HOMD Banner
Taxonomy: V4.3   |  16S rRNA RefSeq: V16.03   |  Genomic RefSeq: V11.03   |  Viruses: V1.2

BAKTAGenome Explorer: Streptococcus oralis subsp. oralis (GCA_000722675.1)

Select a Genome:
BAKTA Annotations for GCA_000722675.1
Genome Selected: Streptococcus oralis subsp. oralis
ContigsBases CDSrRNA tmRNAtRNA
11 1873971 1829 12 1 59
[Table]   [AA Fasta]      [Browser]   [Text]   [Excel]  
Search & Sort all 3863 Records
Search These Records: Clear
Sort Column:   Molecule   PID   NA   AA   Gene  Gene Product  Reverse
Annotation Table [page:1]    |    Number of Records Found: 3863 [8 Pages]    |    Previous Page <==> Next Page    |    Jump to Page: [ 1  2  3  4  5  6  7  8  ]
Notes:   1- Column headers only sort the current page. 2- Select [NA] or [AA] links to show sequences.
Region Protein-ID Type Genome
Viewer		 Range
(bp)		 Show Sequences
(length) NA / AA		 BAKTA
Gene		 BAKTA
GeneProduct
1 JPGA01000001.1 rep_origin open 925-1082
2 JPGA01000001.1 GCA000722675_00001 CDS open 79-924 _na     281_aa dnaA chromosomal replication initiator protein DnaA
3 JPGA01000001.1 GCA000722675_00002 CDS open 1083-2219 _na     378_aa dnaN DNA polymerase III subunit beta
4 JPGA01000001.1 GCA000722675_00003 CDS open 2284-2478 _na     64_aa PF06107 family protein
5 JPGA01000001.1 GCA000722675_00004 CDS open 2562-3677 _na     371_aa ychF redox-regulated ATPase YchF
6 JPGA01000001.1 GCA000722675_00005 CDS open 3751-4320 _na     189_aa pth aminoacyl-tRNA hydrolase
7 JPGA01000001.1 GCA000722675_00001 gene open 79-924 dnaA
8 JPGA01000001.1 GCA000722675_00002 gene open 1083-2219 dnaN
9 JPGA01000001.1 GCA000722675_00003 gene open 2284-2478
10 JPGA01000001.1 GCA000722675_00004 gene open 2562-3677 ychF
11 JPGA01000001.1 GCA000722675_00005 gene open 3751-4320 pth
12 JPGA01000002.1 GCA000722675_00006 CDS open 97-723 _na     208_aa serine hydrolase
13 JPGA01000002.1 GCA000722675_00007 CDS open 720-1997 _na     425_aa tRNA(Ile)-lysidine synthase
14 JPGA01000002.1 GCA000722675_00008 CDS open 2002-2544 _na     180_aa hpt hypoxanthine phosphoribosyltransferase
15 JPGA01000002.1 GCA000722675_00009 CDS open 2560-4518 _na     652_aa ftsH ATP-dependent zinc metalloprotease FtsH
16 JPGA01000002.1 GCA000722675_00006 gene open 97-723
17 JPGA01000002.1 GCA000722675_00007 gene open 720-1997
18 JPGA01000002.1 GCA000722675_00008 gene open 2002-2544 hpt
19 JPGA01000002.1 GCA000722675_00009 gene open 2560-4518 ftsH
20 JPGA01000002.1 GCA000722675_00010 gene open 4877-4948 trnE
21 JPGA01000002.1 GCA000722675_00010 tRNA open 4877-4948 trnE tRNA-Glu(ttc)
22 JPGA01000003.1 GCA000722675_00012 gene open 357-1903 rrs
23 JPGA01000003.1 GCA000722675_00014 gene open 2149-5052 rrl
24 JPGA01000003.1 GCA000722675_00015 gene open 5129-5244 rrf
25 JPGA01000003.1 GCA000722675_00019 gene open 7343-7440 csRNA
26 JPGA01000003.1 GCA000722675_00021 gene open 7997-8095 Bacteria_small_SRP
27 JPGA01000003.1 GCA000722675_00127 gene open 109201-109293 tracrRNA
28 JPGA01000003.1 GCA000722675_00019 ncRNA open 7343-7440 Cia-dependent small RNA csRNA1
29 JPGA01000003.1 GCA000722675_00021 ncRNA open 7997-8095 Bacterial small signal recognition particle RNA
30 JPGA01000003.1 GCA000722675_00127 ncRNA open 109201-109293 Trans-activating crRNA
31 JPGA01000003.1 GCA000722675_00012 rRNA open 357-1903 rrs 16S ribosomal RNA
32 JPGA01000003.1 GCA000722675_00014 rRNA open 2149-5052 rrl 23S ribosomal RNA
33 JPGA01000003.1 GCA000722675_00015 rRNA open 5129-5244 rrf 5S ribosomal RNA
34 JPGA01000003.1 repeat_region open 101951-102919 CRISPR array with 15 repeats of length 36%2C consensus sequence GTTTTGGAACCATTCGAAACAACACAGCTCTAAAAC and spacer length 30
35 JPGA01000003.1 GCA000722675_00017 CDS open 5532-5768 _na     78_aa comW sigma(X)-activator ComW
36 JPGA01000003.1 GCA000722675_00018 CDS open 5962-7296 _na     444_aa adenylosuccinate synthase
37 JPGA01000003.1 GCA000722675_00020 CDS open 7497-7964 _na     155_aa tadA tRNA adenosine(34) deaminase TadA
38 JPGA01000003.1 GCA000722675_00022 CDS open 8151-8594 _na     147_aa dut dUTP diphosphatase
39 JPGA01000003.1 GCA000722675_00023 CDS open 8557-9111 _na     184_aa Phosphoglycerate mutase family protein
40 JPGA01000003.1 GCA000722675_00024 CDS open 9128-9619 _na     163_aa hypothetical protein
41 JPGA01000003.1 GCA000722675_00025 CDS open 9687-11024 _na     445_aa radA DNA repair protein RadA
42 JPGA01000003.1 GCA000722675_00026 CDS open 11097-11591 _na     164_aa cynT Carbonic anhydrase
43 JPGA01000003.1 GCA000722675_00027 CDS open 11805-12773 _na     322_aa prs1 ribose-phosphate diphosphokinase
44 JPGA01000003.1 GCA000722675_00028 CDS open 13111-13743 _na     210_aa abpA amylase-binding adhesin AbpA
45 JPGA01000003.1 GCA000722675_00029 CDS open 13837-14670 _na     277_aa srtB class B sortase%2C LPKTxAVK-specific
46 JPGA01000003.1 GCA000722675_00030 CDS open 14789-15226 _na     145_aa yccU CoA-binding domain-containing protein
47 JPGA01000003.1 GCA000722675_00031 CDS open 15254-16264 _na     336_aa yeiH UPF0324 membrane protein spr0034
48 JPGA01000003.1 GCA000722675_00032 CDS open 16415-17584 _na     389_aa aspB pyridoxal phosphate-dependent aminotransferase
49 JPGA01000003.1 GCA000722675_00033 CDS open 17581-18351 _na     256_aa recO DNA repair protein RecO
50 JPGA01000003.1 GCA000722675_00034 CDS open 18348-19340 _na     330_aa plsX phosphate acyltransferase PlsX
51 JPGA01000003.1 GCA000722675_00035 CDS open 19346-19582 _na     78_aa Acyl carrier protein
52 JPGA01000003.1 GCA000722675_00036 CDS open 20020-20163 _na     47_aa Bacteriocin
53 JPGA01000003.1 GCA000722675_00037 CDS open 20181-20330 _na     49_aa Class IIb bacteriocin%2C lactobin A/cerein 7B family
54 JPGA01000003.1 GCA000722675_00038 CDS open 20343-20519 _na     58_aa DUF5668 domain-containing protein
55 JPGA01000003.1 GCA000722675_00039 CDS open 20669-20824 _na     51_aa Class IIb bacteriocin%2C lactobin A/cerein 7B family
56 JPGA01000003.1 GCA000722675_00040 CDS open 20849-21061 _na     70_aa Bacteriocin immunity protein
57 JPGA01000003.1 GCA000722675_00041 CDS open 21228-21437 _na     69_aa Bacteriocin immunity protein
58 JPGA01000003.1 GCA000722675_00042 CDS open 21439-21546 _na     35_aa hypothetical protein
59 JPGA01000003.1 GCA000722675_00043 CDS open 21799-23952 _na     717_aa comA Transport/processing ATP-binding protein ComA
60 JPGA01000003.1 GCA000722675_00044 CDS open 23965-25314 _na     449_aa Bacteriocin secretion accessory family protein
61 JPGA01000003.1 GCA000722675_00045 CDS open 25483-26190 _na     235_aa purC phosphoribosylaminoimidazolesuccinocarboxamide synthase
62 JPGA01000003.1 GCA000722675_00046 CDS open 26247-29972 _na     1241_aa purL2 phosphoribosylformylglycinamidine synthase
63 JPGA01000003.1 GCA000722675_00047 CDS open 29985-31427 _na     480_aa purF amidophosphoribosyltransferase
64 JPGA01000003.1 GCA000722675_00048 CDS open 31471-32493 _na     340_aa purM Phosphoribosylformylglycinamidine cyclo-ligase
65 JPGA01000003.1 GCA000722675_00049 CDS open 32490-33041 _na     183_aa Phosphoribosylglycinamide formyltransferase
66 JPGA01000003.1 GCA000722675_00050 CDS open 33086-33550 _na     154_aa GNAT family N-acetyltransferase
67 JPGA01000003.1 GCA000722675_00051 CDS open 33552-35099 _na     515_aa purH bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase
68 JPGA01000003.1 GCA000722675_00052 CDS open 35220-36482 _na     420_aa purD Phosphoribosylamine--glycine ligase
69 JPGA01000003.1 GCA000722675_00053 CDS open 36728-37216 _na     162_aa purE N5-carboxyaminoimidazole ribonucleotide mutase
70 JPGA01000003.1 GCA000722675_00054 CDS open 37203-38291 _na     362_aa purK 5-(carboxyamino)imidazole ribonucleotide synthase
71 JPGA01000003.1 GCA000722675_00055 CDS open 38309-39139 _na     276_aa SMODS-associating 2TM beta-strand rich effector domain-containing protein
72 JPGA01000003.1 GCA000722675_00056 CDS open 39146-40444 _na     432_aa purB adenylosuccinate lyase
73 JPGA01000003.1 GCA000722675_00057 CDS open 40888-41496 _na     202_aa ubiC UbiC transcription regulator-associated domain protein
74 JPGA01000003.1 GCA000722675_00058 CDS open 41502-41603 _na     33_aa hypothetical protein
75 JPGA01000003.1 GCA000722675_00059 CDS open 41925-43712 _na     595_aa ganA Beta-galactosidase 3
76 JPGA01000003.1 GCA000722675_00060 CDS open 43709-44185 _na     158_aa agaB PTS mannose transporter subunit IIAB
77 JPGA01000003.1 GCA000722675_00061 CDS open 44212-45117 _na     301_aa manY N-acetylgalactosamine permease IIC component 1
78 JPGA01000003.1 GCA000722675_00062 CDS open 45104-45925 _na     273_aa manZ Mannose permease IID component
79 JPGA01000003.1 GCA000722675_00063 CDS open 45929-46333 _na     134_aa manX PTS fructose transporter subunit IIA
80 JPGA01000003.1 GCA000722675_00065 CDS open 46604-47770 _na     388_aa agaS SIS domain-containing protein
81 JPGA01000003.1 GCA000722675_00066 CDS open 47781-48776 _na     331_aa lacD tagatose-bisphosphate aldolase
82 JPGA01000003.1 GCA000722675_00067 CDS open 48922-49959 _na     345_aa galM Aldose 1-epimerase
83 JPGA01000003.1 GCA000722675_00068 CDS open 50070-50924 _na     284_aa Catechol-2%2C3-dioxygenase
84 JPGA01000003.1 GCA000722675_00069 CDS open 51235-51807 _na     190_aa Tandem five-TM protein
85 JPGA01000003.1 GCA000722675_00070 CDS open 51809-52477 _na     222_aa hypothetical protein
86 JPGA01000003.1 GCA000722675_00071 CDS open 52599-53270 _na     223_aa UPF0016 family membrane protein
87 JPGA01000003.1 GCA000722675_00072 CDS open 53273-53929 _na     218_aa Gram-positive signal peptide protein%2C YSIRK family
88 JPGA01000003.1 GCA000722675_00073 CDS open 54008-54565 _na     185_aa DUF3592 domain-containing protein
89 JPGA01000003.1 GCA000722675_00074 CDS open 54765-55022 _na     85_aa frmR Transcriptional repressor FrmR
90 JPGA01000003.1 GCA000722675_00075 CDS open 55244-55540 _na     98_aa glpE Thiosulfate sulfurtransferase GlpE
91 JPGA01000003.1 GCA000722675_00076 CDS open 55885-56193 _na     102_aa Rhodanese-like domain protein
92 JPGA01000003.1 GCA000722675_00077 CDS open 56369-56932 _na     187_aa wbbJ Acetyltransferase
93 JPGA01000003.1 GCA000722675_00078 CDS open 56972-57661 _na     229_aa DUF4956 domain-containing protein
94 JPGA01000003.1 GCA000722675_00079 CDS open 57893-58423 _na     176_aa VTC domain protein
95 JPGA01000003.1 GCA000722675_00080 CDS open 58469-59860 _na     463_aa Lipoprotein
96 JPGA01000003.1 GCA000722675_00081 CDS open 60286-61002 _na     238_aa ABC transporter domain-containing protein
97 JPGA01000003.1 GCA000722675_00082 CDS open 61004-62086 _na     360_aa drrB ABC transporter%2C permease protein%2C DrrB family
98 JPGA01000003.1 GCA000722675_00083 CDS open 62126-62749 _na     207_aa Fatty acid metabolism regulator protein
99 JPGA01000003.1 GCA000722675_00084 CDS open 63022-63786 _na     254_aa udp Uridine phosphorylase
100 JPGA01000003.1 GCA000722675_00085 CDS open 63820-65199 _na     459_aa trkH Potassium uptake protein%2C TrkH family
101 JPGA01000003.1 GCA000722675_00086 CDS open 65213-65878 _na     221_aa Potassium transporter Trk
102 JPGA01000003.1 GCA000722675_00087 CDS open 66033-68567 _na     844_aa YSIRK signal domain/LPXTG anchor domain surface protein
103 JPGA01000003.1 GCA000722675_00088 CDS open 68648-68812 _na     54_aa Response regulator receiver domain protein
104 JPGA01000003.1 GCA000722675_00089 CDS open 68809-69345 _na     178_aa saeR Response regulator SaeR
105 JPGA01000003.1 GCA000722675_00090 CDS open 69342-70376 _na     344_aa histidine kinase
106 JPGA01000003.1 GCA000722675_00091 CDS open 70579-71190 _na     203_aa rpsD 30S ribosomal protein S4
107 JPGA01000003.1 GCA000722675_00092 CDS open 71323-71841 _na     172_aa HXXEE domain-containing protein
108 JPGA01000003.1 GCA000722675_00093 CDS open 71920-72069 _na     49_aa rpmG 50S ribosomal protein L33
109 JPGA01000003.1 GCA000722675_00094 CDS open 72085-72267 _na     60_aa rpmF 50S ribosomal protein L32
110 JPGA01000003.1 GCA000722675_00095 CDS open 72497-74200 _na     567_aa ilvD dihydroxy-acid dehydratase
111 JPGA01000003.1 GCA000722675_00096 CDS open 74367-74708 _na     113_aa paaD MIP18 family-like domain-containing protein
112 JPGA01000003.1 GCA000722675_00097 CDS open 74877-76157 _na     426_aa hisS histidine--tRNA ligase
113 JPGA01000003.1 GCA000722675_00098 CDS open 76301-76504 _na     67_aa Transcriptional regulator
114 JPGA01000003.1 GCA000722675_00099 CDS open 76504-76701 _na     65_aa Lipoprotein
115 JPGA01000003.1 GCA000722675_00100 CDS open 76704-77054 _na     116_aa pspC Phage shock protein PspC N-terminal domain-containing protein
116 JPGA01000003.1 GCA000722675_00101 CDS open 77073-77807 _na     244_aa DUF3169 domain-containing protein
117 JPGA01000003.1 GCA000722675_00102 CDS open 77819-78643 _na     274_aa ABC-type multidrug transport system%2C ATPase component
118 JPGA01000003.1 GCA000722675_00103 CDS open 78636-79334 _na     232_aa ABC transporter ATP-binding protein
119 JPGA01000003.1 GCA000722675_00104 CDS open 79344-79985 _na     213_aa CAAX amino terminal protease family protein
120 JPGA01000003.1 GCA000722675_00105 CDS open 80003-80221 _na     72_aa Excreted peptide
121 JPGA01000003.1 GCA000722675_00106 CDS open 80373-82136 _na     587_aa aspS aspartate--tRNA ligase
122 JPGA01000003.1 GCA000722675_00107 CDS open 82114-83055 _na     313_aa yitT DUF2179 domain-containing protein
123 JPGA01000003.1 GCA000722675_00108 CDS open 83089-84075 _na     328_aa malR HTH-type transcriptional regulator MalR
124 JPGA01000003.1 GCA000722675_00109 CDS open 84085-84891 _na     268_aa malA Maltodextrose utilization protein MalA
125 JPGA01000003.1 GCA000722675_00110 CDS open 85066-85908 _na     280_aa malD Maltodextrin transport system permease protein MalD
126 JPGA01000003.1 GCA000722675_00111 CDS open 85910-87202 _na     430_aa malC Maltodextrin transport system permease protein MalC
127 JPGA01000003.1 GCA000722675_00112 CDS open 87313-88584 _na     423_aa malX Maltooligosaccharide ABC transporter solute-binding lipoprotein
128 JPGA01000003.1 GCA000722675_00113 CDS open 89057-90574 _na     505_aa malQ 4-alpha-glucanotransferase
129 JPGA01000003.1 GCA000722675_00114 CDS open 90599-92857 _na     752_aa malP Maltodextrin phosphorylase
130 JPGA01000003.1 GCA000722675_00115 CDS open 92920-93768 _na     282_aa Ribosomal RNA large subunit methyltransferase A
131 JPGA01000003.1 GCA000722675_00116 CDS open 93823-95079 _na     418_aa tyrS tyrosine--tRNA ligase
132 JPGA01000003.1 GCA000722675_00117 CDS open 95220-97727 _na     835_aa pbp1b penicillin-binding protein PBP1B
133 JPGA01000003.1 GCA000722675_00118 CDS open 97805-98716 _na     303_aa eamA EamA domain-containing protein
134 JPGA01000003.1 GCA000722675_00119 CDS open 98801-99499 _na     232_aa dapD 2%2C3%2C4%2C5-tetrahydropyridine-2%2C6-dicarboxylate N-acetyltransferase
135 JPGA01000003.1 GCA000722675_00120 CDS open 99567-100697 _na     376_aa abgB N-acetyldiaminopimelate deacetylase
136 JPGA01000003.1 GCA000722675_00121 CDS open 100709-101248 _na     179_aa 5-formyltetrahydrofolate cyclo-ligase
137 JPGA01000003.1 GCA000722675_00122 CDS open 101232-101912 _na     226_aa glpG GlpG protein (Membrane protein of glp regulon)
138 JPGA01000003.1 GCA000722675_00123 CDS open 103000-103662 _na     220_aa csn2 type II-A CRISPR-associated protein Csn2
139 JPGA01000003.1 GCA000722675_00124 CDS open 103652-103996 _na     114_aa cas2 CRISPR-associated endonuclease Cas2
140 JPGA01000003.1 GCA000722675_00125 CDS open 103993-104859 _na     288_aa cas1 type II CRISPR-associated endonuclease Cas1
141 JPGA01000003.1 GCA000722675_00126 CDS open 104859-108986 _na     1375_aa cas9 type II CRISPR RNA-guided endonuclease Cas9
142 JPGA01000003.1 GCA000722675_00128 CDS open 109371-110270 _na     299_aa galU UTP--glucose-1-phosphate uridylyltransferase GalU
143 JPGA01000003.1 GCA000722675_00129 CDS open 110292-111308 _na     338_aa NAD(P)H-dependent glycerol-3-phosphate dehydrogenase
144 JPGA01000003.1 GCA000722675_00130 CDS open 111479-113221 _na     580_aa mdlB ABC transporter ATP-binding protein/permease
145 JPGA01000003.1 GCA000722675_00131 CDS open 113223-114989 _na     588_aa ABC transporter ATP-binding protein
146 JPGA01000003.1 GCA000722675_00132 CDS open 115129-115818 _na     229_aa puuD Gamma-glutamyl hydrolase
147 JPGA01000003.1 GCA000722675_00133 CDS open 115987-117336 _na     449_aa pgi glucose-6-phosphate isomerase
148 JPGA01000003.1 GCA000722675_00134 CDS open 117465-118925 _na     486_aa gltX glutamate--tRNA ligase
149 JPGA01000003.1 GCA000722675_00135 CDS open 118938-119372 _na     144_aa Cytidine/deoxycytidylate deaminase family protein
150 JPGA01000003.1 GCA000722675_00017 gene open 5532-5768 comW
151 JPGA01000003.1 GCA000722675_00018 gene open 5962-7296
152 JPGA01000003.1 GCA000722675_00020 gene open 7497-7964 tadA
153 JPGA01000003.1 GCA000722675_00022 gene open 8151-8594 dut
154 JPGA01000003.1 GCA000722675_00023 gene open 8557-9111
155 JPGA01000003.1 GCA000722675_00024 gene open 9128-9619
156 JPGA01000003.1 GCA000722675_00025 gene open 9687-11024 radA
157 JPGA01000003.1 GCA000722675_00026 gene open 11097-11591 cynT
158 JPGA01000003.1 GCA000722675_00027 gene open 11805-12773 prs1
159 JPGA01000003.1 GCA000722675_00028 gene open 13111-13743 abpA
160 JPGA01000003.1 GCA000722675_00029 gene open 13837-14670 srtB
161 JPGA01000003.1 GCA000722675_00030 gene open 14789-15226 yccU
162 JPGA01000003.1 GCA000722675_00031 gene open 15254-16264 yeiH
163 JPGA01000003.1 GCA000722675_00032 gene open 16415-17584 aspB
164 JPGA01000003.1 GCA000722675_00033 gene open 17581-18351 recO
165 JPGA01000003.1 GCA000722675_00034 gene open 18348-19340 plsX
166 JPGA01000003.1 GCA000722675_00035 gene open 19346-19582
167 JPGA01000003.1 GCA000722675_00036 gene open 20020-20163
168 JPGA01000003.1 GCA000722675_00037 gene open 20181-20330
169 JPGA01000003.1 GCA000722675_00038 gene open 20343-20519
170 JPGA01000003.1 GCA000722675_00039 gene open 20669-20824
171 JPGA01000003.1 GCA000722675_00040 gene open 20849-21061
172 JPGA01000003.1 GCA000722675_00041 gene open 21228-21437
173 JPGA01000003.1 GCA000722675_00042 gene open 21439-21546
174 JPGA01000003.1 GCA000722675_00043 gene open 21799-23952 comA
175 JPGA01000003.1 GCA000722675_00044 gene open 23965-25314
176 JPGA01000003.1 GCA000722675_00045 gene open 25483-26190 purC
177 JPGA01000003.1 GCA000722675_00046 gene open 26247-29972 purL2
178 JPGA01000003.1 GCA000722675_00047 gene open 29985-31427 purF
179 JPGA01000003.1 GCA000722675_00048 gene open 31471-32493 purM
180 JPGA01000003.1 GCA000722675_00049 gene open 32490-33041
181 JPGA01000003.1 GCA000722675_00050 gene open 33086-33550
182 JPGA01000003.1 GCA000722675_00051 gene open 33552-35099 purH
183 JPGA01000003.1 GCA000722675_00052 gene open 35220-36482 purD
184 JPGA01000003.1 GCA000722675_00053 gene open 36728-37216 purE
185 JPGA01000003.1 GCA000722675_00054 gene open 37203-38291 purK
186 JPGA01000003.1 GCA000722675_00055 gene open 38309-39139
187 JPGA01000003.1 GCA000722675_00056 gene open 39146-40444 purB
188 JPGA01000003.1 GCA000722675_00057 gene open 40888-41496 ubiC
189 JPGA01000003.1 GCA000722675_00058 gene open 41502-41603
190 JPGA01000003.1 GCA000722675_00059 gene open 41925-43712 ganA
191 JPGA01000003.1 GCA000722675_00060 gene open 43709-44185 agaB
192 JPGA01000003.1 GCA000722675_00061 gene open 44212-45117 manY
193 JPGA01000003.1 GCA000722675_00062 gene open 45104-45925 manZ
194 JPGA01000003.1 GCA000722675_00063 gene open 45929-46333 manX
195 JPGA01000003.1 GCA000722675_00065 gene open 46604-47770 agaS
196 JPGA01000003.1 GCA000722675_00066 gene open 47781-48776 lacD
197 JPGA01000003.1 GCA000722675_00067 gene open 48922-49959 galM
198 JPGA01000003.1 GCA000722675_00068 gene open 50070-50924
199 JPGA01000003.1 GCA000722675_00069 gene open 51235-51807
200 JPGA01000003.1 GCA000722675_00070 gene open 51809-52477
201 JPGA01000003.1 GCA000722675_00071 gene open 52599-53270
202 JPGA01000003.1 GCA000722675_00072 gene open 53273-53929
203 JPGA01000003.1 GCA000722675_00073 gene open 54008-54565
204 JPGA01000003.1 GCA000722675_00074 gene open 54765-55022 frmR
205 JPGA01000003.1 GCA000722675_00075 gene open 55244-55540 glpE
206 JPGA01000003.1 GCA000722675_00076 gene open 55885-56193
207 JPGA01000003.1 GCA000722675_00077 gene open 56369-56932 wbbJ
208 JPGA01000003.1 GCA000722675_00078 gene open 56972-57661
209 JPGA01000003.1 GCA000722675_00079 gene open 57893-58423
210 JPGA01000003.1 GCA000722675_00080 gene open 58469-59860
211 JPGA01000003.1 GCA000722675_00081 gene open 60286-61002
212 JPGA01000003.1 GCA000722675_00082 gene open 61004-62086 drrB
213 JPGA01000003.1 GCA000722675_00083 gene open 62126-62749
214 JPGA01000003.1 GCA000722675_00084 gene open 63022-63786 udp
215 JPGA01000003.1 GCA000722675_00085 gene open 63820-65199 trkH
216 JPGA01000003.1 GCA000722675_00086 gene open 65213-65878
217 JPGA01000003.1 GCA000722675_00087 gene open 66033-68567
218 JPGA01000003.1 GCA000722675_00088 gene open 68648-68812
219 JPGA01000003.1 GCA000722675_00089 gene open 68809-69345 saeR
220 JPGA01000003.1 GCA000722675_00090 gene open 69342-70376
221 JPGA01000003.1 GCA000722675_00091 gene open 70579-71190 rpsD
222 JPGA01000003.1 GCA000722675_00092 gene open 71323-71841
223 JPGA01000003.1 GCA000722675_00093 gene open 71920-72069 rpmG
224 JPGA01000003.1 GCA000722675_00094 gene open 72085-72267 rpmF
225 JPGA01000003.1 GCA000722675_00095 gene open 72497-74200 ilvD
226 JPGA01000003.1 GCA000722675_00096 gene open 74367-74708 paaD
227 JPGA01000003.1 GCA000722675_00097 gene open 74877-76157 hisS
228 JPGA01000003.1 GCA000722675_00098 gene open 76301-76504
229 JPGA01000003.1 GCA000722675_00099 gene open 76504-76701
230 JPGA01000003.1 GCA000722675_00100 gene open 76704-77054 pspC
231 JPGA01000003.1 GCA000722675_00101 gene open 77073-77807
232 JPGA01000003.1 GCA000722675_00102 gene open 77819-78643
233 JPGA01000003.1 GCA000722675_00103 gene open 78636-79334
234 JPGA01000003.1 GCA000722675_00104 gene open 79344-79985
235 JPGA01000003.1 GCA000722675_00105 gene open 80003-80221
236 JPGA01000003.1 GCA000722675_00106 gene open 80373-82136 aspS
237 JPGA01000003.1 GCA000722675_00107 gene open 82114-83055 yitT
238 JPGA01000003.1 GCA000722675_00108 gene open 83089-84075 malR
239 JPGA01000003.1 GCA000722675_00109 gene open 84085-84891 malA
240 JPGA01000003.1 GCA000722675_00110 gene open 85066-85908 malD
241 JPGA01000003.1 GCA000722675_00111 gene open 85910-87202 malC
242 JPGA01000003.1 GCA000722675_00112 gene open 87313-88584 malX
243 JPGA01000003.1 GCA000722675_00113 gene open 89057-90574 malQ
244 JPGA01000003.1 GCA000722675_00114 gene open 90599-92857 malP
245 JPGA01000003.1 GCA000722675_00115 gene open 92920-93768
246 JPGA01000003.1 GCA000722675_00116 gene open 93823-95079 tyrS
247 JPGA01000003.1 GCA000722675_00117 gene open 95220-97727 pbp1b
248 JPGA01000003.1 GCA000722675_00118 gene open 97805-98716 eamA
249 JPGA01000003.1 GCA000722675_00119 gene open 98801-99499 dapD
250 JPGA01000003.1 GCA000722675_00120 gene open 99567-100697 abgB
251 JPGA01000003.1 GCA000722675_00121 gene open 100709-101248
252 JPGA01000003.1 GCA000722675_00122 gene open 101232-101912 glpG
253 JPGA01000003.1 GCA000722675_00123 gene open 103000-103662 csn2
254 JPGA01000003.1 GCA000722675_00124 gene open 103652-103996 cas2
255 JPGA01000003.1 GCA000722675_00125 gene open 103993-104859 cas1
256 JPGA01000003.1 GCA000722675_00126 gene open 104859-108986 cas9
257 JPGA01000003.1 GCA000722675_00128 gene open 109371-110270 galU
258 JPGA01000003.1 GCA000722675_00129 gene open 110292-111308
259 JPGA01000003.1 GCA000722675_00130 gene open 111479-113221 mdlB
260 JPGA01000003.1 GCA000722675_00131 gene open 113223-114989
261 JPGA01000003.1 GCA000722675_00132 gene open 115129-115818 puuD
262 JPGA01000003.1 GCA000722675_00133 gene open 115987-117336 pgi
263 JPGA01000003.1 GCA000722675_00134 gene open 117465-118925 gltX
264 JPGA01000003.1 GCA000722675_00135 gene open 118938-119372
265 JPGA01000003.1 GCA000722675_00011 gene open 57-128 trnE
266 JPGA01000003.1 GCA000722675_00013 gene open 1955-2027 trnA
267 JPGA01000003.1 GCA000722675_00016 gene open 5250-5323 trnN
268 JPGA01000003.1 GCA000722675_00136 gene open 119488-119559 trnE
269 JPGA01000003.1 GCA000722675_00011 tRNA open 57-128 trnE tRNA-Glu(ttc)
270 JPGA01000003.1 GCA000722675_00013 tRNA open 1955-2027 trnA tRNA-Ala(tgc)
271 JPGA01000003.1 GCA000722675_00016 tRNA open 5250-5323 trnN tRNA-Asn(gtt)
272 JPGA01000003.1 GCA000722675_00136 tRNA open 119488-119559 trnE tRNA-Glu(ttc)
273 JPGA01000004.1 GCA000722675_00138 gene open 357-1903 rrs
274 JPGA01000004.1 GCA000722675_00140 gene open 2150-5053 rrl
275 JPGA01000004.1 GCA000722675_00141 gene open 5130-5245 rrf
276 JPGA01000004.1 GCA000722675_00196 gene open 43449-44995 rrs
277 JPGA01000004.1 GCA000722675_00198 gene open 45242-48145 rrl
278 JPGA01000004.1 GCA000722675_00199 gene open 48222-48337 rrf
279 JPGA01000004.1 GCA000722675_00138 rRNA open 357-1903 rrs 16S ribosomal RNA
280 JPGA01000004.1 GCA000722675_00140 rRNA open 2150-5053 rrl 23S ribosomal RNA
281 JPGA01000004.1 GCA000722675_00141 rRNA open 5130-5245 rrf 5S ribosomal RNA
282 JPGA01000004.1 GCA000722675_00196 rRNA open 43449-44995 rrs 16S ribosomal RNA
283 JPGA01000004.1 GCA000722675_00198 rRNA open 45242-48145 rrl 23S ribosomal RNA
284 JPGA01000004.1 GCA000722675_00199 rRNA open 48222-48337 rrf 5S ribosomal RNA
285 JPGA01000004.1 GCA000722675_00154 CDS open 6477-7754 _na     425_aa ybdK Carboxylate-amine ligase YbdK
286 JPGA01000004.1 GCA000722675_00155 CDS open 7830-9314 _na     494_aa thrC threonine synthase
287 JPGA01000004.1 GCA000722675_00156 CDS open 9375-10655 _na     426_aa norM putative multidrug resistance protein NorM
288 JPGA01000004.1 GCA000722675_00157 CDS open 10659-11279 _na     206_aa HAD family hydrolase
289 JPGA01000004.1 GCA000722675_00158 CDS open 11446-12630 _na     394_aa lysM LysM domain-containing protein
290 JPGA01000004.1 GCA000722675_00159 CDS open 12809-13666 _na     285_aa Beta-carotene 15%2C15'-monooxygenase
291 JPGA01000004.1 GCA000722675_00160 CDS open 13783-14925 _na     380_aa tgt tRNA guanosine(34) transglycosylase Tgt
292 JPGA01000004.1 GCA000722675_00161 CDS open 15059-16876 _na     605_aa oatA O-acetyltransferase OatA
293 JPGA01000004.1 GCA000722675_00162 CDS open 17017-18168 _na     383_aa nagA N-acetylglucosamine-6-phosphate deacetylase
294 JPGA01000004.1 GCA000722675_00163 CDS open 18321-18686 _na     121_aa Superoxide dismutase
295 JPGA01000004.1 GCA000722675_00164 CDS open 18748-19689 _na     313_aa comGA competence type IV pilus ATPase ComGA
296 JPGA01000004.1 GCA000722675_00165 CDS open 19805-20653 _na     282_aa comGB competence type IV pilus assembly protein ComGB
297 JPGA01000004.1 GCA000722675_00166 CDS open 20655-20978 _na     107_aa comGC competence type IV pilus major pilin ComGC
298 JPGA01000004.1 GCA000722675_00167 CDS open 20941-21375 _na     144_aa comGD competence type IV pilus minor pilin ComGD
299 JPGA01000004.1 GCA000722675_00168 CDS open 21338-21640 _na     100_aa comGE competence type IV pilus minor pilin ComGE
300 JPGA01000004.1 GCA000722675_00169 CDS open 21603-22064 _na     153_aa comGF competence type IV pilus minor pilin ComGF
301 JPGA01000004.1 GCA000722675_00170 CDS open 22042-22455 _na     137_aa comGG competence type IV pilus minor pilin ComGG
302 JPGA01000004.1 GCA000722675_00171 CDS open 22488-23078 _na     196_aa Ubiquinone biosynthesis O-methyltransferase
303 JPGA01000004.1 GCA000722675_00172 CDS open 23137-24090 _na     317_aa Adenine-specific methyltransferase
304 JPGA01000004.1 GCA000722675_00173 CDS open 24141-25331 _na     396_aa ackA Acetate kinase
305 JPGA01000004.1 GCA000722675_00174 CDS open 25481-25852 _na     123_aa rnpA ribonuclease P protein component
306 JPGA01000004.1 GCA000722675_00175 CDS open 25821-26654 _na     277_aa yidC Membrane protein insertase YidC
307 JPGA01000004.1 GCA000722675_00176 CDS open 26669-27655 _na     328_aa jag RNA-binding cell elongation regulator Jag/EloR
308 JPGA01000004.1 GCA000722675_00177 CDS open 27711-28334 _na     207_aa Ribonuclease P
309 JPGA01000004.1 GCA000722675_00178 CDS open 28452-30428 _na     658_aa tkt transketolase
310 JPGA01000004.1 GCA000722675_00179 CDS open 30548-30877 _na     109_aa yajC preprotein translocase subunit YajC
311 JPGA01000004.1 GCA000722675_00180 CDS open 30925-31368 _na     147_aa protein-tyrosine-phosphatase
312 JPGA01000004.1 GCA000722675_00181 CDS open 31355-31768 _na     137_aa MORN repeat protein
313 JPGA01000004.1 GCA000722675_00182 CDS open 32064-34715 _na     883_aa adhE bifunctional acetaldehyde-CoA/alcohol dehydrogenase
314 JPGA01000004.1 GCA000722675_00183 CDS open 34794-35099 _na     101_aa comR ComR tetratricopeptide domain-containing protein
315 JPGA01000004.1 GCA000722675_00184 CDS open 35117-35431 _na     104_aa comR ComR tetratricopeptide domain-containing protein
316 JPGA01000004.1 GCA000722675_00185 CDS open 35446-35547 _na     33_aa Transcriptional regulator
317 JPGA01000004.1 GCA000722675_00186 CDS open 35605-36165 _na     186_aa nemR HTH-type transcriptional repressor NemR
318 JPGA01000004.1 GCA000722675_00187 CDS open 36420-37043 _na     207_aa Cysteine hydrolase
319 JPGA01000004.1 GCA000722675_00188 CDS open 37266-38276 _na     336_aa gap type I glyceraldehyde-3-phosphate dehydrogenase
320 JPGA01000004.1 GCA000722675_00189 CDS open 38355-39230 _na     291_aa Pseudouridine synthase
321 JPGA01000004.1 GCA000722675_00190 CDS open 39317-41512 _na     731_aa pbp2a penicillin-binding protein PBP2A
322 JPGA01000004.1 GCA000722675_00191 CDS open 41727-41903 _na     58_aa secE preprotein translocase subunit SecE
323 JPGA01000004.1 GCA000722675_00192 CDS open 41956-42165 _na     69_aa nusG transcription termination/antitermination NusG family protein
324 JPGA01000004.1 GCA000722675_00193 CDS open 42168-42491 _na     107_aa nusG transcription termination/antitermination protein NusG
325 JPGA01000004.1 GCA000722675_00194 CDS open 42611-43084 _na     157_aa comX2 Transcriptional regulator ComX2
326 JPGA01000004.1 GCA000722675_00154 gene open 6477-7754 ybdK
327 JPGA01000004.1 GCA000722675_00155 gene open 7830-9314 thrC
328 JPGA01000004.1 GCA000722675_00156 gene open 9375-10655 norM
329 JPGA01000004.1 GCA000722675_00157 gene open 10659-11279
330 JPGA01000004.1 GCA000722675_00158 gene open 11446-12630 lysM
331 JPGA01000004.1 GCA000722675_00159 gene open 12809-13666
332 JPGA01000004.1 GCA000722675_00160 gene open 13783-14925 tgt
333 JPGA01000004.1 GCA000722675_00161 gene open 15059-16876 oatA
334 JPGA01000004.1 GCA000722675_00162 gene open 17017-18168 nagA
335 JPGA01000004.1 GCA000722675_00163 gene open 18321-18686
336 JPGA01000004.1 GCA000722675_00164 gene open 18748-19689 comGA
337 JPGA01000004.1 GCA000722675_00165 gene open 19805-20653 comGB
338 JPGA01000004.1 GCA000722675_00166 gene open 20655-20978 comGC
339 JPGA01000004.1 GCA000722675_00167 gene open 20941-21375 comGD
340 JPGA01000004.1 GCA000722675_00168 gene open 21338-21640 comGE
341 JPGA01000004.1 GCA000722675_00169 gene open 21603-22064 comGF
342 JPGA01000004.1 GCA000722675_00170 gene open 22042-22455 comGG
343 JPGA01000004.1 GCA000722675_00171 gene open 22488-23078
344 JPGA01000004.1 GCA000722675_00172 gene open 23137-24090
345 JPGA01000004.1 GCA000722675_00173 gene open 24141-25331 ackA
346 JPGA01000004.1 GCA000722675_00174 gene open 25481-25852 rnpA
347 JPGA01000004.1 GCA000722675_00175 gene open 25821-26654 yidC
348 JPGA01000004.1 GCA000722675_00176 gene open 26669-27655 jag
349 JPGA01000004.1 GCA000722675_00177 gene open 27711-28334
350 JPGA01000004.1 GCA000722675_00178 gene open 28452-30428 tkt
351 JPGA01000004.1 GCA000722675_00179 gene open 30548-30877 yajC
352 JPGA01000004.1 GCA000722675_00180 gene open 30925-31368
353 JPGA01000004.1 GCA000722675_00181 gene open 31355-31768
354 JPGA01000004.1 GCA000722675_00182 gene open 32064-34715 adhE
355 JPGA01000004.1 GCA000722675_00183 gene open 34794-35099 comR
356 JPGA01000004.1 GCA000722675_00184 gene open 35117-35431 comR
357 JPGA01000004.1 GCA000722675_00185 gene open 35446-35547
358 JPGA01000004.1 GCA000722675_00186 gene open 35605-36165 nemR
359 JPGA01000004.1 GCA000722675_00187 gene open 36420-37043
360 JPGA01000004.1 GCA000722675_00188 gene open 37266-38276 gap
361 JPGA01000004.1 GCA000722675_00189 gene open 38355-39230
362 JPGA01000004.1 GCA000722675_00190 gene open 39317-41512 pbp2a
363 JPGA01000004.1 GCA000722675_00191 gene open 41727-41903 secE
364 JPGA01000004.1 GCA000722675_00192 gene open 41956-42165 nusG
365 JPGA01000004.1 GCA000722675_00193 gene open 42168-42491 nusG
366 JPGA01000004.1 GCA000722675_00194 gene open 42611-43084 comX2
367 JPGA01000004.1 GCA000722675_00137 gene open 57-128 trnE
368 JPGA01000004.1 GCA000722675_00139 gene open 1955-2027 trnA
369 JPGA01000004.1 GCA000722675_00142 gene open 5250-5322 trnV
370 JPGA01000004.1 GCA000722675_00143 gene open 5328-5398 trnG
371 JPGA01000004.1 GCA000722675_00144 gene open 5434-5507 trnI
372 JPGA01000004.1 GCA000722675_00145 gene open 5519-5590 trnE
373 JPGA01000004.1 GCA000722675_00146 gene open 5597-5686 trnS
374 JPGA01000004.1 GCA000722675_00147 gene open 5698-5771 trnfM
375 JPGA01000004.1 GCA000722675_00148 gene open 5775-5847 trnF
376 JPGA01000004.1 GCA000722675_00149 gene open 5865-5945 trnY
377 JPGA01000004.1 GCA000722675_00150 gene open 5957-6027 trnW
378 JPGA01000004.1 GCA000722675_00151 gene open 6042-6114 trnH
379 JPGA01000004.1 GCA000722675_00152 gene open 6128-6199 trnQ
380 JPGA01000004.1 GCA000722675_00153 gene open 6209-6292 trnL
381 JPGA01000004.1 GCA000722675_00195 gene open 43149-43220 trnE
382 JPGA01000004.1 GCA000722675_00197 gene open 45047-45119 trnA
383 JPGA01000004.1 GCA000722675_00137 tRNA open 57-128 trnE tRNA-Glu(ttc)
384 JPGA01000004.1 GCA000722675_00139 tRNA open 1955-2027 trnA tRNA-Ala(tgc)
385 JPGA01000004.1 GCA000722675_00142 tRNA open 5250-5322 trnV tRNA-Val(tac)
386 JPGA01000004.1 GCA000722675_00143 tRNA open 5328-5398 trnG tRNA-Gly(tcc)
387 JPGA01000004.1 GCA000722675_00144 tRNA open 5434-5507 trnI tRNA-Ile(gat)
388 JPGA01000004.1 GCA000722675_00145 tRNA open 5519-5590 trnE tRNA-Glu(ttc)
389 JPGA01000004.1 GCA000722675_00146 tRNA open 5597-5686 trnS tRNA-Ser(tga)
390 JPGA01000004.1 GCA000722675_00147 tRNA open 5698-5771 trnfM tRNA-fMet(cat)
391 JPGA01000004.1 GCA000722675_00148 tRNA open 5775-5847 trnF tRNA-Phe(gaa)
392 JPGA01000004.1 GCA000722675_00149 tRNA open 5865-5945 trnY tRNA-Tyr(gta)
393 JPGA01000004.1 GCA000722675_00150 tRNA open 5957-6027 trnW tRNA-Trp(cca)
394 JPGA01000004.1 GCA000722675_00151 tRNA open 6042-6114 trnH tRNA-His(gtg)
395 JPGA01000004.1 GCA000722675_00152 tRNA open 6128-6199 trnQ tRNA-Gln(ttg)
396 JPGA01000004.1 GCA000722675_00153 tRNA open 6209-6292 trnL tRNA-Leu(caa)
397 JPGA01000004.1 GCA000722675_00195 tRNA open 43149-43220 trnE tRNA-Glu(ttc)
398 JPGA01000004.1 GCA000722675_00197 tRNA open 45047-45119 trnA tRNA-Ala(tgc)
399 JPGA01000005.1 GCA000722675_00360 gene open 150860-152406 rrs
400 JPGA01000005.1 regulatory_region open 63173-63268 23S methyl RNA motif
401 JPGA01000005.1 regulatory_region open 63839-64056 FMN riboswitch aptamer (RFN element)
402 JPGA01000005.1 regulatory_region open 71705-71784 Ribosomal protein L13 leader
403 JPGA01000005.1 GCA000722675_00360 rRNA open 150860-152406 rrs 16S ribosomal RNA
404 JPGA01000005.1 GCA000722675_00204 CDS open 519-4910 _na     1463_aa polC PolC-type DNA polymerase III
405 JPGA01000005.1 GCA000722675_00205 CDS open 4930-5082 _na     50_aa polC DNA polymerase III PolC
406 JPGA01000005.1 GCA000722675_00206 CDS open 5104-6345 _na     413_aa pepS Aminopeptidase PepS
407 JPGA01000005.1 GCA000722675_00207 CDS open 6355-6585 _na     76_aa Transglycosylase
408 JPGA01000005.1 GCA000722675_00208 CDS open 6659-7381 _na     240_aa Pseudouridine synthase
409 JPGA01000005.1 GCA000722675_00209 CDS open 7492-8826 _na     444_aa pepC aminopeptidase C
410 JPGA01000005.1 GCA000722675_00210 CDS open 8991-11219 _na     742_aa ATPase
411 JPGA01000005.1 GCA000722675_00211 CDS open 11277-12188 _na     303_aa Mannose permease IID component
412 JPGA01000005.1 GCA000722675_00212 CDS open 12203-13015 _na     270_aa PTS system mannose-specific transporter subunit IIC
413 JPGA01000005.1 GCA000722675_00213 CDS open 13091-14080 _na     329_aa agaB PTS system mannose-specific EIIAB component
414 JPGA01000005.1 GCA000722675_00214 CDS open 14363-15175 _na     270_aa HAD family hydrolase
415 JPGA01000005.1 GCA000722675_00215 CDS open 15364-16782 _na     472_aa Xanthine/uracil/vitamin C permease
416 JPGA01000005.1 GCA000722675_00216 CDS open 16836-17543 _na     235_aa CAAX amino terminal protease family membrane protein
417 JPGA01000005.1 GCA000722675_00217 CDS open 17646-18590 _na     314_aa folP dihydropteroate synthase
418 JPGA01000005.1 GCA000722675_00218 CDS open 18592-19914 _na     440_aa Dihydrofolate synthase/folylpolyglutamate synthase
419 JPGA01000005.1 GCA000722675_00219 CDS open 19895-20449 _na     184_aa folE GTP cyclohydrolase I FolE
420 JPGA01000005.1 GCA000722675_00220 CDS open 20598-21419 _na     273_aa folK 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase
421 JPGA01000005.1 GCA000722675_00221 CDS open 21412-22695 _na     427_aa DUF308 domain-containing protein
422 JPGA01000005.1 GCA000722675_00222 CDS open 22746-23063 _na     105_aa GTP cyclohydrolase
423 JPGA01000005.1 GCA000722675_00223 CDS open 23270-24280 _na     336_aa ccpA catabolite control protein A
424 JPGA01000005.1 GCA000722675_00224 CDS open 24527-25489 _na     320_aa ansA L-asparaginase (L-asparagine amidohydrolase)
425 JPGA01000005.1 GCA000722675_00225 CDS open 25555-26940 _na     461_aa Alanine aminotransferase
426 JPGA01000005.1 GCA000722675_00226 CDS open 26977-27429 _na     150_aa uspA Universal stress protein
427 JPGA01000005.1 GCA000722675_00227 CDS open 27595-27894 _na     99_aa DUF1656 domain-containing protein
428 JPGA01000005.1 GCA000722675_00228 CDS open 28038-29252 _na     404_aa aspB alanine transaminase
429 JPGA01000005.1 GCA000722675_00229 CDS open 29397-29531 _na     44_aa rpmH 50S ribosomal protein L34
430 JPGA01000005.1 GCA000722675_00230 CDS open 29713-31557 _na     614_aa Amino acid permease
431 JPGA01000005.1 GCA000722675_00231 CDS open 31709-32485 _na     258_aa tatD Hydrolase%2C TatD family
432 JPGA01000005.1 GCA000722675_00232 CDS open 32482-33045 _na     187_aa rnmV ribonuclease M5
433 JPGA01000005.1 GCA000722675_00233 CDS open 33057-33911 _na     284_aa Dehydrogenase
434 JPGA01000005.1 GCA000722675_00234 CDS open 34105-34440 _na     111_aa DUF771 domain-containing protein
435 JPGA01000005.1 GCA000722675_00235 CDS open 34437-35309 _na     290_aa rsmA 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA
436 JPGA01000005.1 GCA000722675_00236 CDS open 35311-36189 _na     292_aa rsgA ribosome small subunit-dependent GTPase A
437 JPGA01000005.1 GCA000722675_00237 CDS open 36200-36856 _na     218_aa rpe ribulose-phosphate 3-epimerase
438 JPGA01000005.1 GCA000722675_00238 CDS open 36819-37481 _na     220_aa thiN thiamine diphosphokinase
439 JPGA01000005.1 GCA000722675_00239 CDS open 37483-38739 _na     418_aa rmuC DNA recombination protein RmuC
440 JPGA01000005.1 GCA000722675_00240 CDS open 38729-39670 _na     313_aa yhaM 3'-5' exoribonuclease YhaM
441 JPGA01000005.1 GCA000722675_00241 CDS open 39798-40601 _na     267_aa purR pur operon repressor
442 JPGA01000005.1 GCA000722675_00242 CDS open 40668-41924 _na     418_aa lysA Diaminopimelate decarboxylase
443 JPGA01000005.1 GCA000722675_00243 CDS open 42046-42840 _na     264_aa pflA pyruvate formate-lyase-activating protein
444 JPGA01000005.1 GCA000722675_00244 CDS open 42913-43857 _na     314_aa yidC membrane protein insertase YidC
445 JPGA01000005.1 GCA000722675_00245 CDS open 43926-44204 _na     92_aa acyP acylphosphatase
446 JPGA01000005.1 GCA000722675_00246 CDS open 44339-44977 _na     212_aa trmH Putative TrmH family tRNA/rRNA methyltransferase
447 JPGA01000005.1 GCA000722675_00247 CDS open 45032-45715 _na     227_aa ybhL Inner membrane protein YbhL
448 JPGA01000005.1 GCA000722675_00248 CDS open 45825-46817 _na     330_aa asnA aspartate--ammonia ligase
449 JPGA01000005.1 GCA000722675_00249 CDS open 46882-47421 _na     179_aa rsmD 16S rRNA (guanine(966)-N(2))-methyltransferase RsmD
450 JPGA01000005.1 GCA000722675_00250 CDS open 47411-47899 _na     162_aa coaD pantetheine-phosphate adenylyltransferase
451 JPGA01000005.1 GCA000722675_00251 CDS open 47883-48920 _na     345_aa sepM SepM family pheromone-processing serine protease
452 JPGA01000005.1 GCA000722675_00252 CDS open 48976-49206 _na     76_aa Phosphopantetheine adenylyltransferase
453 JPGA01000005.1 GCA000722675_00253 CDS open 49230-50513 _na     427_aa murA UDP-N-acetylglucosamine 1-carboxyvinyltransferase
454 JPGA01000005.1 GCA000722675_00254 CDS open 50500-50694 _na     64_aa DNA-directed RNA polymerase subunit beta
455 JPGA01000005.1 GCA000722675_00255 CDS open 50735-51559 _na     274_aa DNA-entry nuclease
456 JPGA01000005.1 GCA000722675_00256 CDS open 51695-53026 _na     443_aa Membrane protein%2C PF01595 family
457 JPGA01000005.1 GCA000722675_00258 CDS open 53530-55509 _na     659_aa amiA Oligopeptide-binding protein AmiA
458 JPGA01000005.1 GCA000722675_00259 CDS open 55576-57072 _na     498_aa amiC Oligopeptide transport system permease protein AmiC
459 JPGA01000005.1 GCA000722675_00260 CDS open 57072-57998 _na     308_aa oppC oligopeptide ABC transporter permease OppC
460 JPGA01000005.1 GCA000722675_00261 CDS open 58007-59074 _na     355_aa amiE Oligopeptide transport ATP-binding protein AmiE
461 JPGA01000005.1 GCA000722675_00262 CDS open 59085-60014 _na     309_aa amiF Oligopeptide transport ATP-binding protein AmiF
462 JPGA01000005.1 GCA000722675_00263 CDS open 60103-61542 _na     479_aa trkG Trk system potassium uptake protein
463 JPGA01000005.1 GCA000722675_00264 CDS open 61546-62895 _na     449_aa trkA Trk system potassium transporter TrkA
464 JPGA01000005.1 GCA000722675_00265 CDS open 63295-63798 _na     167_aa trmL Putative tRNA (cytidine(34)-2'-O)-methyltransferase
465 JPGA01000005.1 GCA000722675_00266 CDS open 64210-64773 _na     187_aa fmnP Riboflavin transporter
466 JPGA01000005.1 GCA000722675_00267 CDS open 64787-65413 _na     208_aa bcrC Undecaprenyl-diphosphatase BcrC
467 JPGA01000005.1 GCA000722675_00268 CDS open 65687-66733 _na     348_aa pheS phenylalanine--tRNA ligase subunit alpha
468 JPGA01000005.1 GCA000722675_00269 CDS open 66852-69257 _na     801_aa pheT phenylalanine--tRNA ligase subunit beta
469 JPGA01000005.1 GCA000722675_00270 CDS open 69507-70400 _na     297_aa yhaQ ABC transporter domain-containing protein
470 JPGA01000005.1 GCA000722675_00271 CDS open 70466-71596 _na     376_aa ABC-2 type transporter transmembrane domain-containing protein
471 JPGA01000005.1 GCA000722675_00272 CDS open 71807-72253 _na     148_aa rplM 50S ribosomal protein L13
472 JPGA01000005.1 GCA000722675_00273 CDS open 72272-72664 _na     130_aa rpsI 30S ribosomal protein S9
473 JPGA01000005.1 GCA000722675_00274 CDS open 73048-74013 _na     321_aa DUF3137 domain-containing protein
474 JPGA01000005.1 GCA000722675_00275 CDS open 74218-74904 _na     228_aa Peptidase S24-like protein
475 JPGA01000005.1 GCA000722675_00276 CDS open 74908-76323 _na     471_aa DNA polymerase IV
476 JPGA01000005.1 GCA000722675_00277 CDS open 76320-76682 _na     120_aa YolD-like protein
477 JPGA01000005.1 GCA000722675_00278 CDS open 76675-76983 _na     102_aa Replication initiator protein A domain protein
478 JPGA01000005.1 GCA000722675_00279 CDS open 77006-77482 _na     158_aa Glutathione peroxidase
479 JPGA01000005.1 GCA000722675_00280 CDS open 77479-78057 _na     192_aa DUF3278 domain-containing protein
480 JPGA01000005.1 GCA000722675_00281 CDS open 78070-78411 _na     113_aa Inner membrane protein
481 JPGA01000005.1 GCA000722675_00282 CDS open 78422-78964 _na     180_aa DUF3278 domain-containing protein
482 JPGA01000005.1 GCA000722675_00283 CDS open 78980-79174 _na     64_aa xRE HTH cro/C1-type domain-containing protein
483 JPGA01000005.1 GCA000722675_00284 CDS open 79337-80287 _na     316_aa rsmH 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH
484 JPGA01000005.1 GCA000722675_00285 CDS open 80298-80615 _na     105_aa ftsL cell division protein FtsL
485 JPGA01000005.1 GCA000722675_00286 CDS open 80619-82874 _na     751_aa pbp2X penicillin-binding protein PBP2X
486 JPGA01000005.1 GCA000722675_00287 CDS open 82876-83856 _na     326_aa mraY phospho-N-acetylmuramoyl-pentapeptide-transferase
487 JPGA01000005.1 GCA000722675_00288 CDS open 83991-86495 _na     834_aa Glycosyl hydrolase family 65 central catalytic domain protein
488 JPGA01000005.1 GCA000722675_00289 CDS open 86758-87471 _na     237_aa treR trehalose operon repressor
489 JPGA01000005.1 GCA000722675_00290 CDS open 87656-89623 _na     655_aa treB PTS trehalose transporter subunit IIBC
490 JPGA01000005.1 GCA000722675_00291 CDS open 89687-91312 _na     541_aa treC alpha%2Calpha-phosphotrehalase
491 JPGA01000005.1 GCA000722675_00292 CDS open 91457-91702 _na     81_aa yneF UPF0154 protein SPH_1998
492 JPGA01000005.1 GCA000722675_00293 CDS open 91908-92702 _na     264_aa racE glutamate racemase
493 JPGA01000005.1 GCA000722675_00294 CDS open 92699-93670 _na     323_aa nucleoside-triphosphate diphosphatase
494 JPGA01000005.1 GCA000722675_00295 CDS open 93646-94167 _na     173_aa yfcE Phosphoesterase
495 JPGA01000005.1 GCA000722675_00296 CDS open 94164-94625 _na     153_aa cbpB cyclic-di-AMP-binding protein CbpB
496 JPGA01000005.1 GCA000722675_00297 CDS open 94616-95356 _na     246_aa xerD site-specific tyrosine recombinase XerD
497 JPGA01000005.1 GCA000722675_00298 CDS open 95356-96084 _na     242_aa scpA segregation/condensation protein A
498 JPGA01000005.1 GCA000722675_00299 CDS open 96103-96672 _na     189_aa scpB SMC-Scp complex subunit ScpB
499 JPGA01000005.1 GCA000722675_00300 CDS open 96659-97381 _na     240_aa rsuA Pseudouridine synthase
500 JPGA01000005.1 GCA000722675_00301 CDS open 97655-98626 _na     323_aa ceuA Iron-compound ABC transporter iron-compound-binding protein