HOMD Banner
Taxonomy: V4.3   |  16S rRNA RefSeq: V16.03   |  Genomic RefSeq: V11.03   |  Viruses: V1.2

BAKTAGenome Explorer: Arthrospira platensis (GCA_000175415.3)

Select a Genome:
BAKTA Annotations for GCA_000175415.3
Genome Selected: Arthrospira platensis
ContigsBases CDSrRNA tmRNAtRNA
268 6501886 6076 6 1 40
[Table]   [AA Fasta]      [Browser]   [Text]   [Excel]  
Search & Sort all 12298 Records
Search These Records: Clear
Sort Column:   Molecule   PID   NA   AA   Gene  Gene Product  Reverse
Annotation Table [page:1]    |    Number of Records Found: 12298 [25 Pages]    |    Previous Page <==> Next Page    |    Jump to Page: [ 1  2  3  4  5  6  7  8  9  10  11  12  13  14  15  16  17  18  19  20  21  22  23  24  25  ]
Notes:   1- Column headers only sort the current page. 2- Select [NA] or [AA] links to show sequences.
Region Protein-ID Type Genome
Viewer		 Range
(bp)		 Show Sequences
(length) NA / AA		 BAKTA
Gene		 BAKTA
GeneProduct
1 ACSK03000001.1 repeat_region open 1-200 CRISPR array with 3 repeats of length 42%2C consensus sequence AGAAGTTTCCGTCCCCTTGCGGGGAATTGGTAGGGTCTGACA and spacer length 36
2 ACSK03000005.1 GCA000175415_00001 CDS open 2-136 _na     44_aa hypothetical protein
3 ACSK03000005.1 GCA000175415_00001 gene open 2-136
4 ACSK03000006.1 repeat_region open 10-207 CRISPR array with 3 repeats of length 37%2C consensus sequence GTCAGACCCTACCAATTCCCCGCAAGGGGACGGAAAC and spacer length 40
5 ACSK03000015.1 repeat_region open 3-248 CRISPR array with 4 repeats of length 36%2C consensus sequence AGTTGCCATACGTTCGACTTTCAAAGAAGTCTCAAG and spacer length 33
6 ACSK03000018.1 GCA000175415_00002 CDS open 17-244 _na     75_aa hypothetical protein
7 ACSK03000018.1 GCA000175415_00002 gene open 17-244
8 ACSK03000019.1 GCA000175415_00003 CDS open 52-222 _na     56_aa hypothetical protein
9 ACSK03000019.1 GCA000175415_00003 gene open 52-222
10 ACSK03000024.1 repeat_region open 3-273 CRISPR array with 4 repeats of length 37%2C consensus sequence GTCAGACCCTACCAATTCCCCGCAAGGGGACGGAAAC and spacer length 40
11 ACSK03000027.1 repeat_region open 3-281 CRISPR array with 4 repeats of length 37%2C consensus sequence GTTTCCGTCCCCTTGCGGGGAATTGGTAGGGTCTGAC and spacer length 41
12 ACSK03000031.1 repeat_region open 33-311 CRISPR array with 4 repeats of length 38%2C consensus sequence GTCAGACCCTACCAATTCCCCGCAAGGGGACGGAAACT and spacer length 41
13 ACSK03000043.1 GCA000175415_00004 CDS open 11-208 _na     65_aa hypothetical protein
14 ACSK03000043.1 GCA000175415_00004 gene open 11-208
15 ACSK03000046.1 GCA000175415_00005 CDS open 232-390 _na     52_aa hypothetical protein
16 ACSK03000046.1 GCA000175415_00005 gene open 232-390
17 ACSK03000053.1 GCA000175415_00006 CDS open 119-349 _na     76_aa reverse transcriptase domain-containing protein
18 ACSK03000053.1 GCA000175415_00006 gene open 119-349
19 ACSK03000055.1 GCA000175415_00007 CDS open 33-452 _na     139_aa hypothetical protein
20 ACSK03000055.1 GCA000175415_00007 gene open 33-452
21 ACSK03000062.1 GCA000175415_00008 CDS open 34-396 _na     120_aa hypothetical protein
22 ACSK03000062.1 GCA000175415_00008 gene open 34-396
23 ACSK03000065.1 GCA000175415_00009 CDS open 23-523 _na     166_aa hypothetical protein
24 ACSK03000065.1 GCA000175415_00009 gene open 23-523
25 ACSK03000069.1 GCA000175415_00010 CDS open 199-465 _na     88_aa DUF3782 domain-containing protein
26 ACSK03000069.1 GCA000175415_00010 gene open 199-465
27 ACSK03000070.1 GCA000175415_00011 CDS open 55-645 _na     196_aa hypothetical protein
28 ACSK03000070.1 GCA000175415_00011 gene open 55-645
29 ACSK03000077.1 GCA000175415_00012 CDS open 37-705 _na     222_aa Uma2 family endonuclease
30 ACSK03000077.1 GCA000175415_00012 gene open 37-705
31 ACSK03000078.1 GCA000175415_00013 CDS open 349-702 _na     117_aa faxG Protein faxG fax element
32 ACSK03000078.1 GCA000175415_00013 gene open 349-702 faxG
33 ACSK03000083.1 repeat_region open 593-862 CRISPR array with 4 repeats of length 37%2C consensus sequence GTTTCCGTCCCCTTGCGCTTAATTGGTAGGGTCTGAC and spacer length 39
34 ACSK03000083.1 GCA000175415_00014 CDS open 75-494 _na     139_aa rfaE Choline-phosphate cytidylyltransferase
35 ACSK03000083.1 GCA000175415_00014 gene open 75-494 rfaE
36 ACSK03000084.1 GCA000175415_00015 CDS open 4-324 _na     106_aa hypothetical protein
37 ACSK03000084.1 GCA000175415_00016 CDS open 317-601 _na     94_aa hypothetical protein
38 ACSK03000084.1 GCA000175415_00017 CDS open 620-847 _na     75_aa hypothetical protein
39 ACSK03000084.1 GCA000175415_00015 gene open 4-324
40 ACSK03000084.1 GCA000175415_00016 gene open 317-601
41 ACSK03000084.1 GCA000175415_00017 gene open 620-847
42 ACSK03000085.1 GCA000175415_00018 CDS open 29-397 _na     122_aa hypothetical protein
43 ACSK03000085.1 GCA000175415_00019 CDS open 465-830 _na     121_aa hypothetical protein
44 ACSK03000085.1 GCA000175415_00018 gene open 29-397
45 ACSK03000085.1 GCA000175415_00019 gene open 465-830
46 ACSK03000086.1 GCA000175415_00020 CDS open 28-186 _na     52_aa hypothetical protein
47 ACSK03000086.1 GCA000175415_00021 CDS open 618-860 _na     80_aa hypothetical protein
48 ACSK03000086.1 GCA000175415_00020 gene open 28-186
49 ACSK03000086.1 GCA000175415_00021 gene open 618-860
50 ACSK03000087.1 GCA000175415_00022 CDS open 84-437 _na     117_aa hypothetical protein
51 ACSK03000087.1 GCA000175415_00023 CDS open 441-860 _na     139_aa hypothetical protein
52 ACSK03000087.1 GCA000175415_00022 gene open 84-437
53 ACSK03000087.1 GCA000175415_00023 gene open 441-860
54 ACSK03000089.1 GCA000175415_00024 CDS open 3-179 _na     58_aa hypothetical protein
55 ACSK03000089.1 GCA000175415_00024 gene open 3-179
56 ACSK03000092.1 GCA000175415_00025 CDS open 220-723 _na     167_aa hypothetical protein
57 ACSK03000092.1 GCA000175415_00025 gene open 220-723
58 ACSK03000093.1 GCA000175415_00026 CDS open 19-528 _na     169_aa hypothetical protein
59 ACSK03000093.1 GCA000175415_00026 gene open 19-528
60 ACSK03000094.1 GCA000175415_00027 CDS open 51-407 _na     118_aa hypothetical protein
61 ACSK03000094.1 GCA000175415_00027 gene open 51-407
62 ACSK03000095.1 GCA000175415_00028 CDS open 90-956 _na     288_aa DUF1156 domain-containing protein
63 ACSK03000095.1 GCA000175415_00028 gene open 90-956
64 ACSK03000098.1 GCA000175415_00029 CDS open 38-280 _na     80_aa hypothetical protein
65 ACSK03000098.1 GCA000175415_00030 CDS open 240-455 _na     71_aa hypothetical protein
66 ACSK03000098.1 GCA000175415_00029 gene open 38-280
67 ACSK03000098.1 GCA000175415_00030 gene open 240-455
68 ACSK03000099.1 GCA000175415_00031 CDS open 30-575 _na     181_aa hypothetical protein
69 ACSK03000099.1 GCA000175415_00032 CDS open 594-1025 _na     143_aa hypothetical protein
70 ACSK03000099.1 GCA000175415_00031 gene open 30-575
71 ACSK03000099.1 GCA000175415_00032 gene open 594-1025
72 ACSK03000100.1 GCA000175415_00033 CDS open 13-234 _na     73_aa hypothetical protein
73 ACSK03000100.1 GCA000175415_00034 CDS open 237-677 _na     146_aa hypothetical protein
74 ACSK03000100.1 GCA000175415_00033 gene open 13-234
75 ACSK03000100.1 GCA000175415_00034 gene open 237-677
76 ACSK03000104.1 GCA000175415_00035 CDS open 816-1121 _na     101_aa hypothetical protein
77 ACSK03000104.1 GCA000175415_00035 gene open 816-1121
78 ACSK03000106.1 GCA000175415_00036 CDS open 546-1016 _na     156_aa DUF29 domain-containing protein
79 ACSK03000106.1 GCA000175415_00036 gene open 546-1016
80 ACSK03000107.1 GCA000175415_00037 CDS open 41-607 _na     188_aa AMIN domain-containing protein
81 ACSK03000107.1 GCA000175415_00038 CDS open 713-1348 _na     211_aa RNA polymerase subunit sigma-70
82 ACSK03000107.1 GCA000175415_00037 gene open 41-607
83 ACSK03000107.1 GCA000175415_00038 gene open 713-1348
84 ACSK03000109.1 GCA000175415_00039 CDS open 83-304 _na     73_aa hypothetical protein
85 ACSK03000109.1 GCA000175415_00040 CDS open 317-895 _na     192_aa hypothetical protein
86 ACSK03000109.1 GCA000175415_00041 CDS open 892-1512 _na     206_aa hypothetical protein
87 ACSK03000109.1 GCA000175415_00039 gene open 83-304
88 ACSK03000109.1 GCA000175415_00040 gene open 317-895
89 ACSK03000109.1 GCA000175415_00041 gene open 892-1512
90 ACSK03000110.1 GCA000175415_00042 CDS open 102-1583 _na     493_aa purF amidophosphoribosyltransferase
91 ACSK03000110.1 GCA000175415_00042 gene open 102-1583 purF
92 ACSK03000112.1 GCA000175415_00043 CDS open 99-1073 _na     324_aa hypothetical protein
93 ACSK03000112.1 GCA000175415_00043 gene open 99-1073
94 ACSK03000113.1 GCA000175415_00044 CDS open 70-264 _na     64_aa hypothetical protein
95 ACSK03000113.1 GCA000175415_00045 CDS open 292-465 _na     57_aa hypothetical protein
96 ACSK03000113.1 GCA000175415_00046 CDS open 551-817 _na     88_aa TM2 domain-containing protein
97 ACSK03000113.1 GCA000175415_00047 CDS open 975-1412 _na     145_aa DUF2752 domain-containing protein
98 ACSK03000113.1 GCA000175415_00044 gene open 70-264
99 ACSK03000113.1 GCA000175415_00045 gene open 292-465
100 ACSK03000113.1 GCA000175415_00046 gene open 551-817
101 ACSK03000113.1 GCA000175415_00047 gene open 975-1412
102 ACSK03000115.1 GCA000175415_00048 CDS open 54-305 _na     83_aa hypothetical protein
103 ACSK03000115.1 GCA000175415_00049 CDS open 355-987 _na     210_aa hpsB hormogonium polysaccharide secretion pseudopilin HpsB
104 ACSK03000115.1 GCA000175415_00050 CDS open 1049-1903 _na     284_aa hypothetical protein
105 ACSK03000115.1 GCA000175415_00048 gene open 54-305
106 ACSK03000115.1 GCA000175415_00049 gene open 355-987 hpsB
107 ACSK03000115.1 GCA000175415_00050 gene open 1049-1903
108 ACSK03000116.1 GCA000175415_00051 CDS open 365-1072 _na     235_aa hypothetical protein
109 ACSK03000116.1 GCA000175415_00051 gene open 365-1072
110 ACSK03000117.1 GCA000175415_00052 CDS open 852-1934 _na     360_aa tetratricopeptide repeat protein
111 ACSK03000117.1 GCA000175415_00052 gene open 852-1934
112 ACSK03000118.1 GCA000175415_00053 CDS open 49-1314 _na     421_aa rfaB Glycosyl transferase family 1 domain-containing protein
113 ACSK03000118.1 GCA000175415_00054 CDS open 1396-1611 _na     71_aa hypothetical protein
114 ACSK03000118.1 GCA000175415_00055 CDS open 1622-1975 _na     117_aa hypothetical protein
115 ACSK03000118.1 GCA000175415_00053 gene open 49-1314 rfaB
116 ACSK03000118.1 GCA000175415_00054 gene open 1396-1611
117 ACSK03000118.1 GCA000175415_00055 gene open 1622-1975
118 ACSK03000119.1 GCA000175415_00056 CDS open 79-1251 _na     390_aa DEAD/DEAH box helicase
119 ACSK03000119.1 GCA000175415_00056 gene open 79-1251
120 ACSK03000120.1 GCA000175415_00057 CDS open 934-1725 _na     263_aa hypothetical protein
121 ACSK03000120.1 GCA000175415_00058 CDS open 1672-2256 _na     194_aa hypothetical protein
122 ACSK03000120.1 GCA000175415_00057 gene open 934-1725
123 ACSK03000120.1 GCA000175415_00058 gene open 1672-2256
124 ACSK03000121.1 GCA000175415_00059 CDS open 57-257 _na     66_aa hypothetical protein
125 ACSK03000121.1 GCA000175415_00060 CDS open 409-1146 _na     245_aa ATP-binding cassette domain-containing protein
126 ACSK03000121.1 GCA000175415_00061 CDS open 1146-1574 _na     142_aa eVE EVE domain-containing protein
127 ACSK03000121.1 GCA000175415_00062 CDS open 1686-2225 _na     179_aa PH domain-containing protein
128 ACSK03000121.1 GCA000175415_00059 gene open 57-257
129 ACSK03000121.1 GCA000175415_00060 gene open 409-1146
130 ACSK03000121.1 GCA000175415_00061 gene open 1146-1574 eVE
131 ACSK03000121.1 GCA000175415_00062 gene open 1686-2225
132 ACSK03000122.1 GCA000175415_00063 CDS open 417-773 _na     118_aa hypothetical protein
133 ACSK03000122.1 GCA000175415_00064 CDS open 850-1278 _na     142_aa hypothetical protein
134 ACSK03000122.1 GCA000175415_00065 CDS open 1275-1823 _na     182_aa Winged helix-turn-helix domain-containing protein
135 ACSK03000122.1 GCA000175415_00063 gene open 417-773
136 ACSK03000122.1 GCA000175415_00064 gene open 850-1278
137 ACSK03000122.1 GCA000175415_00065 gene open 1275-1823
138 ACSK03000124.1 GCA000175415_00066 CDS open 1388-1714 _na     108_aa trxA thioredoxin
139 ACSK03000124.1 GCA000175415_00067 CDS open 1817-2584 _na     255_aa fabG 3-oxoacyl-[acyl-carrier-protein] reductase
140 ACSK03000124.1 GCA000175415_00066 gene open 1388-1714 trxA
141 ACSK03000124.1 GCA000175415_00067 gene open 1817-2584 fabG
142 ACSK03000125.1 GCA000175415_00068 CDS open 47-1492 _na     481_aa Portal protein
143 ACSK03000125.1 GCA000175415_00069 CDS open 1495-1935 _na     146_aa hypothetical protein
144 ACSK03000125.1 GCA000175415_00068 gene open 47-1492
145 ACSK03000125.1 GCA000175415_00069 gene open 1495-1935
146 ACSK03000126.1 GCA000175415_00070 CDS open 27-836 _na     269_aa nit1 Nitrilase/cyanide hydratase and apolipoprotein N-acyltransferase
147 ACSK03000126.1 GCA000175415_00071 CDS open 1013-1138 _na     41_aa psaJ photosystem I reaction center subunit IX
148 ACSK03000126.1 GCA000175415_00072 CDS open 1251-1739 _na     162_aa psaF Photosystem I reaction center subunit III
149 ACSK03000126.1 GCA000175415_00070 gene open 27-836 nit1
150 ACSK03000126.1 GCA000175415_00071 gene open 1013-1138 psaJ
151 ACSK03000126.1 GCA000175415_00072 gene open 1251-1739 psaF
152 ACSK03000128.1 GCA000175415_00073 CDS open 42-1184 _na     380_aa hypothetical protein
153 ACSK03000128.1 GCA000175415_00074 CDS open 1402-1680 _na     92_aa hupA Histone-like bacterial DNA-binding protein%2C HU-like
154 ACSK03000128.1 GCA000175415_00075 CDS open 1741-2817 _na     358_aa cobD threonine-phosphate decarboxylase CobD
155 ACSK03000128.1 GCA000175415_00073 gene open 42-1184
156 ACSK03000128.1 GCA000175415_00074 gene open 1402-1680 hupA
157 ACSK03000128.1 GCA000175415_00075 gene open 1741-2817 cobD
158 ACSK03000129.1 GCA000175415_00076 CDS open 756-1592 _na     278_aa Putative restriction endonuclease domain-containing protein
159 ACSK03000129.1 GCA000175415_00077 CDS open 1651-2466 _na     271_aa Putative restriction endonuclease domain-containing protein
160 ACSK03000129.1 GCA000175415_00078 CDS open 2525-3103 _na     192_aa Putative restriction endonuclease domain-containing protein
161 ACSK03000129.1 GCA000175415_00076 gene open 756-1592
162 ACSK03000129.1 GCA000175415_00077 gene open 1651-2466
163 ACSK03000129.1 GCA000175415_00078 gene open 2525-3103
164 ACSK03000130.1 GCA000175415_00079 CDS open 967-1212 _na     81_aa hypothetical protein
165 ACSK03000130.1 GCA000175415_00079 gene open 967-1212
166 ACSK03000131.1 repeat_region open 3236-3621 CRISPR array with 6 repeats of length 35%2C consensus sequence GTTGCCATACGTTCGACTTTCAAAGAAGTCTCAAG and spacer length 35
167 ACSK03000131.1 GCA000175415_00080 CDS open 21-716 _na     231_aa hypothetical protein
168 ACSK03000131.1 GCA000175415_00081 CDS open 759-1661 _na     300_aa calcium-binding protein
169 ACSK03000131.1 GCA000175415_00082 CDS open 1844-2104 _na     86_aa hypothetical protein
170 ACSK03000131.1 GCA000175415_00083 CDS open 2184-3140 _na     318_aa tetratricopeptide repeat protein
171 ACSK03000131.1 GCA000175415_00080 gene open 21-716
172 ACSK03000131.1 GCA000175415_00081 gene open 759-1661
173 ACSK03000131.1 GCA000175415_00082 gene open 1844-2104
174 ACSK03000131.1 GCA000175415_00083 gene open 2184-3140
175 ACSK03000132.1 GCA000175415_00084 CDS open 134-322 _na     62_aa hypothetical protein
176 ACSK03000132.1 GCA000175415_00085 CDS open 635-1255 _na     206_aa Nucleotidyl transferase AbiEii/AbiGii toxin family protein
177 ACSK03000132.1 GCA000175415_00086 CDS open 1176-1691 _na     171_aa hypothetical protein
178 ACSK03000132.1 GCA000175415_00087 CDS open 1887-2165 _na     92_aa putative protein family (UPF0175)
179 ACSK03000132.1 GCA000175415_00088 CDS open 2162-2653 _na     163_aa Nucleic acid-binding protein
180 ACSK03000132.1 GCA000175415_00089 CDS open 2951-3601 _na     216_aa PD-(D/E)XK nuclease superfamily
181 ACSK03000132.1 GCA000175415_00084 gene open 134-322
182 ACSK03000132.1 GCA000175415_00085 gene open 635-1255
183 ACSK03000132.1 GCA000175415_00086 gene open 1176-1691
184 ACSK03000132.1 GCA000175415_00087 gene open 1887-2165
185 ACSK03000132.1 GCA000175415_00088 gene open 2162-2653
186 ACSK03000132.1 GCA000175415_00089 gene open 2951-3601
187 ACSK03000133.1 GCA000175415_00090 CDS open 135-479 _na     114_aa hypothetical protein
188 ACSK03000133.1 GCA000175415_00091 CDS open 494-2863 _na     789_aa S8 family serine peptidase
189 ACSK03000133.1 GCA000175415_00092 CDS open 2948-3754 _na     268_aa hypothetical protein
190 ACSK03000133.1 GCA000175415_00090 gene open 135-479
191 ACSK03000133.1 GCA000175415_00091 gene open 494-2863
192 ACSK03000133.1 GCA000175415_00092 gene open 2948-3754
193 ACSK03000134.1 GCA000175415_00093 CDS open 1299-1562 _na     87_aa hypothetical protein
194 ACSK03000134.1 GCA000175415_00094 CDS open 1526-2095 _na     189_aa hypothetical protein
195 ACSK03000134.1 GCA000175415_00095 CDS open 2122-2469 _na     115_aa hypothetical protein
196 ACSK03000134.1 GCA000175415_00093 gene open 1299-1562
197 ACSK03000134.1 GCA000175415_00094 gene open 1526-2095
198 ACSK03000134.1 GCA000175415_00095 gene open 2122-2469
199 ACSK03000135.1 GCA000175415_00096 CDS open 58-516 _na     152_aa hypothetical protein
200 ACSK03000135.1 GCA000175415_00097 CDS open 713-3196 _na     827_aa FHA modulated ABC efflux pump with fused ATPase and integral membrane subunits
201 ACSK03000135.1 GCA000175415_00096 gene open 58-516
202 ACSK03000135.1 GCA000175415_00097 gene open 713-3196
203 ACSK03000136.1 GCA000175415_00098 CDS open 400-636 _na     78_aa hypothetical protein
204 ACSK03000136.1 GCA000175415_00099 CDS open 626-907 _na     93_aa hypothetical protein
205 ACSK03000136.1 GCA000175415_00100 CDS open 1032-1349 _na     105_aa hypothetical protein
206 ACSK03000136.1 GCA000175415_00101 CDS open 1351-1770 _na     139_aa hypothetical protein
207 ACSK03000136.1 GCA000175415_00102 CDS open 1774-2127 _na     117_aa hypothetical protein
208 ACSK03000136.1 GCA000175415_00103 CDS open 2149-2517 _na     122_aa hypothetical protein
209 ACSK03000136.1 GCA000175415_00104 CDS open 2664-3863 _na     399_aa hypothetical protein
210 ACSK03000136.1 GCA000175415_00098 gene open 400-636
211 ACSK03000136.1 GCA000175415_00099 gene open 626-907
212 ACSK03000136.1 GCA000175415_00100 gene open 1032-1349
213 ACSK03000136.1 GCA000175415_00101 gene open 1351-1770
214 ACSK03000136.1 GCA000175415_00102 gene open 1774-2127
215 ACSK03000136.1 GCA000175415_00103 gene open 2149-2517
216 ACSK03000136.1 GCA000175415_00104 gene open 2664-3863
217 ACSK03000137.1 GCA000175415_00105 CDS open 498-3848 _na     1116_aa glycosyl hydrolase family 28-related protein
218 ACSK03000137.1 GCA000175415_00105 gene open 498-3848
219 ACSK03000138.1 GCA000175415_00106 CDS open 724-1446 _na     240_aa a-ycf53 GUN4 domain protein
220 ACSK03000138.1 GCA000175415_00107 CDS open 1597-2691 _na     364_aa pilM Type IV pilus assembly protein PilM
221 ACSK03000138.1 GCA000175415_00108 CDS open 2752-3552 _na     266_aa pilN PilN domain-containing protein
222 ACSK03000138.1 GCA000175415_00109 CDS open 3601-4389 _na     262_aa pilO pilus assembly protein PilO
223 ACSK03000138.1 GCA000175415_00106 gene open 724-1446 a-ycf53
224 ACSK03000138.1 GCA000175415_00107 gene open 1597-2691 pilM
225 ACSK03000138.1 GCA000175415_00108 gene open 2752-3552 pilN
226 ACSK03000138.1 GCA000175415_00109 gene open 3601-4389 pilO
227 ACSK03000139.1 GCA000175415_00110 CDS open 324-1202 _na     292_aa potB Polyamine transporter subunit membrane component of ABC superfamily
228 ACSK03000139.1 GCA000175415_00111 CDS open 1242-1529 _na     95_aa hypothetical protein
229 ACSK03000139.1 GCA000175415_00112 CDS open 1864-2742 _na     292_aa potC Ornithine carbamoyltransferase
230 ACSK03000139.1 GCA000175415_00113 CDS open 3003-4367 _na     454_aa HD/PDEase domain-containing protein
231 ACSK03000139.1 GCA000175415_00110 gene open 324-1202 potB
232 ACSK03000139.1 GCA000175415_00111 gene open 1242-1529
233 ACSK03000139.1 GCA000175415_00112 gene open 1864-2742 potC
234 ACSK03000139.1 GCA000175415_00113 gene open 3003-4367
235 ACSK03000140.1 GCA000175415_00114 CDS open 569-3871 _na     1100_aa CHAT domain-containing protein
236 ACSK03000140.1 GCA000175415_00115 CDS open 4035-4148 _na     37_aa hypothetical protein
237 ACSK03000140.1 GCA000175415_00114 gene open 569-3871
238 ACSK03000140.1 GCA000175415_00115 gene open 4035-4148
239 ACSK03000141.1 GCA000175415_00116 CDS open 260-2176 _na     638_aa dxs 1-deoxy-D-xylulose-5-phosphate synthase
240 ACSK03000141.1 GCA000175415_00117 CDS open 2424-3317 _na     297_aa wcaA Glycosyl transferase family 2
241 ACSK03000141.1 GCA000175415_00118 CDS open 3487-4323 _na     278_aa DUF4199 domain-containing protein
242 ACSK03000141.1 GCA000175415_00116 gene open 260-2176 dxs
243 ACSK03000141.1 GCA000175415_00117 gene open 2424-3317 wcaA
244 ACSK03000141.1 GCA000175415_00118 gene open 3487-4323
245 ACSK03000142.1 GCA000175415_00119 CDS open 252-2435 _na     727_aa bepA Glycosyl transferase%2C family 39
246 ACSK03000142.1 GCA000175415_00120 CDS open 2852-3403 _na     183_aa petD cytochrome b6-f complex subunit IV
247 ACSK03000142.1 GCA000175415_00121 CDS open 3430-4098 _na     222_aa petB Cytochrome b6
248 ACSK03000142.1 GCA000175415_00119 gene open 252-2435 bepA
249 ACSK03000142.1 GCA000175415_00120 gene open 2852-3403 petD
250 ACSK03000142.1 GCA000175415_00121 gene open 3430-4098 petB
251 ACSK03000143.1 GCA000175415_00122 CDS open 874-1623 _na     249_aa hypothetical protein
252 ACSK03000143.1 GCA000175415_00123 CDS open 2245-2742 _na     165_aa J domain-containing protein
253 ACSK03000143.1 GCA000175415_00124 CDS open 2759-3292 _na     177_aa hypothetical protein
254 ACSK03000143.1 GCA000175415_00125 CDS open 3441-3938 _na     165_aa J domain-containing protein
255 ACSK03000143.1 GCA000175415_00126 CDS open 3961-4488 _na     175_aa hypothetical protein
256 ACSK03000143.1 GCA000175415_00127 CDS open 4735-4989 _na     84_aa hicB HicB-like antitoxin of toxin-antitoxin system domain-containing protein
257 ACSK03000143.1 GCA000175415_00128 CDS open 4986-5219 _na     77_aa hicA type II toxin-antitoxin system HicA family toxin
258 ACSK03000143.1 GCA000175415_00129 CDS open 5164-5484 _na     106_aa hypothetical protein
259 ACSK03000143.1 GCA000175415_00130 CDS open 5453-5617 _na     54_aa hypothetical protein
260 ACSK03000143.1 GCA000175415_00122 gene open 874-1623
261 ACSK03000143.1 GCA000175415_00123 gene open 2245-2742
262 ACSK03000143.1 GCA000175415_00124 gene open 2759-3292
263 ACSK03000143.1 GCA000175415_00125 gene open 3441-3938
264 ACSK03000143.1 GCA000175415_00126 gene open 3961-4488
265 ACSK03000143.1 GCA000175415_00127 gene open 4735-4989 hicB
266 ACSK03000143.1 GCA000175415_00128 gene open 4986-5219 hicA
267 ACSK03000143.1 GCA000175415_00129 gene open 5164-5484
268 ACSK03000143.1 GCA000175415_00130 gene open 5453-5617
269 ACSK03000144.1 GCA000175415_00131 CDS open 54-500 _na     148_aa DUF29 domain-containing protein
270 ACSK03000144.1 GCA000175415_00132 CDS open 672-1475 _na     267_aa ulaG Zn-dependent hydrolase
271 ACSK03000144.1 GCA000175415_00133 CDS open 1522-2130 _na     202_aa pabA Anthranilate synthase component 2
272 ACSK03000144.1 GCA000175415_00134 CDS open 2134-2646 _na     170_aa dgkA Diacylglycerol kinase
273 ACSK03000144.1 GCA000175415_00135 CDS open 2729-3289 _na     186_aa ybeY rRNA maturation RNase YbeY
274 ACSK03000144.1 GCA000175415_00136 CDS open 3318-3512 _na     64_aa DUF3285 domain-containing protein
275 ACSK03000144.1 GCA000175415_00137 CDS open 3825-5021 _na     398_aa Peptidase C14 caspase catalytic subunit p20
276 ACSK03000144.1 GCA000175415_00131 gene open 54-500
277 ACSK03000144.1 GCA000175415_00132 gene open 672-1475 ulaG
278 ACSK03000144.1 GCA000175415_00133 gene open 1522-2130 pabA
279 ACSK03000144.1 GCA000175415_00134 gene open 2134-2646 dgkA
280 ACSK03000144.1 GCA000175415_00135 gene open 2729-3289 ybeY
281 ACSK03000144.1 GCA000175415_00136 gene open 3318-3512
282 ACSK03000144.1 GCA000175415_00137 gene open 3825-5021
283 ACSK03000145.1 GCA000175415_00138 CDS open 60-875 _na     271_aa hypothetical protein
284 ACSK03000145.1 GCA000175415_00139 CDS open 963-1682 _na     239_aa flgD FlgD Ig-like domain-containing protein
285 ACSK03000145.1 GCA000175415_00140 CDS open 1714-3096 _na     460_aa hypothetical protein
286 ACSK03000145.1 GCA000175415_00141 CDS open 3260-4150 _na     296_aa hypothetical protein
287 ACSK03000145.1 GCA000175415_00142 CDS open 4269-4931 _na     220_aa tsf translation elongation factor Ts
288 ACSK03000145.1 GCA000175415_00143 CDS open 5085-5882 _na     265_aa rpsB 30S ribosomal protein S2
289 ACSK03000145.1 GCA000175415_00138 gene open 60-875
290 ACSK03000145.1 GCA000175415_00139 gene open 963-1682 flgD
291 ACSK03000145.1 GCA000175415_00140 gene open 1714-3096
292 ACSK03000145.1 GCA000175415_00141 gene open 3260-4150
293 ACSK03000145.1 GCA000175415_00142 gene open 4269-4931 tsf
294 ACSK03000145.1 GCA000175415_00143 gene open 5085-5882 rpsB
295 ACSK03000146.1 GCA000175415_00144 CDS open 76-1290 _na     404_aa nurA NurA domain-containing protein
296 ACSK03000146.1 GCA000175415_00145 CDS open 1497-4556 _na     1019_aa histidine kinase
297 ACSK03000146.1 GCA000175415_00146 CDS open 4824-4943 _na     39_aa hypothetical protein
298 ACSK03000146.1 GCA000175415_00147 CDS open 5193-5432 _na     79_aa hypothetical protein
299 ACSK03000146.1 GCA000175415_00148 CDS open 5762-5959 _na     65_aa patX heterocyst-inhibiting protein PatX
300 ACSK03000146.1 GCA000175415_00144 gene open 76-1290 nurA
301 ACSK03000146.1 GCA000175415_00145 gene open 1497-4556
302 ACSK03000146.1 GCA000175415_00146 gene open 4824-4943
303 ACSK03000146.1 GCA000175415_00147 gene open 5193-5432
304 ACSK03000146.1 GCA000175415_00148 gene open 5762-5959 patX
305 ACSK03000147.1 GCA000175415_00149 CDS open 418-1362 _na     314_aa hypothetical protein
306 ACSK03000147.1 GCA000175415_00150 CDS open 1419-1673 _na     84_aa IraD/Gp25-like domain-containing protein
307 ACSK03000147.1 GCA000175415_00151 CDS open 2054-2809 _na     251_aa sigC group 2 RNA polymerase sigma factor SigC
308 ACSK03000147.1 GCA000175415_00152 CDS open 2806-3378 _na     190_aa hypothetical protein
309 ACSK03000147.1 GCA000175415_00153 CDS open 3375-5219 _na     614_aa Portal protein
310 ACSK03000147.1 GCA000175415_00154 CDS open 5222-5662 _na     146_aa hypothetical protein
311 ACSK03000147.1 GCA000175415_00149 gene open 418-1362
312 ACSK03000147.1 GCA000175415_00150 gene open 1419-1673
313 ACSK03000147.1 GCA000175415_00151 gene open 2054-2809 sigC
314 ACSK03000147.1 GCA000175415_00152 gene open 2806-3378
315 ACSK03000147.1 GCA000175415_00153 gene open 3375-5219
316 ACSK03000147.1 GCA000175415_00154 gene open 5222-5662
317 ACSK03000148.1 GCA000175415_00155 CDS open 449-1132 _na     227_aa DUF3782 domain-containing protein
318 ACSK03000148.1 GCA000175415_00156 CDS open 1493-1732 _na     79_aa hicA type II toxin-antitoxin system HicA family toxin
319 ACSK03000148.1 GCA000175415_00157 CDS open 1750-1962 _na     70_aa 2-oxoisovalerate dehydrogenase%2C E1 component beta subunit
320 ACSK03000148.1 GCA000175415_00158 CDS open 2474-3091 _na     205_aa PD-(D/E)XK nuclease superfamily
321 ACSK03000148.1 GCA000175415_00159 CDS open 3362-3601 _na     79_aa hicA type II toxin-antitoxin system HicA family toxin
322 ACSK03000148.1 GCA000175415_00160 CDS open 3619-3831 _na     70_aa 2-oxoisovalerate dehydrogenase%2C E1 component beta subunit
323 ACSK03000148.1 GCA000175415_00161 CDS open 4344-4985 _na     213_aa DUF3782 domain-containing protein
324 ACSK03000148.1 GCA000175415_00162 CDS open 5035-5268 _na     77_aa hypothetical protein
325 ACSK03000148.1 GCA000175415_00163 CDS open 5262-5900 _na     212_aa PD-(D/E)XK nuclease superfamily
326 ACSK03000148.1 GCA000175415_00155 gene open 449-1132
327 ACSK03000148.1 GCA000175415_00156 gene open 1493-1732 hicA
328 ACSK03000148.1 GCA000175415_00157 gene open 1750-1962
329 ACSK03000148.1 GCA000175415_00158 gene open 2474-3091
330 ACSK03000148.1 GCA000175415_00159 gene open 3362-3601 hicA
331 ACSK03000148.1 GCA000175415_00160 gene open 3619-3831
332 ACSK03000148.1 GCA000175415_00161 gene open 4344-4985
333 ACSK03000148.1 GCA000175415_00162 gene open 5035-5268
334 ACSK03000148.1 GCA000175415_00163 gene open 5262-5900
335 ACSK03000149.1 GCA000175415_00164 CDS open 180-890 _na     236_aa hypothetical protein
336 ACSK03000149.1 GCA000175415_00165 CDS open 1035-2024 _na     329_aa hypothetical protein
337 ACSK03000149.1 GCA000175415_00166 CDS open 2021-2593 _na     190_aa hypothetical protein
338 ACSK03000149.1 GCA000175415_00167 CDS open 2590-3345 _na     251_aa sigC group 2 RNA polymerase sigma factor SigC
339 ACSK03000149.1 GCA000175415_00168 CDS open 3726-3980 _na     84_aa IraD/Gp25-like domain-containing protein
340 ACSK03000149.1 GCA000175415_00169 CDS open 4037-4981 _na     314_aa hypothetical protein
341 ACSK03000149.1 GCA000175415_00170 CDS open 5187-5774 _na     195_aa xerD Integrase family protein
342 ACSK03000149.1 GCA000175415_00171 CDS open 6052-6600 _na     182_aa Winged helix-turn-helix domain-containing protein
343 ACSK03000149.1 GCA000175415_00164 gene open 180-890
344 ACSK03000149.1 GCA000175415_00165 gene open 1035-2024
345 ACSK03000149.1 GCA000175415_00166 gene open 2021-2593
346 ACSK03000149.1 GCA000175415_00167 gene open 2590-3345 sigC
347 ACSK03000149.1 GCA000175415_00168 gene open 3726-3980
348 ACSK03000149.1 GCA000175415_00169 gene open 4037-4981
349 ACSK03000149.1 GCA000175415_00170 gene open 5187-5774 xerD
350 ACSK03000149.1 GCA000175415_00171 gene open 6052-6600
351 ACSK03000150.1 GCA000175415_00172 CDS open 1148-1708 _na     186_aa DUF3038 domain-containing protein
352 ACSK03000150.1 GCA000175415_00173 CDS open 1722-3152 _na     476_aa DUF4335 domain-containing protein
353 ACSK03000150.1 GCA000175415_00174 CDS open 3149-3556 _na     135_aa yuxK Thiol-disulphide oxidoreductase DCC
354 ACSK03000150.1 GCA000175415_00175 CDS open 3623-4468 _na     281_aa arginyl-tRNA synthetase
355 ACSK03000150.1 GCA000175415_00176 CDS open 4490-5248 _na     252_aa dsbG Oxidoreductase%2C DSBA-like
356 ACSK03000150.1 GCA000175415_00177 CDS open 5320-5958 _na     212_aa plsC 1-acyl-sn-glycerol-3-phosphate acyltransferase
357 ACSK03000150.1 GCA000175415_00178 CDS open 5988-6275 _na     95_aa ssr3000 DUF2288 domain-containing protein
358 ACSK03000150.1 GCA000175415_00179 CDS open 6315-6728 _na     137_aa hypothetical protein
359 ACSK03000150.1 GCA000175415_00172 gene open 1148-1708
360 ACSK03000150.1 GCA000175415_00173 gene open 1722-3152
361 ACSK03000150.1 GCA000175415_00174 gene open 3149-3556 yuxK
362 ACSK03000150.1 GCA000175415_00175 gene open 3623-4468
363 ACSK03000150.1 GCA000175415_00176 gene open 4490-5248 dsbG
364 ACSK03000150.1 GCA000175415_00177 gene open 5320-5958 plsC
365 ACSK03000150.1 GCA000175415_00178 gene open 5988-6275 ssr3000
366 ACSK03000150.1 GCA000175415_00179 gene open 6315-6728
367 ACSK03000151.1 GCA000175415_00182 gene open 2966-3082 rrf
368 ACSK03000151.1 GCA000175415_00182 rRNA open 2966-3082 rrf 5S ribosomal RNA
369 ACSK03000151.1 GCA000175415_00180 CDS open 1003-1899 _na     298_aa Auxin Efflux Carrier
370 ACSK03000151.1 GCA000175415_00181 CDS open 2001-2660 _na     219_aa sanA Thioredoxin-like
371 ACSK03000151.1 GCA000175415_00183 CDS open 3151-4065 _na     304_aa nadC carboxylating nicotinate-nucleotide diphosphorylase
372 ACSK03000151.1 GCA000175415_00184 CDS open 4068-5258 _na     396_aa ubiG C-methyltransferase protein
373 ACSK03000151.1 GCA000175415_00185 CDS open 5459-6658 _na     399_aa wecG UDP-N-acetyl-D-mannosaminuronic acid transferase Glycosyl transferase%2C WecB/TagA/CpsF family
374 ACSK03000151.1 GCA000175415_00186 CDS open 6710-7141 _na     143_aa hypothetical protein
375 ACSK03000151.1 GCA000175415_00180 gene open 1003-1899
376 ACSK03000151.1 GCA000175415_00181 gene open 2001-2660 sanA
377 ACSK03000151.1 GCA000175415_00183 gene open 3151-4065 nadC
378 ACSK03000151.1 GCA000175415_00184 gene open 4068-5258 ubiG
379 ACSK03000151.1 GCA000175415_00185 gene open 5459-6658 wecG
380 ACSK03000151.1 GCA000175415_00186 gene open 6710-7141
381 ACSK03000152.1 GCA000175415_00187 CDS open 1575-1880 _na     101_aa hypothetical protein
382 ACSK03000152.1 GCA000175415_00188 CDS open 5570-7369 _na     599_aa mdlB ABC transporter related
383 ACSK03000152.1 GCA000175415_00187 gene open 1575-1880
384 ACSK03000152.1 GCA000175415_00188 gene open 5570-7369 mdlB
385 ACSK03000153.1 GCA000175415_00189 CDS open 121-2562 _na     813_aa nAGPA Phosphodiester glycosidase domain-containing protein
386 ACSK03000153.1 GCA000175415_00190 CDS open 4998-5285 _na     95_aa hypothetical protein
387 ACSK03000153.1 GCA000175415_00191 CDS open 5251-6843 _na     530_aa hypothetical protein
388 ACSK03000153.1 GCA000175415_00192 CDS open 7006-7458 _na     150_aa hypothetical protein
389 ACSK03000153.1 GCA000175415_00189 gene open 121-2562 nAGPA
390 ACSK03000153.1 GCA000175415_00190 gene open 4998-5285
391 ACSK03000153.1 GCA000175415_00191 gene open 5251-6843
392 ACSK03000153.1 GCA000175415_00192 gene open 7006-7458
393 ACSK03000154.1 GCA000175415_00193 CDS open 10-3618 _na     1202_aa Peptidase
394 ACSK03000154.1 GCA000175415_00194 CDS open 6065-8107 _na     680_aa SBBP repeat-containing protein
395 ACSK03000154.1 GCA000175415_00193 gene open 10-3618
396 ACSK03000154.1 GCA000175415_00194 gene open 6065-8107
397 ACSK03000155.1 GCA000175415_00195 CDS open 230-3292 _na     1020_aa TIGR03032 family protein
398 ACSK03000155.1 GCA000175415_00196 CDS open 3428-4558 _na     376_aa hypothetical protein
399 ACSK03000155.1 GCA000175415_00197 CDS open 5024-6115 _na     363_aa hypothetical protein
400 ACSK03000155.1 GCA000175415_00198 CDS open 7108-8919 _na     603_aa hypothetical protein
401 ACSK03000155.1 GCA000175415_00195 gene open 230-3292
402 ACSK03000155.1 GCA000175415_00196 gene open 3428-4558
403 ACSK03000155.1 GCA000175415_00197 gene open 5024-6115
404 ACSK03000155.1 GCA000175415_00198 gene open 7108-8919
405 ACSK03000156.1 GCA000175415_00199 CDS open 59-343 _na     94_aa DUF3288 domain-containing protein
406 ACSK03000156.1 GCA000175415_00200 CDS open 349-4071 _na     1240_aa cobN cobaltochelatase subunit CobN
407 ACSK03000156.1 GCA000175415_00201 CDS open 4128-5774 _na     548_aa Conserved TM helix repeat-containing protein
408 ACSK03000156.1 GCA000175415_00202 CDS open 6094-6546 _na     150_aa SRPBCC family protein
409 ACSK03000156.1 GCA000175415_00203 CDS open 6663-7307 _na     214_aa DUF1400 domain-containing protein
410 ACSK03000156.1 GCA000175415_00204 CDS open 7414-7821 _na     135_aa hypothetical protein
411 ACSK03000156.1 GCA000175415_00205 CDS open 7870-8871 _na     333_aa hypothetical protein
412 ACSK03000156.1 GCA000175415_00199 gene open 59-343
413 ACSK03000156.1 GCA000175415_00200 gene open 349-4071 cobN
414 ACSK03000156.1 GCA000175415_00201 gene open 4128-5774
415 ACSK03000156.1 GCA000175415_00202 gene open 6094-6546
416 ACSK03000156.1 GCA000175415_00203 gene open 6663-7307
417 ACSK03000156.1 GCA000175415_00204 gene open 7414-7821
418 ACSK03000156.1 GCA000175415_00205 gene open 7870-8871
419 ACSK03000157.1 GCA000175415_00206 CDS open 3799-5052 _na     417_aa ctpA carboxyl-terminal processing protease CtpA
420 ACSK03000157.1 GCA000175415_00207 CDS open 5151-6143 _na     330_aa SPOR domain-containing protein
421 ACSK03000157.1 GCA000175415_00208 CDS open 6170-7780 _na     536_aa nnr2 Bifunctional NAD(P)H-hydrate repair enzyme
422 ACSK03000157.1 GCA000175415_00209 CDS open 7888-8646 _na     252_aa spoIIQ2 Metalloendopeptidase (Peptidase M23B)
423 ACSK03000157.1 GCA000175415_00210 CDS open 8713-9138 _na     141_aa NUDIX domain-containing protein
424 ACSK03000157.1 GCA000175415_00211 CDS open 9169-9981 _na     270_aa SDR family oxidoreductase
425 ACSK03000157.1 GCA000175415_00206 gene open 3799-5052 ctpA
426 ACSK03000157.1 GCA000175415_00207 gene open 5151-6143
427 ACSK03000157.1 GCA000175415_00208 gene open 6170-7780 nnr2
428 ACSK03000157.1 GCA000175415_00209 gene open 7888-8646 spoIIQ2
429 ACSK03000157.1 GCA000175415_00210 gene open 8713-9138
430 ACSK03000157.1 GCA000175415_00211 gene open 9169-9981
431 ACSK03000158.1 GCA000175415_00212 CDS open 45-707 _na     220_aa uma2 Putative restriction endonuclease domain-containing protein
432 ACSK03000158.1 GCA000175415_00213 CDS open 710-943 _na     77_aa DUF433 domain-containing protein
433 ACSK03000158.1 GCA000175415_00214 CDS open 1135-1293 _na     52_aa PIN domain-containing protein
434 ACSK03000158.1 GCA000175415_00215 CDS open 1349-1525 _na     58_aa vapC type II toxin-antitoxin system VapC family toxin
435 ACSK03000158.1 GCA000175415_00216 CDS open 1522-1752 _na     76_aa type II toxin-antitoxin system Phd/YefM family antitoxin
436 ACSK03000158.1 GCA000175415_00217 CDS open 2467-3483 _na     338_aa CHAT domain-containing protein
437 ACSK03000158.1 GCA000175415_00218 CDS open 3568-4788 _na     406_aa tnpB RNA-guided endonuclease TnpB family protein
438 ACSK03000158.1 GCA000175415_00219 CDS open 4870-5697 _na     275_aa tetratricopeptide repeat protein
439 ACSK03000158.1 GCA000175415_00220 CDS open 5942-6055 _na     37_aa parD Type II toxin-antitoxin system ParD family antitoxin
440 ACSK03000158.1 GCA000175415_00221 CDS open 6095-6193 _na     32_aa hypothetical protein
441 ACSK03000158.1 GCA000175415_00222 CDS open 6261-6500 _na     79_aa Toxin-antitoxin system%2C antitoxin component
442 ACSK03000158.1 GCA000175415_00223 CDS open 6506-6670 _na     54_aa DUF3368 domain-containing protein
443 ACSK03000158.1 GCA000175415_00224 CDS open 7257-7382 _na     41_aa parD Type II toxin-antitoxin system ParD family antitoxin
444 ACSK03000158.1 GCA000175415_00225 CDS open 7410-7508 _na     32_aa hypothetical protein
445 ACSK03000158.1 GCA000175415_00226 CDS open 7681-7866 _na     61_aa hypothetical protein
446 ACSK03000158.1 GCA000175415_00227 CDS open 7859-8248 _na     129_aa type II toxin-antitoxin system death-on-curing family toxin
447 ACSK03000158.1 GCA000175415_00228 CDS open 8722-8949 _na     75_aa DUF104 domain-containing protein
448 ACSK03000158.1 GCA000175415_00229 CDS open 9003-9245 _na     80_aa DUF2281 domain-containing protein
449 ACSK03000158.1 GCA000175415_00230 CDS open 9242-9457 _na     71_aa vapC Type II toxin-antitoxin system VapC family toxin
450 ACSK03000158.1 GCA000175415_00231 CDS open 9476-9655 _na     59_aa PIN domain-containing protein
451 ACSK03000158.1 GCA000175415_00232 CDS open 9765-10307 _na     180_aa Lipoprotein
452 ACSK03000158.1 GCA000175415_00212 gene open 45-707 uma2
453 ACSK03000158.1 GCA000175415_00213 gene open 710-943
454 ACSK03000158.1 GCA000175415_00214 gene open 1135-1293
455 ACSK03000158.1 GCA000175415_00215 gene open 1349-1525 vapC
456 ACSK03000158.1 GCA000175415_00216 gene open 1522-1752
457 ACSK03000158.1 GCA000175415_00217 gene open 2467-3483
458 ACSK03000158.1 GCA000175415_00218 gene open 3568-4788 tnpB
459 ACSK03000158.1 GCA000175415_00219 gene open 4870-5697
460 ACSK03000158.1 GCA000175415_00220 gene open 5942-6055 parD
461 ACSK03000158.1 GCA000175415_00221 gene open 6095-6193
462 ACSK03000158.1 GCA000175415_00222 gene open 6261-6500
463 ACSK03000158.1 GCA000175415_00223 gene open 6506-6670
464 ACSK03000158.1 GCA000175415_00224 gene open 7257-7382 parD
465 ACSK03000158.1 GCA000175415_00225 gene open 7410-7508
466 ACSK03000158.1 GCA000175415_00226 gene open 7681-7866
467 ACSK03000158.1 GCA000175415_00227 gene open 7859-8248
468 ACSK03000158.1 GCA000175415_00228 gene open 8722-8949
469 ACSK03000158.1 GCA000175415_00229 gene open 9003-9245
470 ACSK03000158.1 GCA000175415_00230 gene open 9242-9457 vapC
471 ACSK03000158.1 GCA000175415_00231 gene open 9476-9655
472 ACSK03000158.1 GCA000175415_00232 gene open 9765-10307
473 ACSK03000159.1 GCA000175415_00233 CDS open 214-852 _na     212_aa hypothetical protein
474 ACSK03000159.1 GCA000175415_00234 CDS open 879-1886 _na     335_aa DUF4351 domain-containing protein
475 ACSK03000159.1 GCA000175415_00235 CDS open 1913-2944 _na     343_aa DUF4351 domain-containing protein
476 ACSK03000159.1 GCA000175415_00236 CDS open 2949-3962 _na     337_aa DUF4351 domain-containing protein
477 ACSK03000159.1 GCA000175415_00237 CDS open 3979-4917 _na     312_aa DUF4351 domain-containing protein
478 ACSK03000159.1 GCA000175415_00238 CDS open 4934-6412 _na     492_aa hypothetical protein
479 ACSK03000159.1 GCA000175415_00239 CDS open 6457-7500 _na     347_aa DUF4351 domain-containing protein
480 ACSK03000159.1 GCA000175415_00240 CDS open 7527-8516 _na     329_aa DUF4351 domain-containing protein
481 ACSK03000159.1 GCA000175415_00233 gene open 214-852
482 ACSK03000159.1 GCA000175415_00234 gene open 879-1886
483 ACSK03000159.1 GCA000175415_00235 gene open 1913-2944
484 ACSK03000159.1 GCA000175415_00236 gene open 2949-3962
485 ACSK03000159.1 GCA000175415_00237 gene open 3979-4917
486 ACSK03000159.1 GCA000175415_00238 gene open 4934-6412
487 ACSK03000159.1 GCA000175415_00239 gene open 6457-7500
488 ACSK03000159.1 GCA000175415_00240 gene open 7527-8516
489 ACSK03000160.1 GCA000175415_00241 CDS open 5-829 _na     274_aa hypothetical protein
490 ACSK03000160.1 GCA000175415_00242 CDS open 891-1160 _na     89_aa hypothetical protein
491 ACSK03000160.1 GCA000175415_00243 CDS open 1197-1931 _na     244_aa wcaK Polysaccharide pyruvyl transferase
492 ACSK03000160.1 GCA000175415_00244 CDS open 2002-3030 _na     342_aa Sugar transferase
493 ACSK03000160.1 GCA000175415_00245 CDS open 3060-3941 _na     293_aa Methionine synthase
494 ACSK03000160.1 GCA000175415_00246 CDS open 3956-4930 _na     324_aa Sugar transferase
495 ACSK03000160.1 GCA000175415_00247 CDS open 4963-5469 _na     168_aa oafA Lipopolysaccharide biosynthesis acyltransferase (Acyltransferase 3)
496 ACSK03000160.1 GCA000175415_00248 CDS open 5470-6132 _na     220_aa acyltransferase
497 ACSK03000160.1 GCA000175415_00249 CDS open 6148-7107 _na     319_aa Putative glycosyl transferase
498 ACSK03000160.1 GCA000175415_00250 CDS open 7125-8327 _na     400_aa rfaB Glycosyl transferase%2C group 1
499 ACSK03000160.1 GCA000175415_00251 CDS open 8342-10363 _na     673_aa mdlB ATP-binding protein of ABC transporter
500 ACSK03000160.1 GCA000175415_00252 CDS open 10390-10914 _na     174_aa Alpha-maltose-1-phosphate synthase