HOMD Banner
Taxonomy: V4.3   |  16S rRNA RefSeq: V16.03   |  Genomic RefSeq: V11.03   |  Viruses: V1.2

BAKTAGenome Explorer: Campylobacter concisus clade-433 (GCA_002913465.1)

Select a Genome:
BAKTA Annotations for GCA_002913465.1
Genome Selected: Campylobacter concisus clade-433
ContigsBases CDSrRNA tmRNAtRNA
52 1784370 1747 3 1 36
[Table]   [AA Fasta]      [Browser]   [Text]   [Excel]  
Search & Sort all 3581 Records
Search These Records: Clear
Sort Column:   Molecule   PID   NA   AA   Gene  Gene Product  Reverse
Annotation Table [page:1]    |    Number of Records Found: 3581 [8 Pages]    |    Previous Page <==> Next Page    |    Jump to Page: [ 1  2  3  4  5  6  7  8  ]
Notes:   1- Column headers only sort the current page. 2- Select [NA] or [AA] links to show sequences.
Region Protein-ID Type Genome
Viewer		 Range
(bp)		 Show Sequences
(length) NA / AA		 BAKTA
Gene		 BAKTA
GeneProduct
1 PPBO01000003.1 GCA002913465_00001 CDS open 179-277 _na     32_aa L(+)-tartrate dehydratase subunit beta
2 PPBO01000003.1 GCA002913465_00002 CDS open 625-1647 _na     340_aa iron ABC transporter permease
3 PPBO01000003.1 GCA002913465_00003 CDS open 1644-2429 _na     261_aa ABC transporter
4 PPBO01000003.1 GCA002913465_00004 CDS open 2453-3400 _na     315_aa NADP-dependent oxidoreductase domain-containing protein
5 PPBO01000003.1 GCA002913465_00005 CDS open 3418-4491 _na     357_aa Fe/B12 periplasmic-binding domain-containing protein
6 PPBO01000003.1 GCA002913465_00006 CDS open 4611-5123 _na     170_aa Formylmethanofuran dehydrogenase subunit E domain-containing protein
7 PPBO01000003.1 GCA002913465_00007 CDS open 5584-6540 _na     318_aa tyrosine-type recombinase/integrase
8 PPBO01000003.1 GCA002913465_00001 gene open 179-277
9 PPBO01000003.1 GCA002913465_00002 gene open 625-1647
10 PPBO01000003.1 GCA002913465_00003 gene open 1644-2429
11 PPBO01000003.1 GCA002913465_00004 gene open 2453-3400
12 PPBO01000003.1 GCA002913465_00005 gene open 3418-4491
13 PPBO01000003.1 GCA002913465_00006 gene open 4611-5123
14 PPBO01000003.1 GCA002913465_00007 gene open 5584-6540
15 PPBO01000004.1 GCA002913465_00008 CDS open 1177-2196 _na     339_aa HdrB-like C-terminal domain-containing protein
16 PPBO01000004.1 GCA002913465_00009 CDS open 2260-3081 _na     273_aa thiamine-phosphate kinase
17 PPBO01000004.1 GCA002913465_00010 CDS open 3059-4183 _na     374_aa truD tRNA pseudouridine(13) synthase TruD
18 PPBO01000004.1 GCA002913465_00011 CDS open 4295-6265 _na     656_aa Protease
19 PPBO01000004.1 GCA002913465_00008 gene open 1177-2196
20 PPBO01000004.1 GCA002913465_00009 gene open 2260-3081
21 PPBO01000004.1 GCA002913465_00010 gene open 3059-4183 truD
22 PPBO01000004.1 GCA002913465_00011 gene open 4295-6265
23 PPBO01000005.1 GCA002913465_00012 CDS open 167-1102 _na     311_aa UDP-glucuronate decarboxylase
24 PPBO01000005.1 GCA002913465_00013 CDS open 1095-4301 _na     1068_aa Radical SAM protein
25 PPBO01000005.1 GCA002913465_00014 CDS open 4277-5878 _na     533_aa glycosyltransferase family 2 protein
26 PPBO01000005.1 GCA002913465_00015 CDS open 5912-6613 _na     233_aa tnp IS1595 family ISCamsp1 transposase
27 PPBO01000005.1 GCA002913465_00016 CDS open 7402-9183 _na     593_aa Tyr recombinase domain-containing protein
28 PPBO01000005.1 GCA002913465_00017 CDS open 9265-9516 _na     83_aa Antitoxin
29 PPBO01000005.1 GCA002913465_00018 CDS open 9506-9793 _na     95_aa relE Toxin-antitoxin system%2C toxin component%2C RelE family
30 PPBO01000005.1 GCA002913465_00019 CDS open 10159-10488 _na     109_aa Bacterial mobilisation domain-containing protein
31 PPBO01000005.1 GCA002913465_00020 CDS open 10536-12128 _na     530_aa Relaxase/mobilization nuclease domain-containing protein
32 PPBO01000005.1 GCA002913465_00021 CDS open 12796-12969 _na     57_aa Transposase
33 PPBO01000005.1 GCA002913465_00022 CDS open 13031-13156 _na     41_aa Putative DNA replication protein
34 PPBO01000005.1 GCA002913465_00023 CDS open 13328-13687 _na     119_aa dnaI Helicase loader DnaI
35 PPBO01000005.1 GCA002913465_00024 CDS open 13641-13865 _na     74_aa Phage protein
36 PPBO01000005.1 GCA002913465_00025 CDS open 14067-14411 _na     114_aa hypothetical protein
37 PPBO01000005.1 GCA002913465_00026 CDS open 14481-14639 _na     52_aa hypothetical protein
38 PPBO01000005.1 GCA002913465_00027 CDS open 15859-16212 _na     117_aa Cupin
39 PPBO01000005.1 GCA002913465_00028 CDS open 16290-17207 _na     305_aa Restriction endonuclease
40 PPBO01000005.1 GCA002913465_00029 CDS open 17310-18491 _na     393_aa Cytosine-specific methyltransferase
41 PPBO01000005.1 GCA002913465_00030 CDS open 18494-19153 _na     219_aa DUF4368 domain-containing protein
42 PPBO01000005.1 GCA002913465_00031 CDS open 19160-20344 _na     394_aa TrsK-like protein
43 PPBO01000005.1 GCA002913465_00032 CDS open 20419-21420 _na     333_aa flgG Flagellar biosynthesis protein FlgG
44 PPBO01000005.1 GCA002913465_00033 CDS open 21531-22367 _na     278_aa Polyribonucleotide nucleotidyltransferase
45 PPBO01000005.1 GCA002913465_00034 CDS open 22532-23251 _na     239_aa Cell surface protein
46 PPBO01000005.1 GCA002913465_00035 CDS open 23264-23959 _na     231_aa hypothetical protein
47 PPBO01000005.1 GCA002913465_00012 gene open 167-1102
48 PPBO01000005.1 GCA002913465_00013 gene open 1095-4301
49 PPBO01000005.1 GCA002913465_00014 gene open 4277-5878
50 PPBO01000005.1 GCA002913465_00015 gene open 5912-6613 tnp
51 PPBO01000005.1 GCA002913465_00016 gene open 7402-9183
52 PPBO01000005.1 GCA002913465_00017 gene open 9265-9516
53 PPBO01000005.1 GCA002913465_00018 gene open 9506-9793 relE
54 PPBO01000005.1 GCA002913465_00019 gene open 10159-10488
55 PPBO01000005.1 GCA002913465_00020 gene open 10536-12128
56 PPBO01000005.1 GCA002913465_00021 gene open 12796-12969
57 PPBO01000005.1 GCA002913465_00022 gene open 13031-13156
58 PPBO01000005.1 GCA002913465_00023 gene open 13328-13687 dnaI
59 PPBO01000005.1 GCA002913465_00024 gene open 13641-13865
60 PPBO01000005.1 GCA002913465_00025 gene open 14067-14411
61 PPBO01000005.1 GCA002913465_00026 gene open 14481-14639
62 PPBO01000005.1 GCA002913465_00027 gene open 15859-16212
63 PPBO01000005.1 GCA002913465_00028 gene open 16290-17207
64 PPBO01000005.1 GCA002913465_00029 gene open 17310-18491
65 PPBO01000005.1 GCA002913465_00030 gene open 18494-19153
66 PPBO01000005.1 GCA002913465_00031 gene open 19160-20344
67 PPBO01000005.1 GCA002913465_00032 gene open 20419-21420 flgG
68 PPBO01000005.1 GCA002913465_00033 gene open 21531-22367
69 PPBO01000005.1 GCA002913465_00034 gene open 22532-23251
70 PPBO01000005.1 GCA002913465_00035 gene open 23264-23959
71 PPBO01000006.1 repeat_region open 8833-9202 CRISPR array with 6 repeats of length 30%2C consensus sequence ATTAGAATTTACTCCGTTGGAGTTTGAAAC and spacer length 35
72 PPBO01000006.1 GCA002913465_00038 CDS open 414-1106 _na     230_aa CRISPR associated protein Cas6 C-terminal domain-containing protein
73 PPBO01000006.1 GCA002913465_00039 CDS open 1278-3044 _na     588_aa CRISPR/Cas system-associated protein Cas8%2C type I-B/HMARI
74 PPBO01000006.1 GCA002913465_00040 CDS open 3055-3996 _na     313_aa cas7b type I-B CRISPR-associated protein Cas7/Csh2
75 PPBO01000006.1 GCA002913465_00041 CDS open 3998-4708 _na     236_aa CRISPR/Cas system-associated RAMP protein Cas5%2C type I-B/HMARI
76 PPBO01000006.1 GCA002913465_00042 CDS open 4683-6884 _na     733_aa CRISPR/Cas system-associated endonuclease/helicase Cas3%2C type I-B/HMARI
77 PPBO01000006.1 GCA002913465_00043 CDS open 6884-7384 _na     166_aa CRISPR-associated exonuclease Cas4
78 PPBO01000006.1 GCA002913465_00044 CDS open 7393-7671 _na     92_aa cas2 CRISPR-associated endonuclease Cas2
79 PPBO01000006.1 GCA002913465_00045 CDS open 7681-8679 _na     332_aa cas1 CRISPR-associated endonuclease Cas1
80 PPBO01000006.1 GCA002913465_00046 CDS open 9265-9543 _na     92_aa HTH cro/C1-type domain-containing protein
81 PPBO01000006.1 GCA002913465_00047 CDS open 9540-9758 _na     72_aa Toxin-antitoxin system%2C toxin component%2C RelE/ParE family
82 PPBO01000006.1 GCA002913465_00048 CDS open 10215-10736 _na     173_aa hypothetical protein
83 PPBO01000006.1 GCA002913465_00049 CDS open 10873-11229 _na     118_aa rplS 50S ribosomal protein L19
84 PPBO01000006.1 GCA002913465_00050 CDS open 11238-11930 _na     230_aa trmD tRNA (guanosine(37)-N1)-methyltransferase TrmD
85 PPBO01000006.1 GCA002913465_00051 CDS open 11927-12457 _na     176_aa rimM ribosome maturation factor RimM
86 PPBO01000006.1 GCA002913465_00052 CDS open 12450-12692 _na     80_aa RNA-binding protein (KH domain)
87 PPBO01000006.1 GCA002913465_00053 CDS open 12692-12919 _na     75_aa rpsP 30S ribosomal protein S16
88 PPBO01000006.1 GCA002913465_00054 CDS open 12991-14331 _na     446_aa ffh signal recognition particle protein
89 PPBO01000006.1 GCA002913465_00055 CDS open 14394-15152 _na     252_aa RNA pseudouridylate synthase
90 PPBO01000006.1 GCA002913465_00056 CDS open 15149-16285 _na     378_aa waaA lipid IV(A) 3-deoxy-D-manno-octulosonic acid transferase
91 PPBO01000006.1 GCA002913465_00057 CDS open 16294-17001 _na     235_aa C4-type zinc ribbon domain-containing protein
92 PPBO01000006.1 GCA002913465_00058 CDS open 17019-17741 _na     240_aa Nif3-like dinuclear metal center hexameric protein
93 PPBO01000006.1 GCA002913465_00059 CDS open 17754-18608 _na     284_aa glyQ glycine--tRNA ligase subunit alpha
94 PPBO01000006.1 GCA002913465_00060 CDS open 18619-19035 _na     138_aa GyrI-like domain-containing protein
95 PPBO01000006.1 GCA002913465_00061 CDS open 19039-19512 _na     157_aa DUF3972 domain-containing protein
96 PPBO01000006.1 GCA002913465_00062 CDS open 19524-20018 _na     164_aa N5-carboxyaminoimidazole ribonucleotide mutase
97 PPBO01000006.1 GCA002913465_00063 CDS open 20015-21274 _na     419_aa Peptidase family U32 C-terminal domain-containing protein
98 PPBO01000006.1 GCA002913465_00064 CDS open 21274-22023 _na     249_aa Chemotaxis protein
99 PPBO01000006.1 GCA002913465_00065 CDS open 22160-22939 _na     259_aa Histidinol-phosphatase
100 PPBO01000006.1 GCA002913465_00066 CDS open 23027-24457 _na     476_aa glnA type I glutamate--ammonia ligase
101 PPBO01000006.1 GCA002913465_00038 gene open 414-1106
102 PPBO01000006.1 GCA002913465_00039 gene open 1278-3044
103 PPBO01000006.1 GCA002913465_00040 gene open 3055-3996 cas7b
104 PPBO01000006.1 GCA002913465_00041 gene open 3998-4708
105 PPBO01000006.1 GCA002913465_00042 gene open 4683-6884
106 PPBO01000006.1 GCA002913465_00043 gene open 6884-7384
107 PPBO01000006.1 GCA002913465_00044 gene open 7393-7671 cas2
108 PPBO01000006.1 GCA002913465_00045 gene open 7681-8679 cas1
109 PPBO01000006.1 GCA002913465_00046 gene open 9265-9543
110 PPBO01000006.1 GCA002913465_00047 gene open 9540-9758
111 PPBO01000006.1 GCA002913465_00048 gene open 10215-10736
112 PPBO01000006.1 GCA002913465_00049 gene open 10873-11229 rplS
113 PPBO01000006.1 GCA002913465_00050 gene open 11238-11930 trmD
114 PPBO01000006.1 GCA002913465_00051 gene open 11927-12457 rimM
115 PPBO01000006.1 GCA002913465_00052 gene open 12450-12692
116 PPBO01000006.1 GCA002913465_00053 gene open 12692-12919 rpsP
117 PPBO01000006.1 GCA002913465_00054 gene open 12991-14331 ffh
118 PPBO01000006.1 GCA002913465_00055 gene open 14394-15152
119 PPBO01000006.1 GCA002913465_00056 gene open 15149-16285 waaA
120 PPBO01000006.1 GCA002913465_00057 gene open 16294-17001
121 PPBO01000006.1 GCA002913465_00058 gene open 17019-17741
122 PPBO01000006.1 GCA002913465_00059 gene open 17754-18608 glyQ
123 PPBO01000006.1 GCA002913465_00060 gene open 18619-19035
124 PPBO01000006.1 GCA002913465_00061 gene open 19039-19512
125 PPBO01000006.1 GCA002913465_00062 gene open 19524-20018
126 PPBO01000006.1 GCA002913465_00063 gene open 20015-21274
127 PPBO01000006.1 GCA002913465_00064 gene open 21274-22023
128 PPBO01000006.1 GCA002913465_00065 gene open 22160-22939
129 PPBO01000006.1 GCA002913465_00066 gene open 23027-24457 glnA
130 PPBO01000006.1 GCA002913465_00036 gene open 39-114 trnE
131 PPBO01000006.1 GCA002913465_00037 gene open 128-203 trnK
132 PPBO01000006.1 GCA002913465_00036 tRNA open 39-114 trnE tRNA-Glu(ctc)
133 PPBO01000006.1 GCA002913465_00037 tRNA open 128-203 trnK tRNA-Lys(ttt)
134 PPBO01000007.1 GCA002913465_00081 gene open 15121-15479 ssrA
135 PPBO01000007.1 GCA002913465_00081 tmRNA open 15121-15479 ssrA transfer-messenger RNA%2C SsrA
136 PPBO01000007.1 GCA002913465_00067 CDS open 265-1665 _na     466_aa Aspartase A
137 PPBO01000007.1 GCA002913465_00068 CDS open 1757-3100 _na     447_aa dcuA C4-dicarboxylate transporter DcuA
138 PPBO01000007.1 GCA002913465_00069 CDS open 3403-5676 _na     757_aa phsA thiosulfate reductase PhsA
139 PPBO01000007.1 GCA002913465_00070 CDS open 5686-6249 _na     187_aa Putative thiosulfate/polysulfide reductase%2C 4Fe-4S iron-sulfur binding domain-containing subunit
140 PPBO01000007.1 GCA002913465_00071 CDS open 6242-7177 _na     311_aa nrfD Polysulfide reductase NrfD
141 PPBO01000007.1 GCA002913465_00072 CDS open 7268-7936 _na     222_aa Two-component system response regulator
142 PPBO01000007.1 GCA002913465_00073 CDS open 7920-9026 _na     368_aa histidine kinase
143 PPBO01000007.1 GCA002913465_00074 CDS open 9076-10086 _na     336_aa ruvB Holliday junction branch migration DNA helicase RuvB
144 PPBO01000007.1 GCA002913465_00075 CDS open 10110-11189 _na     359_aa Cytochrome C
145 PPBO01000007.1 GCA002913465_00076 CDS open 11390-12430 _na     346_aa Acid membrane antigen A
146 PPBO01000007.1 GCA002913465_00077 CDS open 12445-12816 _na     123_aa HIT domain-containing protein
147 PPBO01000007.1 GCA002913465_00078 CDS open 12809-13696 _na     295_aa Double Cache domain-containing protein
148 PPBO01000007.1 GCA002913465_00079 CDS open 13784-14599 _na     271_aa panB 3-methyl-2-oxobutanoate hydroxymethyltransferase
149 PPBO01000007.1 GCA002913465_00080 CDS open 14686-15090 _na     134_aa HPt domain-containing protein
150 PPBO01000007.1 GCA002913465_00082 CDS open 16220-16432 _na     70_aa hypothetical protein
151 PPBO01000007.1 GCA002913465_00083 CDS open 16485-17348 _na     287_aa Signal peptide peptidase protease IV
152 PPBO01000007.1 GCA002913465_00084 CDS open 17336-18553 _na     405_aa metal-dependent hydrolase
153 PPBO01000007.1 GCA002913465_00085 CDS open 18638-19117 _na     159_aa aroQ type II 3-dehydroquinate dehydratase
154 PPBO01000007.1 GCA002913465_00086 CDS open 19114-20139 _na     341_aa X-Pro dipeptidase
155 PPBO01000007.1 GCA002913465_00087 CDS open 20136-20612 _na     158_aa folK 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase
156 PPBO01000007.1 GCA002913465_00088 CDS open 20623-21981 _na     452_aa flhF flagellar biosynthesis protein FlhF
157 PPBO01000007.1 GCA002913465_00089 CDS open 21974-22840 _na     288_aa CobQ/CobB/MinD/ParA nucleotide binding domain-containing protein
158 PPBO01000007.1 GCA002913465_00090 CDS open 22854-23198 _na     114_aa Motility integral membrane protein
159 PPBO01000007.1 GCA002913465_00091 CDS open 23170-23874 _na     234_aa RNA polymerase sigma28 factor
160 PPBO01000007.1 GCA002913465_00092 CDS open 23874-24977 _na     367_aa fliM flagellar motor switch protein FliM
161 PPBO01000007.1 GCA002913465_00093 CDS open 24967-25821 _na     284_aa fliY flagellar motor switch protein FliY
162 PPBO01000007.1 GCA002913465_00094 CDS open 25821-26411 _na     196_aa Cytokinin riboside 5'-monophosphate phosphoribohydrolase
163 PPBO01000007.1 GCA002913465_00095 CDS open 26458-27480 _na     340_aa mnmA tRNA 2-thiouridine(34) synthase MnmA
164 PPBO01000007.1 GCA002913465_00096 CDS open 27467-27850 _na     127_aa marR MarR family transcriptional regulator
165 PPBO01000007.1 GCA002913465_00097 CDS open 28003-28932 _na     309_aa Ribose-phosphate pyrophosphokinase
166 PPBO01000007.1 GCA002913465_00098 CDS open 29341-29823 _na     160_aa yqhA YqhA family protein
167 PPBO01000007.1 GCA002913465_00099 CDS open 29916-30938 _na     340_aa hemE uroporphyrinogen decarboxylase
168 PPBO01000007.1 GCA002913465_00100 CDS open 30928-31842 _na     304_aa Wyosine [tRNA(Phe)-imidazoG37] synthetase%2C radical SAM superfamily
169 PPBO01000007.1 GCA002913465_00101 CDS open 31846-32664 _na     272_aa pyridoxamine kinase
170 PPBO01000007.1 GCA002913465_00102 CDS open 32813-34777 _na     654_aa Methyl-accepting transducer domain-containing protein
171 PPBO01000007.1 GCA002913465_00067 gene open 265-1665
172 PPBO01000007.1 GCA002913465_00068 gene open 1757-3100 dcuA
173 PPBO01000007.1 GCA002913465_00069 gene open 3403-5676 phsA
174 PPBO01000007.1 GCA002913465_00070 gene open 5686-6249
175 PPBO01000007.1 GCA002913465_00071 gene open 6242-7177 nrfD
176 PPBO01000007.1 GCA002913465_00072 gene open 7268-7936
177 PPBO01000007.1 GCA002913465_00073 gene open 7920-9026
178 PPBO01000007.1 GCA002913465_00074 gene open 9076-10086 ruvB
179 PPBO01000007.1 GCA002913465_00075 gene open 10110-11189
180 PPBO01000007.1 GCA002913465_00076 gene open 11390-12430
181 PPBO01000007.1 GCA002913465_00077 gene open 12445-12816
182 PPBO01000007.1 GCA002913465_00078 gene open 12809-13696
183 PPBO01000007.1 GCA002913465_00079 gene open 13784-14599 panB
184 PPBO01000007.1 GCA002913465_00080 gene open 14686-15090
185 PPBO01000007.1 GCA002913465_00082 gene open 16220-16432
186 PPBO01000007.1 GCA002913465_00083 gene open 16485-17348
187 PPBO01000007.1 GCA002913465_00084 gene open 17336-18553
188 PPBO01000007.1 GCA002913465_00085 gene open 18638-19117 aroQ
189 PPBO01000007.1 GCA002913465_00086 gene open 19114-20139
190 PPBO01000007.1 GCA002913465_00087 gene open 20136-20612 folK
191 PPBO01000007.1 GCA002913465_00088 gene open 20623-21981 flhF
192 PPBO01000007.1 GCA002913465_00089 gene open 21974-22840
193 PPBO01000007.1 GCA002913465_00090 gene open 22854-23198
194 PPBO01000007.1 GCA002913465_00091 gene open 23170-23874
195 PPBO01000007.1 GCA002913465_00092 gene open 23874-24977 fliM
196 PPBO01000007.1 GCA002913465_00093 gene open 24967-25821 fliY
197 PPBO01000007.1 GCA002913465_00094 gene open 25821-26411
198 PPBO01000007.1 GCA002913465_00095 gene open 26458-27480 mnmA
199 PPBO01000007.1 GCA002913465_00096 gene open 27467-27850 marR
200 PPBO01000007.1 GCA002913465_00097 gene open 28003-28932
201 PPBO01000007.1 GCA002913465_00098 gene open 29341-29823 yqhA
202 PPBO01000007.1 GCA002913465_00099 gene open 29916-30938 hemE
203 PPBO01000007.1 GCA002913465_00100 gene open 30928-31842
204 PPBO01000007.1 GCA002913465_00101 gene open 31846-32664
205 PPBO01000007.1 GCA002913465_00102 gene open 32813-34777
206 PPBO01000008.1 GCA002913465_00103 CDS open 255-1988 _na     577_aa Bacterial Ig-like domain-containing protein
207 PPBO01000008.1 GCA002913465_00104 CDS open 2161-4503 _na     780_aa Bacterial Ig-like domain-containing protein
208 PPBO01000008.1 GCA002913465_00105 CDS open 4632-5006 _na     124_aa Reactive intermediate/imine deaminase
209 PPBO01000008.1 GCA002913465_00106 CDS open 5101-5574 _na     157_aa Cysteine permease
210 PPBO01000008.1 GCA002913465_00107 CDS open 5552-6091 _na     179_aa tcyA L-cystine-binding protein TcyA
211 PPBO01000008.1 GCA002913465_00108 CDS open 6134-6694 _na     186_aa Fe-S-containing hydro-lyase
212 PPBO01000008.1 GCA002913465_00109 CDS open 6704-7549 _na     281_aa fumarate hydratase
213 PPBO01000008.1 GCA002913465_00110 CDS open 7708-8271 _na     187_aa lemA LemA family protein
214 PPBO01000008.1 GCA002913465_00111 CDS open 8282-9172 _na     296_aa Galanin
215 PPBO01000008.1 GCA002913465_00112 CDS open 9173-9820 _na     215_aa sugar transporter
216 PPBO01000008.1 GCA002913465_00113 CDS open 10290-11630 _na     446_aa corC Magnesium and cobalt efflux protein CorC
217 PPBO01000008.1 GCA002913465_00114 CDS open 11801-13114 _na     437_aa Transporter
218 PPBO01000008.1 GCA002913465_00115 CDS open 13154-13600 _na     148_aa copG CopG family transcriptional regulator
219 PPBO01000008.1 GCA002913465_00116 CDS open 13710-14678 _na     322_aa putative transporter
220 PPBO01000008.1 GCA002913465_00117 CDS open 15404-16207 _na     267_aa Peptidase M48 domain-containing protein
221 PPBO01000008.1 GCA002913465_00118 CDS open 16210-16692 _na     160_aa N-acetyltransferase domain-containing protein
222 PPBO01000008.1 GCA002913465_00120 CDS open 16882-18456 _na     524_aa Na+/H+ antiporter
223 PPBO01000008.1 GCA002913465_00121 CDS open 18453-18965 _na     170_aa Chemotaxis protein
224 PPBO01000008.1 GCA002913465_00122 CDS open 19061-20554 _na     497_aa TonB-dependent receptor-like beta-barrel domain-containing protein
225 PPBO01000008.1 GCA002913465_00123 CDS open 20633-21175 _na     180_aa TonB-dependent receptor plug domain-containing protein
226 PPBO01000008.1 GCA002913465_00124 CDS open 21172-22254 _na     360_aa PepSY domain-containing protein
227 PPBO01000008.1 GCA002913465_00125 CDS open 22643-22801 _na     52_aa hypothetical protein
228 PPBO01000008.1 GCA002913465_00103 gene open 255-1988
229 PPBO01000008.1 GCA002913465_00104 gene open 2161-4503
230 PPBO01000008.1 GCA002913465_00105 gene open 4632-5006
231 PPBO01000008.1 GCA002913465_00106 gene open 5101-5574
232 PPBO01000008.1 GCA002913465_00107 gene open 5552-6091 tcyA
233 PPBO01000008.1 GCA002913465_00108 gene open 6134-6694
234 PPBO01000008.1 GCA002913465_00109 gene open 6704-7549
235 PPBO01000008.1 GCA002913465_00110 gene open 7708-8271 lemA
236 PPBO01000008.1 GCA002913465_00111 gene open 8282-9172
237 PPBO01000008.1 GCA002913465_00112 gene open 9173-9820
238 PPBO01000008.1 GCA002913465_00113 gene open 10290-11630 corC
239 PPBO01000008.1 GCA002913465_00114 gene open 11801-13114
240 PPBO01000008.1 GCA002913465_00115 gene open 13154-13600 copG
241 PPBO01000008.1 GCA002913465_00116 gene open 13710-14678
242 PPBO01000008.1 GCA002913465_00117 gene open 15404-16207
243 PPBO01000008.1 GCA002913465_00118 gene open 16210-16692
244 PPBO01000008.1 GCA002913465_00120 gene open 16882-18456
245 PPBO01000008.1 GCA002913465_00121 gene open 18453-18965
246 PPBO01000008.1 GCA002913465_00122 gene open 19061-20554
247 PPBO01000008.1 GCA002913465_00123 gene open 20633-21175
248 PPBO01000008.1 GCA002913465_00124 gene open 21172-22254
249 PPBO01000008.1 GCA002913465_00125 gene open 22643-22801
250 PPBO01000008.1 GCA002913465_00119 gene open 16736-16823 trnS
251 PPBO01000008.1 GCA002913465_00119 tRNA open 16736-16823 trnS tRNA-Ser(gga)
252 PPBO01000009.1 GCA002913465_00126 CDS open 163-1020 _na     285_aa sdhE 8-methylmenaquinol:fumarate reductase membrane anchor subunit
253 PPBO01000009.1 GCA002913465_00127 CDS open 1023-1988 _na     321_aa sdhB 8-methylmenaquinol:fumarate reductase iron-sulfur subunit
254 PPBO01000009.1 GCA002913465_00128 CDS open 1998-3836 _na     612_aa sdhA 8-methylmenaquinol:fumarate reductase flavoprotein subunit
255 PPBO01000009.1 GCA002913465_00129 CDS open 4267-4689 _na     140_aa Knr4/Smi1-like domain-containing protein
256 PPBO01000009.1 GCA002913465_00130 CDS open 4729-5280 _na     183_aa 2-oxoglutarate:acceptor oxidoreductase%2C gamma subunit
257 PPBO01000009.1 GCA002913465_00131 CDS open 5277-6122 _na     281_aa 2-oxoglutarate ferredoxin oxidoreductase subunit beta
258 PPBO01000009.1 GCA002913465_00132 CDS open 6112-7242 _na     376_aa 2-oxoglutarate synthase subunit alpha
259 PPBO01000009.1 GCA002913465_00133 CDS open 7239-7550 _na     103_aa 2-oxoglutarate:acceptor oxidoreductase%2C delta subunit
260 PPBO01000009.1 GCA002913465_00134 CDS open 7559-8452 _na     297_aa Malate dehydrogenase%2C NAD-dependent
261 PPBO01000009.1 GCA002913465_00135 CDS open 8456-10630 _na     724_aa isocitrate dehydrogenase (NADP(+))
262 PPBO01000009.1 GCA002913465_00136 CDS open 10694-11503 _na     269_aa Endolytic murein transglycosylase
263 PPBO01000009.1 GCA002913465_00137 CDS open 11580-14177 _na     865_aa DUF3971 domain-containing protein
264 PPBO01000009.1 GCA002913465_00138 CDS open 14858-15199 _na     113_aa hypA hydrogenase maturation nickel metallochaperone HypA
265 PPBO01000009.1 GCA002913465_00139 CDS open 15199-16191 _na     330_aa hypE hydrogenase expression/formation protein HypE
266 PPBO01000009.1 GCA002913465_00140 CDS open 16200-17288 _na     362_aa hypD hydrogenase formation protein HypD
267 PPBO01000009.1 GCA002913465_00141 CDS open 17288-17527 _na     79_aa hypC Hydrogenase assembly chaperone HypC
268 PPBO01000009.1 GCA002913465_00142 CDS open 17527-18339 _na     270_aa hypB hydrogenase nickel incorporation protein HypB
269 PPBO01000009.1 GCA002913465_00143 CDS open 18463-19095 _na     210_aa GDYXXLXY protein
270 PPBO01000009.1 GCA002913465_00144 CDS open 19092-20354 _na     420_aa DUF2157 domain-containing protein
271 PPBO01000009.1 GCA002913465_00145 CDS open 20718-21131 _na     137_aa nikR nickel-responsive transcriptional regulator NikR
272 PPBO01000009.1 GCA002913465_00146 CDS open 21177-23402 _na     741_aa hypF carbamoyltransferase HypF
273 PPBO01000009.1 GCA002913465_00147 CDS open 23386-24858 _na     490_aa hydE Protein hydE
274 PPBO01000009.1 GCA002913465_00148 CDS open 24855-25397 _na     180_aa Hydrogenase maturation protease
275 PPBO01000009.1 GCA002913465_00149 CDS open 25397-26077 _na     226_aa cybH Ni/Fe-hydrogenase%2C b-type cytochrome subunit
276 PPBO01000009.1 GCA002913465_00150 CDS open 26087-27805 _na     572_aa [NiFe] hydrogenase%2C large subunit
277 PPBO01000009.1 GCA002913465_00151 CDS open 27815-28960 _na     381_aa [NiFe] hydrogenase%2C small subunit
278 PPBO01000009.1 GCA002913465_00152 CDS open 29302-30009 _na     235_aa flgH flagellar basal body L-ring protein FlgH
279 PPBO01000009.1 GCA002913465_00153 CDS open 30076-31443 _na     455_aa pta phosphate acetyltransferase
280 PPBO01000009.1 GCA002913465_00154 CDS open 31445-32638 _na     397_aa ackA Acetate kinase
281 PPBO01000009.1 GCA002913465_00155 CDS open 32641-33705 _na     354_aa xerH Tyrosine recombinase XerH
282 PPBO01000009.1 GCA002913465_00156 CDS open 33727-34218 _na     163_aa TM2 domain-containing protein
283 PPBO01000009.1 GCA002913465_00157 CDS open 34413-34859 _na     148_aa Beta-lactamase
284 PPBO01000009.1 GCA002913465_00158 CDS open 34856-36280 _na     474_aa UDP-N-acetylmuramoylalanyl-D-glutamyl-2%2C6-diaminopimelate--D-alanyl-D-alanine ligase
285 PPBO01000009.1 GCA002913465_00159 CDS open 36277-37062 _na     261_aa AB hydrolase-1 domain-containing protein
286 PPBO01000009.1 GCA002913465_00160 CDS open 37052-37282 _na     76_aa Antitoxin
287 PPBO01000009.1 GCA002913465_00161 CDS open 37347-38387 _na     346_aa ddl D-alanine--D-alanine ligase
288 PPBO01000009.1 GCA002913465_00162 CDS open 38399-38953 _na     184_aa ruvA Holliday junction branch migration protein RuvA
289 PPBO01000009.1 GCA002913465_00163 CDS open 38953-40884 _na     643_aa Flagellar Assembly Protein A N-terminal region domain-containing protein
290 PPBO01000009.1 GCA002913465_00164 CDS open 41006-42406 _na     466_aa murJ murein biosynthesis integral membrane protein MurJ
291 PPBO01000009.1 GCA002913465_00165 CDS open 42393-43787 _na     464_aa cysS cysteine--tRNA ligase
292 PPBO01000009.1 GCA002913465_00166 CDS open 43756-45504 _na     582_aa Lipid A export ATP-binding/permease protein
293 PPBO01000009.1 GCA002913465_00167 CDS open 45558-46631 _na     357_aa quinone-dependent dihydroorotate dehydrogenase
294 PPBO01000009.1 GCA002913465_00168 CDS open 46643-47884 _na     413_aa Zn-dependent peptidase%2C M16 family
295 PPBO01000009.1 GCA002913465_00169 CDS open 47887-48780 _na     297_aa dapA 4-hydroxy-tetrahydrodipicolinate synthase
296 PPBO01000009.1 GCA002913465_00170 CDS open 48780-49568 _na     262_aa enoyl-ACP reductase
297 PPBO01000009.1 GCA002913465_00171 CDS open 49603-50148 _na     181_aa pgsA CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase
298 PPBO01000009.1 GCA002913465_00172 CDS open 50151-51047 _na     298_aa hypothetical protein
299 PPBO01000009.1 GCA002913465_00173 CDS open 51124-52233 _na     369_aa rseP RIP metalloprotease RseP
300 PPBO01000009.1 GCA002913465_00174 CDS open 52233-52868 _na     211_aa Pyridoxal phosphate homeostasis protein
301 PPBO01000009.1 GCA002913465_00175 CDS open 52980-53522 _na     180_aa beta-lactamase
302 PPBO01000009.1 GCA002913465_00176 CDS open 53630-54676 _na     348_aa hypothetical protein
303 PPBO01000009.1 GCA002913465_00177 CDS open 54712-55512 _na     266_aa Cell surface protein
304 PPBO01000009.1 GCA002913465_00178 CDS open 55525-56328 _na     267_aa hypothetical protein
305 PPBO01000009.1 GCA002913465_00179 CDS open 56355-57065 _na     236_aa hypothetical protein
306 PPBO01000009.1 GCA002913465_00126 gene open 163-1020 sdhE
307 PPBO01000009.1 GCA002913465_00127 gene open 1023-1988 sdhB
308 PPBO01000009.1 GCA002913465_00128 gene open 1998-3836 sdhA
309 PPBO01000009.1 GCA002913465_00129 gene open 4267-4689
310 PPBO01000009.1 GCA002913465_00130 gene open 4729-5280
311 PPBO01000009.1 GCA002913465_00131 gene open 5277-6122
312 PPBO01000009.1 GCA002913465_00132 gene open 6112-7242
313 PPBO01000009.1 GCA002913465_00133 gene open 7239-7550
314 PPBO01000009.1 GCA002913465_00134 gene open 7559-8452
315 PPBO01000009.1 GCA002913465_00135 gene open 8456-10630
316 PPBO01000009.1 GCA002913465_00136 gene open 10694-11503
317 PPBO01000009.1 GCA002913465_00137 gene open 11580-14177
318 PPBO01000009.1 GCA002913465_00138 gene open 14858-15199 hypA
319 PPBO01000009.1 GCA002913465_00139 gene open 15199-16191 hypE
320 PPBO01000009.1 GCA002913465_00140 gene open 16200-17288 hypD
321 PPBO01000009.1 GCA002913465_00141 gene open 17288-17527 hypC
322 PPBO01000009.1 GCA002913465_00142 gene open 17527-18339 hypB
323 PPBO01000009.1 GCA002913465_00143 gene open 18463-19095
324 PPBO01000009.1 GCA002913465_00144 gene open 19092-20354
325 PPBO01000009.1 GCA002913465_00145 gene open 20718-21131 nikR
326 PPBO01000009.1 GCA002913465_00146 gene open 21177-23402 hypF
327 PPBO01000009.1 GCA002913465_00147 gene open 23386-24858 hydE
328 PPBO01000009.1 GCA002913465_00148 gene open 24855-25397
329 PPBO01000009.1 GCA002913465_00149 gene open 25397-26077 cybH
330 PPBO01000009.1 GCA002913465_00150 gene open 26087-27805
331 PPBO01000009.1 GCA002913465_00151 gene open 27815-28960
332 PPBO01000009.1 GCA002913465_00152 gene open 29302-30009 flgH
333 PPBO01000009.1 GCA002913465_00153 gene open 30076-31443 pta
334 PPBO01000009.1 GCA002913465_00154 gene open 31445-32638 ackA
335 PPBO01000009.1 GCA002913465_00155 gene open 32641-33705 xerH
336 PPBO01000009.1 GCA002913465_00156 gene open 33727-34218
337 PPBO01000009.1 GCA002913465_00157 gene open 34413-34859
338 PPBO01000009.1 GCA002913465_00158 gene open 34856-36280
339 PPBO01000009.1 GCA002913465_00159 gene open 36277-37062
340 PPBO01000009.1 GCA002913465_00160 gene open 37052-37282
341 PPBO01000009.1 GCA002913465_00161 gene open 37347-38387 ddl
342 PPBO01000009.1 GCA002913465_00162 gene open 38399-38953 ruvA
343 PPBO01000009.1 GCA002913465_00163 gene open 38953-40884
344 PPBO01000009.1 GCA002913465_00164 gene open 41006-42406 murJ
345 PPBO01000009.1 GCA002913465_00165 gene open 42393-43787 cysS
346 PPBO01000009.1 GCA002913465_00166 gene open 43756-45504
347 PPBO01000009.1 GCA002913465_00167 gene open 45558-46631
348 PPBO01000009.1 GCA002913465_00168 gene open 46643-47884
349 PPBO01000009.1 GCA002913465_00169 gene open 47887-48780 dapA
350 PPBO01000009.1 GCA002913465_00170 gene open 48780-49568
351 PPBO01000009.1 GCA002913465_00171 gene open 49603-50148 pgsA
352 PPBO01000009.1 GCA002913465_00172 gene open 50151-51047
353 PPBO01000009.1 GCA002913465_00173 gene open 51124-52233 rseP
354 PPBO01000009.1 GCA002913465_00174 gene open 52233-52868
355 PPBO01000009.1 GCA002913465_00175 gene open 52980-53522
356 PPBO01000009.1 GCA002913465_00176 gene open 53630-54676
357 PPBO01000009.1 GCA002913465_00177 gene open 54712-55512
358 PPBO01000009.1 GCA002913465_00178 gene open 55525-56328
359 PPBO01000009.1 GCA002913465_00179 gene open 56355-57065
360 PPBO01000010.1 GCA002913465_00180 CDS open 369-1361 _na     330_aa tRNA(Ile)-lysidine synthase
361 PPBO01000010.1 GCA002913465_00181 CDS open 1358-2668 _na     436_aa rimO 30S ribosomal protein S12 methylthiotransferase RimO
362 PPBO01000010.1 GCA002913465_00182 CDS open 2671-3492 _na     273_aa panC pantoate--beta-alanine ligase
363 PPBO01000010.1 GCA002913465_00183 CDS open 3613-4713 _na     366_aa prfB peptide chain release factor 2
364 PPBO01000010.1 GCA002913465_00184 CDS open 4735-5286 _na     183_aa beta-lactamase
365 PPBO01000010.1 GCA002913465_00185 CDS open 5364-5681 _na     105_aa Type II secretion system protein
366 PPBO01000010.1 GCA002913465_00186 CDS open 5678-7018 _na     446_aa Dihydrolipoamide dehydrogenase
367 PPBO01000010.1 GCA002913465_00187 CDS open 7029-7688 _na     219_aa beta-lactamase
368 PPBO01000010.1 GCA002913465_00188 CDS open 7701-8324 _na     207_aa beta-lactamase
369 PPBO01000010.1 GCA002913465_00189 CDS open 8334-9710 _na     458_aa MBOAT family protein
370 PPBO01000010.1 GCA002913465_00190 CDS open 9679-10743 _na     354_aa SGNH/GDSL hydrolase family protein
371 PPBO01000010.1 GCA002913465_00191 CDS open 10748-11284 _na     178_aa Transformation system protein
372 PPBO01000010.1 GCA002913465_00192 CDS open 11277-11798 _na     173_aa pilN Pilus assembly protein PilN
373 PPBO01000010.1 GCA002913465_00193 CDS open 11795-12799 _na     334_aa Clan AA aspartic protease
374 PPBO01000010.1 GCA002913465_00194 CDS open 12860-13306 _na     148_aa Tetratricopeptide repeat protein
375 PPBO01000010.1 GCA002913465_00195 CDS open 13296-14075 _na     259_aa DUF374 domain-containing protein
376 PPBO01000010.1 GCA002913465_00196 CDS open 14056-15357 _na     433_aa miaB tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB
377 PPBO01000010.1 GCA002913465_00197 CDS open 15357-15599 _na     80_aa HP0268 domain-containing protein
378 PPBO01000010.1 GCA002913465_00198 CDS open 15772-16875 _na     367_aa nusA Transcription termination/antitermination protein NusA
379 PPBO01000010.1 GCA002913465_00199 CDS open 16875-17354 _na     159_aa N-acetyltransferase domain-containing protein
380 PPBO01000010.1 GCA002913465_00200 CDS open 17403-18005 _na     200_aa Putative outer membrane protein
381 PPBO01000010.1 GCA002913465_00201 CDS open 18166-18378 _na     70_aa Transcriptional regulator
382 PPBO01000010.1 GCA002913465_00202 CDS open 18522-19865 _na     447_aa rho transcription termination factor Rho
383 PPBO01000010.1 GCA002913465_00203 CDS open 20031-21116 _na     361_aa Threonine synthase
384 PPBO01000010.1 GCA002913465_00204 CDS open 21128-21511 _na     127_aa ridA Enamine deaminase RidA
385 PPBO01000010.1 GCA002913465_00205 CDS open 21659-22279 _na     206_aa PAC domain-containing protein
386 PPBO01000010.1 GCA002913465_00206 CDS open 22276-24654 _na     792_aa Copper-transporting ATPase
387 PPBO01000010.1 GCA002913465_00207 CDS open 24654-24923 _na     89_aa ccoS cbb3-type cytochrome oxidase assembly protein CcoS
388 PPBO01000010.1 GCA002913465_00208 CDS open 24858-25466 _na     202_aa lysE Transporter%2C LysE family
389 PPBO01000010.1 GCA002913465_00209 CDS open 25584-27245 _na     553_aa DNA polymerase III subunit gamma/tau
390 PPBO01000010.1 GCA002913465_00180 gene open 369-1361
391 PPBO01000010.1 GCA002913465_00181 gene open 1358-2668 rimO
392 PPBO01000010.1 GCA002913465_00182 gene open 2671-3492 panC
393 PPBO01000010.1 GCA002913465_00183 gene open 3613-4713 prfB
394 PPBO01000010.1 GCA002913465_00184 gene open 4735-5286
395 PPBO01000010.1 GCA002913465_00185 gene open 5364-5681
396 PPBO01000010.1 GCA002913465_00186 gene open 5678-7018
397 PPBO01000010.1 GCA002913465_00187 gene open 7029-7688
398 PPBO01000010.1 GCA002913465_00188 gene open 7701-8324
399 PPBO01000010.1 GCA002913465_00189 gene open 8334-9710
400 PPBO01000010.1 GCA002913465_00190 gene open 9679-10743
401 PPBO01000010.1 GCA002913465_00191 gene open 10748-11284
402 PPBO01000010.1 GCA002913465_00192 gene open 11277-11798 pilN
403 PPBO01000010.1 GCA002913465_00193 gene open 11795-12799
404 PPBO01000010.1 GCA002913465_00194 gene open 12860-13306
405 PPBO01000010.1 GCA002913465_00195 gene open 13296-14075
406 PPBO01000010.1 GCA002913465_00196 gene open 14056-15357 miaB
407 PPBO01000010.1 GCA002913465_00197 gene open 15357-15599
408 PPBO01000010.1 GCA002913465_00198 gene open 15772-16875 nusA
409 PPBO01000010.1 GCA002913465_00199 gene open 16875-17354
410 PPBO01000010.1 GCA002913465_00200 gene open 17403-18005
411 PPBO01000010.1 GCA002913465_00201 gene open 18166-18378
412 PPBO01000010.1 GCA002913465_00202 gene open 18522-19865 rho
413 PPBO01000010.1 GCA002913465_00203 gene open 20031-21116
414 PPBO01000010.1 GCA002913465_00204 gene open 21128-21511 ridA
415 PPBO01000010.1 GCA002913465_00205 gene open 21659-22279
416 PPBO01000010.1 GCA002913465_00206 gene open 22276-24654
417 PPBO01000010.1 GCA002913465_00207 gene open 24654-24923 ccoS
418 PPBO01000010.1 GCA002913465_00208 gene open 24858-25466 lysE
419 PPBO01000010.1 GCA002913465_00209 gene open 25584-27245
420 PPBO01000011.1 GCA002913465_00210 CDS open 49-801 _na     250_aa DUF4198 domain-containing protein
421 PPBO01000011.1 GCA002913465_00217 CDS open 2206-2934 _na     242_aa HEAT repeat domain-containing protein
422 PPBO01000011.1 GCA002913465_00218 CDS open 2941-5349 _na     802_aa Flagellar protein
423 PPBO01000011.1 GCA002913465_00219 CDS open 5333-6823 _na     496_aa nuoN NADH-quinone oxidoreductase subunit NuoN
424 PPBO01000011.1 GCA002913465_00220 CDS open 6820-8331 _na     503_aa NADH-quinone oxidoreductase subunit M
425 PPBO01000011.1 GCA002913465_00221 CDS open 8331-10169 _na     612_aa nuoL NADH-quinone oxidoreductase subunit L
426 PPBO01000011.1 GCA002913465_00222 CDS open 10173-10475 _na     100_aa nuoK NADH-quinone oxidoreductase subunit NuoK
427 PPBO01000011.1 GCA002913465_00223 CDS open 10472-11008 _na     178_aa NADH-quinone oxidoreductase subunit J
428 PPBO01000011.1 GCA002913465_00224 CDS open 11001-11639 _na     212_aa nuoI NADH-quinone oxidoreductase subunit NuoI
429 PPBO01000011.1 GCA002913465_00225 CDS open 11648-12643 _na     331_aa nuoH NADH-quinone oxidoreductase subunit NuoH
430 PPBO01000011.1 GCA002913465_00226 CDS open 12636-14948 _na     770_aa NADH-quinone oxidoreductase subunit G
431 PPBO01000011.1 GCA002913465_00227 CDS open 14945-15655 _na     236_aa NADH dehydrogenase
432 PPBO01000011.1 GCA002913465_00228 CDS open 15652-15882 _na     76_aa NADH-ubiquinone oxidoreductase chain E
433 PPBO01000011.1 GCA002913465_00229 CDS open 15879-17108 _na     409_aa nuoD NADH-quinone oxidoreductase subunit D
434 PPBO01000011.1 GCA002913465_00230 CDS open 17105-17869 _na     254_aa NADH-quinone oxidoreductase subunit C
435 PPBO01000011.1 GCA002913465_00231 CDS open 17866-18378 _na     170_aa nuoB NADH-quinone oxidoreductase subunit B
436 PPBO01000011.1 GCA002913465_00232 CDS open 18360-18749 _na     129_aa NAD(P)H-quinone oxidoreductase subunit 3
437 PPBO01000011.1 GCA002913465_00233 CDS open 18857-20491 _na     544_aa multidrug ABC transporter permease/ATP-binding protein
438 PPBO01000011.1 GCA002913465_00234 CDS open 20491-21855 _na     454_aa coproporphyrinogen III oxidase family protein
439 PPBO01000011.1 GCA002913465_00235 CDS open 22046-23362 _na     438_aa ABC transporter permease
440 PPBO01000011.1 GCA002913465_00236 CDS open 23398-24189 _na     263_aa DUF2314 domain-containing protein
441 PPBO01000011.1 GCA002913465_00237 CDS open 24572-25069 _na     165_aa yajQ YajQ family cyclic di-GMP-binding protein
442 PPBO01000011.1 GCA002913465_00238 CDS open 25073-26002 _na     309_aa D-2-hydroxyacid dehydrogenase
443 PPBO01000011.1 GCA002913465_00239 CDS open 26005-27186 _na     393_aa Glutathionylspermidine amidase / glutathionylspermidine synthetase
444 PPBO01000011.1 GCA002913465_00240 CDS open 27189-27806 _na     205_aa Lipoprotein
445 PPBO01000011.1 GCA002913465_00241 CDS open 27803-28435 _na     210_aa Excisionase family DNA binding domain-containing protein
446 PPBO01000011.1 GCA002913465_00242 CDS open 28539-28751 _na     70_aa rpsU 30S ribosomal protein S21
447 PPBO01000011.1 GCA002913465_00243 CDS open 28896-30221 _na     441_aa ccoG cytochrome c oxidase accessory protein CcoG
448 PPBO01000011.1 GCA002913465_00244 CDS open 30252-30878 _na     208_aa cmeR Transcriptional repressor of CmeABC operon%2C CmeR
449 PPBO01000011.1 GCA002913465_00245 CDS open 30986-32146 _na     386_aa cmeA Multidrug efflux system CmeABC%2C periplasmic fusion protein CmeA
450 PPBO01000011.1 GCA002913465_00246 CDS open 32157-35282 _na     1041_aa cmeB Multidrug efflux system CmeABC%2C inner membrane drug transporter CmeB
451 PPBO01000011.1 GCA002913465_00247 CDS open 35272-36654 _na     460_aa Efflux transporter outer membrane subunit
452 PPBO01000011.1 GCA002913465_00248 CDS open 36676-36903 _na     75_aa ATP-binding protein
453 PPBO01000011.1 GCA002913465_00249 CDS open 37032-37739 _na     235_aa aqpZ aquaporin Z
454 PPBO01000011.1 GCA002913465_00250 CDS open 37902-38504 _na     200_aa hypothetical protein
455 PPBO01000011.1 GCA002913465_00251 CDS open 38501-41830 _na     1109_aa N-acetylmuramidase domain-containing protein
456 PPBO01000011.1 GCA002913465_00252 CDS open 41827-42324 _na     165_aa hypothetical protein
457 PPBO01000011.1 GCA002913465_00253 CDS open 42343-45192 _na     949_aa vgrG Type VI secretion system tip protein VgrG
458 PPBO01000011.1 GCA002913465_00254 CDS open 45185-45736 _na     183_aa Ankyrin repeat domain-containing protein
459 PPBO01000011.1 GCA002913465_00255 CDS open 45733-46287 _na     184_aa Ankyrin repeat domain-containing protein
460 PPBO01000011.1 GCA002913465_00256 CDS open 46284-46643 _na     119_aa hypothetical protein
461 PPBO01000011.1 GCA002913465_00210 gene open 49-801
462 PPBO01000011.1 GCA002913465_00217 gene open 2206-2934
463 PPBO01000011.1 GCA002913465_00218 gene open 2941-5349
464 PPBO01000011.1 GCA002913465_00219 gene open 5333-6823 nuoN
465 PPBO01000011.1 GCA002913465_00220 gene open 6820-8331
466 PPBO01000011.1 GCA002913465_00221 gene open 8331-10169 nuoL
467 PPBO01000011.1 GCA002913465_00222 gene open 10173-10475 nuoK
468 PPBO01000011.1 GCA002913465_00223 gene open 10472-11008
469 PPBO01000011.1 GCA002913465_00224 gene open 11001-11639 nuoI
470 PPBO01000011.1 GCA002913465_00225 gene open 11648-12643 nuoH
471 PPBO01000011.1 GCA002913465_00226 gene open 12636-14948
472 PPBO01000011.1 GCA002913465_00227 gene open 14945-15655
473 PPBO01000011.1 GCA002913465_00228 gene open 15652-15882
474 PPBO01000011.1 GCA002913465_00229 gene open 15879-17108 nuoD
475 PPBO01000011.1 GCA002913465_00230 gene open 17105-17869
476 PPBO01000011.1 GCA002913465_00231 gene open 17866-18378 nuoB
477 PPBO01000011.1 GCA002913465_00232 gene open 18360-18749
478 PPBO01000011.1 GCA002913465_00233 gene open 18857-20491
479 PPBO01000011.1 GCA002913465_00234 gene open 20491-21855
480 PPBO01000011.1 GCA002913465_00235 gene open 22046-23362
481 PPBO01000011.1 GCA002913465_00236 gene open 23398-24189
482 PPBO01000011.1 GCA002913465_00237 gene open 24572-25069 yajQ
483 PPBO01000011.1 GCA002913465_00238 gene open 25073-26002
484 PPBO01000011.1 GCA002913465_00239 gene open 26005-27186
485 PPBO01000011.1 GCA002913465_00240 gene open 27189-27806
486 PPBO01000011.1 GCA002913465_00241 gene open 27803-28435
487 PPBO01000011.1 GCA002913465_00242 gene open 28539-28751 rpsU
488 PPBO01000011.1 GCA002913465_00243 gene open 28896-30221 ccoG
489 PPBO01000011.1 GCA002913465_00244 gene open 30252-30878 cmeR
490 PPBO01000011.1 GCA002913465_00245 gene open 30986-32146 cmeA
491 PPBO01000011.1 GCA002913465_00246 gene open 32157-35282 cmeB
492 PPBO01000011.1 GCA002913465_00247 gene open 35272-36654
493 PPBO01000011.1 GCA002913465_00248 gene open 36676-36903
494 PPBO01000011.1 GCA002913465_00249 gene open 37032-37739 aqpZ
495 PPBO01000011.1 GCA002913465_00250 gene open 37902-38504
496 PPBO01000011.1 GCA002913465_00251 gene open 38501-41830
497 PPBO01000011.1 GCA002913465_00252 gene open 41827-42324
498 PPBO01000011.1 GCA002913465_00253 gene open 42343-45192 vgrG
499 PPBO01000011.1 GCA002913465_00254 gene open 45185-45736
500 PPBO01000011.1 GCA002913465_00255 gene open 45733-46287