BAKTAGenome Explorer: Streptococcus mutans (GCA_000284575.1)
Select a Genome:
|
BAKTA Annotations for GCA_000284575.1
|
Search & Sort all 3938 Records
| ||||||||||||||||||
Notes: 1- Column headers only sort the current page. 2- Select [NA] or [AA] links to show sequences.
| Region | Protein-ID | Type | Genome Viewer |
Range (bp) |
Show Sequences (length) NA / AA |
BAKTA Gene |
BAKTA GeneProduct |
|
|---|---|---|---|---|---|---|---|---|
| 1 | AP012336.1 | GCA000284575_00885 | gene | open | 899210-899556 | ssrA | ||
| 2 | AP012336.1 | GCA000284575_00885 | tmRNA | open | 899210-899556 | ssrA | transfer-messenger RNA%2C SsrA | |
| 3 | AP012336.1 | GCA000284575_00015 | gene | open | 16881-18437 | rrs | ||
| 4 | AP012336.1 | GCA000284575_00017 | gene | open | 18827-21727 | rrl | ||
| 5 | AP012336.1 | GCA000284575_00018 | gene | open | 21910-22025 | rrf | ||
| 6 | AP012336.1 | GCA000284575_00201 | gene | open | 226946-228502 | rrs | ||
| 7 | AP012336.1 | GCA000284575_00203 | gene | open | 228892-231792 | rrl | ||
| 8 | AP012336.1 | GCA000284575_00204 | gene | open | 231975-232090 | rrf | ||
| 9 | AP012336.1 | GCA000284575_00378 | gene | open | 402730-404286 | rrs | ||
| 10 | AP012336.1 | GCA000284575_00380 | gene | open | 404676-407576 | rrl | ||
| 11 | AP012336.1 | GCA000284575_00381 | gene | open | 407759-407874 | rrf | ||
| 12 | AP012336.1 | GCA000284575_00412 | gene | open | 432184-432265 | skipping-rope | ||
| 13 | AP012336.1 | GCA000284575_00413 | gene | open | 432729-434285 | rrs | ||
| 14 | AP012336.1 | GCA000284575_00415 | gene | open | 434675-437575 | rrl | ||
| 15 | AP012336.1 | GCA000284575_00416 | gene | open | 437758-437873 | rrf | ||
| 16 | AP012336.1 | GCA000284575_00732 | gene | open | 751545-751635 | tracrRNA | ||
| 17 | AP012336.1 | GCA000284575_01075 | gene | open | 1101619-1101757 | asd | ||
| 18 | AP012336.1 | GCA000284575_01305 | gene | open | 1348606-1348716 | SSRC10 | ||
| 19 | AP012336.1 | GCA000284575_01550 | gene | open | 1601571-1601945 | RNaseP_bact_b | ||
| 20 | AP012336.1 | GCA000284575_01574 | gene | open | 1627226-1627361 | SpR19_sRNA | ||
| 21 | AP012336.1 | GCA000284575_01700 | gene | open | 1750779-1750876 | Bacteria_small_SRP | ||
| 22 | AP012336.1 | GCA000284575_01789 | gene | open | 1834670-1834785 | rrf | ||
| 23 | AP012336.1 | GCA000284575_01790 | gene | open | 1834968-1837868 | rrl | ||
| 24 | AP012336.1 | GCA000284575_01792 | gene | open | 1838258-1839814 | rrs | ||
| 25 | AP012336.1 | GCA000284575_01846 | gene | open | 1891380-1891573 | 6S | ||
| 26 | AP012336.1 | GCA000284575_01936 | gene | open | 1990949-1991014 | Spd-sr37 | ||
| 27 | AP012336.1 | GCA000284575_00412 | ncRNA | open | 432184-432265 | skipping-rope RNA | ||
| 28 | AP012336.1 | GCA000284575_00732 | ncRNA | open | 751545-751635 | Trans-activating crRNA | ||
| 29 | AP012336.1 | GCA000284575_01075 | ncRNA | open | 1101619-1101757 | MarS sRNA | ||
| 30 | AP012336.1 | GCA000284575_01305 | ncRNA | open | 1348606-1348716 | Streptococcus sRNA 10 | ||
| 31 | AP012336.1 | GCA000284575_01550 | ncRNA | open | 1601571-1601945 | Bacterial RNase P class B | ||
| 32 | AP012336.1 | GCA000284575_01574 | ncRNA | open | 1627226-1627361 | Streptococcus sRNA SpR19 | ||
| 33 | AP012336.1 | GCA000284575_01700 | ncRNA | open | 1750779-1750876 | Bacterial small signal recognition particle RNA | ||
| 34 | AP012336.1 | GCA000284575_01846 | ncRNA | open | 1891380-1891573 | 6S / SsrS RNA | ||
| 35 | AP012336.1 | GCA000284575_01936 | ncRNA | open | 1990949-1991014 | Streptococcus sRNA Spd-sr37 | ||
| 36 | AP012336.1 | regulatory_region | open | 163079-163158 | Ribosomal protein L13 leader | |||
| 37 | AP012336.1 | regulatory_region | open | 240879-240936 | Lacto-rpoB RNA | |||
| 38 | AP012336.1 | regulatory_region | open | 475460-475559 | 23S methyl RNA motif | |||
| 39 | AP012336.1 | regulatory_region | open | 478193-478406 | FMN riboswitch aptamer (RFN element) | |||
| 40 | AP012336.1 | regulatory_region | open | 612641-612737 | PreQ1-II (pre queuosine) riboswitch aptamer | |||
| 41 | AP012336.1 | regulatory_region | open | 875650-875767 | PyrR binding site | |||
| 42 | AP012336.1 | regulatory_region | open | 922852-922937 | Glycine riboswitch aptamer | |||
| 43 | AP012336.1 | regulatory_region | open | 1056153-1056275 | pemK RNA | |||
| 44 | AP012336.1 | regulatory_region | open | 1129226-1129357 | Ribosomal protein L10 leader | |||
| 45 | AP012336.1 | regulatory_region | open | 1227464-1227575 | PyrR binding site | |||
| 46 | AP012336.1 | regulatory_region | open | 1233859-1233934 | Ribosomal protein L21 leader | |||
| 47 | AP012336.1 | regulatory_region | open | 1370354-1370454 | TPP riboswitch aptamer (THI element) | |||
| 48 | AP012336.1 | regulatory_region | open | 1375820-1375946 | Ribosomal protein L20 leader | |||
| 49 | AP012336.1 | regulatory_region | open | 1469563-1469653 | THF (Tetrahydrofolate) riboswitch aptamer | |||
| 50 | AP012336.1 | regulatory_region | open | 1683559-1683657 | azaaromatic riboswitch aptamer (yjdF RNA) | |||
| 51 | AP012336.1 | regulatory_region | open | 1841414-1841487 | L17 ribosomal protein downstream element | |||
| 52 | AP012336.1 | GCA000284575_00015 | rRNA | open | 16881-18437 | rrs | 16S ribosomal RNA | |
| 53 | AP012336.1 | GCA000284575_00017 | rRNA | open | 18827-21727 | rrl | 23S ribosomal RNA | |
| 54 | AP012336.1 | GCA000284575_00018 | rRNA | open | 21910-22025 | rrf | 5S ribosomal RNA | |
| 55 | AP012336.1 | GCA000284575_00201 | rRNA | open | 226946-228502 | rrs | 16S ribosomal RNA | |
| 56 | AP012336.1 | GCA000284575_00203 | rRNA | open | 228892-231792 | rrl | 23S ribosomal RNA | |
| 57 | AP012336.1 | GCA000284575_00204 | rRNA | open | 231975-232090 | rrf | 5S ribosomal RNA | |
| 58 | AP012336.1 | GCA000284575_00378 | rRNA | open | 402730-404286 | rrs | 16S ribosomal RNA | |
| 59 | AP012336.1 | GCA000284575_00380 | rRNA | open | 404676-407576 | rrl | 23S ribosomal RNA | |
| 60 | AP012336.1 | GCA000284575_00381 | rRNA | open | 407759-407874 | rrf | 5S ribosomal RNA | |
| 61 | AP012336.1 | GCA000284575_00413 | rRNA | open | 432729-434285 | rrs | 16S ribosomal RNA | |
| 62 | AP012336.1 | GCA000284575_00415 | rRNA | open | 434675-437575 | rrl | 23S ribosomal RNA | |
| 63 | AP012336.1 | GCA000284575_00416 | rRNA | open | 437758-437873 | rrf | 5S ribosomal RNA | |
| 64 | AP012336.1 | GCA000284575_01789 | rRNA | open | 1834670-1834785 | rrf | 5S ribosomal RNA | |
| 65 | AP012336.1 | GCA000284575_01790 | rRNA | open | 1834968-1837868 | rrl | 23S ribosomal RNA | |
| 66 | AP012336.1 | GCA000284575_01792 | rRNA | open | 1838258-1839814 | rrs | 16S ribosomal RNA | |
| 67 | AP012336.1 | repeat_region | open | 430283-431251 | CRISPR array with 15 repeats of length 32%2C consensus sequence GTCGCACCCTTCACGGGTGCGTGGATTGAAAT and spacer length 34 | |||
| 68 | AP012336.1 | repeat_region | open | 758428-759002 | CRISPR array with 9 repeats of length 36%2C consensus sequence GTTTTAGAGCTGTGTTGTTTCGAATGGTTCCAAAAC and spacer length 30 | |||
| 69 | AP012336.1 | GCA000284575_00001 | CDS | open | 194-1552 | _na 452_aa | dnaA | chromosomal replication initiator protein DnaA |
| 70 | AP012336.1 | GCA000284575_00002 | CDS | open | 1708-2844 | _na 378_aa | dnaN | DNA polymerase III subunit beta |
| 71 | AP012336.1 | GCA000284575_00003 | CDS | open | 3117-3308 | _na 63_aa | DUF951 domain-containing protein | |
| 72 | AP012336.1 | GCA000284575_00004 | CDS | open | 3472-4587 | _na 371_aa | ychF | redox-regulated ATPase YchF |
| 73 | AP012336.1 | GCA000284575_00005 | CDS | open | 4674-5243 | _na 189_aa | pth | aminoacyl-tRNA hydrolase |
| 74 | AP012336.1 | GCA000284575_00006 | CDS | open | 5236-8733 | _na 1165_aa | mfd | transcription-repair coupling factor |
| 75 | AP012336.1 | GCA000284575_00007 | CDS | open | 8863-9135 | _na 90_aa | hslR | RNA-binding S4 domain-containing protein |
| 76 | AP012336.1 | GCA000284575_00008 | CDS | open | 9122-9493 | _na 123_aa | ftsB | Cell division protein DivIC |
| 77 | AP012336.1 | GCA000284575_00009 | CDS | open | 9493-9612 | _na 39_aa | SP_0009 family protein | |
| 78 | AP012336.1 | GCA000284575_00010 | CDS | open | 9622-10857 | _na 411_aa | penP | serine hydrolase |
| 79 | AP012336.1 | GCA000284575_00011 | CDS | open | 10854-12125 | _na 423_aa | tilS | tRNA(Ile)-lysidine synthase |
| 80 | AP012336.1 | GCA000284575_00012 | CDS | open | 12129-12671 | _na 180_aa | hpt | hypoxanthine phosphoribosyltransferase |
| 81 | AP012336.1 | GCA000284575_00013 | CDS | open | 12693-14663 | _na 656_aa | ftsH | ATP-dependent zinc metalloprotease FtsH |
| 82 | AP012336.1 | GCA000284575_00014 | CDS | open | 15154-16566 | _na 470_aa | potE | Amino acid permease |
| 83 | AP012336.1 | GCA000284575_00036 | CDS | open | 23664-24482 | _na 272_aa | mreC | rod shape-determining protein MreC |
| 84 | AP012336.1 | GCA000284575_00037 | CDS | open | 24484-24990 | _na 168_aa | mreD | rod shape-determining protein MreD |
| 85 | AP012336.1 | GCA000284575_00038 | CDS | open | 25100-26395 | _na 431_aa | pcsB | peptidoglycan hydrolase PcsB |
| 86 | AP012336.1 | GCA000284575_00039 | CDS | open | 26520-27488 | _na 322_aa | prs1 | ribose-phosphate diphosphokinase |
| 87 | AP012336.1 | GCA000284575_00040 | CDS | open | 27577-28752 | _na 391_aa | aspB | pyridoxal phosphate-dependent aminotransferase |
| 88 | AP012336.1 | GCA000284575_00041 | CDS | open | 28742-29497 | _na 251_aa | recO | DNA repair protein RecO |
| 89 | AP012336.1 | GCA000284575_00042 | CDS | open | 29705-30703 | _na 332_aa | plsX | phosphate acyltransferase PlsX |
| 90 | AP012336.1 | GCA000284575_00043 | CDS | open | 30705-30953 | _na 82_aa | acpP | acyl carrier protein |
| 91 | AP012336.1 | GCA000284575_00044 | CDS | open | 31132-31761 | _na 209_aa | ATP-binding protein | |
| 92 | AP012336.1 | GCA000284575_00045 | CDS | open | 31883-32590 | _na 235_aa | purC | phosphoribosylaminoimidazolesuccinocarboxamide synthase |
| 93 | AP012336.1 | GCA000284575_00046 | CDS | open | 32600-36325 | _na 1241_aa | purL2 | phosphoribosylformylglycinamidine synthase |
| 94 | AP012336.1 | GCA000284575_00047 | CDS | open | 36347-36967 | _na 206_aa | Phosphomethylpyrimidine kinase | |
| 95 | AP012336.1 | GCA000284575_00048 | CDS | open | 36993-38432 | _na 479_aa | purF | amidophosphoribosyltransferase |
| 96 | AP012336.1 | GCA000284575_00049 | CDS | open | 38445-38930 | _na 161_aa | Phage protein | |
| 97 | AP012336.1 | GCA000284575_00050 | CDS | open | 38975-39997 | _na 340_aa | purM | Phosphoribosylformylglycinamidine cyclo-ligase |
| 98 | AP012336.1 | GCA000284575_00051 | CDS | open | 39997-40551 | _na 184_aa | purN | phosphoribosylglycinamide formyltransferase |
| 99 | AP012336.1 | GCA000284575_00052 | CDS | open | 40866-42416 | _na 516_aa | purH | bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase |
| 100 | AP012336.1 | GCA000284575_00053 | CDS | open | 42599-43141 | _na 180_aa | acrR | HTH tetR-type domain-containing protein |
| 101 | AP012336.1 | GCA000284575_00054 | CDS | open | 43309-43818 | _na 169_aa | HXXEE domain-containing protein | |
| 102 | AP012336.1 | GCA000284575_00055 | CDS | open | 44307-45182 | _na 291_aa | abiF | Abortive infection bacteriophage resistance protein |
| 103 | AP012336.1 | GCA000284575_00056 | CDS | open | 45328-45801 | _na 157_aa | hypothetical protein | |
| 104 | AP012336.1 | GCA000284575_00057 | CDS | open | 45860-46246 | _na 128_aa | hypothetical protein | |
| 105 | AP012336.1 | GCA000284575_00058 | CDS | open | 46243-46683 | _na 146_aa | secB | protein-export chaperone SecB |
| 106 | AP012336.1 | GCA000284575_00059 | CDS | open | 46877-48136 | _na 419_aa | purD | Phosphoribosylamine--glycine ligase |
| 107 | AP012336.1 | GCA000284575_00060 | CDS | open | 48196-49377 | _na 393_aa | accC | ATP-grasp domain-containing protein |
| 108 | AP012336.1 | GCA000284575_00061 | CDS | open | 49749-50186 | _na 145_aa | N5-carboxyaminoimidazole ribonucleotide mutase | |
| 109 | AP012336.1 | GCA000284575_00062 | CDS | open | 50173-51264 | _na 363_aa | purK | 5-(carboxyamino)imidazole ribonucleotide synthase |
| 110 | AP012336.1 | GCA000284575_00063 | CDS | open | 51434-52063 | _na 209_aa | hypothetical protein | |
| 111 | AP012336.1 | GCA000284575_00064 | CDS | open | 52064-52777 | _na 237_aa | hypothetical protein | |
| 112 | AP012336.1 | GCA000284575_00065 | CDS | open | 52850-53542 | _na 230_aa | racX | Aspartate racemase |
| 113 | AP012336.1 | GCA000284575_00066 | CDS | open | 53636-53917 | _na 93_aa | hypothetical protein | |
| 114 | AP012336.1 | GCA000284575_00067 | CDS | open | 53911-54336 | _na 141_aa | Polyketide cyclase | |
| 115 | AP012336.1 | GCA000284575_00068 | CDS | open | 54367-55407 | _na 346_aa | hypothetical protein | |
| 116 | AP012336.1 | GCA000284575_00069 | CDS | open | 55400-55540 | _na 46_aa | Bacteriocin | |
| 117 | AP012336.1 | GCA000284575_00070 | CDS | open | 55800-57098 | _na 432_aa | purB | adenylosuccinate lyase |
| 118 | AP012336.1 | GCA000284575_00071 | CDS | open | 57118-57807 | _na 229_aa | alkD | DNA alkylation repair enzyme |
| 119 | AP012336.1 | GCA000284575_00072 | CDS | open | 58189-59103 | _na 304_aa | hipB | Transcriptional regulator |
| 120 | AP012336.1 | GCA000284575_00073 | CDS | open | 59635-61476 | _na 613_aa | Carbohydrate-binding domain-containing protein | |
| 121 | AP012336.1 | GCA000284575_00074 | CDS | open | 61811-62806 | _na 331_aa | ruvB | Holliday junction branch migration DNA helicase RuvB |
| 122 | AP012336.1 | GCA000284575_00075 | CDS | open | 62844-63269 | _na 141_aa | wzb | protein-tyrosine-phosphatase |
| 123 | AP012336.1 | GCA000284575_00076 | CDS | open | 63337-63717 | _na 126_aa | MORN repeat protein | |
| 124 | AP012336.1 | GCA000284575_00077 | CDS | open | 63714-65504 | _na 596_aa | oafA | Acyltransferase |
| 125 | AP012336.1 | GCA000284575_00078 | CDS | open | 66186-67670 | _na 494_aa | thrC | threonine synthase |
| 126 | AP012336.1 | GCA000284575_00079 | CDS | open | 68127-69428 | _na 433_aa | norM | putative multidrug resistance protein NorM |
| 127 | AP012336.1 | GCA000284575_00080 | CDS | open | 69786-70052 | _na 88_aa | aCT | ACT domain-containing protein |
| 128 | AP012336.1 | GCA000284575_00081 | CDS | open | 70072-71409 | _na 445_aa | UPF0210 protein STER_0157 | |
| 129 | AP012336.1 | GCA000284575_00082 | CDS | open | 71482-72192 | _na 236_aa | phoE | Phosphoglycerate mutase |
| 130 | AP012336.1 | GCA000284575_00083 | CDS | open | 72176-72925 | _na 249_aa | ldcB | D-alanyl-D-alanine carboxypeptidase |
| 131 | AP012336.1 | GCA000284575_00084 | CDS | open | 72929-73516 | _na 195_aa | flgJ | Putative N-acetyl-muramidase |
| 132 | AP012336.1 | GCA000284575_00085 | CDS | open | 74131-78402 | _na 1423_aa | fruA | Fructan beta-fructosidase |
| 133 | AP012336.1 | GCA000284575_00086 | CDS | open | 78473-80032 | _na 519_aa | fruB | Fructan hydrolase exo-beta-D-fructosidase FruB |
| 134 | AP012336.1 | GCA000284575_00087 | CDS | open | 80207-81241 | _na 344_aa | hrcA | heat-inducible transcriptional repressor HrcA |
| 135 | AP012336.1 | GCA000284575_00088 | CDS | open | 81284-81823 | _na 179_aa | grpE | nucleotide exchange factor GrpE |
| 136 | AP012336.1 | GCA000284575_00089 | CDS | open | 82193-84031 | _na 612_aa | dnaK | molecular chaperone DnaK |
| 137 | AP012336.1 | GCA000284575_00090 | CDS | open | 84559-85692 | _na 377_aa | dnaJ | molecular chaperone DnaJ |
| 138 | AP012336.1 | GCA000284575_00091 | CDS | open | 85994-86743 | _na 249_aa | truA | tRNA pseudouridine(38-40) synthase TruA |
| 139 | AP012336.1 | GCA000284575_00092 | CDS | open | 86733-87500 | _na 255_aa | thiD | bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase |
| 140 | AP012336.1 | GCA000284575_00093 | CDS | open | 87487-87951 | _na 154_aa | eCF-S | Integral membrane protein |
| 141 | AP012336.1 | GCA000284575_00094 | CDS | open | 87997-88560 | _na 187_aa | ywlG | UPF0340 protein SMU_87 |
| 142 | AP012336.1 | GCA000284575_00095 | CDS | open | 88731-89588 | _na 285_aa | mscS | Mechanosensitive ion channel |
| 143 | AP012336.1 | GCA000284575_00096 | CDS | open | 89806-90615 | _na 269_aa | Nitrite transporter | |
| 144 | AP012336.1 | GCA000284575_00097 | CDS | open | 90854-92137 | _na 427_aa | tig | trigger factor |
| 145 | AP012336.1 | GCA000284575_00098 | CDS | open | 92263-93201 | _na 312_aa | hypothetical protein | |
| 146 | AP012336.1 | GCA000284575_00099 | CDS | open | 93500-94084 | _na 194_aa | rpoE | DNA-directed RNA polymerase subunit delta |
| 147 | AP012336.1 | GCA000284575_00100 | CDS | open | 94218-95828 | _na 536_aa | pyrG | CTP synthase |
| 148 | AP012336.1 | GCA000284575_00102 | CDS | open | 96984-97865 | _na 293_aa | fba | class II fructose-bisphosphate aldolase |
| 149 | AP012336.1 | GCA000284575_00103 | CDS | open | 98190-98681 | _na 163_aa | agaB | Sorbose PTS system%2C IIB component |
| 150 | AP012336.1 | GCA000284575_00104 | CDS | open | 98694-99491 | _na 265_aa | manY | Sorbose PTS system%2C IIC component |
| 151 | AP012336.1 | GCA000284575_00105 | CDS | open | 99484-100302 | _na 272_aa | manZ | PTS system%2C IID component |
| 152 | AP012336.1 | GCA000284575_00106 | CDS | open | 100299-100715 | _na 138_aa | PTS system%2C IIA component | |
| 153 | AP012336.1 | GCA000284575_00107 | CDS | open | 100715-102910 | _na 731_aa | yicI | Alpha-glucosidase glycosyl hydrolase |
| 154 | AP012336.1 | GCA000284575_00108 | CDS | open | 102911-103909 | _na 332_aa | purR | Transcriptional regulator repressor of sugar transport operon |
| 155 | AP012336.1 | GCA000284575_00110 | CDS | open | 105515-105823 | _na 102_aa | Methyltransferase domain protein | |
| 156 | AP012336.1 | GCA000284575_00111 | CDS | open | 105988-107208 | _na 406_aa | Permease | |
| 157 | AP012336.1 | GCA000284575_00112 | CDS | open | 107231-108022 | _na 263_aa | mutR | Transcriptional regulator MutR |
| 158 | AP012336.1 | GCA000284575_00113 | CDS | open | 108347-109096 | _na 249_aa | rpiR | RpiR-like protein |
| 159 | AP012336.1 | GCA000284575_00114 | CDS | open | 109225-110157 | _na 310_aa | pfkB | 1-phosphofructokinase |
| 160 | AP012336.1 | GCA000284575_00115 | CDS | open | 110162-111562 | _na 466_aa | frwB | Constitutive fructose permease |
| 161 | AP012336.1 | GCA000284575_00116 | CDS | open | 111577-112029 | _na 150_aa | ptsN | Constitutive fructose permease |
| 162 | AP012336.1 | GCA000284575_00117 | CDS | open | 112047-113036 | _na 329_aa | lacD | tagatose-bisphosphate aldolase |
| 163 | AP012336.1 | GCA000284575_00118 | CDS | open | 113137-114492 | _na 451_aa | Permease | |
| 164 | AP012336.1 | GCA000284575_00119 | CDS | open | 115104-115946 | _na 280_aa | fghA | S-formylglutathione hydrolase |
| 165 | AP012336.1 | GCA000284575_00120 | CDS | open | 115943-117070 | _na 375_aa | frmA | S-(hydroxymethyl)glutathione dehydrogenase/class III alcohol dehydrogenase |
| 166 | AP012336.1 | GCA000284575_00121 | CDS | open | 117529-117717 | _na 62_aa | rpmB | 50S ribosomal protein L28 |
| 167 | AP012336.1 | GCA000284575_00122 | CDS | open | 117770-119098 | _na 442_aa | norM | putative multidrug resistance protein NorM |
| 168 | AP012336.1 | GCA000284575_00123 | CDS | open | 119331-123731 | _na 1466_aa | polC | PolC-type DNA polymerase III |
| 169 | AP012336.1 | GCA000284575_00124 | CDS | open | 123957-124385 | _na 142_aa | marR | Transcriptional regulator (MarR family) |
| 170 | AP012336.1 | GCA000284575_00125 | CDS | open | 124464-125018 | _na 184_aa | ssuE | NADPH-dependent FMN reductase-like domain-containing protein |
| 171 | AP012336.1 | GCA000284575_00126 | CDS | open | 125427-126389 | _na 320_aa | acoA | TPP-dependent acetoin dehydrogenase complex%2C E1 component%2C alpha subunit |
| 172 | AP012336.1 | GCA000284575_00127 | CDS | open | 126539-127534 | _na 331_aa | acoB | Acetoin dehydrogenase (TPP-dependent)%2C E1 component beta subunit |
| 173 | AP012336.1 | GCA000284575_00128 | CDS | open | 127634-129001 | _na 455_aa | aceF | dihydrolipoamide acetyltransferase |
| 174 | AP012336.1 | GCA000284575_00129 | CDS | open | 129075-130820 | _na 581_aa | lpdA | dihydrolipoyl dehydrogenase |
| 175 | AP012336.1 | GCA000284575_00130 | CDS | open | 130926-131915 | _na 329_aa | lplA | lipoate--protein ligase |
| 176 | AP012336.1 | GCA000284575_00131 | CDS | open | 132180-133316 | _na 378_aa | abgB | Aminoacylase/N-acyl-L-amino acid amidohydrolase/hippurate hydrolase |
| 177 | AP012336.1 | GCA000284575_00132 | CDS | open | 133439-134833 | _na 464_aa | araJ | MDR permease transmembrane efflux protein |
| 178 | AP012336.1 | GCA000284575_00133 | CDS | open | 135013-135636 | _na 207_aa | acrR | Transcriptional regulator (TetR/AcrR family) |
| 179 | AP012336.1 | GCA000284575_00134 | CDS | open | 135901-136794 | _na 297_aa | lysR | Transcriptional regulator |
| 180 | AP012336.1 | GCA000284575_00135 | CDS | open | 136984-137337 | _na 117_aa | xRE | Transcriptional regulator |
| 181 | AP012336.1 | GCA000284575_00136 | CDS | open | 137453-139075 | _na 540_aa | sfcA | malolactic enzyme |
| 182 | AP012336.1 | GCA000284575_00137 | CDS | open | 139232-140176 | _na 314_aa | yfdV | Malate permease |
| 183 | AP012336.1 | GCA000284575_00138 | CDS | open | 140297-141481 | _na 394_aa | oxdD | Cupin type-1 domain-containing protein |
| 184 | AP012336.1 | GCA000284575_00139 | CDS | open | 141499-142860 | _na 453_aa | lpd | Glutathione reductase |
| 185 | AP012336.1 | GCA000284575_00140 | CDS | open | 142862-143563 | _na 233_aa | yoaK | DUF1275 domain-containing protein |
| 186 | AP012336.1 | GCA000284575_00141 | CDS | open | 143727-144341 | _na 204_aa | def | peptide deformylase |
| 187 | AP012336.1 | GCA000284575_00142 | CDS | open | 144416-145063 | _na 215_aa | crp | Transcriptional regulator |
| 188 | AP012336.1 | GCA000284575_00143 | CDS | open | 145168-146352 | _na 394_aa | Major facilitator superfamily (MFS) profile domain-containing protein | |
| 189 | AP012336.1 | GCA000284575_00144 | CDS | open | 146552-149221 | _na 889_aa | adhE | bifunctional acetaldehyde-CoA/alcohol dehydrogenase |
| 190 | AP012336.1 | GCA000284575_00145 | CDS | open | 149592-149861 | _na 89_aa | rpsO | 30S ribosomal protein S15 |
| 191 | AP012336.1 | GCA000284575_00146 | CDS | open | 150608-152800 | _na 730_aa | pnp | polyribonucleotide nucleotidyltransferase |
| 192 | AP012336.1 | GCA000284575_00147 | CDS | open | 152790-153530 | _na 246_aa | sseB | SseB protein N-terminal domain-containing protein |
| 193 | AP012336.1 | GCA000284575_00148 | CDS | open | 153541-154158 | _na 205_aa | cysE | serine O-acetyltransferase |
| 194 | AP012336.1 | GCA000284575_00149 | CDS | open | 154232-155575 | _na 447_aa | cysS | cysteine--tRNA ligase |
| 195 | AP012336.1 | GCA000284575_00150 | CDS | open | 155568-155987 | _na 139_aa | mrnC | Mini-ribonuclease 3 |
| 196 | AP012336.1 | GCA000284575_00151 | CDS | open | 156166-157071 | _na 301_aa | yjaZ | DUF2268 domain-containing protein |
| 197 | AP012336.1 | GCA000284575_00152 | CDS | open | 157050-157787 | _na 245_aa | soxR | Transcriptional regulator |
| 198 | AP012336.1 | GCA000284575_00153 | CDS | open | 157823-158815 | _na 330_aa | Lantibiotic ABC transporter | |
| 199 | AP012336.1 | GCA000284575_00154 | CDS | open | 159004-159558 | _na 184_aa | padR | Transcription regulator PadR N-terminal domain-containing protein |
| 200 | AP012336.1 | GCA000284575_00155 | CDS | open | 159871-160617 | _na 248_aa | rlmB | 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB |
| 201 | AP012336.1 | GCA000284575_00156 | CDS | open | 160641-161501 | _na 286_aa | degV | DegV domain-containing protein |
| 202 | AP012336.1 | GCA000284575_00157 | CDS | open | 161633-162148 | _na 171_aa | hypothetical protein | |
| 203 | AP012336.1 | GCA000284575_00158 | CDS | open | 162148-162594 | _na 148_aa | hypothetical protein | |
| 204 | AP012336.1 | GCA000284575_00159 | CDS | open | 162591-162785 | _na 64_aa | xRE | Transcriptional regulator |
| 205 | AP012336.1 | GCA000284575_00160 | CDS | open | 163178-163624 | _na 148_aa | rplM | 50S ribosomal protein L13 |
| 206 | AP012336.1 | GCA000284575_00161 | CDS | open | 163649-164041 | _na 130_aa | rpsI | 30S ribosomal protein S9 |
| 207 | AP012336.1 | GCA000284575_00162 | CDS | open | 164148-164465 | _na 105_aa | Tyr recombinase domain-containing protein | |
| 208 | AP012336.1 | GCA000284575_00163 | CDS | open | 164864-165532 | _na 222_aa | TRANSCRIPTIONAL REGULATOR%2C ARSR FAMILY / Rhodanese-related sulfurtransferase | |
| 209 | AP012336.1 | GCA000284575_00164 | CDS | open | 165839-165973 | _na 44_aa | hypothetical protein | |
| 210 | AP012336.1 | GCA000284575_00165 | CDS | open | 165948-166151 | _na 67_aa | trxA | thioredoxin |
| 211 | AP012336.1 | GCA000284575_00166 | CDS | open | 166160-167080 | _na 306_aa | trxB | thioredoxin-disulfide reductase |
| 212 | AP012336.1 | GCA000284575_00167 | CDS | open | 167077-167346 | _na 89_aa | Thioredoxin | |
| 213 | AP012336.1 | GCA000284575_00168 | CDS | open | 167347-167526 | _na 59_aa | type Z 30S ribosomal protein S14 | |
| 214 | AP012336.1 | GCA000284575_00169 | CDS | open | 167546-168196 | _na 216_aa | Protein-disulfide isomerase | |
| 215 | AP012336.1 | GCA000284575_00170 | CDS | open | 168198-168374 | _na 58_aa | Putative phage-related chromosomal island protein | |
| 216 | AP012336.1 | GCA000284575_00171 | CDS | open | 168356-168919 | _na 187_aa | Putative membrane spanning protein | |
| 217 | AP012336.1 | GCA000284575_00172 | CDS | open | 169326-169571 | _na 81_aa | mazE | SpoVT-AbrB domain-containing protein |
| 218 | AP012336.1 | GCA000284575_00173 | CDS | open | 169565-169897 | _na 110_aa | mazF | PpGpp-regulated growth inhibitor |
| 219 | AP012336.1 | GCA000284575_00174 | CDS | open | 170095-170655 | _na 186_aa | hypothetical protein | |
| 220 | AP012336.1 | GCA000284575_00175 | CDS | open | 171202-172962 | _na 586_aa | PDZ domain-containing protein | |
| 221 | AP012336.1 | GCA000284575_00176 | CDS | open | 172979-173581 | _na 200_aa | Response regulator transcription factor | |
| 222 | AP012336.1 | GCA000284575_00177 | CDS | open | 173714-190837 | _na 5707_aa | dltA | D-alanine--poly(phosphoribitol) ligase subunit DltA |
| 223 | AP012336.1 | GCA000284575_00178 | CDS | open | 191210-192475 | _na 421_aa | fabD | ACP S-malonyltransferase |
| 224 | AP012336.1 | GCA000284575_00179 | CDS | open | 192514-197037 | _na 1507_aa | SDR family NAD(P)-dependent oxidoreductase | |
| 225 | AP012336.1 | GCA000284575_00180 | CDS | open | 197041-201759 | _na 1572_aa | SDR family NAD(P)-dependent oxidoreductase | |
| 226 | AP012336.1 | GCA000284575_00181 | CDS | open | 201776-202660 | _na 294_aa | ABC transporter%2C ATP-binding protein | |
| 227 | AP012336.1 | GCA000284575_00182 | CDS | open | 202657-203394 | _na 245_aa | Putative membrane protein | |
| 228 | AP012336.1 | GCA000284575_00183 | CDS | open | 203493-203648 | _na 51_aa | hypothetical protein | |
| 229 | AP012336.1 | GCA000284575_00184 | CDS | open | 203778-210218 | _na 2146_aa | Amino acid adenylation domain-containing protein | |
| 230 | AP012336.1 | GCA000284575_00185 | CDS | open | 210262-210957 | _na 231_aa | Thioesterase | |
| 231 | AP012336.1 | GCA000284575_00186 | CDS | open | 210978-211649 | _na 223_aa | 4'-phosphopantetheinyl transferase superfamily protein | |
| 232 | AP012336.1 | GCA000284575_00187 | CDS | open | 211737-212636 | _na 299_aa | avrD | AvrD family macrolide biosynthetic protein |
| 233 | AP012336.1 | GCA000284575_00188 | CDS | open | 213220-213837 | _na 205_aa | IS3 family transposase | |
| 234 | AP012336.1 | GCA000284575_00189 | CDS | open | 214084-214314 | _na 76_aa | hypothetical protein | |
| 235 | AP012336.1 | GCA000284575_00190 | CDS | open | 214535-215755 | _na 406_aa | celB | PTS EIIC type-3 domain-containing protein |
| 236 | AP012336.1 | GCA000284575_00191 | CDS | open | 215733-216581 | _na 282_aa | Alpha/beta hydrolase | |
| 237 | AP012336.1 | GCA000284575_00192 | CDS | open | 216723-217325 | _na 200_aa | ssuE | NADPH-dependent FMN reductase-like domain-containing protein |
| 238 | AP012336.1 | GCA000284575_00193 | CDS | open | 217327-219738 | _na 803_aa | urdA | Urocanate reductase |
| 239 | AP012336.1 | GCA000284575_00194 | CDS | open | 219944-220942 | _na 332_aa | mvk | mevalonate kinase |
| 240 | AP012336.1 | GCA000284575_00195 | CDS | open | 221164-221886 | _na 240_aa | znuC | ABC transporter%2C ATP-binding protein putative iron and/or manganese ABC transport system |
| 241 | AP012336.1 | GCA000284575_00196 | CDS | open | 221883-222722 | _na 279_aa | znuB | Mn/Zn ABC transporter |
| 242 | AP012336.1 | GCA000284575_00197 | CDS | open | 222769-223689 | _na 306_aa | sloC | Metal ABC transporter substrate-binding lipoprotein SloC |
| 243 | AP012336.1 | GCA000284575_00198 | CDS | open | 223873-224526 | _na 217_aa | mntR | Manganese transport regulator |
| 244 | AP012336.1 | GCA000284575_00199 | CDS | open | 224622-225599 | _na 325_aa | dusB | tRNA dihydrouridine synthase DusB |
| 245 | AP012336.1 | GCA000284575_00200 | CDS | open | 225586-226518 | _na 310_aa | hslO | Hsp33 family molecular chaperone HslO |
| 246 | AP012336.1 | GCA000284575_00206 | CDS | open | 232830-233312 | _na 160_aa | ComX1%2C transcriptional regulator of competence-specific genes | |
| 247 | AP012336.1 | GCA000284575_00207 | CDS | open | 233459-234307 | _na 282_aa | ispE | 4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase |
| 248 | AP012336.1 | GCA000284575_00208 | CDS | open | 234941-235387 | _na 148_aa | marR | zinc-dependent MarR family transcriptional regulator |
| 249 | AP012336.1 | GCA000284575_00209 | CDS | open | 235390-236100 | _na 236_aa | znuC | ABC transporter%2C ATP-binding protein |
| 250 | AP012336.1 | GCA000284575_00210 | CDS | open | 236090-236902 | _na 270_aa | znuB | ABC transporter%2C zinc permease protein |
| 251 | AP012336.1 | GCA000284575_00211 | CDS | open | 237058-238314 | _na 418_aa | tyrS | tyrosine--tRNA ligase |
| 252 | AP012336.1 | GCA000284575_00212 | CDS | open | 238482-240836 | _na 784_aa | pbp1b | penicillin-binding protein PBP1B |
| 253 | AP012336.1 | GCA000284575_00213 | CDS | open | 241097-244660 | _na 1187_aa | rpoB | DNA-directed RNA polymerase subunit beta |
| 254 | AP012336.1 | GCA000284575_00214 | CDS | open | 244896-248525 | _na 1209_aa | rpoC | DNA-directed RNA polymerase subunit beta' |
| 255 | AP012336.1 | GCA000284575_00215 | CDS | open | 248653-249036 | _na 127_aa | DNA binding protein | |
| 256 | AP012336.1 | GCA000284575_00216 | CDS | open | 249166-250107 | _na 313_aa | comGA | competence type IV pilus ATPase ComGA |
| 257 | AP012336.1 | GCA000284575_00217 | CDS | open | 250097-251074 | _na 325_aa | comGB | competence type IV pilus assembly protein ComGB |
| 258 | AP012336.1 | GCA000284575_00218 | CDS | open | 251074-251388 | _na 104_aa | comGC | competence type IV pilus major pilin ComGC |
| 259 | AP012336.1 | GCA000284575_00219 | CDS | open | 251348-251779 | _na 143_aa | comGD | competence type IV pilus minor pilin ComGD |
| 260 | AP012336.1 | GCA000284575_00220 | CDS | open | 251751-252044 | _na 97_aa | comGE | competence type IV pilus minor pilin ComGE |
| 261 | AP012336.1 | GCA000284575_00221 | CDS | open | 252031-252465 | _na 144_aa | comGF | competence type IV pilus minor pilin ComGF |
| 262 | AP012336.1 | GCA000284575_00222 | CDS | open | 252443-252832 | _na 129_aa | comGG | competence type IV pilus minor pilin ComGG |
| 263 | AP012336.1 | GCA000284575_00223 | CDS | open | 252887-253840 | _na 317_aa | ytxK | DNA methylase adenine-specific domain-containing protein |
| 264 | AP012336.1 | GCA000284575_00224 | CDS | open | 253899-255098 | _na 399_aa | ackA | Acetate kinase |
| 265 | AP012336.1 | GCA000284575_00225 | CDS | open | 255484-255774 | _na 96_aa | tnpA | IS200/IS605 family transposase |
| 266 | AP012336.1 | GCA000284575_00226 | CDS | open | 256407-256652 | _na 81_aa | xRE | Transcriptional regulator |
| 267 | AP012336.1 | GCA000284575_00227 | CDS | open | 256621-257061 | _na 146_aa | hypothetical protein | |
| 268 | AP012336.1 | GCA000284575_00228 | CDS | open | 257114-257776 | _na 220_aa | Protease | |
| 269 | AP012336.1 | GCA000284575_00229 | CDS | open | 257861-258631 | _na 256_aa | proC | pyrroline-5-carboxylate reductase |
| 270 | AP012336.1 | GCA000284575_00230 | CDS | open | 258687-259754 | _na 355_aa | pepA | glutamyl aminopeptidase |
| 271 | AP012336.1 | GCA000284575_00231 | CDS | open | 259814-260122 | _na 102_aa | DUF4651 domain-containing protein | |
| 272 | AP012336.1 | GCA000284575_00232 | CDS | open | 260100-260429 | _na 109_aa | dsbD | Thioredoxin H1 |
| 273 | AP012336.1 | GCA000284575_00233 | CDS | open | 260426-261052 | _na 208_aa | ytpR | YtpR family tRNA-binding protein |
| 274 | AP012336.1 | GCA000284575_00234 | CDS | open | 261150-261572 | _na 140_aa | marR | Transcriptional regulator |
| 275 | AP012336.1 | GCA000284575_00235 | CDS | open | 261572-261928 | _na 118_aa | pspE | Rhodanese domain-containing protein |
| 276 | AP012336.1 | GCA000284575_00236 | CDS | open | 262015-262410 | _na 131_aa | ssb | single-stranded DNA-binding protein |
| 277 | AP012336.1 | GCA000284575_00237 | CDS | open | 262826-263788 | _na 320_aa | rbsB | Periplasmic sugar-binding protein |
| 278 | AP012336.1 | GCA000284575_00238 | CDS | open | 263788-265110 | _na 440_aa | comP | histidine kinase |
| 279 | AP012336.1 | GCA000284575_00239 | CDS | open | 265110-265790 | _na 226_aa | citB | Response regulator |
| 280 | AP012336.1 | GCA000284575_00240 | CDS | open | 265783-267090 | _na 435_aa | ugpB | Sugar-binding periplasmic protein |
| 281 | AP012336.1 | GCA000284575_00241 | CDS | open | 267392-267823 | _na 143_aa | manX | PTS system%2C sugar-specific enzyme IIA component |
| 282 | AP012336.1 | GCA000284575_00242 | CDS | open | 267841-268335 | _na 164_aa | agaB | PTS EIIB type-4 domain-containing protein |
| 283 | AP012336.1 | GCA000284575_00243 | CDS | open | 268709-269560 | _na 283_aa | manY | PTS system%2C mannose-specific IIC component |
| 284 | AP012336.1 | GCA000284575_00244 | CDS | open | 269562-270398 | _na 278_aa | manZ | PTS system%2C mannose-specific IID component |
| 285 | AP012336.1 | GCA000284575_00245 | CDS | open | 270422-270718 | _na 98_aa | PTS fructose transporter subunit IA | |
| 286 | AP012336.1 | GCA000284575_00246 | CDS | open | 270840-271127 | _na 95_aa | groES | co-chaperone GroES |
| 287 | AP012336.1 | GCA000284575_00247 | CDS | open | 271239-272867 | _na 542_aa | groL | chaperonin GroEL |
| 288 | AP012336.1 | GCA000284575_00248 | CDS | open | 273512-275215 | _na 567_aa | yvbJ | TcaA 4th domain-containing protein |
| 289 | AP012336.1 | GCA000284575_00249 | CDS | open | 275235-276101 | _na 288_aa | rluA | Pseudouridine synthase |
| 290 | AP012336.1 | GCA000284575_00250 | CDS | open | 276145-278421 | _na 758_aa | pbp2a | penicillin-binding protein PBP2A |
| 291 | AP012336.1 | GCA000284575_00251 | CDS | open | 278472-278624 | _na 50_aa | rpmG | 50S ribosomal protein L33 |
| 292 | AP012336.1 | GCA000284575_00252 | CDS | open | 278636-278812 | _na 58_aa | secE | preprotein translocase subunit SecE |
| 293 | AP012336.1 | GCA000284575_00253 | CDS | open | 278970-279506 | _na 178_aa | nusG | transcription termination/antitermination protein NusG |
| 294 | AP012336.1 | GCA000284575_00254 | CDS | open | 279723-280412 | _na 229_aa | DUF4956 domain-containing protein | |
| 295 | AP012336.1 | GCA000284575_00255 | CDS | open | 280405-281169 | _na 254_aa | VTC domain-containing protein | |
| 296 | AP012336.1 | GCA000284575_00256 | CDS | open | 281569-284070 | _na 833_aa | leuS | leucine--tRNA ligase |
| 297 | AP012336.1 | GCA000284575_00257 | CDS | open | 284372-285175 | _na 267_aa | hisJ | Amino acid binding protein |
| 298 | AP012336.1 | GCA000284575_00258 | CDS | open | 285342-286184 | _na 280_aa | nlpA | Lipoprotein |
| 299 | AP012336.1 | GCA000284575_00259 | CDS | open | 286379-287752 | _na 457_aa | argE | Peptidase%2C AtmC ArgE/DapE/Acy1 family protein |
| 300 | AP012336.1 | GCA000284575_00260 | CDS | open | 287745-288809 | _na 354_aa | metN | Methionine import ATP-binding protein MetN |
| 301 | AP012336.1 | GCA000284575_00261 | CDS | open | 288811-289500 | _na 229_aa | metP | ABC transporter%2C permease protein |
| 302 | AP012336.1 | GCA000284575_00262 | CDS | open | 289568-290344 | _na 258_aa | nit1 | Carbon-nitrogen hydrolase |
| 303 | AP012336.1 | GCA000284575_00263 | CDS | open | 290468-291313 | _na 281_aa | DNA-directed RNA polymerase subunit delta | |
| 304 | AP012336.1 | GCA000284575_00264 | CDS | open | 291323-291868 | _na 181_aa | eCF-S | ECF-type riboflavin transporter substrate-binding protein |
| 305 | AP012336.1 | GCA000284575_00265 | CDS | open | 291897-293573 | _na 558_aa | sdcBA | energy-coupling factor transporter ATPase |
| 306 | AP012336.1 | GCA000284575_00266 | CDS | open | 293566-294399 | _na 277_aa | ecfT | ABC transporter%2C permease protein |
| 307 | AP012336.1 | GCA000284575_00267 | CDS | open | 294623-295336 | _na 237_aa | rsmG | 16S rRNA (guanine(527)-N(7))-methyltransferase RsmG |
| 308 | AP012336.1 | GCA000284575_00268 | CDS | open | 295424-295984 | _na 186_aa | lemA | Cytoplasmic membrane protein LemA-like protein |
| 309 | AP012336.1 | GCA000284575_00269 | CDS | open | 295994-296893 | _na 299_aa | htpX | zinc metalloprotease HtpX |
| 310 | AP012336.1 | GCA000284575_00270 | CDS | open | 297030-299642 | _na 870_aa | lolE | ABC transporter%2C permease protein |
| 311 | AP012336.1 | GCA000284575_00271 | CDS | open | 299644-300351 | _na 235_aa | lolD | ABC transporter%2C ATP-binding protein |
| 312 | AP012336.1 | GCA000284575_00272 | CDS | open | 300459-301034 | _na 191_aa | acrR | Transcriptional regulator |
| 313 | AP012336.1 | GCA000284575_00273 | CDS | open | 301027-301563 | _na 178_aa | yceD | DNA-binding protein |
| 314 | AP012336.1 | GCA000284575_00274 | CDS | open | 301917-302609 | _na 230_aa | ompR | Response regulator GcrR for glucan-binding protein C |
| 315 | AP012336.1 | GCA000284575_00275 | CDS | open | 302978-303469 | _na 163_aa | nrdR | transcriptional regulator NrdR |
| 316 | AP012336.1 | GCA000284575_00276 | CDS | open | 303456-304625 | _na 389_aa | Chromosome replication protein | |
| 317 | AP012336.1 | GCA000284575_00277 | CDS | open | 304626-305525 | _na 299_aa | dnaI | primosomal protein DnaI |
| 318 | AP012336.1 | GCA000284575_00278 | CDS | open | 305538-306848 | _na 436_aa | der | ribosome biogenesis GTPase Der |
| 319 | AP012336.1 | GCA000284575_00279 | CDS | open | 306923-307549 | _na 208_aa | Sakacin A production response regulator | |
| 320 | AP012336.1 | GCA000284575_00280 | CDS | open | 307597-308235 | _na 212_aa | dedA | Membrane-associated protein DedA |
| 321 | AP012336.1 | GCA000284575_00281 | CDS | open | 308707-309459 | _na 250_aa | comE | Response regulator of the competence regulon%2C ComE response regulator of sakacin A production |
| 322 | AP012336.1 | GCA000284575_00282 | CDS | open | 309456-310781 | _na 441_aa | comD | Histidine kinase of the competence regulon%2C ComD |
| 323 | AP012336.1 | GCA000284575_00283 | CDS | open | 310923-311063 | _na 46_aa | Competence stimulating peptide | |
| 324 | AP012336.1 | GCA000284575_00284 | CDS | open | 311330-311560 | _na 76_aa | Bacteriocin class II with double-glycine leader peptide | |
| 325 | AP012336.1 | GCA000284575_00285 | CDS | open | 311691-312092 | _na 133_aa | Immunity protein%2C BLpL-like | |
| 326 | AP012336.1 | GCA000284575_00286 | CDS | open | 313473-313967 | _na 164_aa | hypothetical protein | |
| 327 | AP012336.1 | GCA000284575_00287 | CDS | open | 314038-314442 | _na 134_aa | hypothetical protein | |
| 328 | AP012336.1 | GCA000284575_00288 | CDS | open | 315217-315381 | _na 54_aa | hypothetical protein | |
| 329 | AP012336.1 | GCA000284575_00289 | CDS | open | 315786-315998 | _na 70_aa | Bacteriocin class II with double-glycine leader peptide | |
| 330 | AP012336.1 | GCA000284575_00290 | CDS | open | 316162-316350 | _na 62_aa | Bacteriocin secretion protein | |
| 331 | AP012336.1 | GCA000284575_00291 | CDS | open | 316835-317863 | _na 342_aa | Bacteriocin transport accessory protein | |
| 332 | AP012336.1 | GCA000284575_00292 | CDS | open | 318051-318212 | _na 53_aa | hypothetical protein | |
| 333 | AP012336.1 | GCA000284575_00293 | CDS | open | 318659-318853 | _na 64_aa | Bacteriocin class II with double-glycine leader peptide | |
| 334 | AP012336.1 | GCA000284575_00294 | CDS | open | 318881-319273 | _na 130_aa | hypothetical protein | |
| 335 | AP012336.1 | GCA000284575_00295 | CDS | open | 319619-319810 | _na 63_aa | ComC/BlpC family leader-containing pheromone/bacteriocin | |
| 336 | AP012336.1 | GCA000284575_00296 | CDS | open | 319860-320021 | _na 53_aa | class IIb bacteriocin%2C lactobin A/cerein 7B family | |
| 337 | AP012336.1 | GCA000284575_00297 | CDS | open | 320415-320573 | _na 52_aa | hypothetical protein | |
| 338 | AP012336.1 | GCA000284575_00298 | CDS | open | 320817-321008 | _na 63_aa | transposase | |
| 339 | AP012336.1 | GCA000284575_00299 | CDS | open | 321277-321618 | _na 113_aa | hypothetical protein | |
| 340 | AP012336.1 | GCA000284575_00300 | CDS | open | 321823-323106 | _na 427_aa | serS | serine--tRNA ligase |
| 341 | AP012336.1 | GCA000284575_00301 | CDS | open | 323630-324703 | _na 357_aa | wecH | Acyltransferase 3 domain-containing protein |
| 342 | AP012336.1 | GCA000284575_00302 | CDS | open | 324940-325308 | _na 122_aa | manO | Mannose operon ManO protein |
| 343 | AP012336.1 | GCA000284575_00303 | CDS | open | 325647-326573 | _na 308_aa | manZ | PTS system%2C mannose-specific component IID |
| 344 | AP012336.1 | GCA000284575_00304 | CDS | open | 326588-327406 | _na 272_aa | manY | PTS system%2C mannose-specific component IIC |
| 345 | AP012336.1 | GCA000284575_00305 | CDS | open | 327441-328433 | _na 330_aa | agaB | PTS system mannose-specific EIIAB component |
| 346 | AP012336.1 | GCA000284575_00306 | CDS | open | 329310-329780 | _na 156_aa | DUF2975 domain-containing protein | |
| 347 | AP012336.1 | GCA000284575_00307 | CDS | open | 329879-332242 | _na 787_aa | recD | ATP-dependent RecD2 DNA helicase |
| 348 | AP012336.1 | GCA000284575_00308 | CDS | open | 332328-332915 | _na 195_aa | lepB | signal peptidase I |
| 349 | AP012336.1 | GCA000284575_00309 | CDS | open | 332935-333855 | _na 306_aa | rnhC | ribonuclease HIII |
| 350 | AP012336.1 | GCA000284575_00310 | CDS | open | 334042-334347 | _na 101_aa | zapA | Cell division protein ZapA |
| 351 | AP012336.1 | GCA000284575_00311 | CDS | open | 334344-334889 | _na 181_aa | cvpA | Colicin V production protein |
| 352 | AP012336.1 | GCA000284575_00312 | CDS | open | 334957-337287 | _na 776_aa | mutS2 | endonuclease MutS2 |
| 353 | AP012336.1 | GCA000284575_00313 | CDS | open | 337362-337676 | _na 104_aa | trxA | thioredoxin |
| 354 | AP012336.1 | GCA000284575_00314 | CDS | open | 337774-338823 | _na 349_aa | tdh | Alcohol dehydrogenase |
| 355 | AP012336.1 | GCA000284575_00315 | CDS | open | 339015-340160 | _na 381_aa | mutY | A/G-specific adenine glycosylase |
| 356 | AP012336.1 | GCA000284575_00316 | CDS | open | 341230-341400 | _na 56_aa | hypothetical protein | |
| 357 | AP012336.1 | GCA000284575_00317 | CDS | open | 341705-341950 | _na 81_aa | Integral membrane protein | |
| 358 | AP012336.1 | GCA000284575_00318 | CDS | open | 342106-342396 | _na 96_aa | rpsF | 30S ribosomal protein S6 |
| 359 | AP012336.1 | GCA000284575_00319 | CDS | open | 342414-342908 | _na 164_aa | ssb | Single-stranded DNA-binding protein |
| 360 | AP012336.1 | GCA000284575_00320 | CDS | open | 342938-343177 | _na 79_aa | rpsR | 30S ribosomal protein S18 |
| 361 | AP012336.1 | GCA000284575_00321 | CDS | open | 343444-344646 | _na 400_aa | IS110 family transposase | |
| 362 | AP012336.1 | GCA000284575_00322 | CDS | open | 345119-345838 | _na 239_aa | traX | TraX family protein |
| 363 | AP012336.1 | GCA000284575_00323 | CDS | open | 345846-346532 | _na 228_aa | Cell wall-active antibiotics response LiaF-like C-terminal domain-containing protein | |
| 364 | AP012336.1 | GCA000284575_00324 | CDS | open | 346529-346930 | _na 133_aa | lytTR | HTH LytTR-type domain-containing protein |
| 365 | AP012336.1 | GCA000284575_00325 | CDS | open | 347024-347686 | _na 220_aa | Integral membrane protein | |
| 366 | AP012336.1 | GCA000284575_00326 | CDS | open | 347968-348912 | _na 314_aa | corA | Magnesium/cobalt transport protein |
| 367 | AP012336.1 | GCA000284575_00327 | CDS | open | 349583-352414 | _na 943_aa | uvrA | excinuclease ABC subunit UvrA |
| 368 | AP012336.1 | GCA000284575_00328 | CDS | open | 352404-353468 | _na 354_aa | pepP | Aminopeptidase P |
| 369 | AP012336.1 | GCA000284575_00329 | CDS | open | 353630-354082 | _na 150_aa | comEB | Deoxycytidylate deaminase |
| 370 | AP012336.1 | GCA000284575_00330 | CDS | open | 354130-354834 | _na 234_aa | Ion transport domain-containing protein | |
| 371 | AP012336.1 | GCA000284575_00331 | CDS | open | 354974-355534 | _na 186_aa | efp | elongation factor P |
| 372 | AP012336.1 | GCA000284575_00332 | CDS | open | 355577-355966 | _na 129_aa | yloU | Alkaline shock protein |
| 373 | AP012336.1 | GCA000284575_00333 | CDS | open | 355959-356387 | _na 142_aa | nusB | transcription antitermination factor NusB |
| 374 | AP012336.1 | GCA000284575_00334 | CDS | open | 356581-357543 | _na 320_aa | scrR | Sucrose operon repressor |
| 375 | AP012336.1 | GCA000284575_00335 | CDS | open | 357546-358985 | _na 479_aa | scrB | Sucrose-6-phosphate hydrolase |
| 376 | AP012336.1 | GCA000284575_00336 | CDS | open | 359181-361175 | _na 664_aa | scrA | PTS system sucrose-specific EIIBCA component |
| 377 | AP012336.1 | GCA000284575_00337 | CDS | open | 361375-362256 | _na 293_aa | scrK | fructokinase ScrK |
| 378 | AP012336.1 | GCA000284575_00338 | CDS | open | 362425-363375 | _na 316_aa | manA | mannose-6-phosphate isomerase%2C class I |
| 379 | AP012336.1 | GCA000284575_00339 | CDS | open | 363552-366071 | _na 839_aa | secA | preprotein translocase subunit SecA |
| 380 | AP012336.1 | GCA000284575_00340 | CDS | open | 366091-367122 | _na 343_aa | aroG1 | 3-deoxy-7-phosphoheptulonate synthase |
| 381 | AP012336.1 | GCA000284575_00341 | CDS | open | 367124-368158 | _na 344_aa | aroG1 | 3-deoxy-7-phosphoheptulonate synthase |
| 382 | AP012336.1 | GCA000284575_00342 | CDS | open | 368428-368787 | _na 119_aa | acpS | Holo-[acyl-carrier-protein] synthase |
| 383 | AP012336.1 | GCA000284575_00343 | CDS | open | 368784-369899 | _na 371_aa | alr | alanine racemase |
| 384 | AP012336.1 | GCA000284575_00344 | CDS | open | 370072-372087 | _na 671_aa | recG | ATP-dependent DNA helicase RecG |
| 385 | AP012336.1 | GCA000284575_00345 | CDS | open | 372230-372394 | _na 54_aa | hypothetical protein | |
| 386 | AP012336.1 | GCA000284575_00346 | CDS | open | 372421-373338 | _na 305_aa | ansA | L-asparaginase |
| 387 | AP012336.1 | GCA000284575_00347 | CDS | open | 373438-374838 | _na 466_aa | Haloacid dehalogenase | |
| 388 | AP012336.1 | GCA000284575_00348 | CDS | open | 375115-375564 | _na 149_aa | uspA | Universal stress protein |
| 389 | AP012336.1 | GCA000284575_00349 | CDS | open | 375662-376198 | _na 178_aa | bioY | Biotin transporter |
| 390 | AP012336.1 | GCA000284575_00350 | CDS | open | 376375-377589 | _na 404_aa | aspB | alanine transaminase |
| 391 | AP012336.1 | GCA000284575_00351 | CDS | open | 377698-378483 | _na 261_aa | codY | GTP-sensing pleiotropic transcriptional regulator CodY |
| 392 | AP012336.1 | GCA000284575_00352 | CDS | open | 378485-379036 | _na 183_aa | pncA | Pyrazinamidase/nicotinamidase |
| 393 | AP012336.1 | GCA000284575_00353 | CDS | open | 379294-381045 | _na 583_aa | aspS | aspartate--tRNA ligase |
| 394 | AP012336.1 | GCA000284575_00354 | CDS | open | 381172-381474 | _na 100_aa | gatC | Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC |
| 395 | AP012336.1 | GCA000284575_00355 | CDS | open | 381474-382940 | _na 488_aa | gatA | Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA |
| 396 | AP012336.1 | GCA000284575_00356 | CDS | open | 382940-384376 | _na 478_aa | gatB | Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB |
| 397 | AP012336.1 | GCA000284575_00357 | CDS | open | 384407-385315 | _na 302_aa | rhaT | Integral membrane protein%2C putative permease |
| 398 | AP012336.1 | GCA000284575_00358 | CDS | open | 385346-386515 | _na 389_aa | yjiC | Glycosyltransferase |
| 399 | AP012336.1 | GCA000284575_00359 | CDS | open | 386493-387143 | _na 216_aa | acrR | Transcriptional regulator |
| 400 | AP012336.1 | GCA000284575_00360 | CDS | open | 387358-387474 | _na 38_aa | hypothetical protein | |
| 401 | AP012336.1 | GCA000284575_00361 | CDS | open | 387490-388107 | _na 205_aa | Phosphoribosylglycinamide synthetase | |
| 402 | AP012336.1 | GCA000284575_00362 | CDS | open | 388212-388739 | _na 175_aa | yqeG | Hydrolase |
| 403 | AP012336.1 | GCA000284575_00363 | CDS | open | 388740-389846 | _na 368_aa | yqeH | ribosome biogenesis GTPase YqeH |
| 404 | AP012336.1 | GCA000284575_00364 | CDS | open | 389903-390211 | _na 102_aa | yhbY | ribosome assembly RNA-binding protein YhbY |
| 405 | AP012336.1 | GCA000284575_00365 | CDS | open | 390238-390870 | _na 210_aa | nadD | nicotinate-nucleotide adenylyltransferase |
| 406 | AP012336.1 | GCA000284575_00366 | CDS | open | 390867-391460 | _na 197_aa | yqeK | bis(5'-nucleosyl)-tetraphosphatase (symmetrical) YqeK |
| 407 | AP012336.1 | GCA000284575_00367 | CDS | open | 391461-391814 | _na 117_aa | rsfS | ribosome silencing factor |
| 408 | AP012336.1 | GCA000284575_00368 | CDS | open | 392025-392837 | _na 270_aa | ubiG | Methyltransferase domain-containing protein |
| 409 | AP012336.1 | GCA000284575_00369 | CDS | open | 393520-394620 | _na 366_aa | tmcAL | nucleotidyltransferase |
| 410 | AP012336.1 | GCA000284575_00370 | CDS | open | 394724-395440 | _na 238_aa | Transcriptional regulator | |
| 411 | AP012336.1 | GCA000284575_00371 | CDS | open | 395755-396471 | _na 238_aa | tACO1 | YebC/PmpR family DNA-binding transcriptional regulator |
| 412 | AP012336.1 | GCA000284575_00372 | CDS | open | 396664-397011 | _na 115_aa | trxA | Bacterocin transport accessory protein%2C Bta |
| 413 | AP012336.1 | GCA000284575_00373 | CDS | open | 397187-397570 | _na 127_aa | yajC | preprotein translocase subunit YajC |
| 414 | AP012336.1 | GCA000284575_00374 | CDS | open | 397682-398431 | _na 249_aa | uppS | isoprenyl transferase |
| 415 | AP012336.1 | GCA000284575_00375 | CDS | open | 398446-399240 | _na 264_aa | cdsA | Phosphatidate cytidylyltransferase |
| 416 | AP012336.1 | GCA000284575_00376 | CDS | open | 399256-400515 | _na 419_aa | rseP | RIP metalloprotease RseP |
| 417 | AP012336.1 | GCA000284575_00377 | CDS | open | 400542-402392 | _na 616_aa | proS | proline--tRNA ligase |
| 418 | AP012336.1 | GCA000284575_00388 | CDS | open | 408656-408976 | _na 106_aa | DUF960 domain-containing protein | |
| 419 | AP012336.1 | GCA000284575_00389 | CDS | open | 409034-409567 | _na 177_aa | ygaC | Nucleoside triphosphate/diphosphate phosphatase |
| 420 | AP012336.1 | GCA000284575_00390 | CDS | open | 409653-410429 | _na 258_aa | recX | recombination regulator RecX |
| 421 | AP012336.1 | GCA000284575_00391 | CDS | open | 410465-411844 | _na 459_aa | rlmD | 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD |
| 422 | AP012336.1 | GCA000284575_00392 | CDS | open | 411854-412315 | _na 153_aa | nrdI | class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI |
| 423 | AP012336.1 | GCA000284575_00393 | CDS | open | 412569-412814 | _na 81_aa | DNA-damage-inducible protein J | |
| 424 | AP012336.1 | GCA000284575_00395 | CDS | open | 413720-413974 | _na 84_aa | Aldose 1-epimerase | |
| 425 | AP012336.1 | GCA000284575_00396 | CDS | open | 414219-414422 | _na 67_aa | hypothetical protein | |
| 426 | AP012336.1 | GCA000284575_00397 | CDS | open | 414464-415045 | _na 193_aa | rutF | Putative cytosolic protein |
| 427 | AP012336.1 | GCA000284575_00398 | CDS | open | 415045-415623 | _na 192_aa | rimL | GNAT family N-acetyltransferase |
| 428 | AP012336.1 | GCA000284575_00399 | CDS | open | 415706-416599 | _na 297_aa | hypothetical protein | |
| 429 | AP012336.1 | GCA000284575_00400 | CDS | open | 416611-419259 | _na 882_aa | valS | valine--tRNA ligase |
| 430 | AP012336.1 | GCA000284575_00401 | CDS | open | 419275-419439 | _na 54_aa | hicA | HicA toxin of toxin-antitoxin |
| 431 | AP012336.1 | GCA000284575_00402 | CDS | open | 419835-420131 | _na 98_aa | SpoVT-AbrB domain-containing protein | |
| 432 | AP012336.1 | GCA000284575_00403 | CDS | open | 420269-420514 | _na 81_aa | PIN domain-containing protein | |
| 433 | AP012336.1 | GCA000284575_00404 | CDS | open | 420798-421772 | _na 324_aa | WYL domain-containing protein | |
| 434 | AP012336.1 | GCA000284575_00405 | CDS | open | 422023-424413 | _na 796_aa | cas3 | CRISPR-Cas type I system-associated endonuclease/helicase Cas3 |
| 435 | AP012336.1 | GCA000284575_00406 | CDS | open | 424658-425386 | _na 242_aa | cas5c | type I-C CRISPR-associated protein Cas5c |
| 436 | AP012336.1 | GCA000284575_00407 | CDS | open | 425386-427281 | _na 631_aa | cas8c | type I-C CRISPR-associated protein Cas8c/Csd1 |
| 437 | AP012336.1 | GCA000284575_00408 | CDS | open | 427285-428136 | _na 283_aa | cas7c | type I-C CRISPR-associated protein Cas7/Csd2 |
| 438 | AP012336.1 | GCA000284575_00409 | CDS | open | 428138-428809 | _na 223_aa | cas4 | CRISPR-associated protein Cas4 |
| 439 | AP012336.1 | GCA000284575_00410 | CDS | open | 428806-429831 | _na 341_aa | cas1c | type I-C CRISPR-associated endonuclease Cas1c |
| 440 | AP012336.1 | GCA000284575_00411 | CDS | open | 429842-430135 | _na 97_aa | cas2 | CRISPR-associated endonuclease Cas2 |
| 441 | AP012336.1 | GCA000284575_00426 | CDS | open | 439103-440461 | _na 452_aa | metL1 | aspartate kinase |
| 442 | AP012336.1 | GCA000284575_00427 | CDS | open | 440560-441204 | _na 214_aa | ycjU | Phosphatase |
| 443 | AP012336.1 | GCA000284575_00428 | CDS | open | 441366-442157 | _na 263_aa | fabM | enoyl-CoA hydratase |
| 444 | AP012336.1 | GCA000284575_00429 | CDS | open | 442486-442920 | _na 144_aa | marR | Transcriptional regulator |
| 445 | AP012336.1 | GCA000284575_00430 | CDS | open | 442920-443897 | _na 325_aa | fabH | Beta-ketoacyl-[acyl-carrier-protein] synthase III |
| 446 | AP012336.1 | GCA000284575_00431 | CDS | open | 443957-444181 | _na 74_aa | acpP | Acyl carrier protein |
| 447 | AP012336.1 | GCA000284575_00432 | CDS | open | 444284-445249 | _na 321_aa | fabK | enoyl-[acyl-carrier-protein] reductase FabK |
| 448 | AP012336.1 | GCA000284575_00433 | CDS | open | 445252-446172 | _na 306_aa | fabD | ACP S-malonyltransferase |
| 449 | AP012336.1 | GCA000284575_00434 | CDS | open | 446187-446921 | _na 244_aa | fabG | 3-oxoacyl-[acyl-carrier-protein] reductase |
| 450 | AP012336.1 | GCA000284575_00435 | CDS | open | 446970-448202 | _na 410_aa | fabF | beta-ketoacyl-ACP synthase II |
| 451 | AP012336.1 | GCA000284575_00436 | CDS | open | 448205-448693 | _na 162_aa | accB | acetyl-CoA carboxylase biotin carboxyl carrier protein |
| 452 | AP012336.1 | GCA000284575_00437 | CDS | open | 448690-449112 | _na 140_aa | fabZ | 3-hydroxyacyl-ACP dehydratase FabZ |
| 453 | AP012336.1 | GCA000284575_00438 | CDS | open | 449280-450650 | _na 456_aa | accC | acetyl-CoA carboxylase biotin carboxylase subunit |
| 454 | AP012336.1 | GCA000284575_00439 | CDS | open | 450659-451525 | _na 288_aa | accD | acetyl-CoA carboxylase%2C carboxyltransferase subunit beta |
| 455 | AP012336.1 | GCA000284575_00440 | CDS | open | 451522-452292 | _na 256_aa | accA | acetyl-CoA carboxylase carboxyl transferase subunit alpha |
| 456 | AP012336.1 | GCA000284575_00441 | CDS | open | 452408-455500 | _na 1030_aa | hepA | SNF helicase |
| 457 | AP012336.1 | GCA000284575_00442 | CDS | open | 455562-456053 | _na 163_aa | Cystathionine gamma-synthase | |
| 458 | AP012336.1 | GCA000284575_00443 | CDS | open | 456168-457499 | _na 443_aa | murC | UDP-N-acetylmuramate--L-alanine ligase |
| 459 | AP012336.1 | GCA000284575_00444 | CDS | open | 457552-458043 | _na 163_aa | yhbS | Acetyltransferase |
| 460 | AP012336.1 | GCA000284575_00445 | CDS | open | 458139-460061 | _na 640_aa | Endolytic murein transglycosylase | |
| 461 | AP012336.1 | GCA000284575_00446 | CDS | open | 460197-460679 | _na 160_aa | greA | transcription elongation factor GreA |
| 462 | AP012336.1 | GCA000284575_00447 | CDS | open | 461092-462024 | _na 310_aa | yidC2 | membrane protein insertase YidC2 |
| 463 | AP012336.1 | GCA000284575_00448 | CDS | open | 462116-462394 | _na 92_aa | acyP | acylphosphatase |
| 464 | AP012336.1 | GCA000284575_00449 | CDS | open | 462427-463167 | _na 246_aa | rRNA methylase | |
| 465 | AP012336.1 | GCA000284575_00450 | CDS | open | 463202-463705 | _na 167_aa | rnaY | HD domain-containing protein |
| 466 | AP012336.1 | GCA000284575_00451 | CDS | open | 463725-464414 | _na 229_aa | ybhL | Integral membrane protein |
| 467 | AP012336.1 | GCA000284575_00452 | CDS | open | 464603-465853 | _na 416_aa | lysA | Diaminopimelate decarboxylase |
| 468 | AP012336.1 | GCA000284575_00453 | CDS | open | 466228-466476 | _na 82_aa | yneF | UPF0154 protein SMU_1719c |
| 469 | AP012336.1 | GCA000284575_00454 | CDS | open | 466529-467323 | _na 264_aa | racE | glutamate racemase |
| 470 | AP012336.1 | GCA000284575_00455 | CDS | open | 467320-468297 | _na 325_aa | nucleoside-triphosphate diphosphatase | |
| 471 | AP012336.1 | GCA000284575_00456 | CDS | open | 468279-468797 | _na 172_aa | yfcE | Phosphoesterase |
| 472 | AP012336.1 | GCA000284575_00457 | CDS | open | 468794-469255 | _na 153_aa | cbpB | cyclic-di-AMP-binding protein CbpB |
| 473 | AP012336.1 | GCA000284575_00458 | CDS | open | 469252-469989 | _na 245_aa | xerD | site-specific tyrosine recombinase XerD |
| 474 | AP012336.1 | GCA000284575_00459 | CDS | open | 469989-470696 | _na 235_aa | scpA | segregation/condensation protein A |
| 475 | AP012336.1 | GCA000284575_00460 | CDS | open | 470693-471289 | _na 198_aa | scpB | SMC-Scp complex subunit ScpB |
| 476 | AP012336.1 | GCA000284575_00461 | CDS | open | 471279-472001 | _na 240_aa | rsuA | Pseudouridine synthase |
| 477 | AP012336.1 | GCA000284575_00462 | CDS | open | 472001-472255 | _na 84_aa | yidD | membrane protein insertion efficiency factor YidD |
| 478 | AP012336.1 | GCA000284575_00463 | CDS | open | 472322-473761 | _na 479_aa | trkH | Potassium uptake protein TrkH |
| 479 | AP012336.1 | GCA000284575_00464 | CDS | open | 473768-475123 | _na 451_aa | trkA | Trk system potassium transporter TrkA |
| 480 | AP012336.1 | GCA000284575_00465 | CDS | open | 475588-476136 | _na 182_aa | trmL | Putative tRNA (cytidine(34)-2'-O)-methyltransferase |
| 481 | AP012336.1 | GCA000284575_00466 | CDS | open | 476315-477142 | _na 275_aa | DUF4097 domain-containing protein | |
| 482 | AP012336.1 | GCA000284575_00467 | CDS | open | 477139-477735 | _na 198_aa | DUF1700 domain-containing protein | |
| 483 | AP012336.1 | GCA000284575_00468 | CDS | open | 477722-478048 | _na 108_aa | padR | Transcription regulator PadR N-terminal domain-containing protein |
| 484 | AP012336.1 | GCA000284575_00469 | CDS | open | 478576-479148 | _na 190_aa | fmnP | Riboflavin transporter |
| 485 | AP012336.1 | GCA000284575_00470 | CDS | open | 479138-479788 | _na 216_aa | pgpB | Phosphatase |
| 486 | AP012336.1 | GCA000284575_00471 | CDS | open | 479954-480316 | _na 120_aa | lrgA | Murein hydrolase regulator LrgA |
| 487 | AP012336.1 | GCA000284575_00472 | CDS | open | 480313-481008 | _na 231_aa | lrgB | Putative effector of murein hydrolase |
| 488 | AP012336.1 | GCA000284575_00473 | CDS | open | 481113-482045 | _na 310_aa | TIGR01212 family radical SAM protein | |
| 489 | AP012336.1 | GCA000284575_00474 | CDS | open | 482042-482587 | _na 181_aa | SAM-dependent methyltransferase | |
| 490 | AP012336.1 | GCA000284575_00475 | CDS | open | 482722-483504 | _na 260_aa | abcX | Putative ABC transporter ATP-binding protein |
| 491 | AP012336.1 | GCA000284575_00476 | CDS | open | 483581-484675 | _na 364_aa | perM | Permease |
| 492 | AP012336.1 | GCA000284575_00477 | CDS | open | 484711-486048 | _na 445_aa | mpfA | Hemolysin |
| 493 | AP012336.1 | GCA000284575_00478 | CDS | open | 486123-486914 | _na 263_aa | pflA | pyruvate formate-lyase-activating protein |
| 494 | AP012336.1 | GCA000284575_00479 | CDS | open | 487730-489280 | _na 516_aa | dltA | D-alanine--poly(phosphoribitol) ligase subunit DltA |
| 495 | AP012336.1 | GCA000284575_00480 | CDS | open | 489277-490539 | _na 420_aa | dltB | D-alanyl-lipoteichoic acid biosynthesis protein DltB |
| 496 | AP012336.1 | GCA000284575_00481 | CDS | open | 490554-490793 | _na 79_aa | dltC | D-alanine--poly(phosphoribitol) ligase subunit DltC |
| 497 | AP012336.1 | GCA000284575_00482 | CDS | open | 490786-492051 | _na 421_aa | dltD | D-alanyl-lipoteichoic acid biosynthesis protein DltD |
| 498 | AP012336.1 | GCA000284575_00483 | CDS | open | 492113-493045 | _na 310_aa | ppaC | manganese-dependent inorganic pyrophosphatase |
| 499 | AP012336.1 | GCA000284575_00484 | CDS | open | 493253-493903 | _na 216_aa | DUF1803 domain-containing protein | |
| 500 | AP012336.1 | GCA000284575_00485 | CDS | open | 493961-494884 | _na 307_aa | yobV | HTH deoR-type domain-containing protein |
