HOMD Banner
Taxonomy: V4.3   |  16S rRNA RefSeq: V16.03   |  Genomic RefSeq: V11.03   |  Viruses: V1.2

BAKTAGenome Explorer: Arthrospira platensis (GCA_000175415.3)

Select a Genome:
BAKTA Annotations for GCA_000175415.3
Genome Selected: Arthrospira platensis
ContigsBases CDSrRNA tmRNAtRNA
268 6501886 6076 6 1 40
[Table]   [AA Fasta]      [Browser]   [Text]   [Excel]  
Search & Sort all 12298 Records
Search These Records: Clear
Sort Column:   Molecule   PID   NA   AA   Gene  Gene Product  Reverse
Annotation Table [page:14]    |    Number of Records Found: 12298 [25 Pages]    |    Previous Page <==> Next Page    |    Jump to Page: [ 1  2  3  4  5  6  7  8  9  10  11  12  13  14  15  16  17  18  19  20  21  22  23  24  25  ]
Notes:   1- Column headers only sort the current page. 2- Select [NA] or [AA] links to show sequences.
Region Protein-ID Type Genome
Viewer		 Range
(bp)		 Show Sequences
(length) NA / AA		 BAKTA
Gene		 BAKTA
GeneProduct
6501 ACSK03000246.1 GCA000175415_03228 gene open 29211-29426 rpsR
6502 ACSK03000246.1 GCA000175415_03229 gene open 29506-29694 rpmG
6503 ACSK03000246.1 GCA000175415_03230 gene open 29732-30283
6504 ACSK03000246.1 GCA000175415_03235 gene open 35882-36772
6505 ACSK03000246.1 GCA000175415_03236 gene open 37265-38464 aspB
6506 ACSK03000246.1 GCA000175415_03237 gene open 38513-38842
6507 ACSK03000246.1 GCA000175415_03238 gene open 40066-41103 glpX
6508 ACSK03000246.1 GCA000175415_03239 gene open 41239-42537 hemA
6509 ACSK03000246.1 GCA000175415_03240 gene open 42810-45536 valS
6510 ACSK03000246.1 GCA000175415_03241 gene open 45724-47124
6511 ACSK03000246.1 GCA000175415_03242 gene open 47124-47744
6512 ACSK03000246.1 GCA000175415_03243 gene open 48042-51626
6513 ACSK03000246.1 GCA000175415_03244 gene open 52089-55628
6514 ACSK03000246.1 GCA000175415_03245 gene open 55675-56343 tsaC
6515 ACSK03000246.1 GCA000175415_03246 gene open 56479-57741 larC
6516 ACSK03000246.1 GCA000175415_03247 gene open 57794-60697 uvrA
6517 ACSK03000246.1 GCA000175415_03248 gene open 60761-61858 rbcL
6518 ACSK03000246.1 GCA000175415_03249 gene open 62321-62944 mtnB
6519 ACSK03000246.1 GCA000175415_03250 gene open 62941-64272 yraQ
6520 ACSK03000246.1 GCA000175415_03251 gene open 64420-64512
6521 ACSK03000246.1 GCA000175415_03252 gene open 64727-65149
6522 ACSK03000246.1 GCA000175415_03253 gene open 65364-65993 cobH
6523 ACSK03000246.1 GCA000175415_03254 gene open 65990-66697
6524 ACSK03000246.1 GCA000175415_03255 gene open 66787-67614 dapB
6525 ACSK03000246.1 GCA000175415_03256 gene open 67746-70283
6526 ACSK03000246.1 GCA000175415_03257 gene open 70395-71528 piuC
6527 ACSK03000246.1 GCA000175415_03258 gene open 71599-72432
6528 ACSK03000246.1 GCA000175415_03259 gene open 72444-73418 dppD
6529 ACSK03000246.1 GCA000175415_03260 gene open 73484-74515 dppD
6530 ACSK03000246.1 GCA000175415_03261 gene open 74519-74716
6531 ACSK03000246.1 GCA000175415_03262 gene open 74898-75584
6532 ACSK03000246.1 GCA000175415_03263 gene open 75568-76512 aes
6533 ACSK03000246.1 GCA000175415_03232 gene open 33490-33562 trnA
6534 ACSK03000246.1 GCA000175415_03233 gene open 33578-33651 trnI
6535 ACSK03000246.1 GCA000175415_03232 tRNA open 33490-33562 trnA tRNA-Ala(tgc)
6536 ACSK03000246.1 GCA000175415_03233 tRNA open 33578-33651 trnI tRNA-Ile(gat)
6537 ACSK03000247.1 GCA000175415_03279 gene open 16592-16769 isrR
6538 ACSK03000247.1 GCA000175415_03279 ncRNA open 16592-16769 isrR Antisense RNA which regulates isiA expression
6539 ACSK03000247.1 GCA000175415_03264 CDS open 41-1444 _na     467_aa selO Protein adenylyltransferase SelO
6540 ACSK03000247.1 GCA000175415_03265 CDS open 1562-2413 _na     283_aa mscK Mechanosensitive ion channel family protein
6541 ACSK03000247.1 GCA000175415_03266 CDS open 2416-3693 _na     425_aa marR MarR family transcriptional regulator
6542 ACSK03000247.1 GCA000175415_03267 CDS open 3726-5849 _na     707_aa glgX glycogen debranching protein GlgX
6543 ACSK03000247.1 GCA000175415_03268 CDS open 5875-6909 _na     344_aa ttcA tRNA(Ile)-lysidine synthase
6544 ACSK03000247.1 GCA000175415_03269 CDS open 7011-8051 _na     346_aa wcaA Undecaprenyl phosphate-L-Ara4FN transferase Glycosyl transferase%2C family 2 Dolichol-phosphate mannosyltransferase
6545 ACSK03000247.1 GCA000175415_03270 CDS open 8823-9212 _na     129_aa hypothetical protein
6546 ACSK03000247.1 GCA000175415_03271 CDS open 9373-10989 _na     538_aa leuA 2-isopropylmalate synthase
6547 ACSK03000247.1 GCA000175415_03272 CDS open 11023-11544 _na     173_aa labA NYN domain-containing protein
6548 ACSK03000247.1 GCA000175415_03273 CDS open 12227-12877 _na     216_aa ompR Two-component system transcriptional regulator (BaeR)
6549 ACSK03000247.1 GCA000175415_03274 CDS open 13032-13523 _na     163_aa 2Fe2S Ferredoxin-like protein
6550 ACSK03000247.1 GCA000175415_03275 CDS open 13801-14112 _na     103_aa groES co-chaperone GroES
6551 ACSK03000247.1 GCA000175415_03276 CDS open 14222-15859 _na     545_aa groL chaperonin GroEL
6552 ACSK03000247.1 GCA000175415_03277 CDS open 15767-15970 _na     67_aa hypothetical protein
6553 ACSK03000247.1 GCA000175415_03278 CDS open 16199-17227 _na     342_aa isiA Iron stress-induced chlorophyll-binding protein (CP43')
6554 ACSK03000247.1 GCA000175415_03280 CDS open 17569-18318 _na     249_aa alpha/beta hydrolase
6555 ACSK03000247.1 GCA000175415_03281 CDS open 18403-18687 _na     94_aa hypothetical protein
6556 ACSK03000247.1 GCA000175415_03282 CDS open 18968-21529 _na     853_aa exonuclease domain-containing protein
6557 ACSK03000247.1 GCA000175415_03283 CDS open 21681-22778 _na     365_aa bchI magnesium chelatase ATPase subunit I
6558 ACSK03000247.1 GCA000175415_03284 CDS open 22806-23333 _na     175_aa ruvC crossover junction endodeoxyribonuclease RuvC
6559 ACSK03000247.1 GCA000175415_03285 CDS open 23350-23733 _na     127_aa HEAT repeat domain-containing protein
6560 ACSK03000247.1 GCA000175415_03286 CDS open 23787-23987 _na     66_aa Photosystem II reaction center X protein
6561 ACSK03000247.1 GCA000175415_03287 CDS open 24033-24596 _na     187_aa def peptide deformylase
6562 ACSK03000247.1 GCA000175415_03288 CDS open 25203-25529 _na     108_aa hypothetical protein
6563 ACSK03000247.1 GCA000175415_03289 CDS open 25530-25982 _na     150_aa hypothetical protein
6564 ACSK03000247.1 GCA000175415_03290 CDS open 26187-26810 _na     207_aa estA Lipase class 2
6565 ACSK03000247.1 GCA000175415_03291 CDS open 26817-27614 _na     265_aa TIGR00297 family protein
6566 ACSK03000247.1 GCA000175415_03292 CDS open 27678-28502 _na     274_aa surA peptidylprolyl isomerase
6567 ACSK03000247.1 GCA000175415_03293 CDS open 28504-30162 _na     552_aa DUF1400 domain-containing protein
6568 ACSK03000247.1 GCA000175415_03294 CDS open 30530-30880 _na     116_aa psb28 photosystem II reaction center protein Psb28
6569 ACSK03000247.1 GCA000175415_03295 CDS open 30961-32232 _na     423_aa hypothetical protein
6570 ACSK03000247.1 GCA000175415_03296 CDS open 32264-32692 _na     142_aa yjhB NUDIX hydrolase
6571 ACSK03000247.1 GCA000175415_03297 CDS open 32731-33189 _na     152_aa pro1025 DUF3531 domain-containing protein
6572 ACSK03000247.1 GCA000175415_03298 CDS open 33322-34320 _na     332_aa Sll0314/Alr1548 family TPR repeat-containing protein
6573 ACSK03000247.1 GCA000175415_03299 CDS open 34458-35126 _na     222_aa ecfA2 ABC transporter related
6574 ACSK03000247.1 GCA000175415_03300 CDS open 35123-35887 _na     254_aa rsmG 16S rRNA (guanine(527)-N(7))-methyltransferase RsmG
6575 ACSK03000247.1 GCA000175415_03301 CDS open 36372-36758 _na     128_aa aroH chorismate mutase
6576 ACSK03000247.1 GCA000175415_03302 CDS open 36851-37672 _na     273_aa sppA Protease IV%2C Signal peptide peptidase A-Serine peptidase MEROPS family S49
6577 ACSK03000247.1 GCA000175415_03303 CDS open 38037-39080 _na     347_aa rhaT EamA domain-containing protein
6578 ACSK03000247.1 GCA000175415_03304 CDS open 39119-40939 _na     606_aa treZ malto-oligosyltrehalose trehalohydrolase
6579 ACSK03000247.1 GCA000175415_03305 CDS open 40991-43801 _na     936_aa treY malto-oligosyltrehalose synthase
6580 ACSK03000247.1 GCA000175415_03306 CDS open 43806-44537 _na     243_aa radC DNA repair protein RadC
6581 ACSK03000247.1 GCA000175415_03307 CDS open 44744-46738 _na     664_aa calcium-binding protein
6582 ACSK03000247.1 GCA000175415_03308 CDS open 47244-48506 _na     420_aa rfaB Glycosyl transferase group 1
6583 ACSK03000247.1 GCA000175415_03309 CDS open 48525-50117 _na     530_aa Sulfotransferase
6584 ACSK03000247.1 GCA000175415_03310 CDS open 50071-50229 _na     52_aa hypothetical protein
6585 ACSK03000247.1 GCA000175415_03311 CDS open 50253-50960 _na     235_aa Methyltransferase type 11
6586 ACSK03000247.1 GCA000175415_03312 CDS open 51041-51625 _na     194_aa ssuE NADPH-dependent FMN reductase
6587 ACSK03000247.1 GCA000175415_03313 CDS open 51632-52369 _na     245_aa yhaK Pirin-like protein
6588 ACSK03000247.1 GCA000175415_03314 CDS open 54217-55797 _na     526_aa nuoN NAD(P)H-quinone oxidoreductase subunit N
6589 ACSK03000247.1 GCA000175415_03315 CDS open 55892-56857 _na     321_aa cmoB tRNA 5-methoxyuridine(34)/uridine 5-oxyacetic acid(34) synthase CmoB
6590 ACSK03000247.1 GCA000175415_03316 CDS open 56917-57672 _na     251_aa cmoA carboxy-S-adenosyl-L-methionine synthase CmoA
6591 ACSK03000247.1 GCA000175415_03317 CDS open 57833-58435 _na     200_aa rhtB LysE/RhtB family amino acid efflux pump
6592 ACSK03000247.1 GCA000175415_03318 CDS open 58406-59116 _na     236_aa Cyclase family protein
6593 ACSK03000247.1 GCA000175415_03319 CDS open 59136-59846 _na     236_aa trmN6 tRNA1(Val) (adenine(37)-N6)-methyltransferase
6594 ACSK03000247.1 GCA000175415_03320 CDS open 59855-61015 _na     386_aa rlhA Collagenase family protease
6595 ACSK03000247.1 GCA000175415_03321 CDS open 61030-62280 _na     416_aa rlhA Peptidase U32
6596 ACSK03000247.1 GCA000175415_03322 CDS open 62295-63587 _na     430_aa S-layer domain protein
6597 ACSK03000247.1 GCA000175415_03323 CDS open 63639-64322 _na     227_aa fabG Short-chain dehydrogenase/reductase SDR
6598 ACSK03000247.1 GCA000175415_03324 CDS open 64367-65545 _na     392_aa bioF 8-amino-7-oxononanoate synthase
6599 ACSK03000247.1 GCA000175415_03325 CDS open 65558-65788 _na     76_aa 8-amino-7-oxononanoate synthase
6600 ACSK03000247.1 GCA000175415_03326 CDS open 65779-66654 _na     291_aa Ion transport protein
6601 ACSK03000247.1 GCA000175415_03327 CDS open 66771-68000 _na     409_aa degQ HhoA/HhoB/HtrA family serine endopeptidase
6602 ACSK03000247.1 GCA000175415_03328 CDS open 68034-68303 _na     89_aa hypothetical protein
6603 ACSK03000247.1 GCA000175415_03329 CDS open 68328-69308 _na     326_aa dnaJ Chaperone DnaJ domain protein
6604 ACSK03000247.1 GCA000175415_03330 CDS open 69501-69941 _na     146_aa ibpA Heat shock protein A
6605 ACSK03000247.1 GCA000175415_03331 CDS open 70245-70451 _na     68_aa Glycogen debranching enzyme
6606 ACSK03000247.1 GCA000175415_03332 CDS open 70540-70938 _na     132_aa msrB Peptide methionine sulfoxide reductase MsrB
6607 ACSK03000247.1 GCA000175415_03333 CDS open 70997-71425 _na     142_aa ndhV DUF2996 domain-containing protein
6608 ACSK03000247.1 GCA000175415_03334 CDS open 71876-73480 _na     534_aa nhaP Sodium/hydrogen exchanger
6609 ACSK03000247.1 GCA000175415_03335 CDS open 73537-74424 _na     295_aa PBS lyase HEAT domain protein repeat-containing protein
6610 ACSK03000247.1 GCA000175415_03336 CDS open 74459-74998 _na     179_aa Lipoprotein
6611 ACSK03000247.1 GCA000175415_03337 CDS open 75161-76552 _na     463_aa sfcA Malate dehydrogenase (Oxaloacetate-decarboxylating) (NADP(+))
6612 ACSK03000247.1 GCA000175415_03338 CDS open 76771-77304 _na     177_aa cysC Adenylyl-sulfate kinase
6613 ACSK03000247.1 GCA000175415_03339 CDS open 77491-78012 _na     173_aa hpt1 Phosphoribosyltransferase
6614 ACSK03000247.1 GCA000175415_03264 gene open 41-1444 selO
6615 ACSK03000247.1 GCA000175415_03265 gene open 1562-2413 mscK
6616 ACSK03000247.1 GCA000175415_03266 gene open 2416-3693 marR
6617 ACSK03000247.1 GCA000175415_03267 gene open 3726-5849 glgX
6618 ACSK03000247.1 GCA000175415_03268 gene open 5875-6909 ttcA
6619 ACSK03000247.1 GCA000175415_03269 gene open 7011-8051 wcaA
6620 ACSK03000247.1 GCA000175415_03270 gene open 8823-9212
6621 ACSK03000247.1 GCA000175415_03271 gene open 9373-10989 leuA
6622 ACSK03000247.1 GCA000175415_03272 gene open 11023-11544 labA
6623 ACSK03000247.1 GCA000175415_03273 gene open 12227-12877 ompR
6624 ACSK03000247.1 GCA000175415_03274 gene open 13032-13523 2Fe2S
6625 ACSK03000247.1 GCA000175415_03275 gene open 13801-14112 groES
6626 ACSK03000247.1 GCA000175415_03276 gene open 14222-15859 groL
6627 ACSK03000247.1 GCA000175415_03277 gene open 15767-15970
6628 ACSK03000247.1 GCA000175415_03278 gene open 16199-17227 isiA
6629 ACSK03000247.1 GCA000175415_03280 gene open 17569-18318
6630 ACSK03000247.1 GCA000175415_03281 gene open 18403-18687
6631 ACSK03000247.1 GCA000175415_03282 gene open 18968-21529
6632 ACSK03000247.1 GCA000175415_03283 gene open 21681-22778 bchI
6633 ACSK03000247.1 GCA000175415_03284 gene open 22806-23333 ruvC
6634 ACSK03000247.1 GCA000175415_03285 gene open 23350-23733
6635 ACSK03000247.1 GCA000175415_03286 gene open 23787-23987
6636 ACSK03000247.1 GCA000175415_03287 gene open 24033-24596 def
6637 ACSK03000247.1 GCA000175415_03288 gene open 25203-25529
6638 ACSK03000247.1 GCA000175415_03289 gene open 25530-25982
6639 ACSK03000247.1 GCA000175415_03290 gene open 26187-26810 estA
6640 ACSK03000247.1 GCA000175415_03291 gene open 26817-27614
6641 ACSK03000247.1 GCA000175415_03292 gene open 27678-28502 surA
6642 ACSK03000247.1 GCA000175415_03293 gene open 28504-30162
6643 ACSK03000247.1 GCA000175415_03294 gene open 30530-30880 psb28
6644 ACSK03000247.1 GCA000175415_03295 gene open 30961-32232
6645 ACSK03000247.1 GCA000175415_03296 gene open 32264-32692 yjhB
6646 ACSK03000247.1 GCA000175415_03297 gene open 32731-33189 pro1025
6647 ACSK03000247.1 GCA000175415_03298 gene open 33322-34320
6648 ACSK03000247.1 GCA000175415_03299 gene open 34458-35126 ecfA2
6649 ACSK03000247.1 GCA000175415_03300 gene open 35123-35887 rsmG
6650 ACSK03000247.1 GCA000175415_03301 gene open 36372-36758 aroH
6651 ACSK03000247.1 GCA000175415_03302 gene open 36851-37672 sppA
6652 ACSK03000247.1 GCA000175415_03303 gene open 38037-39080 rhaT
6653 ACSK03000247.1 GCA000175415_03304 gene open 39119-40939 treZ
6654 ACSK03000247.1 GCA000175415_03305 gene open 40991-43801 treY
6655 ACSK03000247.1 GCA000175415_03306 gene open 43806-44537 radC
6656 ACSK03000247.1 GCA000175415_03307 gene open 44744-46738
6657 ACSK03000247.1 GCA000175415_03308 gene open 47244-48506 rfaB
6658 ACSK03000247.1 GCA000175415_03309 gene open 48525-50117
6659 ACSK03000247.1 GCA000175415_03310 gene open 50071-50229
6660 ACSK03000247.1 GCA000175415_03311 gene open 50253-50960
6661 ACSK03000247.1 GCA000175415_03312 gene open 51041-51625 ssuE
6662 ACSK03000247.1 GCA000175415_03313 gene open 51632-52369 yhaK
6663 ACSK03000247.1 GCA000175415_03314 gene open 54217-55797 nuoN
6664 ACSK03000247.1 GCA000175415_03315 gene open 55892-56857 cmoB
6665 ACSK03000247.1 GCA000175415_03316 gene open 56917-57672 cmoA
6666 ACSK03000247.1 GCA000175415_03317 gene open 57833-58435 rhtB
6667 ACSK03000247.1 GCA000175415_03318 gene open 58406-59116
6668 ACSK03000247.1 GCA000175415_03319 gene open 59136-59846 trmN6
6669 ACSK03000247.1 GCA000175415_03320 gene open 59855-61015 rlhA
6670 ACSK03000247.1 GCA000175415_03321 gene open 61030-62280 rlhA
6671 ACSK03000247.1 GCA000175415_03322 gene open 62295-63587
6672 ACSK03000247.1 GCA000175415_03323 gene open 63639-64322 fabG
6673 ACSK03000247.1 GCA000175415_03324 gene open 64367-65545 bioF
6674 ACSK03000247.1 GCA000175415_03325 gene open 65558-65788
6675 ACSK03000247.1 GCA000175415_03326 gene open 65779-66654
6676 ACSK03000247.1 GCA000175415_03327 gene open 66771-68000 degQ
6677 ACSK03000247.1 GCA000175415_03328 gene open 68034-68303
6678 ACSK03000247.1 GCA000175415_03329 gene open 68328-69308 dnaJ
6679 ACSK03000247.1 GCA000175415_03330 gene open 69501-69941 ibpA
6680 ACSK03000247.1 GCA000175415_03331 gene open 70245-70451
6681 ACSK03000247.1 GCA000175415_03332 gene open 70540-70938 msrB
6682 ACSK03000247.1 GCA000175415_03333 gene open 70997-71425 ndhV
6683 ACSK03000247.1 GCA000175415_03334 gene open 71876-73480 nhaP
6684 ACSK03000247.1 GCA000175415_03335 gene open 73537-74424
6685 ACSK03000247.1 GCA000175415_03336 gene open 74459-74998
6686 ACSK03000247.1 GCA000175415_03337 gene open 75161-76552 sfcA
6687 ACSK03000247.1 GCA000175415_03338 gene open 76771-77304 cysC
6688 ACSK03000247.1 GCA000175415_03339 gene open 77491-78012 hpt1
6689 ACSK03000248.1 GCA000175415_03398 gene open 43149-43435 5_ureB_sRNA
6690 ACSK03000248.1 GCA000175415_03418 gene open 68083-68148 Yfr1
6691 ACSK03000248.1 GCA000175415_03398 ncRNA open 43149-43435 5' ureB small RNA
6692 ACSK03000248.1 GCA000175415_03418 ncRNA open 68083-68148 Cyanobacterial functional RNA 1
6693 ACSK03000248.1 GCA000175415_03340 CDS open 29-1288 _na     419_aa hypothetical protein
6694 ACSK03000248.1 GCA000175415_03341 CDS open 1291-1731 _na     146_aa hypothetical protein
6695 ACSK03000248.1 GCA000175415_03342 CDS open 1736-2710 _na     324_aa hypothetical protein
6696 ACSK03000248.1 GCA000175415_03343 CDS open 2738-3937 _na     399_aa hypothetical protein
6697 ACSK03000248.1 GCA000175415_03344 CDS open 4084-4452 _na     122_aa hypothetical protein
6698 ACSK03000248.1 GCA000175415_03345 CDS open 4474-4827 _na     117_aa hypothetical protein
6699 ACSK03000248.1 GCA000175415_03346 CDS open 4831-5250 _na     139_aa hypothetical protein
6700 ACSK03000248.1 GCA000175415_03347 CDS open 5252-5401 _na     49_aa hypothetical protein
6701 ACSK03000248.1 GCA000175415_03348 CDS open 5694-5975 _na     93_aa hypothetical protein
6702 ACSK03000248.1 GCA000175415_03349 CDS open 5965-6201 _na     78_aa hypothetical protein
6703 ACSK03000248.1 GCA000175415_03350 CDS open 6584-7090 _na     168_aa IS630 family transposase
6704 ACSK03000248.1 GCA000175415_03351 CDS open 7047-7343 _na     98_aa Transposase
6705 ACSK03000248.1 GCA000175415_03352 CDS open 8563-9069 _na     168_aa IS630 family transposase
6706 ACSK03000248.1 GCA000175415_03353 CDS open 9026-9385 _na     119_aa Putative transposase
6707 ACSK03000248.1 GCA000175415_03354 CDS open 10673-10834 _na     53_aa hypothetical protein
6708 ACSK03000248.1 GCA000175415_03355 CDS open 10921-11832 _na     303_aa phnP Beta-lactamase-like protein%2C hydrolase
6709 ACSK03000248.1 GCA000175415_03356 CDS open 11847-12386 _na     179_aa Diheme cytochrome c
6710 ACSK03000248.1 GCA000175415_03357 CDS open 12394-14037 _na     547_aa GTPase
6711 ACSK03000248.1 GCA000175415_03358 CDS open 14388-15554 _na     388_aa aspB pyridoxal phosphate-dependent aminotransferase
6712 ACSK03000248.1 GCA000175415_03359 CDS open 15585-16586 _na     333_aa ldcA LD-carboxypeptidase A
6713 ACSK03000248.1 GCA000175415_03360 CDS open 16588-17478 _na     296_aa yHI9 Phenazine biosynthesis protein PhzF family
6714 ACSK03000248.1 GCA000175415_03361 CDS open 17483-19027 _na     514_aa trpE anthranilate synthase component I
6715 ACSK03000248.1 GCA000175415_03362 CDS open 19231-19659 _na     142_aa psaD Photosystem I reaction center subunit II
6716 ACSK03000248.1 GCA000175415_03363 CDS open 19957-21360 _na     467_aa recombinase
6717 ACSK03000248.1 GCA000175415_03364 CDS open 22340-22666 _na     108_aa hypothetical protein
6718 ACSK03000248.1 GCA000175415_03365 CDS open 22659-22940 _na     93_aa hypothetical protein
6719 ACSK03000248.1 GCA000175415_03366 CDS open 22959-23237 _na     92_aa hypothetical protein
6720 ACSK03000248.1 GCA000175415_03367 CDS open 23300-23524 _na     74_aa hypothetical protein
6721 ACSK03000248.1 GCA000175415_03368 CDS open 23537-24115 _na     192_aa hypothetical protein
6722 ACSK03000248.1 GCA000175415_03369 CDS open 24112-24732 _na     206_aa hypothetical protein
6723 ACSK03000248.1 GCA000175415_03370 CDS open 24818-25207 _na     129_aa hypothetical protein
6724 ACSK03000248.1 GCA000175415_03371 CDS open 25430-25534 _na     34_aa hypothetical protein
6725 ACSK03000248.1 GCA000175415_03372 CDS open 25497-25862 _na     121_aa hypothetical protein
6726 ACSK03000248.1 GCA000175415_03373 CDS open 26077-26259 _na     60_aa DUF1064 domain-containing protein
6727 ACSK03000248.1 GCA000175415_03374 CDS open 26249-26602 _na     117_aa faxG Protein faxG fax element
6728 ACSK03000248.1 GCA000175415_03375 CDS open 26715-27179 _na     154_aa hypothetical protein
6729 ACSK03000248.1 GCA000175415_03376 CDS open 27373-28014 _na     213_aa hypothetical protein
6730 ACSK03000248.1 GCA000175415_03377 CDS open 28095-28340 _na     81_aa hypothetical protein
6731 ACSK03000248.1 GCA000175415_03378 CDS open 28459-30156 _na     565_aa hypothetical protein
6732 ACSK03000248.1 GCA000175415_03379 CDS open 30156-31973 _na     605_aa hypothetical protein
6733 ACSK03000248.1 GCA000175415_03380 CDS open 32040-32300 _na     86_aa hypothetical protein
6734 ACSK03000248.1 GCA000175415_03381 CDS open 32264-32833 _na     189_aa hypothetical protein
6735 ACSK03000248.1 GCA000175415_03382 CDS open 32860-33207 _na     115_aa hypothetical protein
6736 ACSK03000248.1 GCA000175415_03383 CDS open 33274-34500 _na     408_aa hypothetical protein
6737 ACSK03000248.1 GCA000175415_03384 CDS open 34657-35214 _na     185_aa hypothetical protein
6738 ACSK03000248.1 GCA000175415_03386 CDS open 35625-36365 _na     246_aa ydcF YdcF family protein
6739 ACSK03000248.1 GCA000175415_03387 CDS open 36394-36801 _na     135_aa DUF4168 domain-containing protein
6740 ACSK03000248.1 GCA000175415_03388 CDS open 36851-37666 _na     271_aa calcium-binding protein
6741 ACSK03000248.1 GCA000175415_03389 CDS open 37703-37837 _na     44_aa hypothetical protein
6742 ACSK03000248.1 GCA000175415_03390 CDS open 38252-38506 _na     84_aa hypothetical protein
6743 ACSK03000248.1 GCA000175415_03391 CDS open 38633-39742 _na     369_aa SAM-dependent methyltransferase
6744 ACSK03000248.1 GCA000175415_03392 CDS open 39923-40309 _na     128_aa DUF3110 domain-containing protein
6745 ACSK03000248.1 GCA000175415_03393 CDS open 40342-41268 _na     308_aa murQ N-acetylmuramic acid 6-phosphate etherase
6746 ACSK03000248.1 GCA000175415_03394 CDS open 41372-42214 _na     280_aa ureD Urease accessory protein UreD
6747 ACSK03000248.1 GCA000175415_03395 CDS open 42242-42544 _na     100_aa ureA urease subunit gamma
6748 ACSK03000248.1 GCA000175415_03396 CDS open 42567-42929 _na     120_aa ureB urease subunit beta
6749 ACSK03000248.1 GCA000175415_03397 CDS open 42994-44712 _na     572_aa ureC urease subunit alpha
6750 ACSK03000248.1 GCA000175415_03399 CDS open 44765-45223 _na     152_aa Diguanylate cyclase
6751 ACSK03000248.1 GCA000175415_03400 CDS open 45496-46509 _na     337_aa histidine kinase
6752 ACSK03000248.1 GCA000175415_03401 CDS open 46602-46931 _na     109_aa histidine kinase
6753 ACSK03000248.1 GCA000175415_03402 CDS open 46969-47262 _na     97_aa Phytochrome chromophore attachment site domain-containing protein
6754 ACSK03000248.1 GCA000175415_03403 CDS open 47667-48887 _na     406_aa digH Glycosyl hydrolase-like 10 domain-containing protein
6755 ACSK03000248.1 GCA000175415_03404 CDS open 49284-50489 _na     401_aa transporter substrate-binding domain-containing protein
6756 ACSK03000248.1 GCA000175415_03405 CDS open 50512-51843 _na     443_aa gltP Sodium:dicarboxylate symporter
6757 ACSK03000248.1 GCA000175415_03406 CDS open 51851-52639 _na     262_aa racX Aspartate racemase
6758 ACSK03000248.1 GCA000175415_03407 CDS open 52669-55941 _na     1090_aa hypothetical protein
6759 ACSK03000248.1 GCA000175415_03408 CDS open 55984-58236 _na     750_aa WD-40 repeat protein
6760 ACSK03000248.1 GCA000175415_03409 CDS open 58316-59698 _na     460_aa cache domain-containing protein
6761 ACSK03000248.1 GCA000175415_03410 CDS open 59725-61089 _na     454_aa DUF4159 domain-containing protein
6762 ACSK03000248.1 GCA000175415_03411 CDS open 61086-62183 _na     365_aa phage tail protein
6763 ACSK03000248.1 GCA000175415_03412 CDS open 62312-64510 _na     732_aa putative baseplate assembly protein
6764 ACSK03000248.1 GCA000175415_03413 CDS open 64517-64927 _na     136_aa GPW/gp25 family protein
6765 ACSK03000248.1 GCA000175415_03414 CDS open 64986-65117 _na     43_aa hypothetical protein
6766 ACSK03000248.1 GCA000175415_03415 CDS open 65235-66140 _na     301_aa phuW Haem-binding uptake Tiki superfamily ChaN domain-containing protein
6767 ACSK03000248.1 GCA000175415_03416 CDS open 66385-66561 _na     58_aa hypothetical protein
6768 ACSK03000248.1 GCA000175415_03417 CDS open 66779-67963 _na     394_aa lldD GuaB3 family IMP dehydrogenase-related protein
6769 ACSK03000248.1 GCA000175415_03419 CDS open 68330-68653 _na     107_aa trxA thioredoxin
6770 ACSK03000248.1 GCA000175415_03420 CDS open 69028-70095 _na     355_aa ppnN LOG family protein
6771 ACSK03000248.1 GCA000175415_03421 CDS open 70116-70799 _na     227_aa rppA two-component system response regulator RppA
6772 ACSK03000248.1 GCA000175415_03422 CDS open 71050-71694 _na     214_aa hisG ATP phosphoribosyltransferase
6773 ACSK03000248.1 GCA000175415_03423 CDS open 72031-72996 _na     321_aa Nuclease
6774 ACSK03000248.1 GCA000175415_03424 CDS open 73180-75018 _na     612_aa amiC N-acetylmuramoyl-L-alanine amidase
6775 ACSK03000248.1 GCA000175415_03425 CDS open 75425-75691 _na     88_aa hypothetical protein
6776 ACSK03000248.1 GCA000175415_03426 CDS open 75594-77042 _na     482_aa cobJ Precorrin-3B C17-methyltransferase
6777 ACSK03000248.1 GCA000175415_03427 CDS open 77074-77778 _na     234_aa cobI precorrin-2 C(20)-methyltransferase
6778 ACSK03000248.1 GCA000175415_03428 CDS open 77775-78404 _na     209_aa cobH precorrin-8X methylmutase
6779 ACSK03000248.1 GCA000175415_03429 CDS open 78430-79836 _na     468_aa cobG precorrin-3B synthase
6780 ACSK03000248.1 GCA000175415_03340 gene open 29-1288
6781 ACSK03000248.1 GCA000175415_03341 gene open 1291-1731
6782 ACSK03000248.1 GCA000175415_03342 gene open 1736-2710
6783 ACSK03000248.1 GCA000175415_03343 gene open 2738-3937
6784 ACSK03000248.1 GCA000175415_03344 gene open 4084-4452
6785 ACSK03000248.1 GCA000175415_03345 gene open 4474-4827
6786 ACSK03000248.1 GCA000175415_03346 gene open 4831-5250
6787 ACSK03000248.1 GCA000175415_03347 gene open 5252-5401
6788 ACSK03000248.1 GCA000175415_03348 gene open 5694-5975
6789 ACSK03000248.1 GCA000175415_03349 gene open 5965-6201
6790 ACSK03000248.1 GCA000175415_03350 gene open 6584-7090
6791 ACSK03000248.1 GCA000175415_03351 gene open 7047-7343
6792 ACSK03000248.1 GCA000175415_03352 gene open 8563-9069
6793 ACSK03000248.1 GCA000175415_03353 gene open 9026-9385
6794 ACSK03000248.1 GCA000175415_03354 gene open 10673-10834
6795 ACSK03000248.1 GCA000175415_03355 gene open 10921-11832 phnP
6796 ACSK03000248.1 GCA000175415_03356 gene open 11847-12386
6797 ACSK03000248.1 GCA000175415_03357 gene open 12394-14037
6798 ACSK03000248.1 GCA000175415_03358 gene open 14388-15554 aspB
6799 ACSK03000248.1 GCA000175415_03359 gene open 15585-16586 ldcA
6800 ACSK03000248.1 GCA000175415_03360 gene open 16588-17478 yHI9
6801 ACSK03000248.1 GCA000175415_03361 gene open 17483-19027 trpE
6802 ACSK03000248.1 GCA000175415_03362 gene open 19231-19659 psaD
6803 ACSK03000248.1 GCA000175415_03363 gene open 19957-21360
6804 ACSK03000248.1 GCA000175415_03364 gene open 22340-22666
6805 ACSK03000248.1 GCA000175415_03365 gene open 22659-22940
6806 ACSK03000248.1 GCA000175415_03366 gene open 22959-23237
6807 ACSK03000248.1 GCA000175415_03367 gene open 23300-23524
6808 ACSK03000248.1 GCA000175415_03368 gene open 23537-24115
6809 ACSK03000248.1 GCA000175415_03369 gene open 24112-24732
6810 ACSK03000248.1 GCA000175415_03370 gene open 24818-25207
6811 ACSK03000248.1 GCA000175415_03371 gene open 25430-25534
6812 ACSK03000248.1 GCA000175415_03372 gene open 25497-25862
6813 ACSK03000248.1 GCA000175415_03373 gene open 26077-26259
6814 ACSK03000248.1 GCA000175415_03374 gene open 26249-26602 faxG
6815 ACSK03000248.1 GCA000175415_03375 gene open 26715-27179
6816 ACSK03000248.1 GCA000175415_03376 gene open 27373-28014
6817 ACSK03000248.1 GCA000175415_03377 gene open 28095-28340
6818 ACSK03000248.1 GCA000175415_03378 gene open 28459-30156
6819 ACSK03000248.1 GCA000175415_03379 gene open 30156-31973
6820 ACSK03000248.1 GCA000175415_03380 gene open 32040-32300
6821 ACSK03000248.1 GCA000175415_03381 gene open 32264-32833
6822 ACSK03000248.1 GCA000175415_03382 gene open 32860-33207
6823 ACSK03000248.1 GCA000175415_03383 gene open 33274-34500
6824 ACSK03000248.1 GCA000175415_03384 gene open 34657-35214
6825 ACSK03000248.1 GCA000175415_03386 gene open 35625-36365 ydcF
6826 ACSK03000248.1 GCA000175415_03387 gene open 36394-36801
6827 ACSK03000248.1 GCA000175415_03388 gene open 36851-37666
6828 ACSK03000248.1 GCA000175415_03389 gene open 37703-37837
6829 ACSK03000248.1 GCA000175415_03390 gene open 38252-38506
6830 ACSK03000248.1 GCA000175415_03391 gene open 38633-39742
6831 ACSK03000248.1 GCA000175415_03392 gene open 39923-40309
6832 ACSK03000248.1 GCA000175415_03393 gene open 40342-41268 murQ
6833 ACSK03000248.1 GCA000175415_03394 gene open 41372-42214 ureD
6834 ACSK03000248.1 GCA000175415_03395 gene open 42242-42544 ureA
6835 ACSK03000248.1 GCA000175415_03396 gene open 42567-42929 ureB
6836 ACSK03000248.1 GCA000175415_03397 gene open 42994-44712 ureC
6837 ACSK03000248.1 GCA000175415_03399 gene open 44765-45223
6838 ACSK03000248.1 GCA000175415_03400 gene open 45496-46509
6839 ACSK03000248.1 GCA000175415_03401 gene open 46602-46931
6840 ACSK03000248.1 GCA000175415_03402 gene open 46969-47262
6841 ACSK03000248.1 GCA000175415_03403 gene open 47667-48887 digH
6842 ACSK03000248.1 GCA000175415_03404 gene open 49284-50489
6843 ACSK03000248.1 GCA000175415_03405 gene open 50512-51843 gltP
6844 ACSK03000248.1 GCA000175415_03406 gene open 51851-52639 racX
6845 ACSK03000248.1 GCA000175415_03407 gene open 52669-55941
6846 ACSK03000248.1 GCA000175415_03408 gene open 55984-58236
6847 ACSK03000248.1 GCA000175415_03409 gene open 58316-59698
6848 ACSK03000248.1 GCA000175415_03410 gene open 59725-61089
6849 ACSK03000248.1 GCA000175415_03411 gene open 61086-62183
6850 ACSK03000248.1 GCA000175415_03412 gene open 62312-64510
6851 ACSK03000248.1 GCA000175415_03413 gene open 64517-64927
6852 ACSK03000248.1 GCA000175415_03414 gene open 64986-65117
6853 ACSK03000248.1 GCA000175415_03415 gene open 65235-66140 phuW
6854 ACSK03000248.1 GCA000175415_03416 gene open 66385-66561
6855 ACSK03000248.1 GCA000175415_03417 gene open 66779-67963 lldD
6856 ACSK03000248.1 GCA000175415_03419 gene open 68330-68653 trxA
6857 ACSK03000248.1 GCA000175415_03420 gene open 69028-70095 ppnN
6858 ACSK03000248.1 GCA000175415_03421 gene open 70116-70799 rppA
6859 ACSK03000248.1 GCA000175415_03422 gene open 71050-71694 hisG
6860 ACSK03000248.1 GCA000175415_03423 gene open 72031-72996
6861 ACSK03000248.1 GCA000175415_03424 gene open 73180-75018 amiC
6862 ACSK03000248.1 GCA000175415_03425 gene open 75425-75691
6863 ACSK03000248.1 GCA000175415_03426 gene open 75594-77042 cobJ
6864 ACSK03000248.1 GCA000175415_03427 gene open 77074-77778 cobI
6865 ACSK03000248.1 GCA000175415_03428 gene open 77775-78404 cobH
6866 ACSK03000248.1 GCA000175415_03429 gene open 78430-79836 cobG
6867 ACSK03000248.1 GCA000175415_03385 gene open 35405-35492 trnS
6868 ACSK03000248.1 GCA000175415_03385 tRNA open 35405-35492 trnS tRNA-Ser(cga)
6869 ACSK03000249.1 repeat_region open 12007-12417 CRISPR array with 6 repeats of length 35%2C consensus sequence GTTTCCATACGTTTAACTTTCAAAGAAGTTTAAAG and spacer length 38
6870 ACSK03000249.1 repeat_region open 17641-18568 CRISPR array with 13 repeats of length 35%2C consensus sequence GTTTCCATACGTTTAACTTTCAGAGAAGTCTAAAG and spacer length 38
6871 ACSK03000249.1 GCA000175415_03430 CDS open 1580-1999 _na     139_aa DUF4359 domain-containing protein
6872 ACSK03000249.1 GCA000175415_03431 CDS open 2132-2737 _na     201_aa mcrA HNH endonuclease
6873 ACSK03000249.1 GCA000175415_03432 CDS open 2755-3039 _na     94_aa hypothetical protein
6874 ACSK03000249.1 GCA000175415_03433 CDS open 3178-4107 _na     309_aa csa3 IS630 family transposase
6875 ACSK03000249.1 GCA000175415_03434 CDS open 4159-4836 _na     225_aa hypothetical protein
6876 ACSK03000249.1 GCA000175415_03435 CDS open 5906-6136 _na     76_aa reverse transcriptase domain-containing protein
6877 ACSK03000249.1 GCA000175415_03436 CDS open 6126-7298 _na     390_aa reverse transcriptase domain-containing protein
6878 ACSK03000249.1 GCA000175415_03437 CDS open 7648-8811 _na     387_aa Coiled-coil protein
6879 ACSK03000249.1 GCA000175415_03438 CDS open 8892-9278 _na     128_aa hypothetical protein
6880 ACSK03000249.1 GCA000175415_03439 CDS open 9734-9910 _na     58_aa hypothetical protein
6881 ACSK03000249.1 GCA000175415_03440 CDS open 9937-10359 _na     140_aa pentapeptide repeat-containing protein
6882 ACSK03000249.1 GCA000175415_03441 CDS open 10641-11156 _na     171_aa tetratricopeptide repeat protein
6883 ACSK03000249.1 GCA000175415_03442 CDS open 11188-11823 _na     211_aa hypothetical protein
6884 ACSK03000249.1 GCA000175415_03443 CDS open 12609-14351 _na     580_aa cas1 CRISPR-associated endonuclease Cas1
6885 ACSK03000249.1 GCA000175415_03444 CDS open 14463-14615 _na     50_aa hypothetical protein
6886 ACSK03000249.1 GCA000175415_03445 CDS open 14795-15691 _na     298_aa cas1 CRISPR-associated endonuclease Cas1
6887 ACSK03000249.1 GCA000175415_03446 CDS open 15688-15969 _na     93_aa cas2 CRISPR-associated endonuclease Cas2
6888 ACSK03000249.1 GCA000175415_03447 CDS open 16018-16278 _na     86_aa Plasmid maintenance system killer
6889 ACSK03000249.1 GCA000175415_03448 CDS open 16298-16900 _na     200_aa DUF1822 domain-containing protein
6890 ACSK03000249.1 GCA000175415_03449 CDS open 16893-17192 _na     99_aa sigma-70 region 4 domain-containing protein
6891 ACSK03000249.1 GCA000175415_03450 CDS open 17271-17453 _na     60_aa SPOR domain-containing protein
6892 ACSK03000249.1 GCA000175415_03451 CDS open 18815-19105 _na     96_aa hypothetical protein
6893 ACSK03000249.1 GCA000175415_03452 CDS open 19212-19931 _na     239_aa hypothetical protein
6894 ACSK03000249.1 GCA000175415_03453 CDS open 20004-20582 _na     192_aa hypothetical protein
6895 ACSK03000249.1 GCA000175415_03454 CDS open 20663-20797 _na     44_aa hypothetical protein
6896 ACSK03000249.1 GCA000175415_03455 CDS open 20833-21477 _na     214_aa Restriction endonuclease subunit R
6897 ACSK03000249.1 GCA000175415_03456 CDS open 21866-22828 _na     320_aa RAMP superfamily
6898 ACSK03000249.1 GCA000175415_03457 CDS open 22852-23508 _na     218_aa RAMP superfamily CRISPR-associated protein
6899 ACSK03000249.1 GCA000175415_03458 CDS open 23513-23908 _na     131_aa CRISPR type III-B/RAMP module-associated protein Cmr5
6900 ACSK03000249.1 GCA000175415_03459 CDS open 23924-24673 _na     249_aa cmr4 type III-B CRISPR module RAMP protein Cmr4
6901 ACSK03000249.1 GCA000175415_03460 CDS open 24822-25046 _na     74_aa cmr4 CRISPR-associated RAMP protein%2C Cmr4 family
6902 ACSK03000249.1 GCA000175415_03461 CDS open 25043-26206 _na     387_aa CRISPR-associated protein Cmr3
6903 ACSK03000249.1 GCA000175415_03462 CDS open 26207-27928 _na     573_aa Crm2 family CRISPR-associated protein
6904 ACSK03000249.1 GCA000175415_03463 CDS open 28070-29536 _na     488_aa type III-B CRISPR-associated protein Cas10/Cmr2
6905 ACSK03000249.1 GCA000175415_03464 CDS open 29511-30029 _na     172_aa IS1 transposase
6906 ACSK03000249.1 GCA000175415_03465 CDS open 30224-30574 _na     116_aa relaxase/mobilization nuclease domain-containing protein
6907 ACSK03000249.1 GCA000175415_03466 CDS open 30615-31214 _na     199_aa Recombinase
6908 ACSK03000249.1 GCA000175415_03467 CDS open 31973-32407 _na     144_aa reverse transcriptase N-terminal domain-containing protein
6909 ACSK03000249.1 GCA000175415_03468 CDS open 32346-32576 _na     76_aa reverse transcriptase domain-containing protein
6910 ACSK03000249.1 GCA000175415_03469 CDS open 32566-33741 _na     391_aa RNA-dependent DNA polymerase
6911 ACSK03000249.1 GCA000175415_03470 CDS open 33812-34174 _na     120_aa hypothetical protein
6912 ACSK03000249.1 GCA000175415_03471 CDS open 34205-34447 _na     80_aa Transposase
6913 ACSK03000249.1 GCA000175415_03472 CDS open 34807-35439 _na     210_aa Transposase
6914 ACSK03000249.1 GCA000175415_03473 CDS open 36371-36586 _na     71_aa ndhL NAD(P)H-quinone oxidoreductase subunit L
6915 ACSK03000249.1 GCA000175415_03474 CDS open 36586-36939 _na     117_aa ccr2 DUF3007 domain-containing protein
6916 ACSK03000249.1 GCA000175415_03475 CDS open 36970-37791 _na     273_aa trpA tryptophan synthase subunit alpha
6917 ACSK03000249.1 GCA000175415_03476 CDS open 38531-39544 _na     337_aa pdxI Aldo/keto reductase
6918 ACSK03000249.1 GCA000175415_03477 CDS open 39546-40196 _na     216_aa hypothetical protein
6919 ACSK03000249.1 GCA000175415_03478 CDS open 40413-40733 _na     106_aa Transposase (putative) YhgA-like domain-containing protein
6920 ACSK03000249.1 GCA000175415_03479 CDS open 40811-41350 _na     179_aa Nuclease subunit of the excinuclease complex
6921 ACSK03000249.1 GCA000175415_03480 CDS open 41569-41748 _na     59_aa hypothetical protein
6922 ACSK03000249.1 GCA000175415_03481 CDS open 41699-44227 _na     842_aa Dynamin N-terminal domain-containing protein
6923 ACSK03000249.1 GCA000175415_03482 CDS open 44320-44562 _na     80_aa mcrA HNH endonuclease
6924 ACSK03000249.1 GCA000175415_03483 CDS open 44635-45123 _na     162_aa cobalamin biosynthesis protein
6925 ACSK03000249.1 GCA000175415_03484 CDS open 45152-46210 _na     352_aa cysK cysteine synthase A
6926 ACSK03000249.1 GCA000175415_03485 CDS open 46241-46879 _na     212_aa ahpC peroxiredoxin
6927 ACSK03000249.1 GCA000175415_03486 CDS open 47014-48222 _na     402_aa ispH 4-hydroxy-3-methylbut-2-enyl diphosphate reductase
6928 ACSK03000249.1 GCA000175415_03487 CDS open 48358-50343 _na     661_aa htpG molecular chaperone HtpG
6929 ACSK03000249.1 GCA000175415_03488 CDS open 50462-50626 _na     54_aa hypothetical protein
6930 ACSK03000249.1 GCA000175415_03489 CDS open 50640-51623 _na     327_aa Glycosyl transferase family 2
6931 ACSK03000249.1 GCA000175415_03490 CDS open 51625-52617 _na     330_aa hpsE hormogonium polysaccharide biosynthesis glycosyltransferase HpsE
6932 ACSK03000249.1 GCA000175415_03491 CDS open 52761-53762 _na     333_aa hpsE hormogonium polysaccharide biosynthesis glycosyltransferase HpsE
6933 ACSK03000249.1 GCA000175415_03492 CDS open 53867-56653 _na     928_aa clpB ATP-dependent chaperone ClpB
6934 ACSK03000249.1 GCA000175415_03493 CDS open 56806-57234 _na     142_aa gloA lactoylglutathione lyase
6935 ACSK03000249.1 GCA000175415_03494 CDS open 58151-61330 _na     1059_aa T9SS type A sorting domain-containing protein
6936 ACSK03000249.1 GCA000175415_03495 CDS open 61648-62223 _na     191_aa hypothetical protein
6937 ACSK03000249.1 GCA000175415_03496 CDS open 62737-63924 _na     395_aa fmdA formamidase
6938 ACSK03000249.1 GCA000175415_03497 CDS open 63993-64265 _na     90_aa Regulatory protein%2C FmdB-like
6939 ACSK03000249.1 GCA000175415_03498 CDS open 64342-64584 _na     80_aa TIGR02450 family Trp-rich protein
6940 ACSK03000249.1 GCA000175415_03499 CDS open 64588-65175 _na     195_aa hypothetical protein
6941 ACSK03000249.1 GCA000175415_03500 CDS open 65212-66417 _na     401_aa abgB N-acyl-L-amino acid amidohydrolase (L-aminoacylase)
6942 ACSK03000249.1 GCA000175415_03501 CDS open 66446-67453 _na     335_aa hypothetical protein
6943 ACSK03000249.1 GCA000175415_03502 CDS open 68321-68575 _na     84_aa hypothetical protein
6944 ACSK03000249.1 GCA000175415_03503 CDS open 68576-68932 _na     118_aa hypothetical protein
6945 ACSK03000249.1 GCA000175415_03504 CDS open 68944-69660 _na     238_aa tail fiber domain-containing protein
6946 ACSK03000249.1 GCA000175415_03505 CDS open 69834-71039 _na     401_aa hypothetical protein
6947 ACSK03000249.1 GCA000175415_03506 CDS open 71106-71453 _na     115_aa hypothetical protein
6948 ACSK03000249.1 GCA000175415_03507 CDS open 71480-72277 _na     265_aa hypothetical protein
6949 ACSK03000249.1 GCA000175415_03508 CDS open 72341-73576 _na     411_aa hypothetical protein
6950 ACSK03000249.1 GCA000175415_03509 CDS open 73569-73751 _na     60_aa hypothetical protein
6951 ACSK03000249.1 GCA000175415_03510 CDS open 73964-74329 _na     121_aa hypothetical protein
6952 ACSK03000249.1 GCA000175415_03511 CDS open 74292-74396 _na     34_aa hypothetical protein
6953 ACSK03000249.1 GCA000175415_03512 CDS open 74619-75008 _na     129_aa hypothetical protein
6954 ACSK03000249.1 GCA000175415_03513 CDS open 75094-75714 _na     206_aa hypothetical protein
6955 ACSK03000249.1 GCA000175415_03514 CDS open 75711-76289 _na     192_aa hypothetical protein
6956 ACSK03000249.1 GCA000175415_03515 CDS open 76302-76523 _na     73_aa hypothetical protein
6957 ACSK03000249.1 GCA000175415_03516 CDS open 76586-76864 _na     92_aa hypothetical protein
6958 ACSK03000249.1 GCA000175415_03517 CDS open 76883-77167 _na     94_aa hypothetical protein
6959 ACSK03000249.1 GCA000175415_03518 CDS open 77160-77480 _na     106_aa hypothetical protein
6960 ACSK03000249.1 GCA000175415_03519 CDS open 78904-80361 _na     485_aa Recombinase
6961 ACSK03000249.1 GCA000175415_03520 CDS open 80432-80737 _na     101_aa hypothetical protein
6962 ACSK03000249.1 GCA000175415_03430 gene open 1580-1999
6963 ACSK03000249.1 GCA000175415_03431 gene open 2132-2737 mcrA
6964 ACSK03000249.1 GCA000175415_03432 gene open 2755-3039
6965 ACSK03000249.1 GCA000175415_03433 gene open 3178-4107 csa3
6966 ACSK03000249.1 GCA000175415_03434 gene open 4159-4836
6967 ACSK03000249.1 GCA000175415_03435 gene open 5906-6136
6968 ACSK03000249.1 GCA000175415_03436 gene open 6126-7298
6969 ACSK03000249.1 GCA000175415_03437 gene open 7648-8811
6970 ACSK03000249.1 GCA000175415_03438 gene open 8892-9278
6971 ACSK03000249.1 GCA000175415_03439 gene open 9734-9910
6972 ACSK03000249.1 GCA000175415_03440 gene open 9937-10359
6973 ACSK03000249.1 GCA000175415_03441 gene open 10641-11156
6974 ACSK03000249.1 GCA000175415_03442 gene open 11188-11823
6975 ACSK03000249.1 GCA000175415_03443 gene open 12609-14351 cas1
6976 ACSK03000249.1 GCA000175415_03444 gene open 14463-14615
6977 ACSK03000249.1 GCA000175415_03445 gene open 14795-15691 cas1
6978 ACSK03000249.1 GCA000175415_03446 gene open 15688-15969 cas2
6979 ACSK03000249.1 GCA000175415_03447 gene open 16018-16278
6980 ACSK03000249.1 GCA000175415_03448 gene open 16298-16900
6981 ACSK03000249.1 GCA000175415_03449 gene open 16893-17192
6982 ACSK03000249.1 GCA000175415_03450 gene open 17271-17453
6983 ACSK03000249.1 GCA000175415_03451 gene open 18815-19105
6984 ACSK03000249.1 GCA000175415_03452 gene open 19212-19931
6985 ACSK03000249.1 GCA000175415_03453 gene open 20004-20582
6986 ACSK03000249.1 GCA000175415_03454 gene open 20663-20797
6987 ACSK03000249.1 GCA000175415_03455 gene open 20833-21477
6988 ACSK03000249.1 GCA000175415_03456 gene open 21866-22828
6989 ACSK03000249.1 GCA000175415_03457 gene open 22852-23508
6990 ACSK03000249.1 GCA000175415_03458 gene open 23513-23908
6991 ACSK03000249.1 GCA000175415_03459 gene open 23924-24673 cmr4
6992 ACSK03000249.1 GCA000175415_03460 gene open 24822-25046 cmr4
6993 ACSK03000249.1 GCA000175415_03461 gene open 25043-26206
6994 ACSK03000249.1 GCA000175415_03462 gene open 26207-27928
6995 ACSK03000249.1 GCA000175415_03463 gene open 28070-29536
6996 ACSK03000249.1 GCA000175415_03464 gene open 29511-30029
6997 ACSK03000249.1 GCA000175415_03465 gene open 30224-30574
6998 ACSK03000249.1 GCA000175415_03466 gene open 30615-31214
6999 ACSK03000249.1 GCA000175415_03467 gene open 31973-32407
7000 ACSK03000249.1 GCA000175415_03468 gene open 32346-32576