BAKTAGenome Explorer: Alloscardovia omnicolens (GCA_030224105.1)
Select a Genome:
|
BAKTA Annotations for GCA_030224105.1
|
Search & Sort all 3281 Records
| ||||||||||||||||||
Notes: 1- Column headers only sort the current page. 2- Select [NA] or [AA] links to show sequences.
| Region | Protein-ID | Type | Genome Viewer |
Range (bp) |
Show Sequences (length) NA / AA |
BAKTA Gene |
BAKTA GeneProduct |
|
|---|---|---|---|---|---|---|---|---|
| 1 | JASOTQ010000001.1 | GCA030224105_00500 | gene | open | 474580-474979 | ssrA | ||
| 2 | JASOTQ010000001.1 | GCA030224105_00500 | tmRNA | open | 474580-474979 | ssrA | transfer-messenger RNA%2C SsrA | |
| 3 | JASOTQ010000001.1 | regulatory_region | open | 115064-115168 | TPP riboswitch aptamer (THI element) | |||
| 4 | JASOTQ010000001.1 | regulatory_region | open | 293354-293474 | FMN riboswitch aptamer (RFN element) | |||
| 5 | JASOTQ010000001.1 | regulatory_region | open | 480530-480607 | ZMP/ZTP riboswitch aptamer (pfl RNA motif) | |||
| 6 | JASOTQ010000001.1 | repeat_region | open | 400440-401319 | CRISPR array with 14 repeats of length 36%2C consensus sequence CTATTTTACCAAAGAGGATGAAAGCTAATTCACAGC and spacer length 28 | |||
| 7 | JASOTQ010000001.1 | GCA030224105_00098 | CDS | open | 659-2389 | _na 576_aa | hypothetical protein | |
| 8 | JASOTQ010000001.1 | GCA030224105_00099 | CDS | open | 2477-3136 | _na 219_aa | hypothetical protein | |
| 9 | JASOTQ010000001.1 | GCA030224105_00100 | CDS | open | 3199-4959 | _na 586_aa | TOTE conflict system archaeo-eukaryotic primase domain-containing protein | |
| 10 | JASOTQ010000001.1 | GCA030224105_00101 | CDS | open | 5177-5767 | _na 196_aa | parA | ParA family protein |
| 11 | JASOTQ010000001.1 | GCA030224105_00102 | CDS | open | 5772-6674 | _na 300_aa | ParB/RepB/Spo0J family partition protein | |
| 12 | JASOTQ010000001.1 | GCA030224105_00103 | CDS | open | 6855-7535 | _na 226_aa | hypothetical protein | |
| 13 | JASOTQ010000001.1 | GCA030224105_00104 | CDS | open | 7540-9000 | _na 486_aa | hypothetical protein | |
| 14 | JASOTQ010000001.1 | GCA030224105_00105 | CDS | open | 9016-10305 | _na 429_aa | hypothetical protein | |
| 15 | JASOTQ010000001.1 | GCA030224105_00106 | CDS | open | 10298-11422 | _na 374_aa | peptidoglycan amidohydrolase family protein | |
| 16 | JASOTQ010000001.1 | GCA030224105_00107 | CDS | open | 11449-12057 | _na 202_aa | hypothetical protein | |
| 17 | JASOTQ010000001.1 | GCA030224105_00108 | CDS | open | 12409-12714 | _na 101_aa | trbC | Conjugal transfer protein TrbC |
| 18 | JASOTQ010000001.1 | GCA030224105_00109 | CDS | open | 12836-14305 | _na 489_aa | hypothetical protein | |
| 19 | JASOTQ010000001.1 | GCA030224105_00110 | CDS | open | 14334-15779 | _na 481_aa | SCO6880 family protein | |
| 20 | JASOTQ010000001.1 | GCA030224105_00111 | CDS | open | 15790-17376 | _na 528_aa | ATP-binding protein | |
| 21 | JASOTQ010000001.1 | GCA030224105_00112 | CDS | open | 17392-19275 | _na 627_aa | traM | TraM recognition domain-containing protein |
| 22 | JASOTQ010000001.1 | GCA030224105_00113 | CDS | open | 19303-20049 | _na 248_aa | hypothetical protein | |
| 23 | JASOTQ010000001.1 | GCA030224105_00114 | CDS | open | 20072-20635 | _na 187_aa | hypothetical protein | |
| 24 | JASOTQ010000001.1 | GCA030224105_00115 | CDS | open | 20616-21170 | _na 184_aa | hypothetical protein | |
| 25 | JASOTQ010000001.1 | GCA030224105_00116 | CDS | open | 21323-21988 | _na 221_aa | hypothetical protein | |
| 26 | JASOTQ010000001.1 | GCA030224105_00117 | CDS | open | 21981-23111 | _na 376_aa | XRE family transcriptional regulator | |
| 27 | JASOTQ010000001.1 | GCA030224105_00118 | CDS | open | 23126-24484 | _na 452_aa | abiH | AbiH family protein |
| 28 | JASOTQ010000001.1 | GCA030224105_00119 | CDS | open | 24542-29434 | _na 1630_aa | mobF | MobF family relaxase |
| 29 | JASOTQ010000001.1 | GCA030224105_00120 | CDS | open | 29464-29880 | _na 138_aa | hypothetical protein | |
| 30 | JASOTQ010000001.1 | GCA030224105_00121 | CDS | open | 29913-30587 | _na 224_aa | hypothetical protein | |
| 31 | JASOTQ010000001.1 | GCA030224105_00122 | CDS | open | 31142-31435 | _na 97_aa | hypothetical protein | |
| 32 | JASOTQ010000001.1 | GCA030224105_00123 | CDS | open | 31808-32098 | _na 96_aa | ribbon-helix-helix domain-containing protein | |
| 33 | JASOTQ010000001.1 | GCA030224105_00124 | CDS | open | 32117-32386 | _na 89_aa | Toxin-antitoxin system%2C toxin component | |
| 34 | JASOTQ010000001.1 | GCA030224105_00125 | CDS | open | 32857-33171 | _na 104_aa | hypothetical protein | |
| 35 | JASOTQ010000001.1 | GCA030224105_00126 | CDS | open | 33624-33983 | _na 119_aa | hypothetical protein | |
| 36 | JASOTQ010000001.1 | GCA030224105_00127 | CDS | open | 34061-34423 | _na 120_aa | hypothetical protein | |
| 37 | JASOTQ010000001.1 | GCA030224105_00128 | CDS | open | 35195-35515 | _na 106_aa | hypothetical protein | |
| 38 | JASOTQ010000001.1 | GCA030224105_00129 | CDS | open | 36034-36756 | _na 240_aa | hypothetical protein | |
| 39 | JASOTQ010000001.1 | GCA030224105_00130 | CDS | open | 37102-37479 | _na 125_aa | ASCH domain-containing protein | |
| 40 | JASOTQ010000001.1 | GCA030224105_00131 | CDS | open | 37457-38527 | _na 356_aa | hypothetical protein | |
| 41 | JASOTQ010000001.1 | GCA030224105_00132 | CDS | open | 38536-38868 | _na 110_aa | hypothetical protein | |
| 42 | JASOTQ010000001.1 | GCA030224105_00133 | CDS | open | 38865-39050 | _na 61_aa | Antitoxin | |
| 43 | JASOTQ010000001.1 | GCA030224105_00134 | CDS | open | 39201-39668 | _na 155_aa | single-stranded DNA-binding protein | |
| 44 | JASOTQ010000001.1 | GCA030224105_00135 | CDS | open | 39686-40036 | _na 116_aa | hypothetical protein | |
| 45 | JASOTQ010000001.1 | GCA030224105_00136 | CDS | open | 40048-40554 | _na 168_aa | hypothetical protein | |
| 46 | JASOTQ010000001.1 | GCA030224105_00137 | CDS | open | 40567-40896 | _na 109_aa | hypothetical protein | |
| 47 | JASOTQ010000001.1 | GCA030224105_00138 | CDS | open | 40964-41311 | _na 115_aa | hypothetical protein | |
| 48 | JASOTQ010000001.1 | GCA030224105_00139 | CDS | open | 41971-42423 | _na 150_aa | hypothetical protein | |
| 49 | JASOTQ010000001.1 | GCA030224105_00140 | CDS | open | 42493-42906 | _na 137_aa | XRE family transcriptional regulator | |
| 50 | JASOTQ010000001.1 | GCA030224105_00141 | CDS | open | 42906-43457 | _na 183_aa | XRE family transcriptional regulator | |
| 51 | JASOTQ010000001.1 | GCA030224105_00142 | CDS | open | 43544-47356 | _na 1270_aa | LPXTG cell wall anchor domain-containing protein | |
| 52 | JASOTQ010000001.1 | GCA030224105_00143 | CDS | open | 47540-48481 | _na 313_aa | hypothetical protein | |
| 53 | JASOTQ010000001.1 | GCA030224105_00144 | CDS | open | 48501-48830 | _na 109_aa | hypothetical protein | |
| 54 | JASOTQ010000001.1 | GCA030224105_00145 | CDS | open | 48978-50411 | _na 477_aa | mobF | MobF family relaxase |
| 55 | JASOTQ010000001.1 | GCA030224105_00146 | CDS | open | 50605-50970 | _na 121_aa | GNAT family N-acetyltransferase | |
| 56 | JASOTQ010000001.1 | GCA030224105_00147 | CDS | open | 50971-51540 | _na 189_aa | Panacea domain-containing protein | |
| 57 | JASOTQ010000001.1 | GCA030224105_00148 | CDS | open | 51941-52840 | _na 299_aa | tyrosine-type recombinase/integrase | |
| 58 | JASOTQ010000001.1 | GCA030224105_00150 | CDS | open | 53836-55254 | _na 472_aa | Transporter%2C major facilitator family protein | |
| 59 | JASOTQ010000001.1 | GCA030224105_00151 | CDS | open | 55408-55626 | _na 72_aa | Acid shock domain protein | |
| 60 | JASOTQ010000001.1 | GCA030224105_00152 | CDS | open | 55627-55998 | _na 123_aa | Prealbumin-like fold domain-containing protein | |
| 61 | JASOTQ010000001.1 | GCA030224105_00153 | CDS | open | 56461-56661 | _na 66_aa | hypothetical protein | |
| 62 | JASOTQ010000001.1 | GCA030224105_00154 | CDS | open | 56957-58240 | _na 427_aa | Serine hydroxymethyltransferase | |
| 63 | JASOTQ010000001.1 | GCA030224105_00157 | CDS | open | 60095-61105 | _na 336_aa | galE | UDP-glucose 4-epimerase GalE |
| 64 | JASOTQ010000001.1 | GCA030224105_00158 | CDS | open | 61267-62094 | _na 275_aa | trmB | tRNA (guanosine(46)-N7)-methyltransferase TrmB |
| 65 | JASOTQ010000001.1 | GCA030224105_00160 | CDS | open | 62295-62546 | _na 83_aa | hypothetical protein | |
| 66 | JASOTQ010000001.1 | GCA030224105_00161 | CDS | open | 62994-63128 | _na 44_aa | hypothetical protein | |
| 67 | JASOTQ010000001.1 | GCA030224105_00162 | CDS | open | 63373-64581 | _na 402_aa | cysteine-S-conjugate beta-lyase | |
| 68 | JASOTQ010000001.1 | GCA030224105_00163 | CDS | open | 65027-65761 | _na 244_aa | mtrA | MtrAB system response regulator MtrA |
| 69 | JASOTQ010000001.1 | GCA030224105_00164 | CDS | open | 65815-66333 | _na 172_aa | transposase | |
| 70 | JASOTQ010000001.1 | GCA030224105_00165 | CDS | open | 66630-67058 | _na 142_aa | Transposase | |
| 71 | JASOTQ010000001.1 | GCA030224105_00166 | CDS | open | 67317-73088 | _na 1923_aa | Long Rib domain-containing protein | |
| 72 | JASOTQ010000001.1 | GCA030224105_00167 | CDS | open | 73262-73870 | _na 202_aa | hypothetical protein | |
| 73 | JASOTQ010000001.1 | GCA030224105_00168 | CDS | open | 74030-74899 | _na 289_aa | Glycosyltransferase 2-like domain-containing protein | |
| 74 | JASOTQ010000001.1 | GCA030224105_00169 | CDS | open | 74996-76513 | _na 505_aa | ATP synthase F0%2C A subunit | |
| 75 | JASOTQ010000001.1 | GCA030224105_00170 | CDS | open | 76568-77842 | _na 424_aa | Glycosyltransferase%2C group 2 family protein | |
| 76 | JASOTQ010000001.1 | GCA030224105_00171 | CDS | open | 77832-79289 | _na 485_aa | dacB | D-alanyl-D-alanine carboxypeptidase/D-alanyl-D-alanine-endopeptidase |
| 77 | JASOTQ010000001.1 | GCA030224105_00172 | CDS | open | 79290-80378 | _na 362_aa | tRNA(Ile)-lysidine synthase | |
| 78 | JASOTQ010000001.1 | GCA030224105_00173 | CDS | open | 80365-80919 | _na 184_aa | hpt | hypoxanthine phosphoribosyltransferase |
| 79 | JASOTQ010000001.1 | GCA030224105_00174 | CDS | open | 81089-83371 | _na 760_aa | ftsH | ATP-dependent zinc metalloprotease FtsH |
| 80 | JASOTQ010000001.1 | GCA030224105_00175 | CDS | open | 83364-83939 | _na 191_aa | folE | GTP cyclohydrolase I FolE |
| 81 | JASOTQ010000001.1 | GCA030224105_00176 | CDS | open | 84057-84923 | _na 288_aa | folP | dihydropteroate synthase |
| 82 | JASOTQ010000001.1 | GCA030224105_00177 | CDS | open | 84959-85933 | _na 324_aa | folK | 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase |
| 83 | JASOTQ010000001.1 | GCA030224105_00178 | CDS | open | 85930-86394 | _na 154_aa | DUF3180 domain-containing protein | |
| 84 | JASOTQ010000001.1 | GCA030224105_00179 | CDS | open | 86394-87308 | _na 304_aa | FAS1 domain-containing protein | |
| 85 | JASOTQ010000001.1 | GCA030224105_00180 | CDS | open | 87350-88261 | _na 303_aa | Acyl-CoA thioesterase II | |
| 86 | JASOTQ010000001.1 | GCA030224105_00181 | CDS | open | 88533-91520 | _na 995_aa | Glycosyl hydrolase family 3 protein | |
| 87 | JASOTQ010000001.1 | GCA030224105_00182 | CDS | open | 91709-92413 | _na 234_aa | Response regulator receiver domain protein | |
| 88 | JASOTQ010000001.1 | GCA030224105_00183 | CDS | open | 92410-93798 | _na 462_aa | ATP-binding protein | |
| 89 | JASOTQ010000001.1 | GCA030224105_00184 | CDS | open | 93792-94541 | _na 249_aa | LytTr DNA-binding domain protein | |
| 90 | JASOTQ010000001.1 | GCA030224105_00185 | CDS | open | 94541-95902 | _na 453_aa | Sensor histidine kinase NatK-like C-terminal domain-containing protein | |
| 91 | JASOTQ010000001.1 | GCA030224105_00186 | CDS | open | 95962-97641 | _na 559_aa | ettA | energy-dependent translational throttle protein EttA |
| 92 | JASOTQ010000001.1 | GCA030224105_00187 | CDS | open | 98142-99197 | _na 351_aa | Fic family protein | |
| 93 | JASOTQ010000001.1 | GCA030224105_00188 | CDS | open | 99203-100705 | _na 500_aa | site-specific DNA-methyltransferase (adenine-specific) | |
| 94 | JASOTQ010000001.1 | GCA030224105_00189 | CDS | open | 100729-101790 | _na 353_aa | restriction endonuclease subunit S | |
| 95 | JASOTQ010000001.1 | GCA030224105_00190 | CDS | open | 101862-102830 | _na 322_aa | xerA | site-specific tyrosine recombinase/integron integrase |
| 96 | JASOTQ010000001.1 | GCA030224105_00191 | CDS | open | 102865-103998 | _na 377_aa | restriction endonuclease subunit S | |
| 97 | JASOTQ010000001.1 | GCA030224105_00192 | CDS | open | 104070-105038 | _na 322_aa | xerA | site-specific tyrosine recombinase/integron integrase |
| 98 | JASOTQ010000001.1 | GCA030224105_00193 | CDS | open | 105073-106143 | _na 356_aa | restriction endonuclease subunit S | |
| 99 | JASOTQ010000001.1 | GCA030224105_00194 | CDS | open | 106207-109518 | _na 1103_aa | Putative ATP synthase F1%2C delta subunit | |
| 100 | JASOTQ010000001.1 | GCA030224105_00195 | CDS | open | 109867-111531 | _na 554_aa | ABC transporter%2C substrate-binding protein%2C family 5 | |
| 101 | JASOTQ010000001.1 | GCA030224105_00197 | CDS | open | 112121-112951 | _na 276_aa | DUF5067 domain-containing protein | |
| 102 | JASOTQ010000001.1 | GCA030224105_00198 | CDS | open | 113769-114983 | _na 404_aa | DUF559 domain-containing protein | |
| 103 | JASOTQ010000001.1 | GCA030224105_00199 | CDS | open | 115357-116199 | _na 280_aa | thiM | hydroxyethylthiazole kinase |
| 104 | JASOTQ010000001.1 | GCA030224105_00200 | CDS | open | 116186-116851 | _na 221_aa | Thiamine-phosphate synthase | |
| 105 | JASOTQ010000001.1 | GCA030224105_00201 | CDS | open | 116844-117482 | _na 212_aa | HAD hydrolase%2C family IA%2C variant 3 | |
| 106 | JASOTQ010000001.1 | GCA030224105_00202 | CDS | open | 117483-118295 | _na 270_aa | Bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase | |
| 107 | JASOTQ010000001.1 | GCA030224105_00203 | CDS | open | 118298-118963 | _na 221_aa | tenA | thiaminase II |
| 108 | JASOTQ010000001.1 | GCA030224105_00204 | CDS | open | 119112-119321 | _na 69_aa | rpmE | 50S ribosomal protein L31 |
| 109 | JASOTQ010000001.1 | GCA030224105_00205 | CDS | open | 119513-120613 | _na 366_aa | prfA | peptide chain release factor 1 |
| 110 | JASOTQ010000001.1 | GCA030224105_00206 | CDS | open | 120741-121694 | _na 317_aa | prmC | peptide chain release factor N(5)-glutamine methyltransferase |
| 111 | JASOTQ010000001.1 | GCA030224105_00207 | CDS | open | 121864-122715 | _na 283_aa | Putative aldo-keto reductase | |
| 112 | JASOTQ010000001.1 | GCA030224105_00208 | CDS | open | 122825-123643 | _na 272_aa | Haloacid dehalogenase-like hydrolase | |
| 113 | JASOTQ010000001.1 | GCA030224105_00209 | CDS | open | 123698-124441 | _na 247_aa | Tat pathway signal sequence domain protein | |
| 114 | JASOTQ010000001.1 | GCA030224105_00210 | CDS | open | 124455-125105 | _na 216_aa | L-threonylcarbamoyladenylate synthase | |
| 115 | JASOTQ010000001.1 | GCA030224105_00211 | CDS | open | 125113-126276 | _na 387_aa | Glycosyltransferase%2C group 4 family | |
| 116 | JASOTQ010000001.1 | GCA030224105_00212 | CDS | open | 126273-126686 | _na 137_aa | hypothetical protein | |
| 117 | JASOTQ010000001.1 | GCA030224105_00213 | CDS | open | 126762-128288 | _na 508_aa | guaB | IMP dehydrogenase |
| 118 | JASOTQ010000001.1 | GCA030224105_00214 | CDS | open | 128962-129498 | _na 178_aa | Peptidyl-prolyl cis-trans isomerase | |
| 119 | JASOTQ010000001.1 | GCA030224105_00215 | CDS | open | 129536-131257 | _na 573_aa | Alpha amylase%2C catalytic domain protein | |
| 120 | JASOTQ010000001.1 | GCA030224105_00216 | CDS | open | 131693-132391 | _na 232_aa | orn | oligoribonuclease |
| 121 | JASOTQ010000001.1 | GCA030224105_00217 | CDS | open | 132467-133885 | _na 472_aa | AAA+ ATPase domain-containing protein | |
| 122 | JASOTQ010000001.1 | GCA030224105_00218 | CDS | open | 134004-135776 | _na 590_aa | proline--tRNA ligase | |
| 123 | JASOTQ010000001.1 | GCA030224105_00219 | CDS | open | 136001-136492 | _na 163_aa | Single-stranded DNA-binding protein | |
| 124 | JASOTQ010000001.1 | GCA030224105_00220 | CDS | open | 136551-138671 | _na 706_aa | Peptidase family M13 | |
| 125 | JASOTQ010000001.1 | GCA030224105_00221 | CDS | open | 138874-139449 | _na 191_aa | mntP | Manganese efflux pump MntP |
| 126 | JASOTQ010000001.1 | GCA030224105_00222 | CDS | open | 139490-140266 | _na 258_aa | map | type I methionyl aminopeptidase |
| 127 | JASOTQ010000001.1 | GCA030224105_00223 | CDS | open | 140312-141352 | _na 346_aa | dapD | 2%2C3%2C4%2C5-tetrahydropyridine-2%2C6-dicarboxylate N-succinyltransferase |
| 128 | JASOTQ010000001.1 | GCA030224105_00224 | CDS | open | 141612-142739 | _na 375_aa | prfB | peptide chain release factor 2 |
| 129 | JASOTQ010000001.1 | GCA030224105_00225 | CDS | open | 142812-143945 | _na 377_aa | ftsE | cell division ATP-binding protein FtsE |
| 130 | JASOTQ010000001.1 | GCA030224105_00226 | CDS | open | 143948-144871 | _na 307_aa | ftsX | permease-like cell division protein FtsX |
| 131 | JASOTQ010000001.1 | GCA030224105_00227 | CDS | open | 144942-146345 | _na 467_aa | CHAP domain protein | |
| 132 | JASOTQ010000001.1 | GCA030224105_00228 | CDS | open | 146493-146978 | _na 161_aa | smpB | SsrA-binding protein SmpB |
| 133 | JASOTQ010000001.1 | GCA030224105_00229 | CDS | open | 147114-148037 | _na 307_aa | ABC transporter%2C substrate-binding protein%2C family 3 | |
| 134 | JASOTQ010000001.1 | GCA030224105_00230 | CDS | open | 148074-149009 | _na 311_aa | ABC transporter%2C permease protein | |
| 135 | JASOTQ010000001.1 | GCA030224105_00231 | CDS | open | 149002-149787 | _na 261_aa | glnQ | Glutamine ABC transporter%2C ATP-binding protein GlnQ |
| 136 | JASOTQ010000001.1 | GCA030224105_00232 | CDS | open | 149915-151801 | _na 628_aa | glmS | glutamine--fructose-6-phosphate transaminase (isomerizing) |
| 137 | JASOTQ010000001.1 | GCA030224105_00233 | CDS | open | 151805-152659 | _na 284_aa | ADP-dependent (S)-NAD(P)H-hydrate dehydratase | |
| 138 | JASOTQ010000001.1 | GCA030224105_00234 | CDS | open | 152659-153465 | _na 268_aa | RNA pseudouridine synthase | |
| 139 | JASOTQ010000001.1 | GCA030224105_00235 | CDS | open | 153443-154207 | _na 254_aa | type III pantothenate kinase | |
| 140 | JASOTQ010000001.1 | GCA030224105_00236 | CDS | open | 154390-155985 | _na 531_aa | ABC transporter%2C substrate-binding protein%2C family 5 | |
| 141 | JASOTQ010000001.1 | GCA030224105_00237 | CDS | open | 155982-157121 | _na 379_aa | ABC transporter%2C permease protein | |
| 142 | JASOTQ010000001.1 | GCA030224105_00238 | CDS | open | 157121-157996 | _na 291_aa | ABC transporter%2C permease protein | |
| 143 | JASOTQ010000001.1 | GCA030224105_00239 | CDS | open | 157998-158774 | _na 258_aa | ABC transporter%2C ATP-binding protein | |
| 144 | JASOTQ010000001.1 | GCA030224105_00240 | CDS | open | 158777-159469 | _na 230_aa | ABC transporter%2C ATP-binding protein | |
| 145 | JASOTQ010000001.1 | GCA030224105_00241 | CDS | open | 159926-160531 | _na 201_aa | Superoxide dismutase | |
| 146 | JASOTQ010000001.1 | GCA030224105_00242 | CDS | open | 160636-163779 | _na 1047_aa | Beta-galactosidase | |
| 147 | JASOTQ010000001.1 | GCA030224105_00243 | CDS | open | 163812-165080 | _na 422_aa | lacI | Transcriptional regulator%2C LacI family |
| 148 | JASOTQ010000001.1 | GCA030224105_00244 | CDS | open | 165418-166350 | _na 310_aa | ABC transporter%2C permease protein | |
| 149 | JASOTQ010000001.1 | GCA030224105_00245 | CDS | open | 166363-167349 | _na 328_aa | Carbohydrate ABC transporter permease | |
| 150 | JASOTQ010000001.1 | GCA030224105_00246 | CDS | open | 167653-169002 | _na 449_aa | ABC transporter%2C solute-binding protein | |
| 151 | JASOTQ010000001.1 | GCA030224105_00247 | CDS | open | 169178-169672 | _na 164_aa | S-ribosylhomocysteine lyase | |
| 152 | JASOTQ010000001.1 | GCA030224105_00248 | CDS | open | 169698-171083 | _na 461_aa | alr | alanine racemase |
| 153 | JASOTQ010000001.1 | GCA030224105_00249 | CDS | open | 171080-172351 | _na 423_aa | deoxyguanosinetriphosphate triphosphohydrolase | |
| 154 | JASOTQ010000001.1 | GCA030224105_00250 | CDS | open | 172385-173560 | _na 391_aa | icd | NADP-dependent isocitrate dehydrogenase |
| 155 | JASOTQ010000001.1 | GCA030224105_00251 | CDS | open | 173563-174684 | _na 373_aa | citrate synthase | |
| 156 | JASOTQ010000001.1 | GCA030224105_00252 | CDS | open | 174677-177343 | _na 888_aa | acnA | aconitate hydratase AcnA |
| 157 | JASOTQ010000001.1 | GCA030224105_00253 | CDS | open | 178462-180492 | _na 676_aa | DNA primase | |
| 158 | JASOTQ010000001.1 | GCA030224105_00254 | CDS | open | 180514-181701 | _na 395_aa | Citrate transporter | |
| 159 | JASOTQ010000001.1 | GCA030224105_00255 | CDS | open | 182081-182509 | _na 142_aa | Peroxiredoxin%2C Ohr subfamily | |
| 160 | JASOTQ010000001.1 | GCA030224105_00256 | CDS | open | 182759-183520 | _na 253_aa | mutF | Putative mutacin ABC transporter%2C ATP-binding protein MutF |
| 161 | JASOTQ010000001.1 | GCA030224105_00257 | CDS | open | 183520-185259 | _na 579_aa | ABC transporter permease | |
| 162 | JASOTQ010000001.1 | GCA030224105_00259 | CDS | open | 185978-186475 | _na 165_aa | N5-carboxyaminoimidazole ribonucleotide mutase | |
| 163 | JASOTQ010000001.1 | GCA030224105_00260 | CDS | open | 186459-187622 | _na 387_aa | purK | 5-(carboxyamino)imidazole ribonucleotide synthase |
| 164 | JASOTQ010000001.1 | GCA030224105_00261 | CDS | open | 187691-188974 | _na 427_aa | Phosphoribosylamine--glycine ligase | |
| 165 | JASOTQ010000001.1 | GCA030224105_00262 | CDS | open | 189286-190335 | _na 349_aa | Phosphoribosylformylglycinamidine cyclo-ligase | |
| 166 | JASOTQ010000001.1 | GCA030224105_00263 | CDS | open | 190384-191889 | _na 501_aa | purF | amidophosphoribosyltransferase |
| 167 | JASOTQ010000001.1 | GCA030224105_00264 | CDS | open | 191916-195677 | _na 1253_aa | phosphoribosylformylglycinamidine synthase | |
| 168 | JASOTQ010000001.1 | GCA030224105_00265 | CDS | open | 195796-196545 | _na 249_aa | purC | phosphoribosylaminoimidazolesuccinocarboxamide synthase |
| 169 | JASOTQ010000001.1 | GCA030224105_00266 | CDS | open | 196686-197999 | _na 437_aa | purT | formate-dependent phosphoribosylglycinamide formyltransferase |
| 170 | JASOTQ010000001.1 | GCA030224105_00267 | CDS | open | 198046-199188 | _na 380_aa | Glycosyltransferase%2C group 1 family protein | |
| 171 | JASOTQ010000001.1 | GCA030224105_00269 | CDS | open | 199358-200467 | _na 369_aa | Sugar diacid recognition | |
| 172 | JASOTQ010000001.1 | GCA030224105_00270 | CDS | open | 200621-201919 | _na 432_aa | Citrate transporter | |
| 173 | JASOTQ010000001.1 | GCA030224105_00271 | CDS | open | 201934-203064 | _na 376_aa | Putative glycerate kinase | |
| 174 | JASOTQ010000001.1 | GCA030224105_00272 | CDS | open | 203674-204600 | _na 308_aa | Transporter | |
| 175 | JASOTQ010000001.1 | GCA030224105_00273 | CDS | open | 205123-205494 | _na 123_aa | rpsL | 30S ribosomal protein S12 |
| 176 | JASOTQ010000001.1 | GCA030224105_00274 | CDS | open | 205497-205967 | _na 156_aa | rpsG | 30S ribosomal protein S7 |
| 177 | JASOTQ010000001.1 | GCA030224105_00275 | CDS | open | 206001-208127 | _na 708_aa | fusA | elongation factor G |
| 178 | JASOTQ010000001.1 | GCA030224105_00276 | CDS | open | 208352-209551 | _na 399_aa | tuf | elongation factor Tu |
| 179 | JASOTQ010000001.1 | GCA030224105_00277 | CDS | open | 210196-211068 | _na 290_aa | hypothetical protein | |
| 180 | JASOTQ010000001.1 | GCA030224105_00278 | CDS | open | 211199-212263 | _na 354_aa | nusA | Transcription termination/antitermination protein NusA |
| 181 | JASOTQ010000001.1 | GCA030224105_00279 | CDS | open | 212496-215498 | _na 1000_aa | infB | translation initiation factor IF-2 |
| 182 | JASOTQ010000001.1 | GCA030224105_00280 | CDS | open | 215598-216140 | _na 180_aa | rbfA | 30S ribosome-binding factor RbfA |
| 183 | JASOTQ010000001.1 | GCA030224105_00281 | CDS | open | 216133-217146 | _na 337_aa | truB | tRNA pseudouridine(55) synthase TruB |
| 184 | JASOTQ010000001.1 | GCA030224105_00282 | CDS | open | 217150-218280 | _na 376_aa | Riboflavin kinase | |
| 185 | JASOTQ010000001.1 | GCA030224105_00283 | CDS | open | 218566-219981 | _na 471_aa | Transporter%2C major facilitator family protein | |
| 186 | JASOTQ010000001.1 | GCA030224105_00284 | CDS | open | 220030-220689 | _na 219_aa | DNA alkylation repair enzyme | |
| 187 | JASOTQ010000001.1 | GCA030224105_00285 | CDS | open | 220695-221456 | _na 253_aa | Amino acid ABC transporter ATP-binding protein | |
| 188 | JASOTQ010000001.1 | GCA030224105_00286 | CDS | open | 221456-222310 | _na 284_aa | ABC transporter%2C permease protein | |
| 189 | JASOTQ010000001.1 | GCA030224105_00287 | CDS | open | 222468-223307 | _na 279_aa | ABC transporter%2C substrate-binding protein%2C family 3 | |
| 190 | JASOTQ010000001.1 | GCA030224105_00288 | CDS | open | 223461-223901 | _na 146_aa | Cupin domain protein | |
| 191 | JASOTQ010000001.1 | GCA030224105_00289 | CDS | open | 223927-224268 | _na 113_aa | Carboxymuconolactone decarboxylase family protein | |
| 192 | JASOTQ010000001.1 | GCA030224105_00290 | CDS | open | 224222-225304 | _na 360_aa | ABC transporter%2C ATP-binding protein | |
| 193 | JASOTQ010000001.1 | GCA030224105_00291 | CDS | open | 225305-225499 | _na 64_aa | hypothetical protein | |
| 194 | JASOTQ010000001.1 | GCA030224105_00292 | CDS | open | 225780-226298 | _na 172_aa | Cupin family protein | |
| 195 | JASOTQ010000001.1 | GCA030224105_00293 | CDS | open | 226317-227672 | _na 451_aa | Amidohydrolase family protein | |
| 196 | JASOTQ010000001.1 | GCA030224105_00294 | CDS | open | 227764-229329 | _na 521_aa | adenosylhomocysteinase | |
| 197 | JASOTQ010000001.1 | GCA030224105_00295 | CDS | open | 229726-230553 | _na 275_aa | Nucleoside phosphorylase domain-containing protein | |
| 198 | JASOTQ010000001.1 | GCA030224105_00296 | CDS | open | 231394-232386 | _na 330_aa | NlpC/P60 family protein | |
| 199 | JASOTQ010000001.1 | GCA030224105_00297 | CDS | open | 232708-233271 | _na 187_aa | efp | elongation factor P |
| 200 | JASOTQ010000001.1 | GCA030224105_00298 | CDS | open | 233304-234032 | _na 242_aa | nusB | transcription antitermination factor NusB |
| 201 | JASOTQ010000001.1 | GCA030224105_00299 | CDS | open | 234064-235299 | _na 411_aa | carbamoyl phosphate synthase small subunit | |
| 202 | JASOTQ010000001.1 | GCA030224105_00300 | CDS | open | 235329-238700 | _na 1123_aa | carB | carbamoyl-phosphate synthase large subunit |
| 203 | JASOTQ010000001.1 | GCA030224105_00301 | CDS | open | 238837-240102 | _na 421_aa | Transporter%2C major facilitator family protein | |
| 204 | JASOTQ010000001.1 | GCA030224105_00302 | CDS | open | 240786-241403 | _na 205_aa | gmk | guanylate kinase |
| 205 | JASOTQ010000001.1 | GCA030224105_00303 | CDS | open | 241416-241967 | _na 183_aa | Flavin reductase like domain-containing protein | |
| 206 | JASOTQ010000001.1 | GCA030224105_00304 | CDS | open | 242125-243702 | _na 525_aa | ErfK/YbiS/YcfS/YnhG | |
| 207 | JASOTQ010000001.1 | GCA030224105_00305 | CDS | open | 243797-244906 | _na 369_aa | lacI | Transcriptional regulator%2C LacI family |
| 208 | JASOTQ010000001.1 | GCA030224105_00306 | CDS | open | 245580-246521 | _na 313_aa | Nucleoside hydrolase | |
| 209 | JASOTQ010000001.1 | GCA030224105_00307 | CDS | open | 246656-247612 | _na 318_aa | Ribokinase | |
| 210 | JASOTQ010000001.1 | GCA030224105_00308 | CDS | open | 247725-248756 | _na 343_aa | NAD dependent epimerase/dehydratase family protein | |
| 211 | JASOTQ010000001.1 | GCA030224105_00309 | CDS | open | 248785-249729 | _na 314_aa | Fido domain-containing protein | |
| 212 | JASOTQ010000001.1 | GCA030224105_00310 | CDS | open | 249768-251621 | _na 617_aa | ilvD | dihydroxy-acid dehydratase |
| 213 | JASOTQ010000001.1 | GCA030224105_00311 | CDS | open | 252035-252304 | _na 89_aa | rpoZ | DNA-directed RNA polymerase subunit omega |
| 214 | JASOTQ010000001.1 | GCA030224105_00312 | CDS | open | 252576-253832 | _na 418_aa | metK | methionine adenosyltransferase |
| 215 | JASOTQ010000001.1 | GCA030224105_00313 | CDS | open | 253846-256395 | _na 849_aa | Primosomal protein N' 3' DNA-binding domain-containing protein | |
| 216 | JASOTQ010000001.1 | GCA030224105_00314 | CDS | open | 256467-257417 | _na 316_aa | fmt | methionyl-tRNA formyltransferase |
| 217 | JASOTQ010000001.1 | GCA030224105_00315 | CDS | open | 257410-258909 | _na 499_aa | Putative ribosomal RNA small subunit methyltransferase B | |
| 218 | JASOTQ010000001.1 | GCA030224105_00316 | CDS | open | 258906-259556 | _na 216_aa | serB | phosphoserine phosphatase SerB |
| 219 | JASOTQ010000001.1 | GCA030224105_00317 | CDS | open | 259671-261263 | _na 530_aa | arc | proteasome ATPase |
| 220 | JASOTQ010000001.1 | GCA030224105_00318 | CDS | open | 261289-262848 | _na 519_aa | dop | depupylase/deamidase Dop |
| 221 | JASOTQ010000001.1 | GCA030224105_00319 | CDS | open | 262957-263814 | _na 285_aa | Inositol monophosphatase family protein | |
| 222 | JASOTQ010000001.1 | GCA030224105_00320 | CDS | open | 263840-264088 | _na 82_aa | Prokaryotic ubiquitin-like protein Pup | |
| 223 | JASOTQ010000001.1 | GCA030224105_00321 | CDS | open | 264088-265575 | _na 495_aa | pafA | Putative proteasome accessory factor PafA |
| 224 | JASOTQ010000001.1 | GCA030224105_00322 | CDS | open | 265622-265906 | _na 94_aa | DNA-binding protein HB1 | |
| 225 | JASOTQ010000001.1 | GCA030224105_00323 | CDS | open | 266090-268624 | _na 844_aa | TIGR00374 family protein | |
| 226 | JASOTQ010000001.1 | GCA030224105_00324 | CDS | open | 268761-270194 | _na 477_aa | purB | adenylosuccinate lyase |
| 227 | JASOTQ010000001.1 | GCA030224105_00325 | CDS | open | 270233-271681 | _na 482_aa | AB hydrolase-1 domain-containing protein | |
| 228 | JASOTQ010000001.1 | GCA030224105_00326 | CDS | open | 271678-272055 | _na 125_aa | hypothetical protein | |
| 229 | JASOTQ010000001.1 | GCA030224105_00327 | CDS | open | 272592-273173 | _na 193_aa | Cell surface protein | |
| 230 | JASOTQ010000001.1 | GCA030224105_00328 | CDS | open | 273170-274198 | _na 342_aa | von Willebrand factor type A domain protein | |
| 231 | JASOTQ010000001.1 | GCA030224105_00329 | CDS | open | 274198-275283 | _na 361_aa | VWFA domain-containing protein | |
| 232 | JASOTQ010000001.1 | GCA030224105_00330 | CDS | open | 275284-275814 | _na 176_aa | hypothetical protein | |
| 233 | JASOTQ010000001.1 | GCA030224105_00331 | CDS | open | 275843-276802 | _na 319_aa | DUF58 domain-containing protein | |
| 234 | JASOTQ010000001.1 | GCA030224105_00332 | CDS | open | 276918-278009 | _na 363_aa | ATPase family protein | |
| 235 | JASOTQ010000001.1 | GCA030224105_00333 | CDS | open | 278118-278843 | _na 241_aa | uracil-DNA glycosylase | |
| 236 | JASOTQ010000001.1 | GCA030224105_00334 | CDS | open | 278988-279653 | _na 221_aa | LytR/CpsA/Psr regulator C-terminal domain-containing protein | |
| 237 | JASOTQ010000001.1 | GCA030224105_00335 | CDS | open | 279890-281503 | _na 537_aa | groL | chaperonin GroEL |
| 238 | JASOTQ010000001.1 | GCA030224105_00336 | CDS | open | 281643-281933 | _na 96_aa | WXG100 family type VII secretion target | |
| 239 | JASOTQ010000001.1 | GCA030224105_00337 | CDS | open | 282132-282863 | _na 243_aa | DNA-binding response regulator | |
| 240 | JASOTQ010000001.1 | GCA030224105_00338 | CDS | open | 282915-284960 | _na 681_aa | histidine kinase | |
| 241 | JASOTQ010000001.1 | GCA030224105_00339 | CDS | open | 285026-285415 | _na 129_aa | Cold-shock DNA-binding domain protein | |
| 242 | JASOTQ010000001.1 | GCA030224105_00340 | CDS | open | 285446-286336 | _na 296_aa | DUF3027 domain-containing protein | |
| 243 | JASOTQ010000001.1 | GCA030224105_00341 | CDS | open | 286377-287327 | _na 316_aa | Universal stress family protein | |
| 244 | JASOTQ010000001.1 | GCA030224105_00342 | CDS | open | 287556-290087 | _na 843_aa | ATP-dependent Clp protease ATP-binding subunit | |
| 245 | JASOTQ010000001.1 | GCA030224105_00343 | CDS | open | 290431-292719 | _na 762_aa | energy-coupling factor transporter ATPase | |
| 246 | JASOTQ010000001.1 | GCA030224105_00344 | CDS | open | 292751-293347 | _na 198_aa | Riboflavin transporter | |
| 247 | JASOTQ010000001.1 | GCA030224105_00345 | CDS | open | 293796-294698 | _na 300_aa | Putative nitroreductase TM1586 domain-containing protein | |
| 248 | JASOTQ010000001.1 | GCA030224105_00346 | CDS | open | 294801-295559 | _na 252_aa | ppgK | polyphosphate--glucose phosphotransferase |
| 249 | JASOTQ010000001.1 | GCA030224105_00347 | CDS | open | 295636-296826 | _na 396_aa | alanine transaminase | |
| 250 | JASOTQ010000001.1 | GCA030224105_00348 | CDS | open | 296823-297407 | _na 194_aa | Integral membrane bound transporter domain-containing protein | |
| 251 | JASOTQ010000001.1 | GCA030224105_00349 | CDS | open | 297394-299637 | _na 747_aa | Glycosyltransferase | |
| 252 | JASOTQ010000001.1 | GCA030224105_00350 | CDS | open | 299700-303110 | _na 1136_aa | Tetratricopeptide repeat protein | |
| 253 | JASOTQ010000001.1 | GCA030224105_00351 | CDS | open | 303103-305619 | _na 838_aa | ligA | NAD-dependent DNA ligase LigA |
| 254 | JASOTQ010000001.1 | GCA030224105_00352 | CDS | open | 305616-306746 | _na 376_aa | Iron-sulfur cluster carrier protein | |
| 255 | JASOTQ010000001.1 | GCA030224105_00353 | CDS | open | 306736-307395 | _na 219_aa | SGNH/GDSL hydrolase family protein | |
| 256 | JASOTQ010000001.1 | GCA030224105_00354 | CDS | open | 307363-308295 | _na 310_aa | Serine aminopeptidase S33 domain-containing protein | |
| 257 | JASOTQ010000001.1 | GCA030224105_00355 | CDS | open | 308366-309799 | _na 477_aa | glnA | type I glutamate--ammonia ligase |
| 258 | JASOTQ010000001.1 | GCA030224105_00356 | CDS | open | 310401-311126 | _na 241_aa | DUF4191 domain-containing protein | |
| 259 | JASOTQ010000001.1 | GCA030224105_00357 | CDS | open | 311230-312690 | _na 486_aa | Pyridine nucleotide-disulfide oxidoreductase | |
| 260 | JASOTQ010000001.1 | GCA030224105_00358 | CDS | open | 312753-313283 | _na 176_aa | hypothetical protein | |
| 261 | JASOTQ010000001.1 | GCA030224105_00359 | CDS | open | 313359-314567 | _na 402_aa | Transporter%2C major facilitator family protein | |
| 262 | JASOTQ010000001.1 | GCA030224105_00360 | CDS | open | 314947-315372 | _na 141_aa | DUF3800 domain-containing protein | |
| 263 | JASOTQ010000001.1 | GCA030224105_00361 | CDS | open | 315779-316408 | _na 209_aa | DUF3043 domain-containing protein | |
| 264 | JASOTQ010000001.1 | GCA030224105_00362 | CDS | open | 316715-318085 | _na 456_aa | Peptidase dimerization domain protein | |
| 265 | JASOTQ010000001.1 | GCA030224105_00363 | CDS | open | 318386-319015 | _na 209_aa | ABC transporter%2C permease protein | |
| 266 | JASOTQ010000001.1 | GCA030224105_00364 | CDS | open | 319016-321157 | _na 713_aa | ccmA | heme ABC exporter ATP-binding protein CcmA |
| 267 | JASOTQ010000001.1 | GCA030224105_00365 | CDS | open | 321847-322749 | _na 300_aa | trmH | RNA methyltransferase%2C TrmH family |
| 268 | JASOTQ010000001.1 | GCA030224105_00366 | CDS | open | 322873-323940 | _na 355_aa | pheS | phenylalanine--tRNA ligase subunit alpha |
| 269 | JASOTQ010000001.1 | GCA030224105_00367 | CDS | open | 323944-326541 | _na 865_aa | pheT | phenylalanine--tRNA ligase subunit beta |
| 270 | JASOTQ010000001.1 | GCA030224105_00368 | CDS | open | 326601-327257 | _na 218_aa | DUF4190 domain-containing protein | |
| 271 | JASOTQ010000001.1 | GCA030224105_00369 | CDS | open | 327429-328547 | _na 372_aa | argC | N-acetyl-gamma-glutamyl-phosphate reductase |
| 272 | JASOTQ010000001.1 | GCA030224105_00370 | CDS | open | 328544-329716 | _na 390_aa | argJ | bifunctional glutamate N-acetyltransferase/amino-acid acetyltransferase ArgJ |
| 273 | JASOTQ010000001.1 | GCA030224105_00371 | CDS | open | 329722-330681 | _na 319_aa | Acetylglutamate kinase | |
| 274 | JASOTQ010000001.1 | GCA030224105_00372 | CDS | open | 330668-331894 | _na 408_aa | acetylornithine transaminase | |
| 275 | JASOTQ010000001.1 | GCA030224105_00373 | CDS | open | 331936-332910 | _na 324_aa | argF | ornithine carbamoyltransferase |
| 276 | JASOTQ010000001.1 | GCA030224105_00374 | CDS | open | 332963-333496 | _na 177_aa | Arginine repressor | |
| 277 | JASOTQ010000001.1 | GCA030224105_00375 | CDS | open | 333612-334850 | _na 412_aa | argG | argininosuccinate synthase |
| 278 | JASOTQ010000001.1 | GCA030224105_00376 | CDS | open | 334952-336439 | _na 495_aa | argH | argininosuccinate lyase |
| 279 | JASOTQ010000001.1 | GCA030224105_00377 | CDS | open | 336598-336894 | _na 98_aa | Thiamine-binding protein domain-containing protein | |
| 280 | JASOTQ010000001.1 | GCA030224105_00378 | CDS | open | 337087-338406 | _na 439_aa | tyrS | tyrosine--tRNA ligase |
| 281 | JASOTQ010000001.1 | GCA030224105_00379 | CDS | open | 338409-339725 | _na 438_aa | Tetratricopeptide repeat protein | |
| 282 | JASOTQ010000001.1 | GCA030224105_00380 | CDS | open | 339729-340784 | _na 351_aa | HAD hydrolase%2C family IIA | |
| 283 | JASOTQ010000001.1 | GCA030224105_00381 | CDS | open | 340793-340900 | _na 35_aa | hypothetical protein | |
| 284 | JASOTQ010000001.1 | GCA030224105_00382 | CDS | open | 340909-341664 | _na 251_aa | Ribosomal RNA large subunit methyltransferase J | |
| 285 | JASOTQ010000001.1 | GCA030224105_00383 | CDS | open | 341727-342641 | _na 304_aa | NAD kinase | |
| 286 | JASOTQ010000001.1 | GCA030224105_00384 | CDS | open | 342641-344344 | _na 567_aa | recN | DNA repair protein RecN |
| 287 | JASOTQ010000001.1 | GCA030224105_00385 | CDS | open | 345079-346599 | _na 506_aa | thrC | threonine synthase |
| 288 | JASOTQ010000001.1 | GCA030224105_00386 | CDS | open | 346789-348219 | _na 476_aa | glutamate-5-semialdehyde dehydrogenase | |
| 289 | JASOTQ010000001.1 | GCA030224105_00387 | CDS | open | 348219-348797 | _na 192_aa | Phosphoribosylglycinamide synthetase | |
| 290 | JASOTQ010000001.1 | GCA030224105_00388 | CDS | open | 348812-349561 | _na 249_aa | nadD | nicotinate-nucleotide adenylyltransferase |
| 291 | JASOTQ010000001.1 | GCA030224105_00389 | CDS | open | 349810-350823 | _na 337_aa | ribose-phosphate diphosphokinase | |
| 292 | JASOTQ010000001.1 | GCA030224105_00391 | CDS | open | 351174-351977 | _na 267_aa | HAD hydrolase family | |
| 293 | JASOTQ010000001.1 | GCA030224105_00392 | CDS | open | 351990-353390 | _na 466_aa | glmU | bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU |
| 294 | JASOTQ010000001.1 | GCA030224105_00393 | CDS | open | 353406-353795 | _na 129_aa | rsfS | ribosome silencing factor |
| 295 | JASOTQ010000001.1 | GCA030224105_00394 | CDS | open | 353805-354554 | _na 249_aa | Phosphoglycerate mutase family protein | |
| 296 | JASOTQ010000001.1 | GCA030224105_00396 | CDS | open | 354762-355418 | _na 218_aa | DUF421 domain-containing protein | |
| 297 | JASOTQ010000001.1 | GCA030224105_00397 | CDS | open | 355434-355874 | _na 146_aa | DUF3290 domain-containing protein | |
| 298 | JASOTQ010000001.1 | GCA030224105_00398 | CDS | open | 356040-356984 | _na 314_aa | CorA-like protein | |
| 299 | JASOTQ010000001.1 | GCA030224105_00399 | CDS | open | 357323-360274 | _na 983_aa | leuS | leucine--tRNA ligase |
| 300 | JASOTQ010000001.1 | GCA030224105_00400 | CDS | open | 361048-361680 | _na 210_aa | ComEA protein | |
| 301 | JASOTQ010000001.1 | GCA030224105_00401 | CDS | open | 361664-363376 | _na 570_aa | ComEC/Rec2-like protein | |
| 302 | JASOTQ010000001.1 | GCA030224105_00402 | CDS | open | 363381-364367 | _na 328_aa | holA | DNA polymerase III subunit delta |
| 303 | JASOTQ010000001.1 | GCA030224105_00403 | CDS | open | 364364-365095 | _na 243_aa | tsaE | tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE |
| 304 | JASOTQ010000001.1 | GCA030224105_00404 | CDS | open | 365095-366189 | _na 364_aa | tsaB | tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB |
| 305 | JASOTQ010000001.1 | GCA030224105_00405 | CDS | open | 366173-366925 | _na 250_aa | rimI | ribosomal protein S18-alanine N-acetyltransferase |
| 306 | JASOTQ010000001.1 | GCA030224105_00406 | CDS | open | 366936-367982 | _na 348_aa | tsaD | tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD |
| 307 | JASOTQ010000001.1 | GCA030224105_00407 | CDS | open | 368898-369110 | _na 70_aa | hypothetical protein | |
| 308 | JASOTQ010000001.1 | GCA030224105_00409 | CDS | open | 369565-370899 | _na 444_aa | nhaA | Na+/H+ antiporter NhaA |
| 309 | JASOTQ010000001.1 | GCA030224105_00410 | CDS | open | 370900-371583 | _na 227_aa | Cytokinin riboside 5'-monophosphate phosphoribohydrolase | |
| 310 | JASOTQ010000001.1 | GCA030224105_00411 | CDS | open | 371618-372286 | _na 222_aa | O-methyltransferase | |
| 311 | JASOTQ010000001.1 | GCA030224105_00412 | CDS | open | 372309-372662 | _na 117_aa | Cysteine methyltransferase | |
| 312 | JASOTQ010000001.1 | GCA030224105_00413 | CDS | open | 372625-373701 | _na 358_aa | dprA | DNA processing protein DprA |
| 313 | JASOTQ010000001.1 | GCA030224105_00414 | CDS | open | 373703-375298 | _na 531_aa | Mg chelatase-like protein | |
| 314 | JASOTQ010000001.1 | GCA030224105_00415 | CDS | open | 375298-375717 | _na 139_aa | yraN | YraN family protein |
| 315 | JASOTQ010000001.1 | GCA030224105_00416 | CDS | open | 376389-377264 | _na 291_aa | pyridoxamine kinase | |
| 316 | JASOTQ010000001.1 | GCA030224105_00417 | CDS | open | 377556-378866 | _na 436_aa | O-acetylhomoserine aminocarboxypropyltransferase/cysteine synthase | |
| 317 | JASOTQ010000001.1 | GCA030224105_00418 | CDS | open | 380068-381339 | _na 423_aa | HTH marR-type domain-containing protein | |
| 318 | JASOTQ010000001.1 | GCA030224105_00419 | CDS | open | 381414-382277 | _na 287_aa | luxR | Transcriptional regulator%2C LuxR family |
| 319 | JASOTQ010000001.1 | GCA030224105_00420 | CDS | open | 382706-383611 | _na 301_aa | BD-FAE-like domain-containing protein | |
| 320 | JASOTQ010000001.1 | GCA030224105_00421 | CDS | open | 383635-384669 | _na 344_aa | Sugar-binding domain protein | |
| 321 | JASOTQ010000001.1 | GCA030224105_00422 | CDS | open | 384975-385976 | _na 333_aa | Putative sugar transporter solute-binding protein | |
| 322 | JASOTQ010000001.1 | GCA030224105_00423 | CDS | open | 385939-386259 | _na 106_aa | hypothetical protein | |
| 323 | JASOTQ010000001.1 | GCA030224105_00424 | CDS | open | 386413-387438 | _na 341_aa | ABC transporter%2C permease protein | |
| 324 | JASOTQ010000001.1 | GCA030224105_00425 | CDS | open | 387439-388308 | _na 289_aa | ABC transporter%2C permease protein | |
| 325 | JASOTQ010000001.1 | GCA030224105_00426 | CDS | open | 388434-390068 | _na 544_aa | Glycosyl hydrolase%2C family 43 | |
| 326 | JASOTQ010000001.1 | GCA030224105_00427 | CDS | open | 390151-391494 | _na 447_aa | Putative prolyl aminopeptidase | |
| 327 | JASOTQ010000001.1 | GCA030224105_00428 | CDS | open | 391513-392304 | _na 263_aa | proC | pyrroline-5-carboxylate reductase |
| 328 | JASOTQ010000001.1 | GCA030224105_00429 | CDS | open | 392316-393419 | _na 367_aa | ychF | redox-regulated ATPase YchF |
| 329 | JASOTQ010000001.1 | GCA030224105_00430 | CDS | open | 393367-393642 | _na 91_aa | hypothetical protein | |
| 330 | JASOTQ010000001.1 | GCA030224105_00431 | CDS | open | 394490-394789 | _na 99_aa | apeA | ApeA N-terminal domain-containing protein |
| 331 | JASOTQ010000001.1 | GCA030224105_00432 | CDS | open | 395674-399075 | _na 1133_aa | cas9 | type II CRISPR RNA-guided endonuclease Cas9 |
| 332 | JASOTQ010000001.1 | GCA030224105_00433 | CDS | open | 399088-399990 | _na 300_aa | cas1 | type II CRISPR-associated endonuclease Cas1 |
| 333 | JASOTQ010000001.1 | GCA030224105_00434 | CDS | open | 399993-400325 | _na 110_aa | cas2 | CRISPR-associated endonuclease Cas2 |
| 334 | JASOTQ010000001.1 | GCA030224105_00435 | CDS | open | 401960-403309 | _na 449_aa | Transporter%2C major facilitator family protein | |
| 335 | JASOTQ010000001.1 | GCA030224105_00436 | CDS | open | 403345-403740 | _na 131_aa | DUF1304 domain-containing protein | |
| 336 | JASOTQ010000001.1 | GCA030224105_00437 | CDS | open | 403867-404295 | _na 142_aa | Cystathionine beta-lyase | |
| 337 | JASOTQ010000001.1 | GCA030224105_00438 | CDS | open | 404292-404639 | _na 115_aa | hypothetical protein | |
| 338 | JASOTQ010000001.1 | GCA030224105_00439 | CDS | open | 404668-405666 | _na 332_aa | Acetyltransferase%2C GNAT family | |
| 339 | JASOTQ010000001.1 | GCA030224105_00440 | CDS | open | 405658-406434 | _na 258_aa | murI | glutamate racemase |
| 340 | JASOTQ010000001.1 | GCA030224105_00441 | CDS | open | 406424-407278 | _na 284_aa | Phospholipase%2C patatin family | |
| 341 | JASOTQ010000001.1 | GCA030224105_00442 | CDS | open | 407400-408350 | _na 316_aa | dapF | diaminopimelate epimerase |
| 342 | JASOTQ010000001.1 | GCA030224105_00443 | CDS | open | 408340-408711 | _na 123_aa | MmcQ/YjbR family DNA-binding protein | |
| 343 | JASOTQ010000001.1 | GCA030224105_00444 | CDS | open | 408716-409327 | _na 203_aa | Vitamin K epoxide reductase family protein | |
| 344 | JASOTQ010000001.1 | GCA030224105_00445 | CDS | open | 409366-410298 | _na 310_aa | PHP domain protein | |
| 345 | JASOTQ010000001.1 | GCA030224105_00446 | CDS | open | 410167-410742 | _na 191_aa | hypothetical protein | |
| 346 | JASOTQ010000001.1 | GCA030224105_00447 | CDS | open | 411265-411483 | _na 72_aa | hypothetical protein | |
| 347 | JASOTQ010000001.1 | GCA030224105_00448 | CDS | open | 411824-412048 | _na 74_aa | ATP-binding protein | |
| 348 | JASOTQ010000001.1 | GCA030224105_00449 | CDS | open | 412087-413688 | _na 533_aa | Aminoglycoside phosphotransferase domain-containing protein | |
| 349 | JASOTQ010000001.1 | GCA030224105_00450 | CDS | open | 413818-415338 | _na 506_aa | DNA 3'-5' helicase | |
| 350 | JASOTQ010000001.1 | GCA030224105_00451 | CDS | open | 415335-416888 | _na 517_aa | Hydrolase | |
| 351 | JASOTQ010000001.1 | GCA030224105_00452 | CDS | open | 417320-418420 | _na 366_aa | endopeptidase La | |
| 352 | JASOTQ010000001.1 | GCA030224105_00453 | CDS | open | 418450-418896 | _na 148_aa | DUF3052 domain-containing protein | |
| 353 | JASOTQ010000001.1 | GCA030224105_00454 | CDS | open | 419044-420135 | _na 363_aa | Hydrolase%2C alpha/beta domain protein | |
| 354 | JASOTQ010000001.1 | GCA030224105_00455 | CDS | open | 420223-421125 | _na 300_aa | GIY-YIG nuclease family protein | |
| 355 | JASOTQ010000001.1 | GCA030224105_00457 | CDS | open | 421471-422586 | _na 371_aa | DivIVA domain repeat protein | |
| 356 | JASOTQ010000001.1 | GCA030224105_00458 | CDS | open | 422667-423425 | _na 252_aa | recO | DNA repair protein RecO |
| 357 | JASOTQ010000001.1 | GCA030224105_00459 | CDS | open | 423422-424213 | _na 263_aa | isoprenyl transferase | |
| 358 | JASOTQ010000001.1 | GCA030224105_00460 | CDS | open | 424313-425725 | _na 470_aa | glycine--tRNA ligase | |
| 359 | JASOTQ010000001.1 | GCA030224105_00461 | CDS | open | 425951-427189 | _na 412_aa | dusB | tRNA dihydrouridine synthase DusB |
| 360 | JASOTQ010000001.1 | GCA030224105_00462 | CDS | open | 427353-428612 | _na 419_aa | ftsZ | cell division protein FtsZ |
| 361 | JASOTQ010000001.1 | GCA030224105_00463 | CDS | open | 428628-429110 | _na 160_aa | sepF | Cell division protein SepF |
| 362 | JASOTQ010000001.1 | GCA030224105_00464 | CDS | open | 429115-429399 | _na 94_aa | YGGT family protein | |
| 363 | JASOTQ010000001.1 | GCA030224105_00465 | CDS | open | 429537-430850 | _na 437_aa | Cell wall synthesis protein Wag31 | |
| 364 | JASOTQ010000001.1 | GCA030224105_00466 | CDS | open | 430853-431458 | _na 201_aa | Lipoprotein signal peptidase | |
| 365 | JASOTQ010000001.1 | GCA030224105_00467 | CDS | open | 431458-432390 | _na 310_aa | Pseudouridine synthase | |
| 366 | JASOTQ010000001.1 | GCA030224105_00468 | CDS | open | 432423-435971 | _na 1182_aa | dnaE | DNA polymerase III subunit alpha |
| 367 | JASOTQ010000001.1 | GCA030224105_00469 | CDS | open | 436044-437492 | _na 482_aa | Histidinol dehydrogenase | |
| 368 | JASOTQ010000001.1 | GCA030224105_00470 | CDS | open | 437568-438734 | _na 388_aa | histidinol-phosphate transaminase | |
| 369 | JASOTQ010000001.1 | GCA030224105_00471 | CDS | open | 438770-439369 | _na 199_aa | hisB | imidazoleglycerol-phosphate dehydratase HisB |
| 370 | JASOTQ010000001.1 | GCA030224105_00472 | CDS | open | 439370-440002 | _na 210_aa | hypothetical protein | |
| 371 | JASOTQ010000001.1 | GCA030224105_00473 | CDS | open | 440011-440682 | _na 223_aa | hisH | imidazole glycerol phosphate synthase subunit HisH |
| 372 | JASOTQ010000001.1 | GCA030224105_00474 | CDS | open | 440698-441423 | _na 241_aa | priA | bifunctional 1-(5-phosphoribosyl)-5-((5-phosphoribosylamino)methylideneamino)imidazole-4-carboxamide isomerase/phosphoribosylanthranilate isomerase PriA |
| 373 | JASOTQ010000001.1 | GCA030224105_00475 | CDS | open | 441461-442798 | _na 445_aa | glnA | type I glutamate--ammonia ligase |
| 374 | JASOTQ010000001.1 | GCA030224105_00476 | CDS | open | 442903-447009 | _na 1368_aa | hrpA | ATP-dependent RNA helicase HrpA |
| 375 | JASOTQ010000001.1 | GCA030224105_00477 | CDS | open | 447146-447883 | _na 245_aa | Methyltransferase small domain protein | |
| 376 | JASOTQ010000001.1 | GCA030224105_00478 | CDS | open | 448631-449587 | _na 318_aa | Inosine-uridine preferring nucleoside hydrolase | |
| 377 | JASOTQ010000001.1 | GCA030224105_00479 | CDS | open | 449606-451000 | _na 464_aa | Transporter%2C major facilitator family protein | |
| 378 | JASOTQ010000001.1 | GCA030224105_00480 | CDS | open | 451099-452601 | _na 500_aa | hflX | GTPase HflX |
| 379 | JASOTQ010000001.1 | GCA030224105_00481 | CDS | open | 452728-453690 | _na 320_aa | L-lactate dehydrogenase | |
| 380 | JASOTQ010000001.1 | GCA030224105_00482 | CDS | open | 453776-454561 | _na 261_aa | lexA | transcriptional repressor LexA |
| 381 | JASOTQ010000001.1 | GCA030224105_00483 | CDS | open | 454708-455034 | _na 108_aa | lysM | LysM domain protein |
| 382 | JASOTQ010000001.1 | GCA030224105_00484 | CDS | open | 455054-455509 | _na 151_aa | nrdR | transcriptional regulator NrdR |
| 383 | JASOTQ010000001.1 | GCA030224105_00485 | CDS | open | 455610-456848 | _na 412_aa | serA | phosphoglycerate dehydrogenase |
| 384 | JASOTQ010000001.1 | GCA030224105_00486 | CDS | open | 456859-459246 | _na 795_aa | DNA 3'-5' helicase | |
| 385 | JASOTQ010000001.1 | GCA030224105_00487 | CDS | open | 459513-460079 | _na 188_aa | mraZ | division/cell wall cluster transcriptional repressor MraZ |
| 386 | JASOTQ010000001.1 | GCA030224105_00488 | CDS | open | 460073-461230 | _na 385_aa | rsmH | 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH |
| 387 | JASOTQ010000001.1 | GCA030224105_00489 | CDS | open | 461217-461663 | _na 148_aa | ftsL | Cell division protein FtsL |
| 388 | JASOTQ010000001.1 | GCA030224105_00490 | CDS | open | 461663-463525 | _na 620_aa | Penicillin-binding protein%2C transpeptidase domain protein | |
| 389 | JASOTQ010000001.1 | GCA030224105_00491 | CDS | open | 463551-464522 | _na 323_aa | UDP-N-acetylmuramyl peptide synthase | |
| 390 | JASOTQ010000001.1 | GCA030224105_00492 | CDS | open | 464525-466102 | _na 525_aa | UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase | |
| 391 | JASOTQ010000001.1 | GCA030224105_00493 | CDS | open | 466193-467287 | _na 364_aa | mraY | phospho-N-acetylmuramoyl-pentapeptide-transferase |
| 392 | JASOTQ010000001.1 | GCA030224105_00494 | CDS | open | 467374-468936 | _na 520_aa | murD | UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase |
| 393 | JASOTQ010000001.1 | GCA030224105_00495 | CDS | open | 468926-470335 | _na 469_aa | ftsW | putative peptidoglycan glycosyltransferase FtsW |
| 394 | JASOTQ010000001.1 | GCA030224105_00496 | CDS | open | 470351-471595 | _na 414_aa | UDP-N-acetylglucosamine--N-acetylmuramyl-(pentapeptide) pyrophosphoryl-undecaprenol N-acetylglucosamine transferase | |
| 395 | JASOTQ010000001.1 | GCA030224105_00497 | CDS | open | 471595-473100 | _na 501_aa | murC | UDP-N-acetylmuramate--L-alanine ligase |
| 396 | JASOTQ010000001.1 | GCA030224105_00498 | CDS | open | 473097-473987 | _na 296_aa | hypothetical protein | |
| 397 | JASOTQ010000001.1 | GCA030224105_00499 | CDS | open | 474130-474342 | _na 70_aa | SHIRT domain-containing protein | |
| 398 | JASOTQ010000001.1 | GCA030224105_00501 | CDS | open | 475190-476473 | _na 427_aa | Arylsulfotransferase N-terminal domain-containing protein | |
| 399 | JASOTQ010000001.1 | GCA030224105_00502 | CDS | open | 476558-477889 | _na 443_aa | Na+/H+ antiporter family protein | |
| 400 | JASOTQ010000001.1 | GCA030224105_00503 | CDS | open | 477876-478373 | _na 165_aa | dtd | D-aminoacyl-tRNA deacylase |
| 401 | JASOTQ010000001.1 | GCA030224105_00504 | CDS | open | 478427-479260 | _na 277_aa | Ion channel | |
| 402 | JASOTQ010000001.1 | GCA030224105_00505 | CDS | open | 479133-480476 | _na 447_aa | OFA family MFS transporter | |
| 403 | JASOTQ010000001.1 | GCA030224105_00506 | CDS | open | 480661-481413 | _na 250_aa | DUF1054 domain-containing protein | |
| 404 | JASOTQ010000001.1 | GCA030224105_00507 | CDS | open | 481234-481689 | _na 151_aa | phospholipase D-like domain-containing protein | |
| 405 | JASOTQ010000001.1 | GCA030224105_00508 | CDS | open | 481664-482155 | _na 163_aa | PLD nuclease N-terminal domain-containing protein | |
| 406 | JASOTQ010000001.1 | GCA030224105_00509 | CDS | open | 482421-482753 | _na 110_aa | Metallothionein | |
| 407 | JASOTQ010000001.1 | GCA030224105_00510 | CDS | open | 482756-483151 | _na 131_aa | arsR | Transcriptional regulator%2C ArsR family |
| 408 | JASOTQ010000001.1 | GCA030224105_00512 | CDS | open | 483705-484169 | _na 154_aa | DAGKc domain-containing protein | |
| 409 | JASOTQ010000001.1 | GCA030224105_00513 | CDS | open | 484283-484636 | _na 117_aa | YegS/DAGK C-terminal domain-containing protein | |
| 410 | JASOTQ010000001.1 | GCA030224105_00514 | CDS | open | 484824-485087 | _na 87_aa | extracellular solute-binding protein | |
| 411 | JASOTQ010000001.1 | GCA030224105_00515 | CDS | open | 485100-486431 | _na 443_aa | extracellular solute-binding protein | |
| 412 | JASOTQ010000001.1 | GCA030224105_00516 | CDS | open | 486591-487544 | _na 317_aa | ABC transporter%2C permease protein | |
| 413 | JASOTQ010000001.1 | GCA030224105_00517 | CDS | open | 487554-488525 | _na 323_aa | ABC transporter%2C permease protein | |
| 414 | JASOTQ010000001.1 | GCA030224105_00518 | CDS | open | 488567-489232 | _na 221_aa | yesL | YesL family protein |
| 415 | JASOTQ010000001.1 | GCA030224105_00519 | CDS | open | 489289-490344 | _na 351_aa | Sugar-binding domain protein | |
| 416 | JASOTQ010000001.1 | GCA030224105_00520 | CDS | open | 490367-490801 | _na 144_aa | hypothetical protein | |
| 417 | JASOTQ010000001.1 | GCA030224105_00521 | CDS | open | 490779-492251 | _na 490_aa | beta-fructofuranosidase | |
| 418 | JASOTQ010000001.1 | GCA030224105_00522 | CDS | open | 492259-492597 | _na 112_aa | hypothetical protein | |
| 419 | JASOTQ010000001.1 | GCA030224105_00523 | CDS | open | 492648-493547 | _na 299_aa | pfkB | Kinase%2C PfkB family |
| 420 | JASOTQ010000001.1 | GCA030224105_00524 | CDS | open | 493801-494550 | _na 249_aa | ABC transporter%2C ATP-binding protein | |
| 421 | JASOTQ010000001.1 | GCA030224105_00525 | CDS | open | 494580-497234 | _na 884_aa | ABC transporter permease | |
| 422 | JASOTQ010000001.1 | GCA030224105_00526 | CDS | open | 497407-498747 | _na 446_aa | xylA | xylose isomerase |
| 423 | JASOTQ010000001.1 | GCA030224105_00527 | CDS | open | 499499-501049 | _na 516_aa | xylB | xylulokinase |
| 424 | JASOTQ010000001.1 | GCA030224105_00528 | CDS | open | 501231-502469 | _na 412_aa | ROK family protein | |
| 425 | JASOTQ010000001.1 | GCA030224105_00529 | CDS | open | 502526-504106 | _na 526_aa | Xaa-Pro aminopeptidase | |
| 426 | JASOTQ010000001.1 | GCA030224105_00530 | CDS | open | 504590-506056 | _na 488_aa | tetrahydrofolate synthase | |
| 427 | JASOTQ010000001.1 | GCA030224105_00531 | CDS | open | 506068-509694 | _na 1208_aa | smc | chromosome segregation protein SMC |
| 428 | JASOTQ010000001.1 | GCA030224105_00532 | CDS | open | 509753-511195 | _na 480_aa | UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2%2C 6-diaminopimelate ligase | |
| 429 | JASOTQ010000001.1 | GCA030224105_00533 | CDS | open | 511196-511984 | _na 262_aa | Exonuclease | |
| 430 | JASOTQ010000001.1 | GCA030224105_00534 | CDS | open | 512006-512590 | _na 194_aa | Sigma-70 region 2 | |
| 431 | JASOTQ010000001.1 | GCA030224105_00535 | CDS | open | 512643-512963 | _na 106_aa | hypothetical protein | |
| 432 | JASOTQ010000001.1 | GCA030224105_00536 | CDS | open | 513193-513426 | _na 77_aa | Secreted protein | |
| 433 | JASOTQ010000001.1 | GCA030224105_00537 | CDS | open | 514262-514675 | _na 137_aa | hypothetical protein | |
| 434 | JASOTQ010000001.1 | GCA030224105_00539 | CDS | open | 515178-516137 | _na 319_aa | Aldose 1-epimerase | |
| 435 | JASOTQ010000001.1 | GCA030224105_00540 | CDS | open | 516174-516707 | _na 177_aa | ybaK | Cys-tRNA(Pro) deacylase |
| 436 | JASOTQ010000001.1 | GCA030224105_00541 | CDS | open | 516797-518353 | _na 518_aa | beta-fructofuranosidase | |
| 437 | JASOTQ010000001.1 | GCA030224105_00542 | CDS | open | 518388-519689 | _na 433_aa | Galactoside permease | |
| 438 | JASOTQ010000001.1 | GCA030224105_00543 | CDS | open | 519844-520929 | _na 361_aa | Sugar-binding domain protein | |
| 439 | JASOTQ010000001.1 | GCA030224105_00544 | CDS | open | 521149-522480 | _na 443_aa | Galactoside permease | |
| 440 | JASOTQ010000001.1 | GCA030224105_00545 | CDS | open | 523361-524416 | _na 351_aa | gap | type I glyceraldehyde-3-phosphate dehydrogenase |
| 441 | JASOTQ010000001.1 | GCA030224105_00546 | CDS | open | 524542-525342 | _na 266_aa | thiamine diphosphokinase | |
| 442 | JASOTQ010000001.1 | GCA030224105_00547 | CDS | open | 525365-526372 | _na 335_aa | msrA | Peptide methionine sulfoxide reductase MsrA |
| 443 | JASOTQ010000001.1 | GCA030224105_00548 | CDS | open | 526767-527540 | _na 257_aa | gluA | Glutamate ABC transporter%2C ATP-binding protein GluA |
| 444 | JASOTQ010000001.1 | GCA030224105_00549 | CDS | open | 527555-528385 | _na 276_aa | glnH | Putative ABC transporter glutamine-binding protein GlnH |
| 445 | JASOTQ010000001.1 | GCA030224105_00550 | CDS | open | 528385-529062 | _na 225_aa | ABC transporter%2C permease protein | |
| 446 | JASOTQ010000001.1 | GCA030224105_00551 | CDS | open | 529059-530177 | _na 372_aa | ABC transporter%2C permease protein | |
| 447 | JASOTQ010000001.1 | GCA030224105_00552 | CDS | open | 530255-530542 | _na 95_aa | XRE family transcriptional regulator | |
| 448 | JASOTQ010000001.1 | GCA030224105_00553 | CDS | open | 530731-530946 | _na 71_aa | Transcriptional regulator | |
| 449 | JASOTQ010000001.1 | GCA030224105_00554 | CDS | open | 530958-531182 | _na 74_aa | hypothetical protein | |
| 450 | JASOTQ010000001.1 | GCA030224105_00555 | CDS | open | 531270-531854 | _na 194_aa | hypothetical protein | |
| 451 | JASOTQ010000001.1 | GCA030224105_00556 | CDS | open | 532011-532274 | _na 87_aa | DUF3310 domain-containing protein | |
| 452 | JASOTQ010000001.1 | GCA030224105_00557 | CDS | open | 532289-532834 | _na 181_aa | hypothetical protein | |
| 453 | JASOTQ010000001.1 | GCA030224105_00558 | CDS | open | 532837-533820 | _na 327_aa | bet | phage recombination protein Bet |
| 454 | JASOTQ010000001.1 | GCA030224105_00559 | CDS | open | 533824-534285 | _na 153_aa | Single-stranded DNA-binding protein | |
| 455 | JASOTQ010000001.1 | GCA030224105_00560 | CDS | open | 534285-534680 | _na 131_aa | Restriction endonuclease type IV Mrr domain-containing protein | |
| 456 | JASOTQ010000001.1 | GCA030224105_00561 | CDS | open | 534789-535073 | _na 94_aa | Phage protein | |
| 457 | JASOTQ010000001.1 | GCA030224105_00562 | CDS | open | 535076-535393 | _na 105_aa | hypothetical protein | |
| 458 | JASOTQ010000001.1 | GCA030224105_00563 | CDS | open | 536033-536806 | _na 257_aa | Phage conserved hypothetical protein C-terminal domain-containing protein | |
| 459 | JASOTQ010000001.1 | GCA030224105_00564 | CDS | open | 536829-537344 | _na 171_aa | hypothetical protein | |
| 460 | JASOTQ010000001.1 | GCA030224105_00565 | CDS | open | 537611-538369 | _na 252_aa | phnA | PhnA protein |
| 461 | JASOTQ010000001.1 | GCA030224105_00566 | CDS | open | 538574-538990 | _na 138_aa | hypothetical protein | |
| 462 | JASOTQ010000001.1 | GCA030224105_00567 | CDS | open | 538987-539385 | _na 132_aa | hypothetical protein | |
| 463 | JASOTQ010000001.1 | GCA030224105_00568 | CDS | open | 539394-539663 | _na 89_aa | hypothetical protein | |
| 464 | JASOTQ010000001.1 | GCA030224105_00569 | CDS | open | 540292-540516 | _na 74_aa | hypothetical protein | |
| 465 | JASOTQ010000001.1 | GCA030224105_00570 | CDS | open | 540527-541399 | _na 290_aa | BRO family protein | |
| 466 | JASOTQ010000001.1 | GCA030224105_00571 | CDS | open | 541392-541535 | _na 47_aa | hypothetical protein | |
| 467 | JASOTQ010000001.1 | GCA030224105_00572 | CDS | open | 541538-541969 | _na 143_aa | ASCH domain-containing protein | |
| 468 | JASOTQ010000001.1 | GCA030224105_00573 | CDS | open | 541972-542262 | _na 96_aa | hypothetical protein | |
| 469 | JASOTQ010000001.1 | GCA030224105_00574 | CDS | open | 542259-543041 | _na 260_aa | DNA methyltransferase | |
| 470 | JASOTQ010000001.1 | GCA030224105_00575 | CDS | open | 543057-543302 | _na 81_aa | Antitoxin | |
| 471 | JASOTQ010000001.1 | GCA030224105_00576 | CDS | open | 543321-543479 | _na 52_aa | hypothetical protein | |
| 472 | JASOTQ010000001.1 | GCA030224105_00577 | CDS | open | 543496-543681 | _na 61_aa | hypothetical protein | |
| 473 | JASOTQ010000001.1 | GCA030224105_00578 | CDS | open | 543824-544114 | _na 96_aa | hypothetical protein | |
| 474 | JASOTQ010000001.1 | GCA030224105_00579 | CDS | open | 544202-544762 | _na 186_aa | hypothetical protein | |
| 475 | JASOTQ010000001.1 | GCA030224105_00580 | CDS | open | 544800-544955 | _na 51_aa | hypothetical protein | |
| 476 | JASOTQ010000001.1 | GCA030224105_00581 | CDS | open | 545073-546092 | _na 339_aa | hypothetical protein | |
| 477 | JASOTQ010000001.1 | GCA030224105_00582 | CDS | open | 546242-546460 | _na 72_aa | Lipoprotein | |
| 478 | JASOTQ010000001.1 | GCA030224105_00583 | CDS | open | 546512-546967 | _na 151_aa | hypothetical protein | |
| 479 | JASOTQ010000001.1 | GCA030224105_00584 | CDS | open | 547127-547483 | _na 118_aa | hypothetical protein | |
| 480 | JASOTQ010000001.1 | GCA030224105_00098 | gene | open | 659-2389 | |||
| 481 | JASOTQ010000001.1 | GCA030224105_00099 | gene | open | 2477-3136 | |||
| 482 | JASOTQ010000001.1 | GCA030224105_00100 | gene | open | 3199-4959 | |||
| 483 | JASOTQ010000001.1 | GCA030224105_00101 | gene | open | 5177-5767 | parA | ||
| 484 | JASOTQ010000001.1 | GCA030224105_00102 | gene | open | 5772-6674 | |||
| 485 | JASOTQ010000001.1 | GCA030224105_00103 | gene | open | 6855-7535 | |||
| 486 | JASOTQ010000001.1 | GCA030224105_00104 | gene | open | 7540-9000 | |||
| 487 | JASOTQ010000001.1 | GCA030224105_00105 | gene | open | 9016-10305 | |||
| 488 | JASOTQ010000001.1 | GCA030224105_00106 | gene | open | 10298-11422 | |||
| 489 | JASOTQ010000001.1 | GCA030224105_00107 | gene | open | 11449-12057 | |||
| 490 | JASOTQ010000001.1 | GCA030224105_00108 | gene | open | 12409-12714 | trbC | ||
| 491 | JASOTQ010000001.1 | GCA030224105_00109 | gene | open | 12836-14305 | |||
| 492 | JASOTQ010000001.1 | GCA030224105_00110 | gene | open | 14334-15779 | |||
| 493 | JASOTQ010000001.1 | GCA030224105_00111 | gene | open | 15790-17376 | |||
| 494 | JASOTQ010000001.1 | GCA030224105_00112 | gene | open | 17392-19275 | traM | ||
| 495 | JASOTQ010000001.1 | GCA030224105_00113 | gene | open | 19303-20049 | |||
| 496 | JASOTQ010000001.1 | GCA030224105_00114 | gene | open | 20072-20635 | |||
| 497 | JASOTQ010000001.1 | GCA030224105_00115 | gene | open | 20616-21170 | |||
| 498 | JASOTQ010000001.1 | GCA030224105_00116 | gene | open | 21323-21988 | |||
| 499 | JASOTQ010000001.1 | GCA030224105_00117 | gene | open | 21981-23111 | |||
| 500 | JASOTQ010000001.1 | GCA030224105_00118 | gene | open | 23126-24484 | abiH |

