB MoeB
200 ALKK01000004.1 GCA000292975_00119 CDS open 31751-32923 _na     390_aa YadA-like C-terminal domain protein
201 ALKK01000004.1 GCA000292975_00120 CDS open 33061-33768 _na     235_aa deoD purine-nucleoside phosphorylase
202 ALKK01000004.1 GCA000292975_00121 CDS open 33765-35468 _na     567_aa ygiQ YgiQ family radical SAM protein
203 ALKK01000004.1 GCA000292975_00122 CDS open 35477-36793 _na     438_aa der ribosome biogenesis GTPase Der
204 ALKK01000004.1 GCA000292975_00123 CDS open 36870-38015 _na     381_aa brnQ branched-chain amino acid transport system II carrier protein
205 ALKK01000004.1 GCA000292975_00124 CDS open 38036-38401 _na     121_aa Glutaredoxin
206 ALKK01000004.1 GCA000292975_00125 CDS open 38419-39684 _na     421_aa brnQ branched-chain amino acid transport system II carrier protein
207 ALKK01000004.1 GCA000292975_00126 CDS open 39795-40001 _na     68_aa Glutaredoxin
208 ALKK01000004.1 GCA000292975_00127 CDS open 39998-42256 _na     752_aa ribonucleoside-diphosphate reductase subunit alpha
209 ALKK01000004.1 GCA000292975_00128 CDS open 42249-43283 _na     344_aa ribonucleotide-diphosphate reductase subunit beta
210 ALKK01000004.1 GCA000292975_00129 CDS open 43320-43622 _na     100_aa FeS cluster biogenesis domain-containing protein
211 ALKK01000004.1 GCA000292975_00130 CDS open 43716-44795 _na     359_aa glpQ glycerophosphodiester phosphodiesterase
212 ALKK01000004.1 GCA000292975_00131 CDS open 44837-45280 _na     147_aa sarZ HTH-type transcriptional regulator SarZ
213 ALKK01000004.1 GCA000292975_00132 CDS open 45301-45849 _na     182_aa Glutathione peroxidase
214 ALKK01000004.1 GCA000292975_00133 CDS open 45851-45964 _na     37_aa hypothetical protein
215 ALKK01000004.1 GCA000292975_00134 CDS open 46117-46932 _na     271_aa PF10670 domain protein
216 ALKK01000004.1 GCA000292975_00083 gene open 32-448
217 ALKK01000004.1 GCA000292975_00084 gene open 445-621
218 ALKK01000004.1 GCA000292975_00085 gene open 770-895
219 ALKK01000004.1 GCA000292975_00086 gene open 962-1318
220 ALKK01000004.1 GCA000292975_00088 gene open 1624-2445
221 ALKK01000004.1 GCA000292975_00089 gene open 2614-2814
222 ALKK01000004.1 GCA000292975_00090 gene open 2930-3535
223 ALKK01000004.1 GCA000292975_00091 gene open 3560-4564 ruvB
224 ALKK01000004.1 GCA000292975_00092 gene open 4554-4970
225 ALKK01000004.1 GCA000292975_00093 gene open 4985-5698
226 ALKK01000004.1 GCA000292975_00094 gene open 5685-6995 mtaB
227 ALKK01000004.1 GCA000292975_00095 gene open 6973-7935
228 ALKK01000004.1 GCA000292975_00096 gene open 7953-8351
229 ALKK01000004.1 GCA000292975_00097 gene open 8361-10190 mrdA
230 ALKK01000004.1 GCA000292975_00098 gene open 10183-12051
231 ALKK01000004.1 GCA000292975_00099 gene open 12072-12377 yhbY
232 ALKK01000004.1 GCA000292975_00100 gene open 12401-14182 dxs
233 ALKK01000004.1 GCA000292975_00101 gene open 14166-14996
234 ALKK01000004.1 GCA000292975_00102 gene open 15005-15808
235 ALKK01000004.1 GCA000292975_00103 gene open 15805-17091
236 ALKK01000004.1 GCA000292975_00104 gene open 17092-17775 rsmI
237 ALKK01000004.1 GCA000292975_00105 gene open 17750-18646 ylqF
238 ALKK01000004.1 GCA000292975_00106 gene open 18643-19422
239 ALKK01000004.1 GCA000292975_00107 gene open 19435-19794
240 ALKK01000004.1 GCA000292975_00108 gene open 19889-21043
241 ALKK01000004.1 GCA000292975_00109 gene open 21104-22495
242 ALKK01000004.1 GCA000292975_00110 gene open 22692-24140
243 ALKK01000004.1 GCA000292975_00111 gene open 24158-24439
244 ALKK01000004.1 GCA000292975_00112 gene open 24444-25754
245 ALKK01000004.1 GCA000292975_00113 gene open 25763-26878
246 ALKK01000004.1 GCA000292975_00114 gene open 26895-28328
247 ALKK01000004.1 GCA000292975_00115 gene open 28359-29720
248 ALKK01000004.1 GCA000292975_00116 gene open 29724-29963
249 ALKK01000004.1 GCA000292975_00117 gene open 30057-30560
250 ALKK01000004.1 GCA000292975_00118 gene open 30576-31256 moeB
251 ALKK01000004.1 GCA000292975_00119 gene open 31751-32923
252 ALKK01000004.1 GCA000292975_00120 gene open 33061-33768 deoD
253 ALKK01000004.1 GCA000292975_00121 gene open 33765-35468 ygiQ
254 ALKK01000004.1 GCA000292975_00122 gene open 35477-36793 der
255 ALKK01000004.1 GCA000292975_00123 gene open 36870-38015 brnQ
256 ALKK01000004.1 GCA000292975_00124 gene open 38036-38401
257 ALKK01000004.1 GCA000292975_00125 gene open 38419-39684 brnQ
258 ALKK01000004.1 GCA000292975_00126 gene open 39795-40001
259 ALKK01000004.1 GCA000292975_00127 gene open 39998-42256
260 ALKK01000004.1 GCA000292975_00128 gene open 42249-43283
261 ALKK01000004.1 GCA000292975_00129 gene open 43320-43622
262 ALKK01000004.1 GCA000292975_00130 gene open 43716-44795 glpQ
263 ALKK01000004.1 GCA000292975_00131 gene open 44837-45280 sarZ
264 ALKK01000004.1 GCA000292975_00132 gene open 45301-45849
265 ALKK01000004.1 GCA000292975_00133 gene open 45851-45964
266 ALKK01000004.1 GCA000292975_00134 gene open 46117-46932
267 ALKK01000004.1 GCA000292975_00087 gene open 1490-1574 trnS
268 ALKK01000004.1 GCA000292975_00087 tRNA open 1490-1574 trnS tRNA-Ser(gga)
269 ALKK01000005.1 GCA000292975_00135 CDS open 12-947 _na     311_aa Porin
270 ALKK01000005.1 GCA000292975_00136 CDS open 1101-1922 _na     273_aa Outer membrane protein beta-barrel domain-containing protein
271 ALKK01000005.1 GCA000292975_00137 CDS open 2146-3054 _na     302_aa Major outer membrane protein
272 ALKK01000005.1 GCA000292975_00135 gene open 12-947
273 ALKK01000005.1 GCA000292975_00136 gene open 1101-1922
274 ALKK01000005.1 GCA000292975_00137 gene open 2146-3054
275 ALKK01000006.1 GCA000292975_00138 CDS open 350-1330 _na     326_aa prfB peptide chain release factor 2
276 ALKK01000006.1 GCA000292975_00139 CDS open 1461-1682 _na     73_aa (2Fe-2S) ferredoxin domain-containing protein
277 ALKK01000006.1 GCA000292975_00140 CDS open 1679-2023 _na     114_aa Holo-[acyl-carrier-protein] synthase
278 ALKK01000006.1 GCA000292975_00141 CDS open 2020-2778 _na     252_aa tatD Hydrolase TatD
279 ALKK01000006.1 GCA000292975_00142 CDS open 2765-3625 _na     286_aa hslO Hsp33 family molecular chaperone HslO
280 ALKK01000006.1 GCA000292975_00143 CDS open 3637-4158 _na     173_aa ComEA family DNA-binding protein
281 ALKK01000006.1 GCA000292975_00144 CDS open 4148-5530 _na     460_aa coproporphyrinogen III oxidase
282 ALKK01000006.1 GCA000292975_00145 CDS open 5534-6502 _na     322_aa Bacterial type II secretion system protein E domain-containing protein
283 ALKK01000006.1 GCA000292975_00146 CDS open 6549-8051 _na     500_aa Magnesium chelatase
284 ALKK01000006.1 GCA000292975_00147 CDS open 8142-8699 _na     185_aa mntP Putative manganese efflux pump MntP
285 ALKK01000006.1 GCA000292975_00148 CDS open 8771-9175 _na     134_aa nusB transcription antitermination factor NusB
286 ALKK01000006.1 GCA000292975_00149 CDS open 9184-9408 _na     74_aa DUF2273 domain-containing protein
287 ALKK01000006.1 GCA000292975_00150 CDS open 9410-9946 _na     178_aa amaP alkaline shock response membrane anchor protein AmaP
288 ALKK01000006.1 GCA000292975_00151 CDS open 9995-10357 _na     120_aa Alkaline shock protein 23 family protein
289 ALKK01000006.1 GCA000292975_00152 CDS open 10426-11769 _na     447_aa accC acetyl-CoA carboxylase biotin carboxylase subunit
290 ALKK01000006.1 GCA000292975_00153 CDS open 11793-12200 _na     135_aa Biotin-requiring enzyme
291 ALKK01000006.1 GCA000292975_00154 CDS open 12223-15648 _na     1141_aa DNA polymerase III subunit alpha
292 ALKK01000006.1 GCA000292975_00155 CDS open 15663-17423 _na     586_aa Helicase XPB/Ssl2 N-terminal domain-containing protein
293 ALKK01000006.1 GCA000292975_00156 CDS open 17439-20843 _na     1134_aa Helicase SNF
294 ALKK01000006.1 GCA000292975_00157 CDS open 21050-21925 _na     291_aa Hemin receptor
295 ALKK01000006.1 GCA000292975_00158 CDS open 21956-24100 _na     714_aa TonB-dependent receptor
296 ALKK01000006.1 GCA000292975_00159 CDS open 24116-25090 _na     324_aa Iron chelate uptake ABC transporter%2C FeCT family%2C permease protein
297 ALKK01000006.1 GCA000292975_00160 CDS open 25087-25887 _na     266_aa Heme ABC transporter ATP-binding protein
298 ALKK01000006.1 GCA000292975_00161 CDS open 25903-27129 _na     408_aa Coproporphyrinogen III oxidase
299 ALKK01000006.1 GCA000292975_00162 CDS open 27396-28655 _na     419_aa PTS system sugar-specific permease protein
300 ALKK01000006.1 GCA000292975_00163 CDS open 28685-29077 _na     130_aa PTS system%2C lactose/cellobiose-specific IIB subunit
301 ALKK01000006.1 GCA000292975_00164 CDS open 29132-29569 _na     145_aa Phosphoenolpyruvate-dependent sugar PTS family porter%2C EIIA 2
302 ALKK01000006.1 GCA000292975_00165 CDS open 29588-30238 _na     216_aa L-fuculose-phosphate aldolase
303 ALKK01000006.1 GCA000292975_00166 CDS open 30250-32310 _na     686_aa Phosphoenolpyruvate-dependent sugar PTS family porter%2C EIIA 2
304 ALKK01000006.1 GCA000292975_00167 CDS open 32625-33776 _na     383_aa Bacterial transcriptional activator domain-containing protein
305 ALKK01000006.1 GCA000292975_00168 CDS open 33788-35320 _na     510_aa Amidohydrolase
306 ALKK01000006.1 GCA000292975_00169 CDS open 35350-36978 _na     542_aa aepA Exoenzyme regulatory protein aepA
307 ALKK01000006.1 GCA000292975_00170 CDS open 36975-38399 _na     474_aa nhaC Na+/H+ antiporter NhaC
308 ALKK01000006.1 GCA000292975_00171 CDS open 38605-40518 _na     637_aa thrS threonine--tRNA ligase
309 ALKK01000006.1 GCA000292975_00172 CDS open 40532-44164 _na     1210_aa lptD LPS-assembly protein LptD
310 ALKK01000006.1 GCA000292975_00173 CDS open 44259-44579 _na     106_aa Thioredoxin
311 ALKK01000006.1 GCA000292975_00174 CDS open 44682-45350 _na     222_aa tsaB tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB
312 ALKK01000006.1 GCA000292975_00175 CDS open 45331-45798 _na     155_aa tsaE tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE
313 ALKK01000006.1 GCA000292975_00176 CDS open 45795-46271 _na     158_aa D-glycero-beta-D-manno-heptose 1-phosphate adenylyltransferase
314 ALKK01000006.1 GCA000292975_00177 CDS open 46268-46864 _na     198_aa NUDIX domain protein
315 ALKK01000006.1 GCA000292975_00178 CDS open 47201-48475 _na     424_aa ISL3 family transposase
316 ALKK01000006.1 GCA000292975_00138 gene open 350-1330 prfB
317 ALKK01000006.1 GCA000292975_00139 gene open 1461-1682
318 ALKK01000006.1 GCA000292975_00140 gene open 1679-2023
319 ALKK01000006.1 GCA000292975_00141 gene open 2020-2778 tatD
320 ALKK01000006.1 GCA000292975_00142 gene open 2765-3625 hslO
321 ALKK01000006.1 GCA000292975_00143 gene open 3637-4158
322 ALKK01000006.1 GCA000292975_00144 gene open 4148-5530
323 ALKK01000006.1 GCA000292975_00145 gene open 5534-6502
324 ALKK01000006.1 GCA000292975_00146 gene open 6549-8051
325 ALKK01000006.1 GCA000292975_00147 gene open 8142-8699 mntP
326 ALKK01000006.1 GCA000292975_00148 gene open 8771-9175 nusB
327 ALKK01000006.1 GCA000292975_00149 gene open 9184-9408
328 ALKK01000006.1 GCA000292975_00150 gene open 9410-9946 amaP
329 ALKK01000006.1 GCA000292975_00151 gene open 9995-10357
330 ALKK01000006.1 GCA000292975_00152 gene open 10426-11769 accC
331 ALKK01000006.1 GCA000292975_00153 gene open 11793-12200
332 ALKK01000006.1 GCA000292975_00154 gene open 12223-15648
333 ALKK01000006.1 GCA000292975_00155 gene open 15663-17423
334 ALKK01000006.1 GCA000292975_00156 gene open 17439-20843
335 ALKK01000006.1 GCA000292975_00157 gene open 21050-21925
336 ALKK01000006.1 GCA000292975_00158 gene open 21956-24100
337 ALKK01000006.1 GCA000292975_00159 gene open 24116-25090
338 ALKK01000006.1 GCA000292975_00160 gene open 25087-25887
339 ALKK01000006.1 GCA000292975_00161 gene open 25903-27129
340 ALKK01000006.1 GCA000292975_00162 gene open 27396-28655
341 ALKK01000006.1 GCA000292975_00163 gene open 28685-29077
342 ALKK01000006.1 GCA000292975_00164 gene open 29132-29569
343 ALKK01000006.1 GCA000292975_00165 gene open 29588-30238
344 ALKK01000006.1 GCA000292975_00166 gene open 30250-32310
345 ALKK01000006.1 GCA000292975_00167 gene open 32625-33776
346 ALKK01000006.1 GCA000292975_00168 gene open 33788-35320
347 ALKK01000006.1 GCA000292975_00169 gene open 35350-36978 aepA
348 ALKK01000006.1 GCA000292975_00170 gene open 36975-38399 nhaC
349 ALKK01000006.1 GCA000292975_00171 gene open 38605-40518 thrS
350 ALKK01000006.1 GCA000292975_00172 gene open 40532-44164 lptD
351 ALKK01000006.1 GCA000292975_00173 gene open 44259-44579
352 ALKK01000006.1 GCA000292975_00174 gene open 44682-45350 tsaB
353 ALKK01000006.1 GCA000292975_00175 gene open 45331-45798 tsaE
354 ALKK01000006.1 GCA000292975_00176 gene open 45795-46271
355 ALKK01000006.1 GCA000292975_00177 gene open 46268-46864
356 ALKK01000006.1 GCA000292975_00178 gene open 47201-48475
357 ALKK01000008.1 GCA000292975_00179 CDS open 172-759 _na     195_aa CBS domain-containing protein
358 ALKK01000008.1 GCA000292975_00180 CDS open 780-3314 _na     844_aa ppdK pyruvate%2C phosphate dikinase
359 ALKK01000008.1 GCA000292975_00181 CDS open 3325-5256 _na     643_aa Fructose-1%2C6-bisphosphatase class 3
360 ALKK01000008.1 GCA000292975_00182 CDS open 5639-7033 _na     464_aa Aromatic hydrocarbon degradation protein
361 ALKK01000008.1 GCA000292975_00183 CDS open 7063-7629 _na     188_aa tetR Transcriptional regulator%2C TetR family
362 ALKK01000008.1 GCA000292975_00184 CDS open 7659-9755 _na     698_aa Ligand-gated channel
363 ALKK01000008.1 GCA000292975_00185 CDS open 9927-10328 _na     133_aa Esterase
364 ALKK01000008.1 GCA000292975_00186 CDS open 10353-13307 _na     984_aa Autotransporter domain-containing protein
365 ALKK01000008.1 GCA000292975_00187 CDS open 13478-14686 _na     402_aa tyrS tyrosine--tRNA ligase
366 ALKK01000008.1 GCA000292975_00188 CDS open 14697-15158 _na     153_aa Acetyltransferase (GNAT) domain protein
367 ALKK01000008.1 GCA000292975_00189 CDS open 15151-15792 _na     213_aa nth endonuclease III
368 ALKK01000008.1 GCA000292975_00190 CDS open 15853-17025 _na     390_aa nifS cysteine desulfurase NifS
369 ALKK01000008.1 GCA000292975_00191 CDS open 17073-17450 _na     125_aa nifU Fe-S cluster assembly scaffold protein NifU
370 ALKK01000008.1 GCA000292975_00192 CDS open 17572-18711 _na     379_aa D-alanyl-D-alanine carboxypeptidase
371 ALKK01000008.1 GCA000292975_00193 CDS open 18731-19270 _na     179_aa Outer membrane protein
372 ALKK01000008.1 GCA000292975_00194 CDS open 19431-20540 _na     369_aa Cyclically-permuted mutarotase family protein
373 ALKK01000008.1 GCA000292975_00195 CDS open 20544-21551 _na     335_aa lacI LacI family transcriptional regulator
374 ALKK01000008.1 GCA000292975_00196 CDS open 21565-22554 _na     329_aa siaP Sialic acid-binding periplasmic protein SiaP
375 ALKK01000008.1 GCA000292975_00197 CDS open 22572-24425 _na     617_aa dctM TRAP C4-dicarboxylate transport system permease DctM subunit domain-containing protein
376 ALKK01000008.1 GCA000292975_00198 CDS open 24429-25331 _na     300_aa N-acetylmannosamine kinase
377 ALKK01000008.1 GCA000292975_00199 CDS open 25328-26200 _na     290_aa N-acetylneuraminate lyase
378 ALKK01000008.1 GCA000292975_00200 CDS open 26211-26888 _na     225_aa Putative N-acetylmannosamine-6-phosphate 2-epimerase
379 ALKK01000008.1 GCA000292975_00201 CDS open 27035-27496 _na     153_aa YhcH/YjgK/YiaL family protein
380 ALKK01000008.1 GCA000292975_00202 CDS open 27630-29048 _na     472_aa pykF pyruvate kinase PykF
381 ALKK01000008.1 GCA000292975_00203 CDS open 29082-30389 _na     435_aa eno phosphopyruvate hydratase
382 ALKK01000008.1 GCA000292975_00204 CDS open 30672-31385 _na     237_aa VWA domain-containing protein
383 ALKK01000008.1 GCA000292975_00205 CDS open 31401-32753 _na     450_aa creD cell envelope integrity protein CreD
384 ALKK01000008.1 GCA000292975_00206 CDS open 33333-33794 _na     153_aa IAA acetyltransferase
385 ALKK01000008.1 GCA000292975_00207 CDS open 33850-34392 _na     180_aa ClbS/DfsB family four-helix bundle protein
386 ALKK01000008.1 GCA000292975_00208 CDS open 34659-35189 _na     176_aa N-acetyltransferase domain-containing protein
387 ALKK01000008.1 GCA000292975_00209 CDS open 35418-36956 _na     512_aa guaA glutamine-hydrolyzing GMP synthase
388 ALKK01000008.1 GCA000292975_00179 gene open 172-759
389 ALKK01000008.1 GCA000292975_00180 gene open 780-3314 ppdK
390 ALKK01000008.1 GCA000292975_00181 gene open 3325-5256
391 ALKK01000008.1 GCA000292975_00182 gene open 5639-7033
392 ALKK01000008.1 GCA000292975_00183 gene open 7063-7629 tetR
393 ALKK01000008.1 GCA000292975_00184 gene open 7659-9755
394 ALKK01000008.1 GCA000292975_00185 gene open 9927-10328
395 ALKK01000008.1 GCA000292975_00186 gene open 10353-13307
396 ALKK01000008.1 GCA000292975_00187 gene open 13478-14686 tyrS
397 ALKK01000008.1 GCA000292975_00188 gene open 14697-15158
398 ALKK01000008.1 GCA000292975_00189 gene open 15151-15792 nth
399 ALKK01000008.1 GCA000292975_00190 gene open 15853-17025 nifS
400 ALKK01000008.1 GCA000292975_00191 gene open 17073-17450 nifU
401 ALKK01000008.1 GCA000292975_00192 gene open 17572-18711
402 ALKK01000008.1 GCA000292975_00193 gene open 18731-19270
403 ALKK01000008.1 GCA000292975_00194 gene open 19431-20540
404 ALKK01000008.1 GCA000292975_00195 gene open 20544-21551 lacI
405 ALKK01000008.1 GCA000292975_00196 gene open 21565-22554 siaP
406 ALKK01000008.1 GCA000292975_00197 gene open 22572-24425 dctM
407 ALKK01000008.1 GCA000292975_00198 gene open 24429-25331
408 ALKK01000008.1 GCA000292975_00199 gene open 25328-26200
409 ALKK01000008.1 GCA000292975_00200 gene open 26211-26888
410 ALKK01000008.1 GCA000292975_00201 gene open 27035-27496
411 ALKK01000008.1 GCA000292975_00202 gene open 27630-29048 pykF
412 ALKK01000008.1 GCA000292975_00203 gene open 29082-30389 eno
413 ALKK01000008.1 GCA000292975_00204 gene open 30672-31385
414 ALKK01000008.1 GCA000292975_00205 gene open 31401-32753 creD
415 ALKK01000008.1 GCA000292975_00206 gene open 33333-33794
416 ALKK01000008.1 GCA000292975_00207 gene open 33850-34392
417 ALKK01000008.1 GCA000292975_00208 gene open 34659-35189
418 ALKK01000008.1 GCA000292975_00209 gene open 35418-36956 guaA
419 ALKK01000009.1 GCA000292975_00210 CDS open 1240-2022 _na     260_aa Methyltransferase domain protein
420 ALKK01000009.1 GCA000292975_00211 CDS open 2053-3456 _na     467_aa Multidrug-efflux transporter
421 ALKK01000009.1 GCA000292975_00212 CDS open 3555-5168 _na     537_aa PTS sugar transporter subunit IIABC
422 ALKK01000009.1 GCA000292975_00210 gene open 1240-2022
423 ALKK01000009.1 GCA000292975_00211 gene open 2053-3456
424 ALKK01000009.1 GCA000292975_00212 gene open 3555-5168
425 ALKK01000010.1 GCA000292975_00213 CDS open 30-743 _na     237_aa HTH cro/C1-type domain-containing protein
426 ALKK01000010.1 GCA000292975_00214 CDS open 842-997 _na     51_aa hypothetical protein
427 ALKK01000010.1 GCA000292975_00215 CDS open 975-2138 _na     387_aa Fic/DOC family protein
428 ALKK01000010.1 GCA000292975_00216 CDS open 2350-2718 _na     122_aa DNA-binding helix-turn-helix protein
429 ALKK01000010.1 GCA000292975_00213 gene open 30-743
430 ALKK01000010.1 GCA000292975_00214 gene open 842-997
431 ALKK01000010.1 GCA000292975_00215 gene open 975-2138
432 ALKK01000010.1 GCA000292975_00216 gene open 2350-2718
433 ALKK01000011.1 repeat_region open 1236-1476 CRISPR array with 4 repeats of length 32%2C consensus sequence ATTTACATTCTACTTTAGTAATACTCTAATTA and spacer length 34
434 ALKK01000011.1 GCA000292975_00217 CDS open 1665-1928 _na     87_aa hypothetical protein
435 ALKK01000011.1 GCA000292975_00218 CDS open 1925-2497 _na     190_aa hypothetical protein
436 ALKK01000011.1 GCA000292975_00219 CDS open 2507-2692 _na     61_aa hypothetical protein
437 ALKK01000011.1 GCA000292975_00220 CDS open 2679-3950 _na     423_aa Phosphoadenosine phosphosulfate reductase family protein
438 ALKK01000011.1 GCA000292975_00221 CDS open 3961-4467 _na     168_aa ParB-like protein
439 ALKK01000011.1 GCA000292975_00222 CDS open 4473-4853 _na     126_aa hypothetical protein
440 ALKK01000011.1 GCA000292975_00223 CDS open 4834-6030 _na     398_aa SNF2 family N-terminal domain protein
441 ALKK01000011.1 GCA000292975_00224 CDS open 6027-7313 _na     428_aa DUF2325 domain-containing protein
442 ALKK01000011.1 GCA000292975_00225 CDS open 7426-7911 _na     161_aa ParB-like protein
443 ALKK01000011.1 GCA000292975_00226 CDS open 7908-8711 _na     267_aa tRNA-guanine(15) transglycosylase-like domain-containing protein
444 ALKK01000011.1 GCA000292975_00227 CDS open 8712-9146 _na     144_aa DUF6884 domain-containing protein
445 ALKK01000011.1 GCA000292975_00228 CDS open 9133-9735 _na     200_aa queuosine precursor transporter
446 ALKK01000011.1 GCA000292975_00229 CDS open 9788-9994 _na     68_aa hypothetical protein
447 ALKK01000011.1 GCA000292975_00230 CDS open 10209-10496 _na     95_aa hypothetical protein
448 ALKK01000011.1 GCA000292975_00231 CDS open 10501-10674 _na     57_aa Bacteriocin-type signal sequence
449 ALKK01000011.1 GCA000292975_00232 CDS open 10878-11366 _na     162_aa ParB-like protein
450 ALKK01000011.1 GCA000292975_00233 CDS open 11363-11608 _na     81_aa hypothetical protein
451 ALKK01000011.1 GCA000292975_00234 CDS open 11630-12109 _na     159_aa hypothetical protein
452 ALKK01000011.1 GCA000292975_00235 CDS open 12128-12328 _na     66_aa Phage protein
453 ALKK01000011.1 GCA000292975_00236 CDS open 12342-12746 _na     134_aa rusA Crossover junction endodeoxyribonuclease RusA
454 ALKK01000011.1 GCA000292975_00237 CDS open 12781-13596 _na     271_aa Phage antirepressor protein KilAC domain protein
455 ALKK01000011.1 GCA000292975_00238 CDS open 13577-14380 _na     267_aa hypothetical protein
456 ALKK01000011.1 GCA000292975_00239 CDS open 14356-14610 _na     84_aa DUF3310 domain-containing protein
457 ALKK01000011.1 GCA000292975_00240 CDS open 14607-14765 _na     52_aa hypothetical protein
458 ALKK01000011.1 GCA000292975_00241 CDS open 14861-15793 _na     310_aa Terminase%2C ATPase subunit%2C gpP-like protein
459 ALKK01000011.1 GCA000292975_00242 CDS open 15790-16125 _na     111_aa Transcriptional regulator
460 ALKK01000011.1 GCA000292975_00243 CDS open 16110-17492 _na     460_aa PBSX family phage terminase large subunit
461 ALKK01000011.1 GCA000292975_00244 CDS open 17504-20071 _na     855_aa Phage protein F-like protein
462 ALKK01000011.1 GCA000292975_00245 CDS open 20081-20320 _na     79_aa hypothetical protein
463 ALKK01000011.1 GCA000292975_00246 CDS open 20331-20912 _na     193_aa phage virion morphogenesis protein
464 ALKK01000011.1 GCA000292975_00247 CDS open 21148-21726 _na     192_aa Phage-Barnase-EndoU-ColicinE5/D-RelE like nuclease 4 domain-containing protein
465 ALKK01000011.1 GCA000292975_00248 CDS open 21841-23301 _na     486_aa PF13250 domain protein
466 ALKK01000011.1 GCA000292975_00249 CDS open 23315-23776 _na     153_aa Lipoprotein
467 ALKK01000011.1 GCA000292975_00250 CDS open 23871-24002 _na     43_aa hicB Toxin-antitoxin system HicB family antitoxin
468 ALKK01000011.1 GCA000292975_00251 CDS open 24200-24322 _na     40_aa hypothetical protein
469 ALKK01000011.1 GCA000292975_00252 CDS open 24319-24852 _na     177_aa Phage regulatory protein%2C Rha family
470 ALKK01000011.1 GCA000292975_00253 CDS open 24854-25219 _na     121_aa hypothetical protein
471 ALKK01000011.1 GCA000292975_00254 CDS open 25259-25447 _na     62_aa Toxin-antitoxin system%2C antitoxin component%2C ribbon-helix-helix domain protein
472 ALKK01000011.1 GCA000292975_00255 CDS open 25543-25725 _na     60_aa hicA Type II toxin-antitoxin system HicA family toxin
473 ALKK01000011.1 GCA000292975_00256 CDS open 25765-26199 _na     144_aa hicB Antitoxin HicB
474 ALKK01000011.1 GCA000292975_00257 CDS open 26314-26520 _na     68_aa Phage protein
475 ALKK01000011.1 GCA000292975_00258 CDS open 26537-26956 _na     139_aa Terminase
476 ALKK01000011.1 GCA000292975_00259 CDS open 26989-27621 _na     210_aa hypothetical protein
477 ALKK01000011.1 GCA000292975_00260 CDS open 27718-27900 _na     60_aa copG CopG family transcriptional regulator
478 ALKK01000011.1 GCA000292975_00261 CDS open 27897-28478 _na     193_aa hypothetical protein
479 ALKK01000011.1 GCA000292975_00262 CDS open 28670-29620 _na     316_aa Phage prohead protease%2C HK97 family
480 ALKK01000011.1 GCA000292975_00263 CDS open 29633-29734 _na     33_aa hypothetical protein
481 ALKK01000011.1 GCA000292975_00264 CDS open 29734-30084 _na     116_aa hypothetical protein
482 ALKK01000011.1 GCA000292975_00265 CDS open 30104-31078 _na     324_aa Phage major capsid protein E
483 ALKK01000011.1 GCA000292975_00266 CDS open 31083-31421 _na     112_aa hypothetical protein
484 ALKK01000011.1 GCA000292975_00267 CDS open 31418-31858 _na     146_aa hypothetical protein
485 ALKK01000011.1 GCA000292975_00268 CDS open 31873-32835 _na     320_aa Phage tail tube protein
486 ALKK01000011.1 GCA000292975_00269 CDS open 32853-33242 _na     129_aa Phage XkdN-like protein
487 ALKK01000011.1 GCA000292975_00270 CDS open 33554-38245 _na     1563_aa Tail tape measure protein%2C TIGR01760 family
488 ALKK01000011.1 GCA000292975_00271 CDS open 38443-38928 _na     161_aa hypothetical protein
489 ALKK01000011.1 GCA000292975_00272 CDS open 38868-39125 _na     85_aa hypothetical protein
490 ALKK01000011.1 GCA000292975_00273 CDS open 39199-42306 _na     1035_aa Phage minor structural protein
491 ALKK01000011.1 GCA000292975_00274 CDS open 42315-42932 _na     205_aa DUF4376 domain-containing protein
492 ALKK01000011.1 GCA000292975_00275 CDS open 42943-44571 _na     542_aa Collagen triple helix repeat protein
493 ALKK01000011.1 GCA000292975_00276 CDS open 44555-45370 _na     271_aa hypothetical protein
494 ALKK01000011.1 GCA000292975_00277 CDS open 45386-46066 _na     226_aa PF14301 domain protein
495 ALKK01000011.1 GCA000292975_00278 CDS open 46063-46641 _na     192_aa N-acetylmuramoyl-L-alanine amidase
496 ALKK01000011.1 GCA000292975_00279 CDS open 46638-46769 _na     43_aa hypothetical protein
497 ALKK01000011.1 GCA000292975_00280 CDS open 46766-47158 _na     130_aa Holin of 3TMs%2C for gene-transfer release
498 ALKK01000011.1 GCA000292975_00281 CDS open 47158-47427 _na     89_aa hypothetical protein
499 ALKK01000011.1 GCA000292975_00282 CDS open 47796-48593 _na     265_aa hypothetical protein
500 ALKK01000011.1 GCA000292975_00283 CDS open 48614-49465 _na     283_aa PF13475 domain protein