BAKTAGenome Explorer: Fusobacterium necrophorum (GCA_001597545.1)
Select a Genome:
|
BAKTA Annotations for GCA_001597545.1
|
Search & Sort all 4079 Records
| ||||||||||||||||||
Notes: 1- Column headers only sort the current page. 2- Select [NA] or [AA] links to show sequences.
| Region | Protein-ID | Type | Genome Viewer |
Range (bp) |
Show Sequences (length) NA / AA |
BAKTA Gene |
BAKTA GeneProduct |
|
|---|---|---|---|---|---|---|---|---|
| 1 | LVFB01000001.1 | regulatory_region | open | 46848-47032 | Lysine riboswitch aptamer | |||
| 2 | LVFB01000001.1 | GCA001597545_00245 | CDS | open | 145-1458 | _na 437_aa | Propionate permease | |
| 3 | LVFB01000001.1 | GCA001597545_00246 | CDS | open | 1468-3027 | _na 519_aa | 3-oxoacid CoA-transferase | |
| 4 | LVFB01000001.1 | GCA001597545_00247 | CDS | open | 3065-3850 | _na 261_aa | 3-hydroxybutyryl-CoA dehydratase | |
| 5 | LVFB01000001.1 | GCA001597545_00248 | CDS | open | 3970-4425 | _na 151_aa | maoC | MaoC family dehydratase |
| 6 | LVFB01000001.1 | GCA001597545_00249 | CDS | open | 4462-5499 | _na 345_aa | Electron transfer flavoprotein subunit alpha | |
| 7 | LVFB01000001.1 | GCA001597545_00250 | CDS | open | 5513-6313 | _na 266_aa | Electron transfer flavoprotein subunit beta | |
| 8 | LVFB01000001.1 | GCA001597545_00251 | CDS | open | 6328-7464 | _na 378_aa | acrC | acryloyl-CoA reductase |
| 9 | LVFB01000001.1 | GCA001597545_00252 | CDS | open | 7489-8697 | _na 402_aa | Formyl-CoA transferase | |
| 10 | LVFB01000001.1 | GCA001597545_00253 | CDS | open | 8725-10047 | _na 440_aa | Permease | |
| 11 | LVFB01000001.1 | GCA001597545_00254 | CDS | open | 10065-10853 | _na 262_aa | 3-hydroxybutyryl-CoA dehydratase | |
| 12 | LVFB01000001.1 | GCA001597545_00255 | CDS | open | 11103-12509 | _na 468_aa | AAA family ATPase | |
| 13 | LVFB01000001.1 | GCA001597545_00256 | CDS | open | 12600-14141 | _na 513_aa | citF | citrate lyase subunit alpha |
| 14 | LVFB01000001.1 | GCA001597545_00257 | CDS | open | 14143-15045 | _na 300_aa | Putative citrate (Pro-3S)-lyase%2C beta subunit | |
| 15 | LVFB01000001.1 | GCA001597545_00258 | CDS | open | 15056-15340 | _na 94_aa | citD | citrate lyase acyl carrier protein |
| 16 | LVFB01000001.1 | GCA001597545_00259 | CDS | open | 15353-16471 | _na 372_aa | Glutaconyl-CoA decarboxylase subunit beta | |
| 17 | LVFB01000001.1 | GCA001597545_00260 | CDS | open | 16485-16850 | _na 121_aa | Biotin-requiring enzyme | |
| 18 | LVFB01000001.1 | GCA001597545_00261 | CDS | open | 16860-17195 | _na 111_aa | Oxaloacetate decarboxylase%2C gamma chain | |
| 19 | LVFB01000001.1 | GCA001597545_00262 | CDS | open | 17204-18595 | _na 463_aa | oxaloacetate decarboxylase subunit alpha | |
| 20 | LVFB01000001.1 | GCA001597545_00263 | CDS | open | 18623-19972 | _na 449_aa | 2-hydroxycarboxylate transporter family protein | |
| 21 | LVFB01000001.1 | GCA001597545_00264 | CDS | open | 20141-20794 | _na 217_aa | gntR | GntR family transcriptional regulator |
| 22 | LVFB01000001.1 | GCA001597545_00265 | CDS | open | 21074-21553 | _na 159_aa | Ecotin | |
| 23 | LVFB01000001.1 | GCA001597545_00266 | CDS | open | 21617-21961 | _na 114_aa | 4Fe-4S Mo/W bis-MGD-type domain-containing protein | |
| 24 | LVFB01000001.1 | GCA001597545_00267 | CDS | open | 21961-23277 | _na 438_aa | Pyridine nucleotide-disulfide oxidoreductase | |
| 25 | LVFB01000001.1 | GCA001597545_00268 | CDS | open | 23292-24725 | _na 477_aa | FAD dependent oxidoreductase | |
| 26 | LVFB01000001.1 | GCA001597545_00269 | CDS | open | 24861-26360 | _na 499_aa | glpK | glycerol kinase GlpK |
| 27 | LVFB01000001.1 | GCA001597545_00270 | CDS | open | 26373-27122 | _na 249_aa | MIP family channel protein | |
| 28 | LVFB01000001.1 | GCA001597545_00271 | CDS | open | 27296-28579 | _na 427_aa | dctM | TRAP transporter%2C DctM subunit |
| 29 | LVFB01000001.1 | GCA001597545_00272 | CDS | open | 28592-29050 | _na 152_aa | TRAP transporter%2C DctQ-like membrane protein | |
| 30 | LVFB01000001.1 | GCA001597545_00273 | CDS | open | 29063-30082 | _na 339_aa | C4-dicarboxylate ABC transporter | |
| 31 | LVFB01000001.1 | GCA001597545_00274 | CDS | open | 30102-30836 | _na 244_aa | Glycerophosphodiester phosphodiesterase family protein | |
| 32 | LVFB01000001.1 | GCA001597545_00275 | CDS | open | 30975-31379 | _na 134_aa | phosphoenolpyruvate--glycerone phosphotransferase | |
| 33 | LVFB01000001.1 | GCA001597545_00276 | CDS | open | 31388-31999 | _na 203_aa | dhaL | dihydroxyacetone kinase subunit DhaL |
| 34 | LVFB01000001.1 | GCA001597545_00277 | CDS | open | 32010-32996 | _na 328_aa | dhaK | dihydroxyacetone kinase subunit DhaK |
| 35 | LVFB01000001.1 | GCA001597545_00278 | CDS | open | 33050-33610 | _na 186_aa | Glycerol-3-phosphate responsive antiterminator | |
| 36 | LVFB01000001.1 | GCA001597545_00279 | CDS | open | 33612-34166 | _na 184_aa | Fe-S-containing hydro-lyase | |
| 37 | LVFB01000001.1 | GCA001597545_00280 | CDS | open | 34176-35021 | _na 281_aa | fumarate hydratase | |
| 38 | LVFB01000001.1 | GCA001597545_00281 | CDS | open | 35030-36268 | _na 412_aa | Aminotransferase | |
| 39 | LVFB01000001.1 | GCA001597545_00282 | CDS | open | 36341-36892 | _na 183_aa | Porin | |
| 40 | LVFB01000001.1 | GCA001597545_00283 | CDS | open | 36912-38066 | _na 384_aa | L%2CD-TPase catalytic domain-containing protein | |
| 41 | LVFB01000001.1 | GCA001597545_00284 | CDS | open | 38220-39017 | _na 265_aa | B12 binding domain protein | |
| 42 | LVFB01000001.1 | GCA001597545_00285 | CDS | open | 39014-40579 | _na 521_aa | D-Lysine 5%2C6-aminomutase alpha subunit | |
| 43 | LVFB01000001.1 | GCA001597545_00286 | CDS | open | 40586-42004 | _na 472_aa | mutS | DNA mismatch repair proteins mutS family domain-containing protein |
| 44 | LVFB01000001.1 | GCA001597545_00287 | CDS | open | 41992-43074 | _na 360_aa | hydF | Hydrogenase maturation GTPase HydF |
| 45 | LVFB01000001.1 | GCA001597545_00288 | CDS | open | 43099-44358 | _na 419_aa | ablA | lysine 2%2C3-aminomutase |
| 46 | LVFB01000001.1 | GCA001597545_00289 | CDS | open | 44421-45458 | _na 345_aa | L-erythro-3%2C5-diaminohexanoate dehydrogenase | |
| 47 | LVFB01000001.1 | GCA001597545_00290 | CDS | open | 45461-46297 | _na 278_aa | 3-keto-5-aminohexanoate cleavage enzyme | |
| 48 | LVFB01000001.1 | GCA001597545_00291 | CDS | open | 46332-46715 | _na 127_aa | Thioesterase domain-containing protein | |
| 49 | LVFB01000001.1 | GCA001597545_00292 | CDS | open | 47257-47541 | _na 94_aa | CXXX repeat peptide modification system protein | |
| 50 | LVFB01000001.1 | GCA001597545_00293 | CDS | open | 47543-47665 | _na 40_aa | hypothetical protein | |
| 51 | LVFB01000001.1 | GCA001597545_00294 | CDS | open | 47982-48257 | _na 91_aa | DNA-binding protein HU | |
| 52 | LVFB01000001.1 | GCA001597545_00295 | CDS | open | 48373-49173 | _na 266_aa | L-allo-threonine dehydrogenase | |
| 53 | LVFB01000001.1 | GCA001597545_00296 | CDS | open | 49351-49689 | _na 112_aa | Histidine triad domain protein | |
| 54 | LVFB01000001.1 | GCA001597545_00297 | CDS | open | 49704-50147 | _na 147_aa | rpiB | ribose 5-phosphate isomerase B |
| 55 | LVFB01000001.1 | GCA001597545_00298 | CDS | open | 50160-50645 | _na 161_aa | peptidylprolyl isomerase | |
| 56 | LVFB01000001.1 | GCA001597545_00299 | CDS | open | 50674-51213 | _na 179_aa | 4-methyl-5(B-hydroxyethyl)-thiazole monophosphate biosynthesis protein | |
| 57 | LVFB01000001.1 | GCA001597545_00300 | CDS | open | 51262-52563 | _na 433_aa | Suppressor of fused protein | |
| 58 | LVFB01000001.1 | GCA001597545_00301 | CDS | open | 52694-53302 | _na 202_aa | CDP-alcohol phosphatidyltransferase | |
| 59 | LVFB01000001.1 | GCA001597545_00302 | CDS | open | 53299-54234 | _na 311_aa | Phosphatidate cytidylyltransferase | |
| 60 | LVFB01000001.1 | GCA001597545_00303 | CDS | open | 54261-54878 | _na 205_aa | Acyltransferase | |
| 61 | LVFB01000001.1 | GCA001597545_00304 | CDS | open | 54939-55610 | _na 223_aa | Methylase | |
| 62 | LVFB01000001.1 | GCA001597545_00305 | CDS | open | 56101-56592 | _na 163_aa | FR47-like protein | |
| 63 | LVFB01000001.1 | GCA001597545_00306 | CDS | open | 56711-57133 | _na 140_aa | SRPBCC family protein | |
| 64 | LVFB01000001.1 | GCA001597545_00307 | CDS | open | 57375-57950 | _na 191_aa | DUF4375 domain-containing protein | |
| 65 | LVFB01000001.1 | GCA001597545_00308 | CDS | open | 57980-58420 | _na 146_aa | PF10020 family protein | |
| 66 | LVFB01000001.1 | GCA001597545_00309 | CDS | open | 58457-59074 | _na 205_aa | hypothetical protein | |
| 67 | LVFB01000001.1 | GCA001597545_00310 | CDS | open | 59095-59220 | _na 41_aa | hypothetical protein | |
| 68 | LVFB01000001.1 | GCA001597545_00311 | CDS | open | 59429-59881 | _na 150_aa | SMI1/KNR4 family protein | |
| 69 | LVFB01000001.1 | GCA001597545_00312 | CDS | open | 59976-60329 | _na 117_aa | Knr4/Smi1-like domain-containing protein | |
| 70 | LVFB01000001.1 | GCA001597545_00313 | CDS | open | 61303-62328 | _na 341_aa | yhcG | YhcG PDDEXK nuclease domain-containing protein |
| 71 | LVFB01000001.1 | GCA001597545_00314 | CDS | open | 62456-62959 | _na 167_aa | PF12958 family protein | |
| 72 | LVFB01000001.1 | GCA001597545_00315 | CDS | open | 63046-63273 | _na 75_aa | hypothetical protein | |
| 73 | LVFB01000001.1 | GCA001597545_00316 | CDS | open | 63295-63633 | _na 112_aa | hypothetical protein | |
| 74 | LVFB01000001.1 | GCA001597545_00317 | CDS | open | 63651-63974 | _na 107_aa | hypothetical protein | |
| 75 | LVFB01000001.1 | GCA001597545_00318 | CDS | open | 64011-64256 | _na 81_aa | Immunity protein 17 | |
| 76 | LVFB01000001.1 | GCA001597545_00319 | CDS | open | 64727-65785 | _na 352_aa | Leucine-rich repeat domain-containing protein | |
| 77 | LVFB01000001.1 | GCA001597545_00320 | CDS | open | 66159-66401 | _na 80_aa | DUF4176 domain-containing protein | |
| 78 | LVFB01000001.1 | GCA001597545_00321 | CDS | open | 66539-67342 | _na 267_aa | Histidinol-phosphatase | |
| 79 | LVFB01000001.1 | GCA001597545_00322 | CDS | open | 67431-69836 | _na 801_aa | Rhodanese domain-containing protein | |
| 80 | LVFB01000001.1 | GCA001597545_00323 | CDS | open | 69833-70135 | _na 100_aa | Transcriptional regulator | |
| 81 | LVFB01000001.1 | GCA001597545_00324 | CDS | open | 70349-71782 | _na 477_aa | Amino acid carrier protein | |
| 82 | LVFB01000001.1 | GCA001597545_00325 | CDS | open | 71856-73316 | _na 486_aa | cobyric acid synthase | |
| 83 | LVFB01000001.1 | GCA001597545_00326 | CDS | open | 73411-73713 | _na 100_aa | FMN-binding domain protein | |
| 84 | LVFB01000001.1 | GCA001597545_00327 | CDS | open | 73802-75004 | _na 400_aa | 2-hydroxyglutaryl-CoA dehydratase | |
| 85 | LVFB01000001.1 | GCA001597545_00328 | CDS | open | 75008-77938 | _na 976_aa | 2-hydroxyglutaryl-CoA dehydratase | |
| 86 | LVFB01000001.1 | GCA001597545_00329 | CDS | open | 77987-78703 | _na 238_aa | Murein L%2CD-transpeptidase catalytic domain family protein | |
| 87 | LVFB01000001.1 | GCA001597545_00330 | CDS | open | 78717-78848 | _na 43_aa | hypothetical protein | |
| 88 | LVFB01000001.1 | GCA001597545_00331 | CDS | open | 78896-79258 | _na 120_aa | hypothetical protein | |
| 89 | LVFB01000001.1 | GCA001597545_00332 | CDS | open | 79337-81886 | _na 849_aa | clpB | ATP-dependent chaperone ClpB |
| 90 | LVFB01000001.1 | GCA001597545_00333 | CDS | open | 82068-83465 | _na 465_aa | C4-dicarboxylate ABC transporter | |
| 91 | LVFB01000001.1 | GCA001597545_00334 | CDS | open | 83544-85016 | _na 490_aa | Xaa-His dipeptidase | |
| 92 | LVFB01000001.1 | GCA001597545_00335 | CDS | open | 85242-85778 | _na 178_aa | mutT | DNA mismatch repair protein MutT |
| 93 | LVFB01000001.1 | GCA001597545_00336 | CDS | open | 85720-86598 | _na 292_aa | eamA | EamA domain-containing protein |
| 94 | LVFB01000001.1 | GCA001597545_00337 | CDS | open | 86968-87915 | _na 315_aa | DUF2207 domain-containing protein | |
| 95 | LVFB01000001.1 | GCA001597545_00338 | CDS | open | 88029-88337 | _na 102_aa | Cupin | |
| 96 | LVFB01000001.1 | GCA001597545_00339 | CDS | open | 88390-88752 | _na 120_aa | hypothetical protein | |
| 97 | LVFB01000001.1 | GCA001597545_00340 | CDS | open | 88947-89498 | _na 183_aa | ykuD | YkuD domain-containing protein |
| 98 | LVFB01000001.1 | GCA001597545_00341 | CDS | open | 90091-90324 | _na 77_aa | Tetratricopeptide repeat protein | |
| 99 | LVFB01000001.1 | GCA001597545_00342 | CDS | open | 90742-91218 | _na 158_aa | MFS transporter | |
| 100 | LVFB01000001.1 | GCA001597545_00343 | CDS | open | 91286-91618 | _na 110_aa | inorganic diphosphatase | |
| 101 | LVFB01000001.1 | GCA001597545_00344 | CDS | open | 91691-92170 | _na 159_aa | Flavin reductase | |
| 102 | LVFB01000001.1 | GCA001597545_00345 | CDS | open | 92188-92979 | _na 263_aa | Ribosomal protein L11 methyltransferase-like protein | |
| 103 | LVFB01000001.1 | GCA001597545_00346 | CDS | open | 93074-93253 | _na 59_aa | GNAT family N-acetyltransferase | |
| 104 | LVFB01000001.1 | GCA001597545_00347 | CDS | open | 93508-93975 | _na 155_aa | Diamine acetyltransferase | |
| 105 | LVFB01000001.1 | GCA001597545_00348 | CDS | open | 94131-95021 | _na 296_aa | B12-binding domain-containing radical SAM protein | |
| 106 | LVFB01000001.1 | GCA001597545_00349 | CDS | open | 95212-95724 | _na 170_aa | Acetyl-CoA carboxylase biotin carboxyl carrier protein subunit | |
| 107 | LVFB01000001.1 | GCA001597545_00350 | CDS | open | 96037-96327 | _na 96_aa | DUF5683 domain-containing protein | |
| 108 | LVFB01000001.1 | GCA001597545_00245 | gene | open | 145-1458 | |||
| 109 | LVFB01000001.1 | GCA001597545_00246 | gene | open | 1468-3027 | |||
| 110 | LVFB01000001.1 | GCA001597545_00247 | gene | open | 3065-3850 | |||
| 111 | LVFB01000001.1 | GCA001597545_00248 | gene | open | 3970-4425 | maoC | ||
| 112 | LVFB01000001.1 | GCA001597545_00249 | gene | open | 4462-5499 | |||
| 113 | LVFB01000001.1 | GCA001597545_00250 | gene | open | 5513-6313 | |||
| 114 | LVFB01000001.1 | GCA001597545_00251 | gene | open | 6328-7464 | acrC | ||
| 115 | LVFB01000001.1 | GCA001597545_00252 | gene | open | 7489-8697 | |||
| 116 | LVFB01000001.1 | GCA001597545_00253 | gene | open | 8725-10047 | |||
| 117 | LVFB01000001.1 | GCA001597545_00254 | gene | open | 10065-10853 | |||
| 118 | LVFB01000001.1 | GCA001597545_00255 | gene | open | 11103-12509 | |||
| 119 | LVFB01000001.1 | GCA001597545_00256 | gene | open | 12600-14141 | citF | ||
| 120 | LVFB01000001.1 | GCA001597545_00257 | gene | open | 14143-15045 | |||
| 121 | LVFB01000001.1 | GCA001597545_00258 | gene | open | 15056-15340 | citD | ||
| 122 | LVFB01000001.1 | GCA001597545_00259 | gene | open | 15353-16471 | |||
| 123 | LVFB01000001.1 | GCA001597545_00260 | gene | open | 16485-16850 | |||
| 124 | LVFB01000001.1 | GCA001597545_00261 | gene | open | 16860-17195 | |||
| 125 | LVFB01000001.1 | GCA001597545_00262 | gene | open | 17204-18595 | |||
| 126 | LVFB01000001.1 | GCA001597545_00263 | gene | open | 18623-19972 | |||
| 127 | LVFB01000001.1 | GCA001597545_00264 | gene | open | 20141-20794 | gntR | ||
| 128 | LVFB01000001.1 | GCA001597545_00265 | gene | open | 21074-21553 | |||
| 129 | LVFB01000001.1 | GCA001597545_00266 | gene | open | 21617-21961 | |||
| 130 | LVFB01000001.1 | GCA001597545_00267 | gene | open | 21961-23277 | |||
| 131 | LVFB01000001.1 | GCA001597545_00268 | gene | open | 23292-24725 | |||
| 132 | LVFB01000001.1 | GCA001597545_00269 | gene | open | 24861-26360 | glpK | ||
| 133 | LVFB01000001.1 | GCA001597545_00270 | gene | open | 26373-27122 | |||
| 134 | LVFB01000001.1 | GCA001597545_00271 | gene | open | 27296-28579 | dctM | ||
| 135 | LVFB01000001.1 | GCA001597545_00272 | gene | open | 28592-29050 | |||
| 136 | LVFB01000001.1 | GCA001597545_00273 | gene | open | 29063-30082 | |||
| 137 | LVFB01000001.1 | GCA001597545_00274 | gene | open | 30102-30836 | |||
| 138 | LVFB01000001.1 | GCA001597545_00275 | gene | open | 30975-31379 | |||
| 139 | LVFB01000001.1 | GCA001597545_00276 | gene | open | 31388-31999 | dhaL | ||
| 140 | LVFB01000001.1 | GCA001597545_00277 | gene | open | 32010-32996 | dhaK | ||
| 141 | LVFB01000001.1 | GCA001597545_00278 | gene | open | 33050-33610 | |||
| 142 | LVFB01000001.1 | GCA001597545_00279 | gene | open | 33612-34166 | |||
| 143 | LVFB01000001.1 | GCA001597545_00280 | gene | open | 34176-35021 | |||
| 144 | LVFB01000001.1 | GCA001597545_00281 | gene | open | 35030-36268 | |||
| 145 | LVFB01000001.1 | GCA001597545_00282 | gene | open | 36341-36892 | |||
| 146 | LVFB01000001.1 | GCA001597545_00283 | gene | open | 36912-38066 | |||
| 147 | LVFB01000001.1 | GCA001597545_00284 | gene | open | 38220-39017 | |||
| 148 | LVFB01000001.1 | GCA001597545_00285 | gene | open | 39014-40579 | |||
| 149 | LVFB01000001.1 | GCA001597545_00286 | gene | open | 40586-42004 | mutS | ||
| 150 | LVFB01000001.1 | GCA001597545_00287 | gene | open | 41992-43074 | hydF | ||
| 151 | LVFB01000001.1 | GCA001597545_00288 | gene | open | 43099-44358 | ablA | ||
| 152 | LVFB01000001.1 | GCA001597545_00289 | gene | open | 44421-45458 | |||
| 153 | LVFB01000001.1 | GCA001597545_00290 | gene | open | 45461-46297 | |||
| 154 | LVFB01000001.1 | GCA001597545_00291 | gene | open | 46332-46715 | |||
| 155 | LVFB01000001.1 | GCA001597545_00292 | gene | open | 47257-47541 | |||
| 156 | LVFB01000001.1 | GCA001597545_00293 | gene | open | 47543-47665 | |||
| 157 | LVFB01000001.1 | GCA001597545_00294 | gene | open | 47982-48257 | |||
| 158 | LVFB01000001.1 | GCA001597545_00295 | gene | open | 48373-49173 | |||
| 159 | LVFB01000001.1 | GCA001597545_00296 | gene | open | 49351-49689 | |||
| 160 | LVFB01000001.1 | GCA001597545_00297 | gene | open | 49704-50147 | rpiB | ||
| 161 | LVFB01000001.1 | GCA001597545_00298 | gene | open | 50160-50645 | |||
| 162 | LVFB01000001.1 | GCA001597545_00299 | gene | open | 50674-51213 | |||
| 163 | LVFB01000001.1 | GCA001597545_00300 | gene | open | 51262-52563 | |||
| 164 | LVFB01000001.1 | GCA001597545_00301 | gene | open | 52694-53302 | |||
| 165 | LVFB01000001.1 | GCA001597545_00302 | gene | open | 53299-54234 | |||
| 166 | LVFB01000001.1 | GCA001597545_00303 | gene | open | 54261-54878 | |||
| 167 | LVFB01000001.1 | GCA001597545_00304 | gene | open | 54939-55610 | |||
| 168 | LVFB01000001.1 | GCA001597545_00305 | gene | open | 56101-56592 | |||
| 169 | LVFB01000001.1 | GCA001597545_00306 | gene | open | 56711-57133 | |||
| 170 | LVFB01000001.1 | GCA001597545_00307 | gene | open | 57375-57950 | |||
| 171 | LVFB01000001.1 | GCA001597545_00308 | gene | open | 57980-58420 | |||
| 172 | LVFB01000001.1 | GCA001597545_00309 | gene | open | 58457-59074 | |||
| 173 | LVFB01000001.1 | GCA001597545_00310 | gene | open | 59095-59220 | |||
| 174 | LVFB01000001.1 | GCA001597545_00311 | gene | open | 59429-59881 | |||
| 175 | LVFB01000001.1 | GCA001597545_00312 | gene | open | 59976-60329 | |||
| 176 | LVFB01000001.1 | GCA001597545_00313 | gene | open | 61303-62328 | yhcG | ||
| 177 | LVFB01000001.1 | GCA001597545_00314 | gene | open | 62456-62959 | |||
| 178 | LVFB01000001.1 | GCA001597545_00315 | gene | open | 63046-63273 | |||
| 179 | LVFB01000001.1 | GCA001597545_00316 | gene | open | 63295-63633 | |||
| 180 | LVFB01000001.1 | GCA001597545_00317 | gene | open | 63651-63974 | |||
| 181 | LVFB01000001.1 | GCA001597545_00318 | gene | open | 64011-64256 | |||
| 182 | LVFB01000001.1 | GCA001597545_00319 | gene | open | 64727-65785 | |||
| 183 | LVFB01000001.1 | GCA001597545_00320 | gene | open | 66159-66401 | |||
| 184 | LVFB01000001.1 | GCA001597545_00321 | gene | open | 66539-67342 | |||
| 185 | LVFB01000001.1 | GCA001597545_00322 | gene | open | 67431-69836 | |||
| 186 | LVFB01000001.1 | GCA001597545_00323 | gene | open | 69833-70135 | |||
| 187 | LVFB01000001.1 | GCA001597545_00324 | gene | open | 70349-71782 | |||
| 188 | LVFB01000001.1 | GCA001597545_00325 | gene | open | 71856-73316 | |||
| 189 | LVFB01000001.1 | GCA001597545_00326 | gene | open | 73411-73713 | |||
| 190 | LVFB01000001.1 | GCA001597545_00327 | gene | open | 73802-75004 | |||
| 191 | LVFB01000001.1 | GCA001597545_00328 | gene | open | 75008-77938 | |||
| 192 | LVFB01000001.1 | GCA001597545_00329 | gene | open | 77987-78703 | |||
| 193 | LVFB01000001.1 | GCA001597545_00330 | gene | open | 78717-78848 | |||
| 194 | LVFB01000001.1 | GCA001597545_00331 | gene | open | 78896-79258 | |||
| 195 | LVFB01000001.1 | GCA001597545_00332 | gene | open | 79337-81886 | clpB | ||
| 196 | LVFB01000001.1 | GCA001597545_00333 | gene | open | 82068-83465 | |||
| 197 | LVFB01000001.1 | GCA001597545_00334 | gene | open | 83544-85016 | |||
| 198 | LVFB01000001.1 | GCA001597545_00335 | gene | open | 85242-85778 | mutT | ||
| 199 | LVFB01000001.1 | GCA001597545_00336 | gene | open | 85720-86598 | eamA | ||
| 200 | LVFB01000001.1 | GCA001597545_00337 | gene | open | 86968-87915 | |||
| 201 | LVFB01000001.1 | GCA001597545_00338 | gene | open | 88029-88337 | |||
| 202 | LVFB01000001.1 | GCA001597545_00339 | gene | open | 88390-88752 | |||
| 203 | LVFB01000001.1 | GCA001597545_00340 | gene | open | 88947-89498 | ykuD | ||
| 204 | LVFB01000001.1 | GCA001597545_00341 | gene | open | 90091-90324 | |||
| 205 | LVFB01000001.1 | GCA001597545_00342 | gene | open | 90742-91218 | |||
| 206 | LVFB01000001.1 | GCA001597545_00343 | gene | open | 91286-91618 | |||
| 207 | LVFB01000001.1 | GCA001597545_00344 | gene | open | 91691-92170 | |||
| 208 | LVFB01000001.1 | GCA001597545_00345 | gene | open | 92188-92979 | |||
| 209 | LVFB01000001.1 | GCA001597545_00346 | gene | open | 93074-93253 | |||
| 210 | LVFB01000001.1 | GCA001597545_00347 | gene | open | 93508-93975 | |||
| 211 | LVFB01000001.1 | GCA001597545_00348 | gene | open | 94131-95021 | |||
| 212 | LVFB01000001.1 | GCA001597545_00349 | gene | open | 95212-95724 | |||
| 213 | LVFB01000001.1 | GCA001597545_00350 | gene | open | 96037-96327 | |||
| 214 | LVFB01000001.1 | GCA001597545_00351 | gene | open | 96650-96725 | trnT | ||
| 215 | LVFB01000001.1 | GCA001597545_00351 | tRNA | open | 96650-96725 | trnT | tRNA-Thr(cgt) | |
| 216 | LVFB01000002.1 | repeat_region | open | 1272-1578 | CRISPR array with 5 repeats of length 32%2C consensus sequence ATTTACATTCTACTTTAGTAATACTCTAATTA and spacer length 34 | |||
| 217 | LVFB01000002.1 | GCA001597545_00352 | CDS | open | 1766-2029 | _na 87_aa | hypothetical protein | |
| 218 | LVFB01000002.1 | GCA001597545_00353 | CDS | open | 2026-2598 | _na 190_aa | hypothetical protein | |
| 219 | LVFB01000002.1 | GCA001597545_00354 | CDS | open | 2608-2793 | _na 61_aa | hypothetical protein | |
| 220 | LVFB01000002.1 | GCA001597545_00355 | CDS | open | 2780-4051 | _na 423_aa | Phosphoadenosine phosphosulfate reductase family protein | |
| 221 | LVFB01000002.1 | GCA001597545_00356 | CDS | open | 4062-4568 | _na 168_aa | ParB-like protein | |
| 222 | LVFB01000002.1 | GCA001597545_00357 | CDS | open | 4574-4954 | _na 126_aa | hypothetical protein | |
| 223 | LVFB01000002.1 | GCA001597545_00358 | CDS | open | 4935-6131 | _na 398_aa | SNF2 family N-terminal domain protein | |
| 224 | LVFB01000002.1 | GCA001597545_00359 | CDS | open | 6128-7414 | _na 428_aa | DUF2325 domain-containing protein | |
| 225 | LVFB01000002.1 | GCA001597545_00360 | CDS | open | 7527-8012 | _na 161_aa | ParB-like protein | |
| 226 | LVFB01000002.1 | GCA001597545_00361 | CDS | open | 8009-8812 | _na 267_aa | tRNA-guanine(15) transglycosylase-like domain-containing protein | |
| 227 | LVFB01000002.1 | GCA001597545_00362 | CDS | open | 8813-9247 | _na 144_aa | DUF6884 domain-containing protein | |
| 228 | LVFB01000002.1 | GCA001597545_00363 | CDS | open | 9234-9836 | _na 200_aa | queuosine precursor transporter | |
| 229 | LVFB01000002.1 | GCA001597545_00364 | CDS | open | 9889-10095 | _na 68_aa | hypothetical protein | |
| 230 | LVFB01000002.1 | GCA001597545_00365 | CDS | open | 10310-10597 | _na 95_aa | hypothetical protein | |
| 231 | LVFB01000002.1 | GCA001597545_00366 | CDS | open | 10602-10775 | _na 57_aa | Bacteriocin-type signal sequence | |
| 232 | LVFB01000002.1 | GCA001597545_00367 | CDS | open | 10979-11467 | _na 162_aa | ParB-like protein | |
| 233 | LVFB01000002.1 | GCA001597545_00368 | CDS | open | 11464-11709 | _na 81_aa | hypothetical protein | |
| 234 | LVFB01000002.1 | GCA001597545_00369 | CDS | open | 11731-12210 | _na 159_aa | hypothetical protein | |
| 235 | LVFB01000002.1 | GCA001597545_00370 | CDS | open | 12229-12429 | _na 66_aa | Phage protein | |
| 236 | LVFB01000002.1 | GCA001597545_00371 | CDS | open | 12443-12847 | _na 134_aa | rusA | Crossover junction endodeoxyribonuclease RusA |
| 237 | LVFB01000002.1 | GCA001597545_00372 | CDS | open | 12882-13697 | _na 271_aa | Phage antirepressor protein KilAC domain protein | |
| 238 | LVFB01000002.1 | GCA001597545_00373 | CDS | open | 13678-14481 | _na 267_aa | hypothetical protein | |
| 239 | LVFB01000002.1 | GCA001597545_00374 | CDS | open | 14457-14711 | _na 84_aa | DUF3310 domain-containing protein | |
| 240 | LVFB01000002.1 | GCA001597545_00375 | CDS | open | 14708-14866 | _na 52_aa | hypothetical protein | |
| 241 | LVFB01000002.1 | GCA001597545_00376 | CDS | open | 14962-15894 | _na 310_aa | Terminase%2C ATPase subunit%2C gpP-like protein | |
| 242 | LVFB01000002.1 | GCA001597545_00377 | CDS | open | 15891-16226 | _na 111_aa | Transcriptional regulator | |
| 243 | LVFB01000002.1 | GCA001597545_00378 | CDS | open | 16211-17593 | _na 460_aa | PBSX family phage terminase large subunit | |
| 244 | LVFB01000002.1 | GCA001597545_00379 | CDS | open | 17605-20172 | _na 855_aa | Phage protein F-like protein | |
| 245 | LVFB01000002.1 | GCA001597545_00380 | CDS | open | 20182-20421 | _na 79_aa | hypothetical protein | |
| 246 | LVFB01000002.1 | GCA001597545_00381 | CDS | open | 20432-21013 | _na 193_aa | phage virion morphogenesis protein | |
| 247 | LVFB01000002.1 | GCA001597545_00382 | CDS | open | 21249-21827 | _na 192_aa | Phage-Barnase-EndoU-ColicinE5/D-RelE like nuclease 4 domain-containing protein | |
| 248 | LVFB01000002.1 | GCA001597545_00383 | CDS | open | 21942-23402 | _na 486_aa | PF13250 domain protein | |
| 249 | LVFB01000002.1 | GCA001597545_00384 | CDS | open | 23416-23877 | _na 153_aa | Lipoprotein | |
| 250 | LVFB01000002.1 | GCA001597545_00385 | CDS | open | 23972-24103 | _na 43_aa | hicB | Toxin-antitoxin system HicB family antitoxin |
| 251 | LVFB01000002.1 | GCA001597545_00386 | CDS | open | 24301-24423 | _na 40_aa | hypothetical protein | |
| 252 | LVFB01000002.1 | GCA001597545_00387 | CDS | open | 24420-24953 | _na 177_aa | Phage regulatory protein%2C Rha family | |
| 253 | LVFB01000002.1 | GCA001597545_00388 | CDS | open | 24955-25320 | _na 121_aa | hypothetical protein | |
| 254 | LVFB01000002.1 | GCA001597545_00389 | CDS | open | 25360-25548 | _na 62_aa | Toxin-antitoxin system%2C antitoxin component%2C ribbon-helix-helix domain protein | |
| 255 | LVFB01000002.1 | GCA001597545_00390 | CDS | open | 25644-25826 | _na 60_aa | hicA | Type II toxin-antitoxin system HicA family toxin |
| 256 | LVFB01000002.1 | GCA001597545_00391 | CDS | open | 25866-26300 | _na 144_aa | hicB | Antitoxin HicB |
| 257 | LVFB01000002.1 | GCA001597545_00392 | CDS | open | 26415-26621 | _na 68_aa | Phage protein | |
| 258 | LVFB01000002.1 | GCA001597545_00393 | CDS | open | 26638-27057 | _na 139_aa | Terminase | |
| 259 | LVFB01000002.1 | GCA001597545_00394 | CDS | open | 27090-27722 | _na 210_aa | hypothetical protein | |
| 260 | LVFB01000002.1 | GCA001597545_00395 | CDS | open | 27819-28001 | _na 60_aa | copG | CopG family transcriptional regulator |
| 261 | LVFB01000002.1 | GCA001597545_00396 | CDS | open | 27998-28579 | _na 193_aa | hypothetical protein | |
| 262 | LVFB01000002.1 | GCA001597545_00397 | CDS | open | 28771-29721 | _na 316_aa | Phage prohead protease%2C HK97 family | |
| 263 | LVFB01000002.1 | GCA001597545_00398 | CDS | open | 29734-29835 | _na 33_aa | hypothetical protein | |
| 264 | LVFB01000002.1 | GCA001597545_00399 | CDS | open | 29835-30185 | _na 116_aa | hypothetical protein | |
| 265 | LVFB01000002.1 | GCA001597545_00400 | CDS | open | 30205-31179 | _na 324_aa | Phage major capsid protein E | |
| 266 | LVFB01000002.1 | GCA001597545_00401 | CDS | open | 31184-31522 | _na 112_aa | hypothetical protein | |
| 267 | LVFB01000002.1 | GCA001597545_00402 | CDS | open | 31519-31959 | _na 146_aa | hypothetical protein | |
| 268 | LVFB01000002.1 | GCA001597545_00403 | CDS | open | 31974-32936 | _na 320_aa | Phage tail tube protein | |
| 269 | LVFB01000002.1 | GCA001597545_00404 | CDS | open | 32954-33343 | _na 129_aa | Phage XkdN-like protein | |
| 270 | LVFB01000002.1 | GCA001597545_00405 | CDS | open | 33655-38346 | _na 1563_aa | Tail tape measure protein%2C TIGR01760 family | |
| 271 | LVFB01000002.1 | GCA001597545_00406 | CDS | open | 38544-39029 | _na 161_aa | hypothetical protein | |
| 272 | LVFB01000002.1 | GCA001597545_00407 | CDS | open | 38969-39226 | _na 85_aa | hypothetical protein | |
| 273 | LVFB01000002.1 | GCA001597545_00408 | CDS | open | 39300-42407 | _na 1035_aa | Phage minor structural protein | |
| 274 | LVFB01000002.1 | GCA001597545_00409 | CDS | open | 42416-43033 | _na 205_aa | DUF4376 domain-containing protein | |
| 275 | LVFB01000002.1 | GCA001597545_00410 | CDS | open | 43044-44672 | _na 542_aa | Collagen triple helix repeat protein | |
| 276 | LVFB01000002.1 | GCA001597545_00411 | CDS | open | 44656-45471 | _na 271_aa | hypothetical protein | |
| 277 | LVFB01000002.1 | GCA001597545_00412 | CDS | open | 45487-46167 | _na 226_aa | PF14301 domain protein | |
| 278 | LVFB01000002.1 | GCA001597545_00413 | CDS | open | 46164-46742 | _na 192_aa | N-acetylmuramoyl-L-alanine amidase | |
| 279 | LVFB01000002.1 | GCA001597545_00414 | CDS | open | 46739-46870 | _na 43_aa | hypothetical protein | |
| 280 | LVFB01000002.1 | GCA001597545_00415 | CDS | open | 46867-47259 | _na 130_aa | Holin of 3TMs%2C for gene-transfer release | |
| 281 | LVFB01000002.1 | GCA001597545_00416 | CDS | open | 47259-47528 | _na 89_aa | hypothetical protein | |
| 282 | LVFB01000002.1 | GCA001597545_00417 | CDS | open | 47897-48694 | _na 265_aa | hypothetical protein | |
| 283 | LVFB01000002.1 | GCA001597545_00418 | CDS | open | 48715-49566 | _na 283_aa | PF13475 domain protein | |
| 284 | LVFB01000002.1 | GCA001597545_00419 | CDS | open | 50057-50683 | _na 208_aa | DNA-binding helix-turn-helix protein | |
| 285 | LVFB01000002.1 | GCA001597545_00420 | CDS | open | 51048-51137 | _na 29_aa | hypothetical protein | |
| 286 | LVFB01000002.1 | GCA001597545_00421 | CDS | open | 51109-51336 | _na 75_aa | hypothetical protein | |
| 287 | LVFB01000002.1 | GCA001597545_00422 | CDS | open | 51314-51712 | _na 132_aa | hypothetical protein | |
| 288 | LVFB01000002.1 | GCA001597545_00423 | CDS | open | 51820-52437 | _na 205_aa | Bro-N domain-containing protein | |
| 289 | LVFB01000002.1 | GCA001597545_00424 | CDS | open | 52421-53200 | _na 259_aa | Site-specific recombinase%2C phage integrase family | |
| 290 | LVFB01000002.1 | GCA001597545_00425 | CDS | open | 53290-53391 | _na 33_aa | hypothetical protein | |
| 291 | LVFB01000002.1 | GCA001597545_00426 | CDS | open | 53393-53794 | _na 133_aa | hypothetical protein | |
| 292 | LVFB01000002.1 | GCA001597545_00427 | CDS | open | 53804-55660 | _na 618_aa | Mu transposase%2C C-terminal domain protein | |
| 293 | LVFB01000002.1 | GCA001597545_00428 | CDS | open | 55669-56643 | _na 324_aa | AAA domain protein | |
| 294 | LVFB01000002.1 | GCA001597545_00429 | CDS | open | 56654-56845 | _na 63_aa | hypothetical protein | |
| 295 | LVFB01000002.1 | GCA001597545_00430 | CDS | open | 56855-57082 | _na 75_aa | hypothetical protein | |
| 296 | LVFB01000002.1 | GCA001597545_00431 | CDS | open | 57133-57762 | _na 209_aa | PF08960 domain protein | |
| 297 | LVFB01000002.1 | GCA001597545_00432 | CDS | open | 57764-58015 | _na 83_aa | hypothetical protein | |
| 298 | LVFB01000002.1 | GCA001597545_00433 | CDS | open | 58005-58655 | _na 216_aa | PF11363 family protein | |
| 299 | LVFB01000002.1 | GCA001597545_00434 | CDS | open | 58657-59043 | _na 128_aa | PF06252 family protein | |
| 300 | LVFB01000002.1 | GCA001597545_00435 | CDS | open | 59040-59393 | _na 117_aa | DUF4406 domain-containing protein | |
| 301 | LVFB01000002.1 | GCA001597545_00436 | CDS | open | 59390-59974 | _na 194_aa | DUF4391 domain-containing protein | |
| 302 | LVFB01000002.1 | GCA001597545_00437 | CDS | open | 59976-60311 | _na 111_aa | hypothetical protein | |
| 303 | LVFB01000002.1 | GCA001597545_00438 | CDS | open | 60308-60592 | _na 94_aa | DUF3850 domain-containing protein | |
| 304 | LVFB01000002.1 | GCA001597545_00439 | CDS | open | 60595-60810 | _na 71_aa | hypothetical protein | |
| 305 | LVFB01000002.1 | GCA001597545_00440 | CDS | open | 60813-61418 | _na 201_aa | Sigma-70 region 2 | |
| 306 | LVFB01000002.1 | GCA001597545_00441 | CDS | open | 61384-61689 | _na 101_aa | hypothetical protein | |
| 307 | LVFB01000002.1 | GCA001597545_00442 | CDS | open | 61764-61916 | _na 50_aa | hypothetical protein | |
| 308 | LVFB01000002.1 | GCA001597545_00443 | CDS | open | 62003-62842 | _na 279_aa | site-specific DNA-methyltransferase (adenine-specific) | |
| 309 | LVFB01000002.1 | GCA001597545_00444 | CDS | open | 62895-63131 | _na 78_aa | Helix-turn-helix domain-containing protein | |
| 310 | LVFB01000002.1 | GCA001597545_00445 | CDS | open | 63618-64100 | _na 160_aa | hypothetical protein | |
| 311 | LVFB01000002.1 | GCA001597545_00446 | CDS | open | 64151-64462 | _na 103_aa | hypothetical protein | |
| 312 | LVFB01000002.1 | GCA001597545_00447 | CDS | open | 64509-64691 | _na 60_aa | Toxin-antitoxin system%2C antitoxin component%2C ribbon-helix-helix domain protein | |
| 313 | LVFB01000002.1 | GCA001597545_00448 | CDS | open | 64702-65169 | _na 155_aa | Phage protein | |
| 314 | LVFB01000002.1 | GCA001597545_00449 | CDS | open | 65296-65706 | _na 136_aa | Helix-turn-helix domain-containing protein | |
| 315 | LVFB01000002.1 | GCA001597545_00450 | CDS | open | 65657-66964 | _na 435_aa | PBSX family phage terminase large subunit | |
| 316 | LVFB01000002.1 | GCA001597545_00451 | CDS | open | 67078-68571 | _na 497_aa | Phage minor structural protein%2C N-terminal domain protein | |
| 317 | LVFB01000002.1 | GCA001597545_00452 | CDS | open | 68546-69367 | _na 273_aa | Phage protein F-like protein | |
| 318 | LVFB01000002.1 | GCA001597545_00453 | CDS | open | 69360-69965 | _na 201_aa | Phage minor structural protein GP20 | |
| 319 | LVFB01000002.1 | GCA001597545_00454 | CDS | open | 69969-71078 | _na 369_aa | Baseplate protein J-like domain-containing protein | |
| 320 | LVFB01000002.1 | GCA001597545_00455 | CDS | open | 71088-71327 | _na 79_aa | hypothetical protein | |
| 321 | LVFB01000002.1 | GCA001597545_00456 | CDS | open | 71324-71722 | _na 132_aa | Putative DnaT-like domain-containing protein | |
| 322 | LVFB01000002.1 | GCA001597545_00457 | CDS | open | 71733-72191 | _na 152_aa | hypothetical protein | |
| 323 | LVFB01000002.1 | GCA001597545_00458 | CDS | open | 72191-72529 | _na 112_aa | Phage head-tail adaptor | |
| 324 | LVFB01000002.1 | GCA001597545_00459 | CDS | open | 72519-73079 | _na 186_aa | Phage metallopeptidase domain-containing protein | |
| 325 | LVFB01000002.1 | GCA001597545_00460 | CDS | open | 73092-74081 | _na 329_aa | PF11863 domain protein | |
| 326 | LVFB01000002.1 | GCA001597545_00461 | CDS | open | 74097-74519 | _na 140_aa | DUF3277 domain-containing protein | |
| 327 | LVFB01000002.1 | GCA001597545_00462 | CDS | open | 74527-74754 | _na 75_aa | hypothetical protein | |
| 328 | LVFB01000002.1 | GCA001597545_00463 | CDS | open | 74717-75166 | _na 149_aa | Phage XkdN-like protein | |
| 329 | LVFB01000002.1 | GCA001597545_00464 | CDS | open | 75313-77010 | _na 565_aa | Tape measure domain protein | |
| 330 | LVFB01000002.1 | GCA001597545_00465 | CDS | open | 77012-77593 | _na 193_aa | Dit-like phage tail protein N-terminal domain-containing protein | |
| 331 | LVFB01000002.1 | GCA001597545_00466 | CDS | open | 77609-77929 | _na 106_aa | PRC-barrel domain-containing protein | |
| 332 | LVFB01000002.1 | GCA001597545_00467 | CDS | open | 77929-78786 | _na 285_aa | Phage protein | |
| 333 | LVFB01000002.1 | GCA001597545_00468 | CDS | open | 78783-79430 | _na 215_aa | Phage protein Gp138 N-terminal domain-containing protein | |
| 334 | LVFB01000002.1 | GCA001597545_00469 | CDS | open | 79439-79777 | _na 112_aa | IraD/Gp25-like domain-containing protein | |
| 335 | LVFB01000002.1 | GCA001597545_00470 | CDS | open | 79774-80916 | _na 380_aa | Baseplate protein J-like domain-containing protein | |
| 336 | LVFB01000002.1 | GCA001597545_00471 | CDS | open | 80917-81444 | _na 175_aa | DUF2313 domain-containing protein | |
| 337 | LVFB01000002.1 | GCA001597545_00472 | CDS | open | 81448-82341 | _na 297_aa | Baseplate structural protein Gp10 C-terminal domain-containing protein | |
| 338 | LVFB01000002.1 | GCA001597545_00473 | CDS | open | 82353-83033 | _na 226_aa | PF14301 domain protein | |
| 339 | LVFB01000002.1 | GCA001597545_00474 | CDS | open | 83044-83508 | _na 154_aa | Serine-type D-Ala-D-Ala carboxypeptidase | |
| 340 | LVFB01000002.1 | GCA001597545_00475 | CDS | open | 83522-83806 | _na 94_aa | Phage holin%2C LL-H family | |
| 341 | LVFB01000002.1 | GCA001597545_00476 | CDS | open | 83816-84265 | _na 149_aa | PF07087 family protein | |
| 342 | LVFB01000002.1 | GCA001597545_00477 | CDS | open | 84285-84749 | _na 154_aa | Toxin secretion/phage lysis holin | |
| 343 | LVFB01000002.1 | GCA001597545_00478 | CDS | open | 84763-85020 | _na 85_aa | hypothetical protein | |
| 344 | LVFB01000002.1 | GCA001597545_00479 | CDS | open | 85650-86051 | _na 133_aa | tnpA | IS200/IS605 family transposase |
| 345 | LVFB01000002.1 | GCA001597545_00352 | gene | open | 1766-2029 | |||
| 346 | LVFB01000002.1 | GCA001597545_00353 | gene | open | 2026-2598 | |||
| 347 | LVFB01000002.1 | GCA001597545_00354 | gene | open | 2608-2793 | |||
| 348 | LVFB01000002.1 | GCA001597545_00355 | gene | open | 2780-4051 | |||
| 349 | LVFB01000002.1 | GCA001597545_00356 | gene | open | 4062-4568 | |||
| 350 | LVFB01000002.1 | GCA001597545_00357 | gene | open | 4574-4954 | |||
| 351 | LVFB01000002.1 | GCA001597545_00358 | gene | open | 4935-6131 | |||
| 352 | LVFB01000002.1 | GCA001597545_00359 | gene | open | 6128-7414 | |||
| 353 | LVFB01000002.1 | GCA001597545_00360 | gene | open | 7527-8012 | |||
| 354 | LVFB01000002.1 | GCA001597545_00361 | gene | open | 8009-8812 | |||
| 355 | LVFB01000002.1 | GCA001597545_00362 | gene | open | 8813-9247 | |||
| 356 | LVFB01000002.1 | GCA001597545_00363 | gene | open | 9234-9836 | |||
| 357 | LVFB01000002.1 | GCA001597545_00364 | gene | open | 9889-10095 | |||
| 358 | LVFB01000002.1 | GCA001597545_00365 | gene | open | 10310-10597 | |||
| 359 | LVFB01000002.1 | GCA001597545_00366 | gene | open | 10602-10775 | |||
| 360 | LVFB01000002.1 | GCA001597545_00367 | gene | open | 10979-11467 | |||
| 361 | LVFB01000002.1 | GCA001597545_00368 | gene | open | 11464-11709 | |||
| 362 | LVFB01000002.1 | GCA001597545_00369 | gene | open | 11731-12210 | |||
| 363 | LVFB01000002.1 | GCA001597545_00370 | gene | open | 12229-12429 | |||
| 364 | LVFB01000002.1 | GCA001597545_00371 | gene | open | 12443-12847 | rusA | ||
| 365 | LVFB01000002.1 | GCA001597545_00372 | gene | open | 12882-13697 | |||
| 366 | LVFB01000002.1 | GCA001597545_00373 | gene | open | 13678-14481 | |||
| 367 | LVFB01000002.1 | GCA001597545_00374 | gene | open | 14457-14711 | |||
| 368 | LVFB01000002.1 | GCA001597545_00375 | gene | open | 14708-14866 | |||
| 369 | LVFB01000002.1 | GCA001597545_00376 | gene | open | 14962-15894 | |||
| 370 | LVFB01000002.1 | GCA001597545_00377 | gene | open | 15891-16226 | |||
| 371 | LVFB01000002.1 | GCA001597545_00378 | gene | open | 16211-17593 | |||
| 372 | LVFB01000002.1 | GCA001597545_00379 | gene | open | 17605-20172 | |||
| 373 | LVFB01000002.1 | GCA001597545_00380 | gene | open | 20182-20421 | |||
| 374 | LVFB01000002.1 | GCA001597545_00381 | gene | open | 20432-21013 | |||
| 375 | LVFB01000002.1 | GCA001597545_00382 | gene | open | 21249-21827 | |||
| 376 | LVFB01000002.1 | GCA001597545_00383 | gene | open | 21942-23402 | |||
| 377 | LVFB01000002.1 | GCA001597545_00384 | gene | open | 23416-23877 | |||
| 378 | LVFB01000002.1 | GCA001597545_00385 | gene | open | 23972-24103 | hicB | ||
| 379 | LVFB01000002.1 | GCA001597545_00386 | gene | open | 24301-24423 | |||
| 380 | LVFB01000002.1 | GCA001597545_00387 | gene | open | 24420-24953 | |||
| 381 | LVFB01000002.1 | GCA001597545_00388 | gene | open | 24955-25320 | |||
| 382 | LVFB01000002.1 | GCA001597545_00389 | gene | open | 25360-25548 | |||
| 383 | LVFB01000002.1 | GCA001597545_00390 | gene | open | 25644-25826 | hicA | ||
| 384 | LVFB01000002.1 | GCA001597545_00391 | gene | open | 25866-26300 | hicB | ||
| 385 | LVFB01000002.1 | GCA001597545_00392 | gene | open | 26415-26621 | |||
| 386 | LVFB01000002.1 | GCA001597545_00393 | gene | open | 26638-27057 | |||
| 387 | LVFB01000002.1 | GCA001597545_00394 | gene | open | 27090-27722 | |||
| 388 | LVFB01000002.1 | GCA001597545_00395 | gene | open | 27819-28001 | copG | ||
| 389 | LVFB01000002.1 | GCA001597545_00396 | gene | open | 27998-28579 | |||
| 390 | LVFB01000002.1 | GCA001597545_00397 | gene | open | 28771-29721 | |||
| 391 | LVFB01000002.1 | GCA001597545_00398 | gene | open | 29734-29835 | |||
| 392 | LVFB01000002.1 | GCA001597545_00399 | gene | open | 29835-30185 | |||
| 393 | LVFB01000002.1 | GCA001597545_00400 | gene | open | 30205-31179 | |||
| 394 | LVFB01000002.1 | GCA001597545_00401 | gene | open | 31184-31522 | |||
| 395 | LVFB01000002.1 | GCA001597545_00402 | gene | open | 31519-31959 | |||
| 396 | LVFB01000002.1 | GCA001597545_00403 | gene | open | 31974-32936 | |||
| 397 | LVFB01000002.1 | GCA001597545_00404 | gene | open | 32954-33343 | |||
| 398 | LVFB01000002.1 | GCA001597545_00405 | gene | open | 33655-38346 | |||
| 399 | LVFB01000002.1 | GCA001597545_00406 | gene | open | 38544-39029 | |||
| 400 | LVFB01000002.1 | GCA001597545_00407 | gene | open | 38969-39226 | |||
| 401 | LVFB01000002.1 | GCA001597545_00408 | gene | open | 39300-42407 | |||
| 402 | LVFB01000002.1 | GCA001597545_00409 | gene | open | 42416-43033 | |||
| 403 | LVFB01000002.1 | GCA001597545_00410 | gene | open | 43044-44672 | |||
| 404 | LVFB01000002.1 | GCA001597545_00411 | gene | open | 44656-45471 | |||
| 405 | LVFB01000002.1 | GCA001597545_00412 | gene | open | 45487-46167 | |||
| 406 | LVFB01000002.1 | GCA001597545_00413 | gene | open | 46164-46742 | |||
| 407 | LVFB01000002.1 | GCA001597545_00414 | gene | open | 46739-46870 | |||
| 408 | LVFB01000002.1 | GCA001597545_00415 | gene | open | 46867-47259 | |||
| 409 | LVFB01000002.1 | GCA001597545_00416 | gene | open | 47259-47528 | |||
| 410 | LVFB01000002.1 | GCA001597545_00417 | gene | open | 47897-48694 | |||
| 411 | LVFB01000002.1 | GCA001597545_00418 | gene | open | 48715-49566 | |||
| 412 | LVFB01000002.1 | GCA001597545_00419 | gene | open | 50057-50683 | |||
| 413 | LVFB01000002.1 | GCA001597545_00420 | gene | open | 51048-51137 | |||
| 414 | LVFB01000002.1 | GCA001597545_00421 | gene | open | 51109-51336 | |||
| 415 | LVFB01000002.1 | GCA001597545_00422 | gene | open | 51314-51712 | |||
| 416 | LVFB01000002.1 | GCA001597545_00423 | gene | open | 51820-52437 | |||
| 417 | LVFB01000002.1 | GCA001597545_00424 | gene | open | 52421-53200 | |||
| 418 | LVFB01000002.1 | GCA001597545_00425 | gene | open | 53290-53391 | |||
| 419 | LVFB01000002.1 | GCA001597545_00426 | gene | open | 53393-53794 | |||
| 420 | LVFB01000002.1 | GCA001597545_00427 | gene | open | 53804-55660 | |||
| 421 | LVFB01000002.1 | GCA001597545_00428 | gene | open | 55669-56643 | |||
| 422 | LVFB01000002.1 | GCA001597545_00429 | gene | open | 56654-56845 | |||
| 423 | LVFB01000002.1 | GCA001597545_00430 | gene | open | 56855-57082 | |||
| 424 | LVFB01000002.1 | GCA001597545_00431 | gene | open | 57133-57762 | |||
| 425 | LVFB01000002.1 | GCA001597545_00432 | gene | open | 57764-58015 | |||
| 426 | LVFB01000002.1 | GCA001597545_00433 | gene | open | 58005-58655 | |||
| 427 | LVFB01000002.1 | GCA001597545_00434 | gene | open | 58657-59043 | |||
| 428 | LVFB01000002.1 | GCA001597545_00435 | gene | open | 59040-59393 | |||
| 429 | LVFB01000002.1 | GCA001597545_00436 | gene | open | 59390-59974 | |||
| 430 | LVFB01000002.1 | GCA001597545_00437 | gene | open | 59976-60311 | |||
| 431 | LVFB01000002.1 | GCA001597545_00438 | gene | open | 60308-60592 | |||
| 432 | LVFB01000002.1 | GCA001597545_00439 | gene | open | 60595-60810 | |||
| 433 | LVFB01000002.1 | GCA001597545_00440 | gene | open | 60813-61418 | |||
| 434 | LVFB01000002.1 | GCA001597545_00441 | gene | open | 61384-61689 | |||
| 435 | LVFB01000002.1 | GCA001597545_00442 | gene | open | 61764-61916 | |||
| 436 | LVFB01000002.1 | GCA001597545_00443 | gene | open | 62003-62842 | |||
| 437 | LVFB01000002.1 | GCA001597545_00444 | gene | open | 62895-63131 | |||
| 438 | LVFB01000002.1 | GCA001597545_00445 | gene | open | 63618-64100 | |||
| 439 | LVFB01000002.1 | GCA001597545_00446 | gene | open | 64151-64462 | |||
| 440 | LVFB01000002.1 | GCA001597545_00447 | gene | open | 64509-64691 | |||
| 441 | LVFB01000002.1 | GCA001597545_00448 | gene | open | 64702-65169 | |||
| 442 | LVFB01000002.1 | GCA001597545_00449 | gene | open | 65296-65706 | |||
| 443 | LVFB01000002.1 | GCA001597545_00450 | gene | open | 65657-66964 | |||
| 444 | LVFB01000002.1 | GCA001597545_00451 | gene | open | 67078-68571 | |||
| 445 | LVFB01000002.1 | GCA001597545_00452 | gene | open | 68546-69367 | |||
| 446 | LVFB01000002.1 | GCA001597545_00453 | gene | open | 69360-69965 | |||
| 447 | LVFB01000002.1 | GCA001597545_00454 | gene | open | 69969-71078 | |||
| 448 | LVFB01000002.1 | GCA001597545_00455 | gene | open | 71088-71327 | |||
| 449 | LVFB01000002.1 | GCA001597545_00456 | gene | open | 71324-71722 | |||
| 450 | LVFB01000002.1 | GCA001597545_00457 | gene | open | 71733-72191 | |||
| 451 | LVFB01000002.1 | GCA001597545_00458 | gene | open | 72191-72529 | |||
| 452 | LVFB01000002.1 | GCA001597545_00459 | gene | open | 72519-73079 | |||
| 453 | LVFB01000002.1 | GCA001597545_00460 | gene | open | 73092-74081 | |||
| 454 | LVFB01000002.1 | GCA001597545_00461 | gene | open | 74097-74519 | |||
| 455 | LVFB01000002.1 | GCA001597545_00462 | gene | open | 74527-74754 | |||
| 456 | LVFB01000002.1 | GCA001597545_00463 | gene | open | 74717-75166 | |||
| 457 | LVFB01000002.1 | GCA001597545_00464 | gene | open | 75313-77010 | |||
| 458 | LVFB01000002.1 | GCA001597545_00465 | gene | open | 77012-77593 | |||
| 459 | LVFB01000002.1 | GCA001597545_00466 | gene | open | 77609-77929 | |||
| 460 | LVFB01000002.1 | GCA001597545_00467 | gene | open | 77929-78786 | |||
| 461 | LVFB01000002.1 | GCA001597545_00468 | gene | open | 78783-79430 | |||
| 462 | LVFB01000002.1 | GCA001597545_00469 | gene | open | 79439-79777 | |||
| 463 | LVFB01000002.1 | GCA001597545_00470 | gene | open | 79774-80916 | |||
| 464 | LVFB01000002.1 | GCA001597545_00471 | gene | open | 80917-81444 | |||
| 465 | LVFB01000002.1 | GCA001597545_00472 | gene | open | 81448-82341 | |||
| 466 | LVFB01000002.1 | GCA001597545_00473 | gene | open | 82353-83033 | |||
| 467 | LVFB01000002.1 | GCA001597545_00474 | gene | open | 83044-83508 | |||
| 468 | LVFB01000002.1 | GCA001597545_00475 | gene | open | 83522-83806 | |||
| 469 | LVFB01000002.1 | GCA001597545_00476 | gene | open | 83816-84265 | |||
| 470 | LVFB01000002.1 | GCA001597545_00477 | gene | open | 84285-84749 | |||
| 471 | LVFB01000002.1 | GCA001597545_00478 | gene | open | 84763-85020 | |||
| 472 | LVFB01000002.1 | GCA001597545_00479 | gene | open | 85650-86051 | tnpA | ||
| 473 | LVFB01000003.1 | regulatory_region | open | 33457-33554 | Purine riboswitch aptamer | |||
| 474 | LVFB01000003.1 | GCA001597545_00480 | CDS | open | 634-819 | _na 61_aa | hypothetical protein | |
| 475 | LVFB01000003.1 | GCA001597545_00481 | CDS | open | 1307-2443 | _na 378_aa | Haloacid dehalogenase-like hydrolase | |
| 476 | LVFB01000003.1 | GCA001597545_00482 | CDS | open | 2476-3384 | _na 302_aa | murQ | N-acetylmuramic acid 6-phosphate etherase |
| 477 | LVFB01000003.1 | GCA001597545_00483 | CDS | open | 3377-4789 | _na 470_aa | PTS glucose transporter subunit IIB | |
| 478 | LVFB01000003.1 | GCA001597545_00484 | CDS | open | 5063-6187 | _na 374_aa | tetR | Transcriptional regulator%2C TetR family |
| 479 | LVFB01000003.1 | GCA001597545_00485 | CDS | open | 6406-7950 | _na 514_aa | 3-oxoacid CoA-transferase | |
| 480 | LVFB01000003.1 | GCA001597545_00486 | CDS | open | 7987-9366 | _na 459_aa | Citrate transporter | |
| 481 | LVFB01000003.1 | GCA001597545_00487 | CDS | open | 9397-9801 | _na 134_aa | Enoyl-CoA hydratase | |
| 482 | LVFB01000003.1 | GCA001597545_00488 | CDS | open | 9929-13168 | _na 1079_aa | Cell surface protein | |
| 483 | LVFB01000003.1 | GCA001597545_00489 | CDS | open | 13727-15034 | _na 435_aa | phoH | PhoH family protein |
| 484 | LVFB01000003.1 | GCA001597545_00490 | CDS | open | 15068-15994 | _na 308_aa | Thioredoxin reductase | |
| 485 | LVFB01000003.1 | GCA001597545_00491 | CDS | open | 16018-16638 | _na 206_aa | MBL fold metallo-hydrolase | |
| 486 | LVFB01000003.1 | GCA001597545_00492 | CDS | open | 16827-17285 | _na 152_aa | Putative tRNA (cytidine(34)-2'-O)-methyltransferase | |
| 487 | LVFB01000003.1 | GCA001597545_00493 | CDS | open | 17288-17857 | _na 189_aa | ruvC | crossover junction endodeoxyribonuclease RuvC |
| 488 | LVFB01000003.1 | GCA001597545_00494 | CDS | open | 17869-18897 | _na 342_aa | Aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme | |
| 489 | LVFB01000003.1 | GCA001597545_00495 | CDS | open | 18908-20017 | _na 369_aa | tRNA(Met) cytidine acetate ligase | |
| 490 | LVFB01000003.1 | GCA001597545_00496 | CDS | open | 20014-21303 | _na 429_aa | Melibiose carrier protein | |
| 491 | LVFB01000003.1 | GCA001597545_00497 | CDS | open | 21306-22475 | _na 389_aa | comE | Competence protein ComE |
| 492 | LVFB01000003.1 | GCA001597545_00498 | CDS | open | 22598-23197 | _na 199_aa | Thymidylate synthase | |
| 493 | LVFB01000003.1 | GCA001597545_00499 | CDS | open | 23331-24398 | _na 355_aa | mutY | A/G-specific adenine glycosylase |
| 494 | LVFB01000003.1 | GCA001597545_00500 | CDS | open | 24460-24684 | _na 74_aa | secG | preprotein translocase subunit SecG |
| 495 | LVFB01000003.1 | GCA001597545_00501 | CDS | open | 24787-26019 | _na 410_aa | Replication-associated recombination protein A | |
| 496 | LVFB01000003.1 | GCA001597545_00502 | CDS | open | 26021-27262 | _na 413_aa | hisS | histidine--tRNA ligase |
| 497 | LVFB01000003.1 | GCA001597545_00503 | CDS | open | 27266-29050 | _na 594_aa | aspS | aspartate--tRNA ligase |
| 498 | LVFB01000003.1 | GCA001597545_00504 | CDS | open | 29182-29763 | _na 193_aa | nadD | nicotinate (nicotinamide) nucleotide adenylyltransferase |
| 499 | LVFB01000003.1 | GCA001597545_00505 | CDS | open | 29876-30271 | _na 131_aa | 8-oxo-dGTP diphosphatase | |
| 500 | LVFB01000003.1 | GCA001597545_00506 | CDS | open | 30273-31613 | _na 446_aa | Poly(A) polymerase |

