HOMD Banner
Taxonomy: V4.3   |  16S rRNA RefSeq: V16.03   |  Genomic RefSeq: V11.03   |  Viruses: V1.2

BAKTAGenome Explorer: Actinomyces israelii (GCA_000711965.1)

Select a Genome:
BAKTA Annotations for GCA_000711965.1
Genome Selected: Actinomyces israelii
ContigsBases CDSrRNA tmRNAtRNA
102 4,025,772 3302 3 1 51
[Table]   [AA Fasta]      [Browser]   [Text]   [Excel]  
Search & Sort all 6745 Records
Search These Records: Clear
Sort Column:   Molecule   PID   NA   AA   Gene  Gene Product  Reverse
Annotation Table [page:13]    |    Number of Records Found: 6745 [14 Pages]    |    Previous Page <==> Next Page    |    Jump to Page: [ 1  2  3  4  5  6  7  8  9  10  11  12  13  14  ]
Notes:   1- Column headers only sort the current page. 2- Select [NA] or [AA] links to show sequences.
Region Protein-ID Type Genome
Viewer		 Range
(bp)		 Show Sequences
(length) NA / AA		 BAKTA
Gene		 BAKTA
GeneProduct
6001 JONS01000070.1 GCA000711965_03224 CDS open 8320-9600 _na     426_aa SGNH/GDSL hydrolase family protein
6002 JONS01000070.1 GCA000711965_03225 CDS open 11100-11435 _na     111_aa hypothetical protein
6003 JONS01000070.1 GCA000711965_03226 CDS open 12063-12257 _na     64_aa hypothetical protein
6004 JONS01000070.1 GCA000711965_03214 gene open 421-1728
6005 JONS01000070.1 GCA000711965_03215 gene open 1770-2345 cysE
6006 JONS01000070.1 GCA000711965_03216 gene open 2548-3480 cysK
6007 JONS01000070.1 GCA000711965_03217 gene open 3936-4661 yigZ
6008 JONS01000070.1 GCA000711965_03218 gene open 4855-5019 rpmF
6009 JONS01000070.1 GCA000711965_03221 gene open 5428-5982
6010 JONS01000070.1 GCA000711965_03222 gene open 6000-6311
6011 JONS01000070.1 GCA000711965_03223 gene open 6311-6583
6012 JONS01000070.1 GCA000711965_03224 gene open 8320-9600
6013 JONS01000070.1 GCA000711965_03225 gene open 11100-11435
6014 JONS01000070.1 GCA000711965_03226 gene open 12063-12257
6015 JONS01000070.1 GCA000711965_03219 gene open 5085-5155 trnG
6016 JONS01000070.1 GCA000711965_03220 gene open 5208-5284 trnP
6017 JONS01000070.1 GCA000711965_03219 tRNA open 5085-5155 trnG tRNA-Gly(tcc)
6018 JONS01000070.1 GCA000711965_03220 tRNA open 5208-5284 trnP tRNA-Pro(tgg)
6019 JONS01000071.1 GCA000711965_03227 CDS open 369-1031 _na     220_aa histidine kinase
6020 JONS01000071.1 GCA000711965_03228 CDS open 1001-1411 _na     136_aa sensor histidine kinase
6021 JONS01000071.1 GCA000711965_03229 CDS open 1408-2076 _na     222_aa response regulator transcription factor
6022 JONS01000071.1 GCA000711965_03230 CDS open 2263-2994 _na     243_aa ubiG bifunctional 2-polyprenyl-6-hydroxyphenol methylase/3-demethylubiquinol 3-O-methyltransferase UbiG
6023 JONS01000071.1 GCA000711965_03231 CDS open 3105-4487 _na     460_aa amino acid permease
6024 JONS01000071.1 GCA000711965_03232 CDS open 4586-6331 _na     581_aa DUF2079 domain-containing protein
6025 JONS01000071.1 GCA000711965_03233 CDS open 6321-6794 _na     157_aa crcB CrcB family protein
6026 JONS01000071.1 GCA000711965_03234 CDS open 6791-7237 _na     148_aa crcB CrcB family protein
6027 JONS01000071.1 GCA000711965_03235 CDS open 7340-7858 _na     172_aa nfeD nodulation protein NfeD
6028 JONS01000071.1 GCA000711965_03236 CDS open 7914-9359 _na     481_aa Band 7 domain-containing protein
6029 JONS01000071.1 GCA000711965_03237 CDS open 9558-10397 _na     279_aa thioredoxin domain-containing protein
6030 JONS01000071.1 GCA000711965_03238 CDS open 10660-11604 _na     314_aa ROK family glucokinase
6031 JONS01000071.1 GCA000711965_03227 gene open 369-1031
6032 JONS01000071.1 GCA000711965_03228 gene open 1001-1411
6033 JONS01000071.1 GCA000711965_03229 gene open 1408-2076
6034 JONS01000071.1 GCA000711965_03230 gene open 2263-2994 ubiG
6035 JONS01000071.1 GCA000711965_03231 gene open 3105-4487
6036 JONS01000071.1 GCA000711965_03232 gene open 4586-6331
6037 JONS01000071.1 GCA000711965_03233 gene open 6321-6794 crcB
6038 JONS01000071.1 GCA000711965_03234 gene open 6791-7237 crcB
6039 JONS01000071.1 GCA000711965_03235 gene open 7340-7858 nfeD
6040 JONS01000071.1 GCA000711965_03236 gene open 7914-9359
6041 JONS01000071.1 GCA000711965_03237 gene open 9558-10397
6042 JONS01000071.1 GCA000711965_03238 gene open 10660-11604
6043 JONS01000072.1 GCA000711965_03239 CDS open 1106-1216 _na     36_aa Transposase
6044 JONS01000072.1 GCA000711965_03240 CDS open 1490-3346 _na     618_aa alpha-glucosidase
6045 JONS01000072.1 GCA000711965_03241 CDS open 3475-4644 _na     389_aa ROK family transcriptional regulator
6046 JONS01000072.1 GCA000711965_03242 CDS open 4781-7306 _na     841_aa glycoside hydrolase family 31 protein
6047 JONS01000072.1 GCA000711965_03243 CDS open 7360-8205 _na     281_aa SDR family oxidoreductase
6048 JONS01000072.1 GCA000711965_03244 CDS open 8224-9105 _na     293_aa carbohydrate ABC transporter permease
6049 JONS01000072.1 GCA000711965_03245 CDS open 9102-10166 _na     354_aa carbohydrate ABC transporter permease
6050 JONS01000072.1 GCA000711965_03246 CDS open 10314-11603 _na     429_aa ABC transporter substrate-binding protein
6051 JONS01000072.1 GCA000711965_03239 gene open 1106-1216
6052 JONS01000072.1 GCA000711965_03240 gene open 1490-3346
6053 JONS01000072.1 GCA000711965_03241 gene open 3475-4644
6054 JONS01000072.1 GCA000711965_03242 gene open 4781-7306
6055 JONS01000072.1 GCA000711965_03243 gene open 7360-8205
6056 JONS01000072.1 GCA000711965_03244 gene open 8224-9105
6057 JONS01000072.1 GCA000711965_03245 gene open 9102-10166
6058 JONS01000072.1 GCA000711965_03246 gene open 10314-11603
6059 JONS01000073.1 GCA000711965_03247 gene open 102-211 Actinomyces-1
6060 JONS01000073.1 GCA000711965_03247 ncRNA open 102-211 Actinomyces-1 RNA
6061 JONS01000073.1 GCA000711965_03248 CDS open 384-827 _na     147_aa Rv3654c family TadE-like protein
6062 JONS01000073.1 GCA000711965_03249 CDS open 824-1138 _na     104_aa tadE TadE family protein
6063 JONS01000073.1 GCA000711965_03250 CDS open 1217-1459 _na     80_aa DUF4244 domain-containing protein
6064 JONS01000073.1 GCA000711965_03251 CDS open 1711-5352 _na     1213_aa DEAD/DEAH box helicase
6065 JONS01000073.1 GCA000711965_03252 CDS open 5491-7209 _na     572_aa Transporter%2C CPA2 family
6066 JONS01000073.1 GCA000711965_03253 CDS open 7581-8729 _na     382_aa ATP-binding protein
6067 JONS01000073.1 GCA000711965_03254 CDS open 9015-9665 _na     216_aa SMI1/KNR4 family protein
6068 JONS01000073.1 GCA000711965_03255 CDS open 9813-10940 _na     375_aa AAA domain-containing protein
6069 JONS01000073.1 GCA000711965_03248 gene open 384-827
6070 JONS01000073.1 GCA000711965_03249 gene open 824-1138 tadE
6071 JONS01000073.1 GCA000711965_03250 gene open 1217-1459
6072 JONS01000073.1 GCA000711965_03251 gene open 1711-5352
6073 JONS01000073.1 GCA000711965_03252 gene open 5491-7209
6074 JONS01000073.1 GCA000711965_03253 gene open 7581-8729
6075 JONS01000073.1 GCA000711965_03254 gene open 9015-9665
6076 JONS01000073.1 GCA000711965_03255 gene open 9813-10940
6077 JONS01000074.1 GCA000711965_03256 CDS open 488-2761 _na     757_aa hypothetical protein
6078 JONS01000074.1 GCA000711965_03257 CDS open 3651-4058 _na     135_aa hypothetical protein
6079 JONS01000074.1 GCA000711965_03258 CDS open 4462-4758 _na     98_aa hypothetical protein
6080 JONS01000074.1 GCA000711965_03259 CDS open 5198-5551 _na     117_aa fdxA ferredoxin
6081 JONS01000074.1 GCA000711965_03260 CDS open 5619-6860 _na     413_aa dapC succinyldiaminopimelate transaminase
6082 JONS01000074.1 GCA000711965_03261 CDS open 7251-8639 _na     462_aa citrate synthase
6083 JONS01000074.1 GCA000711965_03262 CDS open 8745-9383 _na     212_aa NYN domain-containing protein
6084 JONS01000074.1 GCA000711965_03263 CDS open 9544-10350 _na     268_aa class I SAM-dependent methyltransferase
6085 JONS01000074.1 GCA000711965_03264 CDS open 10557-10772 _na     71_aa hypothetical protein
6086 JONS01000074.1 GCA000711965_03256 gene open 488-2761
6087 JONS01000074.1 GCA000711965_03257 gene open 3651-4058
6088 JONS01000074.1 GCA000711965_03258 gene open 4462-4758
6089 JONS01000074.1 GCA000711965_03259 gene open 5198-5551 fdxA
6090 JONS01000074.1 GCA000711965_03260 gene open 5619-6860 dapC
6091 JONS01000074.1 GCA000711965_03261 gene open 7251-8639
6092 JONS01000074.1 GCA000711965_03262 gene open 8745-9383
6093 JONS01000074.1 GCA000711965_03263 gene open 9544-10350
6094 JONS01000074.1 GCA000711965_03264 gene open 10557-10772
6095 JONS01000075.1 GCA000711965_03265 CDS open 90-1376 _na     428_aa eno phosphopyruvate hydratase
6096 JONS01000075.1 GCA000711965_03266 CDS open 1555-2136 _na     193_aa Lipoprotein
6097 JONS01000075.1 GCA000711965_03267 CDS open 2730-2969 _na     79_aa hypothetical protein
6098 JONS01000075.1 GCA000711965_03268 CDS open 3022-4125 _na     367_aa ABC transporter permease
6099 JONS01000075.1 GCA000711965_03269 CDS open 4122-5231 _na     369_aa Efflux ABC transporter%2C permease protein
6100 JONS01000075.1 GCA000711965_03270 CDS open 5271-5948 _na     225_aa ABC transporter ATP-binding protein
6101 JONS01000075.1 GCA000711965_03271 CDS open 6093-6764 _na     223_aa luxR LuxR C-terminal-related transcriptional regulator
6102 JONS01000075.1 GCA000711965_03272 CDS open 6852-7538 _na     228_aa TetR/AcrR family transcriptional regulator
6103 JONS01000075.1 GCA000711965_03273 CDS open 7538-7993 _na     151_aa doxX DoxX family protein
6104 JONS01000075.1 GCA000711965_03274 CDS open 8041-8958 _na     305_aa arsenic resistance protein
6105 JONS01000075.1 GCA000711965_03275 CDS open 9011-9430 _na     139_aa DUF6941 domain-containing protein
6106 JONS01000075.1 GCA000711965_03276 CDS open 9728-10063 _na     111_aa DUF2283 domain-containing protein
6107 JONS01000075.1 GCA000711965_03265 gene open 90-1376 eno
6108 JONS01000075.1 GCA000711965_03266 gene open 1555-2136
6109 JONS01000075.1 GCA000711965_03267 gene open 2730-2969
6110 JONS01000075.1 GCA000711965_03268 gene open 3022-4125
6111 JONS01000075.1 GCA000711965_03269 gene open 4122-5231
6112 JONS01000075.1 GCA000711965_03270 gene open 5271-5948
6113 JONS01000075.1 GCA000711965_03271 gene open 6093-6764 luxR
6114 JONS01000075.1 GCA000711965_03272 gene open 6852-7538
6115 JONS01000075.1 GCA000711965_03273 gene open 7538-7993 doxX
6116 JONS01000075.1 GCA000711965_03274 gene open 8041-8958
6117 JONS01000075.1 GCA000711965_03275 gene open 9011-9430
6118 JONS01000075.1 GCA000711965_03276 gene open 9728-10063
6119 JONS01000076.1 GCA000711965_03283 gene open 4950-5331 RNaseP_bact_a
6120 JONS01000076.1 GCA000711965_03283 ncRNA open 4950-5331 Bacterial RNase P class A
6121 JONS01000076.1 GCA000711965_03277 CDS open 270-845 _na     191_aa nhaA Na+/H+ antiporter NhaA
6122 JONS01000076.1 GCA000711965_03278 CDS open 945-1700 _na     251_aa N-acyl homoserine lactonase family protein
6123 JONS01000076.1 GCA000711965_03279 CDS open 1697-1822 _na     41_aa hypothetical protein
6124 JONS01000076.1 GCA000711965_03280 CDS open 1832-2566 _na     244_aa histidine phosphatase family protein
6125 JONS01000076.1 GCA000711965_03281 CDS open 2632-3522 _na     296_aa map type I methionyl aminopeptidase
6126 JONS01000076.1 GCA000711965_03282 CDS open 3710-4840 _na     376_aa DUF4352 domain-containing protein
6127 JONS01000076.1 GCA000711965_03284 CDS open 5403-6134 _na     243_aa zinc ribbon domain-containing protein
6128 JONS01000076.1 GCA000711965_03285 CDS open 6147-7052 _na     301_aa Nif3-like dinuclear metal center hexameric protein
6129 JONS01000076.1 GCA000711965_03286 CDS open 7219-8112 _na     297_aa helix-turn-helix transcriptional regulator
6130 JONS01000076.1 GCA000711965_03287 CDS open 8205-8369 _na     54_aa hypothetical protein
6131 JONS01000076.1 GCA000711965_03277 gene open 270-845 nhaA
6132 JONS01000076.1 GCA000711965_03278 gene open 945-1700
6133 JONS01000076.1 GCA000711965_03279 gene open 1697-1822
6134 JONS01000076.1 GCA000711965_03280 gene open 1832-2566
6135 JONS01000076.1 GCA000711965_03281 gene open 2632-3522 map
6136 JONS01000076.1 GCA000711965_03282 gene open 3710-4840
6137 JONS01000076.1 GCA000711965_03284 gene open 5403-6134
6138 JONS01000076.1 GCA000711965_03285 gene open 6147-7052
6139 JONS01000076.1 GCA000711965_03286 gene open 7219-8112
6140 JONS01000076.1 GCA000711965_03287 gene open 8205-8369
6141 JONS01000077.1 GCA000711965_03288 CDS open 176-997 _na     273_aa hypothetical protein
6142 JONS01000077.1 GCA000711965_03289 CDS open 1079-2248 _na     389_aa branched-chain amino acid aminotransferase
6143 JONS01000077.1 GCA000711965_03290 CDS open 2350-3471 _na     373_aa LCP family protein
6144 JONS01000077.1 GCA000711965_03291 CDS open 3583-4680 _na     365_aa polysaccharide pyruvyl transferase family protein
6145 JONS01000077.1 GCA000711965_03292 CDS open 4717-6189 _na     490_aa sugar transferase
6146 JONS01000077.1 GCA000711965_03293 CDS open 6261-6749 _na     162_aa hypothetical protein
6147 JONS01000077.1 GCA000711965_03288 gene open 176-997
6148 JONS01000077.1 GCA000711965_03289 gene open 1079-2248
6149 JONS01000077.1 GCA000711965_03290 gene open 2350-3471
6150 JONS01000077.1 GCA000711965_03291 gene open 3583-4680
6151 JONS01000077.1 GCA000711965_03292 gene open 4717-6189
6152 JONS01000077.1 GCA000711965_03293 gene open 6261-6749
6153 JONS01000078.1 GCA000711965_03294 CDS open 142-372 _na     76_aa hypothetical protein
6154 JONS01000078.1 GCA000711965_03295 CDS open 959-2206 _na     415_aa Arginine deiminase
6155 JONS01000078.1 GCA000711965_03296 CDS open 2280-3746 _na     488_aa arcD arginine-ornithine antiporter
6156 JONS01000078.1 GCA000711965_03297 CDS open 3959-4243 _na     94_aa arginine repressor
6157 JONS01000078.1 GCA000711965_03298 CDS open 4345-6972 _na     875_aa hrpB ATP-dependent helicase HrpB
6158 JONS01000078.1 GCA000711965_03294 gene open 142-372
6159 JONS01000078.1 GCA000711965_03295 gene open 959-2206
6160 JONS01000078.1 GCA000711965_03296 gene open 2280-3746 arcD
6161 JONS01000078.1 GCA000711965_03297 gene open 3959-4243
6162 JONS01000078.1 GCA000711965_03298 gene open 4345-6972 hrpB
6163 JONS01000079.1 GCA000711965_03299 CDS open 519-1823 _na     434_aa tyrS tyrosine--tRNA ligase
6164 JONS01000079.1 GCA000711965_03300 CDS open 1998-2675 _na     225_aa endonuclease III domain-containing protein
6165 JONS01000079.1 GCA000711965_03301 CDS open 2672-3295 _na     207_aa ubiG bifunctional 2-polyprenyl-6-hydroxyphenol methylase/3-demethylubiquinol 3-O-methyltransferase UbiG
6166 JONS01000079.1 GCA000711965_03302 CDS open 3295-3960 _na     221_aa DNA-3-methyladenine glycosylase
6167 JONS01000079.1 GCA000711965_03303 CDS open 3965-5455 _na     496_aa argH argininosuccinate lyase
6168 JONS01000079.1 GCA000711965_03304 CDS open 5571-6863 _na     430_aa O-antigen ligase
6169 JONS01000079.1 GCA000711965_03299 gene open 519-1823 tyrS
6170 JONS01000079.1 GCA000711965_03300 gene open 1998-2675
6171 JONS01000079.1 GCA000711965_03301 gene open 2672-3295 ubiG
6172 JONS01000079.1 GCA000711965_03302 gene open 3295-3960
6173 JONS01000079.1 GCA000711965_03303 gene open 3965-5455 argH
6174 JONS01000079.1 GCA000711965_03304 gene open 5571-6863
6175 JONS01000080.1 GCA000711965_03305 CDS open 570-1445 _na     291_aa mafI MafI family immunity protein
6176 JONS01000080.1 GCA000711965_03306 CDS open 2108-2443 _na     111_aa hypothetical protein
6177 JONS01000080.1 GCA000711965_03307 CDS open 2538-3398 _na     286_aa zeta toxin family protein
6178 JONS01000080.1 GCA000711965_03308 CDS open 3395-3748 _na     117_aa hypothetical protein
6179 JONS01000080.1 GCA000711965_03309 CDS open 4293-4439 _na     48_aa hypothetical protein
6180 JONS01000080.1 GCA000711965_03310 CDS open 4458-4742 _na     94_aa hypothetical protein
6181 JONS01000080.1 GCA000711965_03311 CDS open 4755-5144 _na     129_aa hypothetical protein
6182 JONS01000080.1 GCA000711965_03312 CDS open 5047-5784 _na     245_aa hypothetical protein
6183 JONS01000080.1 GCA000711965_03313 CDS open 5877-6905 _na     342_aa S1 motif domain-containing protein
6184 JONS01000080.1 GCA000711965_03305 gene open 570-1445 mafI
6185 JONS01000080.1 GCA000711965_03306 gene open 2108-2443
6186 JONS01000080.1 GCA000711965_03307 gene open 2538-3398
6187 JONS01000080.1 GCA000711965_03308 gene open 3395-3748
6188 JONS01000080.1 GCA000711965_03309 gene open 4293-4439
6189 JONS01000080.1 GCA000711965_03310 gene open 4458-4742
6190 JONS01000080.1 GCA000711965_03311 gene open 4755-5144
6191 JONS01000080.1 GCA000711965_03312 gene open 5047-5784
6192 JONS01000080.1 GCA000711965_03313 gene open 5877-6905
6193 JONS01000081.1 GCA000711965_03314 CDS open 32-277 _na     81_aa hypothetical protein
6194 JONS01000081.1 GCA000711965_03315 CDS open 277-1398 _na     373_aa DegT/DnrJ/EryC1/StrS aminotransferase family protein
6195 JONS01000081.1 GCA000711965_03316 CDS open 1402-2418 _na     338_aa Gfo/Idh/MocA family protein
6196 JONS01000081.1 GCA000711965_03317 CDS open 2508-3752 _na     414_aa lipopolysaccharide biosynthesis protein
6197 JONS01000081.1 GCA000711965_03318 CDS open 3749-5062 _na     437_aa glycosyltransferase
6198 JONS01000081.1 GCA000711965_03319 CDS open 5418-6155 _na     245_aa hypothetical protein
6199 JONS01000081.1 GCA000711965_03314 gene open 32-277
6200 JONS01000081.1 GCA000711965_03315 gene open 277-1398
6201 JONS01000081.1 GCA000711965_03316 gene open 1402-2418
6202 JONS01000081.1 GCA000711965_03317 gene open 2508-3752
6203 JONS01000081.1 GCA000711965_03318 gene open 3749-5062
6204 JONS01000081.1 GCA000711965_03319 gene open 5418-6155
6205 JONS01000082.1 GCA000711965_03320 CDS open 249-686 _na     145_aa Helix-turn-helix domain-containing protein
6206 JONS01000082.1 GCA000711965_03321 CDS open 834-1991 _na     385_aa Phosphotransferase system EIIC domain-containing protein
6207 JONS01000082.1 GCA000711965_03322 CDS open 2160-2660 _na     166_aa 3H domain protein
6208 JONS01000082.1 GCA000711965_03323 CDS open 3307-3552 _na     81_aa nrdH glutaredoxin-like protein NrdH
6209 JONS01000082.1 GCA000711965_03324 CDS open 3558-3983 _na     141_aa nrdI class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI
6210 JONS01000082.1 GCA000711965_03325 CDS open 3968-4177 _na     69_aa hypothetical protein
6211 JONS01000082.1 GCA000711965_03326 CDS open 4476-4793 _na     105_aa hypothetical protein
6212 JONS01000082.1 GCA000711965_03327 CDS open 4829-5995 _na     388_aa ISAs1 family transposase
6213 JONS01000082.1 GCA000711965_03320 gene open 249-686
6214 JONS01000082.1 GCA000711965_03321 gene open 834-1991
6215 JONS01000082.1 GCA000711965_03322 gene open 2160-2660
6216 JONS01000082.1 GCA000711965_03323 gene open 3307-3552 nrdH
6217 JONS01000082.1 GCA000711965_03324 gene open 3558-3983 nrdI
6218 JONS01000082.1 GCA000711965_03325 gene open 3968-4177
6219 JONS01000082.1 GCA000711965_03326 gene open 4476-4793
6220 JONS01000082.1 GCA000711965_03327 gene open 4829-5995
6221 JONS01000083.1 GCA000711965_03328 CDS open 514-1098 _na     194_aa isochorismatase family protein
6222 JONS01000083.1 GCA000711965_03329 CDS open 1140-2063 _na     307_aa rsmI 16S rRNA (cytidine(1402)-2'-O)-methyltransferase
6223 JONS01000083.1 GCA000711965_03330 CDS open 2193-4076 _na     627_aa phospholipid carrier-dependent glycosyltransferase
6224 JONS01000083.1 GCA000711965_03328 gene open 514-1098
6225 JONS01000083.1 GCA000711965_03329 gene open 1140-2063 rsmI
6226 JONS01000083.1 GCA000711965_03330 gene open 2193-4076
6227 JONS01000084.1 GCA000711965_03331 CDS open 298-615 _na     105_aa hypothetical protein
6228 JONS01000084.1 GCA000711965_03332 CDS open 927-1829 _na     300_aa uracil-DNA glycosylase
6229 JONS01000084.1 GCA000711965_03333 CDS open 2256-4169 _na     637_aa protein kinase domain-containing protein
6230 JONS01000084.1 GCA000711965_03334 CDS open 4553-4852 _na     99_aa Transposase IS4-like domain-containing protein
6231 JONS01000084.1 GCA000711965_03331 gene open 298-615
6232 JONS01000084.1 GCA000711965_03332 gene open 927-1829
6233 JONS01000084.1 GCA000711965_03333 gene open 2256-4169
6234 JONS01000084.1 GCA000711965_03334 gene open 4553-4852
6235 JONS01000085.1 GCA000711965_03335 CDS open 423-1031 _na     202_aa rimM ribosome maturation factor RimM
6236 JONS01000085.1 GCA000711965_03336 CDS open 1031-2545 _na     504_aa trmD tRNA (guanosine(37)-N1)-methyltransferase TrmD
6237 JONS01000085.1 GCA000711965_03337 CDS open 2532-3374 _na     280_aa lepB signal peptidase I
6238 JONS01000085.1 GCA000711965_03338 CDS open 3644-3994 _na     116_aa rplS 50S ribosomal protein L19
6239 JONS01000085.1 GCA000711965_03335 gene open 423-1031 rimM
6240 JONS01000085.1 GCA000711965_03336 gene open 1031-2545 trmD
6241 JONS01000085.1 GCA000711965_03337 gene open 2532-3374 lepB
6242 JONS01000085.1 GCA000711965_03338 gene open 3644-3994 rplS
6243 JONS01000086.1 GCA000711965_03339 CDS open 516-1364 _na     282_aa panB 3-methyl-2-oxobutanoate hydroxymethyltransferase
6244 JONS01000086.1 GCA000711965_03340 CDS open 1389-2138 _na     249_aa lysE LysE family translocator
6245 JONS01000086.1 GCA000711965_03341 CDS open 2135-3445 _na     436_aa nhaA Sodium/proton antiporter nhaA
6246 JONS01000086.1 GCA000711965_03339 gene open 516-1364 panB
6247 JONS01000086.1 GCA000711965_03340 gene open 1389-2138 lysE
6248 JONS01000086.1 GCA000711965_03341 gene open 2135-3445 nhaA
6249 JONS01000087.1 GCA000711965_03342 CDS open 291-1790 _na     499_aa ATPase involved in DNA repair
6250 JONS01000087.1 GCA000711965_03343 CDS open 1768-3417 _na     549_aa hypothetical protein
6251 JONS01000087.1 GCA000711965_03342 gene open 291-1790
6252 JONS01000087.1 GCA000711965_03343 gene open 1768-3417
6253 JONS01000088.1 GCA000711965_03344 CDS open 1540-1686 _na     48_aa hypothetical protein
6254 JONS01000088.1 GCA000711965_03345 CDS open 2373-2960 _na     195_aa hypothetical protein
6255 JONS01000088.1 GCA000711965_03344 gene open 1540-1686
6256 JONS01000088.1 GCA000711965_03345 gene open 2373-2960
6257 JONS01000089.1 GCA000711965_03346 CDS open 462-1283 _na     273_aa CPBP family intramembrane glutamic endopeptidase
6258 JONS01000089.1 GCA000711965_03347 CDS open 1280-1651 _na     123_aa hypothetical protein
6259 JONS01000089.1 GCA000711965_03348 CDS open 2139-2969 _na     276_aa hypothetical protein
6260 JONS01000089.1 GCA000711965_03346 gene open 462-1283
6261 JONS01000089.1 GCA000711965_03347 gene open 1280-1651
6262 JONS01000089.1 GCA000711965_03348 gene open 2139-2969
6263 JONS01000090.1 GCA000711965_03349 CDS open 863-1507 _na     214_aa DNA-binding response regulator
6264 JONS01000090.1 GCA000711965_03350 CDS open 1722-2717 _na     331_aa hypothetical protein
6265 JONS01000090.1 GCA000711965_03349 gene open 863-1507
6266 JONS01000090.1 GCA000711965_03350 gene open 1722-2717
6267 JONS01000091.1 GCA000711965_03351 CDS open 1651-2079 _na     142_aa CocE/NonD family hydrolase C-terminal non-catalytic domain-containing protein
6268 JONS01000091.1 GCA000711965_03352 CDS open 2110-2472 _na     120_aa hypothetical protein
6269 JONS01000091.1 GCA000711965_03351 gene open 1651-2079
6270 JONS01000091.1 GCA000711965_03352 gene open 2110-2472
6271 JONS01000093.1 GCA000711965_03353 CDS open 719-1747 _na     342_aa hypothetical protein
6272 JONS01000093.1 GCA000711965_03353 gene open 719-1747
6273 JONS01000094.1 GCA000711965_03354 gene open 1-2259 rrl
6274 JONS01000094.1 GCA000711965_03354 rRNA open 1-2259 rrl 23S ribosomal RNA
6275 JONS01000095.1 GCA000711965_03355 CDS open 24-1253 _na     409_aa hypothetical protein
6276 JONS01000095.1 GCA000711965_03355 gene open 24-1253
6277 JONS01000096.1 GCA000711965_03356 CDS open 71-1216 _na     381_aa hypothetical protein
6278 JONS01000096.1 GCA000711965_03356 gene open 71-1216
6279 JONS01000097.1 GCA000711965_03357 CDS open 395-571 _na     58_aa hypothetical protein
6280 JONS01000097.1 GCA000711965_03358 CDS open 603-1550 _na     315_aa IS1634 family transposase
6281 JONS01000097.1 GCA000711965_03357 gene open 395-571
6282 JONS01000097.1 GCA000711965_03358 gene open 603-1550
6283 JONS01000098.1 GCA000711965_03359 CDS open 17-469 _na     150_aa hypothetical protein
6284 JONS01000098.1 GCA000711965_03360 CDS open 551-799 _na     82_aa hypothetical protein
6285 JONS01000098.1 GCA000711965_03359 gene open 17-469
6286 JONS01000098.1 GCA000711965_03360 gene open 551-799
6287 JONS01000099.1 GCA000711965_03361 CDS open 88-759 _na     223_aa response regulator transcription factor
6288 JONS01000099.1 GCA000711965_03362 CDS open 842-1108 _na     88_aa hypothetical protein
6289 JONS01000099.1 GCA000711965_03361 gene open 88-759
6290 JONS01000099.1 GCA000711965_03362 gene open 842-1108
6291 JONS01000100.1 GCA000711965_03363 CDS open 104-1093 _na     329_aa Transcriptional regulator%2C AbiEi antitoxin%2C Type IV TA system
6292 JONS01000100.1 GCA000711965_03363 gene open 104-1093
6293 JONS01000101.1 GCA000711965_03364 CDS open 149-1117 _na     322_aa hypothetical protein
6294 JONS01000101.1 GCA000711965_03364 gene open 149-1117
6295 JONS01000102.1 GCA000711965_03365 CDS open 260-451 _na     63_aa hypothetical protein
6296 JONS01000102.1 GCA000711965_03365 gene open 260-451
6297 JONS01000103.1 GCA000711965_03366 CDS open 153-1163 _na     336_aa hypothetical protein
6298 JONS01000103.1 GCA000711965_03366 gene open 153-1163
6299 JONS01000104.1 GCA000711965_03367 CDS open 3-164 _na     53_aa hypothetical protein
6300 JONS01000104.1 GCA000711965_03368 CDS open 180-644 _na     154_aa hypothetical protein
6301 JONS01000104.1 GCA000711965_03367 gene open 3-164
6302 JONS01000104.1 GCA000711965_03368 gene open 180-644
6303 KL544003.1 repeat_region open 51992-53918 CRISPR array with 32 repeats of length 28%2C consensus sequence GGATCATCCCCGCTCGCGCGGGGTTTAC and spacer length 32
6304 KL544003.1 GCA000711965_00945 CDS open 213-1229 _na     338_aa Tat pathway signal protein
6305 KL544003.1 GCA000711965_00946 CDS open 1321-2292 _na     323_aa tetratricopeptide repeat protein
6306 KL544003.1 GCA000711965_00947 CDS open 2645-5008 _na     787_aa Alpha-1%2C4 glucan phosphorylase
6307 KL544003.1 GCA000711965_00948 CDS open 5449-7668 _na     739_aa glgB 1%2C4-alpha-glucan branching protein GlgB
6308 KL544003.1 GCA000711965_00949 CDS open 7772-9307 _na     511_aa Maltokinase N-terminal cap domain-containing protein
6309 KL544003.1 GCA000711965_00950 CDS open 9304-11061 _na     585_aa Alpha-amylase
6310 KL544003.1 GCA000711965_00951 CDS open 11265-13355 _na     696_aa alpha-1%2C4-glucan--maltose-1-phosphate maltosyltransferase
6311 KL544003.1 GCA000711965_00952 CDS open 13496-14608 _na     370_aa trpS tryptophan--tRNA ligase
6312 KL544003.1 GCA000711965_00953 CDS open 14748-16499 _na     583_aa alpha/beta hydrolase
6313 KL544003.1 GCA000711965_00954 CDS open 16617-17531 _na     304_aa ABC transporter ATP-binding protein
6314 KL544003.1 GCA000711965_00955 CDS open 17528-20101 _na     857_aa ABC transporter permease
6315 KL544003.1 GCA000711965_00956 CDS open 20258-21169 _na     303_aa ribonuclease Z
6316 KL544003.1 GCA000711965_00957 CDS open 21247-23601 _na     784_aa glgX glycogen debranching protein GlgX
6317 KL544003.1 GCA000711965_00958 CDS open 23641-24531 _na     296_aa electron transfer flavoprotein subunit beta/FixA family protein
6318 KL544003.1 GCA000711965_00959 CDS open 24594-25595 _na     333_aa electron transfer flavoprotein subunit alpha/FixB family protein
6319 KL544003.1 GCA000711965_00960 CDS open 25641-26798 _na     385_aa AAA family ATPase
6320 KL544003.1 GCA000711965_00961 CDS open 26795-29326 _na     843_aa DUF5682 domain-containing protein
6321 KL544003.1 GCA000711965_00962 CDS open 29323-30534 _na     403_aa VWA domain-containing protein
6322 KL544003.1 GCA000711965_00963 CDS open 30531-32630 _na     699_aa SWIM-type domain-containing protein
6323 KL544003.1 GCA000711965_00964 CDS open 32654-34618 _na     654_aa PQQ-like domain protein
6324 KL544003.1 GCA000711965_00965 CDS open 35060-38710 _na     1216_aa DUF4132 domain-containing protein
6325 KL544003.1 GCA000711965_00966 CDS open 38517-39572 _na     351_aa hypothetical protein
6326 KL544003.1 GCA000711965_00967 CDS open 40147-41028 _na     293_aa ureD Urease accessory protein UreD
6327 KL544003.1 GCA000711965_00968 CDS open 41147-41428 _na     93_aa DUF1540 domain-containing protein
6328 KL544003.1 GCA000711965_00969 CDS open 41771-42103 _na     110_aa gntR GntR family transcriptional regulator
6329 KL544003.1 GCA000711965_00970 CDS open 42100-43356 _na     418_aa ATP-binding cassette domain-containing protein
6330 KL544003.1 GCA000711965_00971 CDS open 43456-43641 _na     61_aa hypothetical protein
6331 KL544003.1 GCA000711965_00972 CDS open 44551-45672 _na     373_aa mnmA tRNA 2-thiouridine(34) synthase MnmA
6332 KL544003.1 GCA000711965_00973 CDS open 45756-46565 _na     269_aa metal-dependent transcriptional regulator
6333 KL544003.1 GCA000711965_00974 CDS open 46784-47326 _na     180_aa nrdI class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI
6334 KL544003.1 GCA000711965_00975 CDS open 47381-48400 _na     339_aa nrdF class 1b ribonucleoside-diphosphate reductase subunit beta
6335 KL544003.1 GCA000711965_00976 CDS open 48397-48999 _na     200_aa NADPH-dependent FMN reductase
6336 KL544003.1 GCA000711965_00977 CDS open 53965-54357 _na     130_aa cas2e type I-E CRISPR-associated endoribonuclease Cas2e
6337 KL544003.1 GCA000711965_00978 CDS open 54351-55289 _na     312_aa cas1e type I-E CRISPR-associated endonuclease Cas1e
6338 KL544003.1 GCA000711965_00979 CDS open 55292-55978 _na     228_aa cas6e type I-E CRISPR-associated protein Cas6/Cse3/CasE
6339 KL544003.1 GCA000711965_00980 CDS open 55969-56685 _na     238_aa cas5e type I-E CRISPR-associated protein Cas5/CasD
6340 KL544003.1 GCA000711965_00981 CDS open 56685-57809 _na     374_aa cas7e type I-E CRISPR-associated protein Cas7/Cse4/CasC
6341 KL544003.1 GCA000711965_00982 CDS open 57812-58498 _na     228_aa casB type I-E CRISPR-associated protein Cse2/CasB
6342 KL544003.1 GCA000711965_00983 CDS open 58495-60156 _na     553_aa casA type I-E CRISPR-associated protein Cse1/CasA
6343 KL544003.1 GCA000711965_00984 CDS open 60153-63104 _na     983_aa CRISPR-associated helicase/endonuclease Cas3
6344 KL544003.1 GCA000711965_00985 CDS open 63289-64023 _na     244_aa FadR/GntR family transcriptional regulator
6345 KL544003.1 GCA000711965_00986 CDS open 64200-65798 _na     532_aa ABC transporter%2C substrate-binding protein%2C family 5
6346 KL544003.1 GCA000711965_00987 CDS open 65890-66855 _na     321_aa ABC transmembrane type-1 domain-containing protein
6347 KL544003.1 GCA000711965_00988 CDS open 66855-68996 _na     713_aa Oligopeptide/dipeptide transporter%2C C-terminal domain protein
6348 KL544003.1 GCA000711965_00989 CDS open 68996-69820 _na     274_aa ATP-binding cassette domain-containing protein
6349 KL544003.1 GCA000711965_00990 CDS open 69888-70808 _na     306_aa dihydrodipicolinate synthase family protein
6350 KL544003.1 GCA000711965_00991 CDS open 70810-71814 _na     334_aa ROK family protein
6351 KL544003.1 GCA000711965_00992 CDS open 71869-72564 _na     231_aa Putative N-acetylmannosamine-6-phosphate 2-epimerase
6352 KL544003.1 GCA000711965_00993 CDS open 72767-73048 _na     93_aa DNA-binding protein HU
6353 KL544003.1 GCA000711965_00994 CDS open 73202-74035 _na     277_aa ABC transporter ATP-binding protein
6354 KL544003.1 GCA000711965_00995 CDS open 74011-75771 _na     586_aa transporter
6355 KL544003.1 GCA000711965_00996 CDS open 75997-76737 _na     246_aa nagB glucosamine-6-phosphate deaminase
6356 KL544003.1 GCA000711965_00997 CDS open 76852-77199 _na     115_aa DUF3039 domain-containing protein
6357 KL544003.1 GCA000711965_00998 CDS open 77196-79013 _na     605_aa Type III restriction enzyme%2C res subunit
6358 KL544003.1 GCA000711965_00999 CDS open 79090-80481 _na     463_aa nicotinate phosphoribosyltransferase
6359 KL544003.1 GCA000711965_01000 CDS open 80562-80882 _na     106_aa clpS ATP-dependent Clp protease adapter ClpS
6360 KL544003.1 GCA000711965_01001 CDS open 80882-81556 _na     224_aa DUF2017 domain-containing protein
6361 KL544003.1 GCA000711965_01002 CDS open 81600-82469 _na     289_aa murI glutamate racemase
6362 KL544003.1 GCA000711965_01003 CDS open 82498-83313 _na     271_aa MBL fold metallo-hydrolase
6363 KL544003.1 GCA000711965_01004 CDS open 83493-84203 _na     236_aa DUF3054 domain-containing protein
6364 KL544003.1 GCA000711965_01005 CDS open 84082-84321 _na     79_aa hypothetical protein
6365 KL544003.1 GCA000711965_01006 CDS open 84380-85087 _na     235_aa non-canonical purine NTP pyrophosphatase
6366 KL544003.1 GCA000711965_01007 CDS open 85084-85896 _na     270_aa rph ribonuclease PH
6367 KL544003.1 GCA000711965_01008 CDS open 86097-86741 _na     214_aa excalibur calcium-binding domain-containing protein
6368 KL544003.1 GCA000711965_01010 CDS open 86878-87075 _na     65_aa hypothetical protein
6369 KL544003.1 GCA000711965_01011 CDS open 87201-87386 _na     61_aa hypothetical protein
6370 KL544003.1 GCA000711965_01014 CDS open 88033-89097 _na     354_aa pip prolyl aminopeptidase
6371 KL544003.1 GCA000711965_01015 CDS open 89246-90190 _na     314_aa Glutathione synthetase%2C ATP-binding-like domain protein
6372 KL544003.1 GCA000711965_01016 CDS open 90560-90943 _na     127_aa yccF YccF domain-containing protein
6373 KL544003.1 GCA000711965_01017 CDS open 90985-91485 _na     166_aa ybaK Cys-tRNA(Pro) deacylase
6374 KL544003.1 GCA000711965_01018 CDS open 91610-92587 _na     325_aa mmuM homocysteine S-methyltransferase
6375 KL544003.1 GCA000711965_01019 CDS open 92607-92894 _na     95_aa hypothetical protein
6376 KL544003.1 GCA000711965_01020 CDS open 93268-95994 _na     908_aa PF12029 domain protein
6377 KL544003.1 GCA000711965_01021 CDS open 96476-98263 _na     595_aa oleate hydratase
6378 KL544003.1 GCA000711965_01022 CDS open 98390-99853 _na     487_aa Amino acid carrier protein
6379 KL544003.1 GCA000711965_01023 CDS open 99989-101539 _na     516_aa sodium:alanine symporter family protein
6380 KL544003.1 GCA000711965_01024 CDS open 101543-103045 _na     500_aa sodium:alanine symporter family protein
6381 KL544003.1 GCA000711965_01025 CDS open 103130-104686 _na     518_aa sodium:alanine symporter family protein
6382 KL544003.1 GCA000711965_01026 CDS open 104758-105579 _na     273_aa fumarylacetoacetate hydrolase family protein
6383 KL544003.1 GCA000711965_01027 CDS open 105600-106838 _na     412_aa MalY/PatB family protein
6384 KL544003.1 GCA000711965_01028 CDS open 107232-108080 _na     282_aa Putative urate catabolism protein
6385 KL544003.1 GCA000711965_01029 CDS open 108147-109256 _na     369_aa C45 family peptidase
6386 KL544003.1 GCA000711965_01030 CDS open 109448-111286 _na     612_aa luxR LuxR C-terminal-related transcriptional regulator
6387 KL544003.1 GCA000711965_01031 CDS open 111417-113015 _na     532_aa gltX glutamate--tRNA ligase
6388 KL544003.1 GCA000711965_01035 CDS open 113660-115354 _na     564_aa ribonuclease J
6389 KL544003.1 GCA000711965_01036 CDS open 115370-116344 _na     324_aa pfkB Carbohydrate kinase%2C PfkB family
6390 KL544003.1 GCA000711965_01037 CDS open 116405-119272 _na     955_aa ftsK DNA translocase FtsK
6391 KL544003.1 GCA000711965_01038 CDS open 119349-120572 _na     407_aa capA CapA family protein
6392 KL544003.1 GCA000711965_01039 CDS open 120814-121521 _na     235_aa pgsA CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase
6393 KL544003.1 GCA000711965_01040 CDS open 121518-122033 _na     171_aa cinA CinA family protein
6394 KL544003.1 GCA000711965_01041 CDS open 122227-122589 _na     120_aa DNA-binding helix-turn-helix protein
6395 KL544003.1 GCA000711965_01042 CDS open 122745-122978 _na     77_aa DUF3046 domain-containing protein
6396 KL544003.1 GCA000711965_01043 CDS open 123200-124426 _na     408_aa recA recombinase RecA
6397 KL544003.1 GCA000711965_01044 CDS open 124426-124920 _na     164_aa recX regulatory protein RecX
6398 KL544003.1 GCA000711965_01045 CDS open 124948-126825 _na     625_aa phosphoenolpyruvate carboxykinase (GTP)
6399 KL544003.1 GCA000711965_01046 CDS open 127110-128846 _na     578_aa formate--tetrahydrofolate ligase
6400 KL544003.1 GCA000711965_01047 CDS open 129014-129406 _na     130_aa gcvH glycine cleavage system protein GcvH
6401 KL544003.1 GCA000711965_01048 CDS open 129442-130749 _na     435_aa gcvT glycine cleavage system aminomethyltransferase GcvT
6402 KL544003.1 GCA000711965_01049 CDS open 130746-133727 _na     993_aa gcvP aminomethyl-transferring glycine dehydrogenase
6403 KL544003.1 GCA000711965_01050 CDS open 134626-135543 _na     305_aa hypothetical protein
6404 KL544003.1 GCA000711965_01051 CDS open 135608-136567 _na     319_aa tetratricopeptide repeat protein
6405 KL544003.1 GCA000711965_01052 CDS open 136708-138363 _na     551_aa miaB tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB
6406 KL544003.1 GCA000711965_01053 CDS open 138450-138824 _na     124_aa PF08000 family protein
6407 KL544003.1 GCA000711965_00945 gene open 213-1229
6408 KL544003.1 GCA000711965_00946 gene open 1321-2292
6409 KL544003.1 GCA000711965_00947 gene open 2645-5008
6410 KL544003.1 GCA000711965_00948 gene open 5449-7668 glgB
6411 KL544003.1 GCA000711965_00949 gene open 7772-9307
6412 KL544003.1 GCA000711965_00950 gene open 9304-11061
6413 KL544003.1 GCA000711965_00951 gene open 11265-13355
6414 KL544003.1 GCA000711965_00952 gene open 13496-14608 trpS
6415 KL544003.1 GCA000711965_00953 gene open 14748-16499
6416 KL544003.1 GCA000711965_00954 gene open 16617-17531
6417 KL544003.1 GCA000711965_00955 gene open 17528-20101
6418 KL544003.1 GCA000711965_00956 gene open 20258-21169
6419 KL544003.1 GCA000711965_00957 gene open 21247-23601 glgX
6420 KL544003.1 GCA000711965_00958 gene open 23641-24531
6421 KL544003.1 GCA000711965_00959 gene open 24594-25595
6422 KL544003.1 GCA000711965_00960 gene open 25641-26798
6423 KL544003.1 GCA000711965_00961 gene open 26795-29326
6424 KL544003.1 GCA000711965_00962 gene open 29323-30534
6425 KL544003.1 GCA000711965_00963 gene open 30531-32630
6426 KL544003.1 GCA000711965_00964 gene open 32654-34618
6427 KL544003.1 GCA000711965_00965 gene open 35060-38710
6428 KL544003.1 GCA000711965_00966 gene open 38517-39572
6429 KL544003.1 GCA000711965_00967 gene open 40147-41028 ureD
6430 KL544003.1 GCA000711965_00968 gene open 41147-41428
6431 KL544003.1 GCA000711965_00969 gene open 41771-42103 gntR
6432 KL544003.1 GCA000711965_00970 gene open 42100-43356
6433 KL544003.1 GCA000711965_00971 gene open 43456-43641
6434 KL544003.1 GCA000711965_00972 gene open 44551-45672 mnmA
6435 KL544003.1 GCA000711965_00973 gene open 45756-46565
6436 KL544003.1 GCA000711965_00974 gene open 46784-47326 nrdI
6437 KL544003.1 GCA000711965_00975 gene open 47381-48400 nrdF
6438 KL544003.1 GCA000711965_00976 gene open 48397-48999
6439 KL544003.1 GCA000711965_00977 gene open 53965-54357 cas2e
6440 KL544003.1 GCA000711965_00978 gene open 54351-55289 cas1e
6441 KL544003.1 GCA000711965_00979 gene open 55292-55978 cas6e
6442 KL544003.1 GCA000711965_00980 gene open 55969-56685 cas5e
6443 KL544003.1 GCA000711965_00981 gene open 56685-57809 cas7e
6444 KL544003.1 GCA000711965_00982 gene open 57812-58498 casB
6445 KL544003.1 GCA000711965_00983 gene open 58495-60156 casA
6446 KL544003.1 GCA000711965_00984 gene open 60153-63104
6447 KL544003.1 GCA000711965_00985 gene open 63289-64023
6448 KL544003.1 GCA000711965_00986 gene open 64200-65798
6449 KL544003.1 GCA000711965_00987 gene open 65890-66855
6450 KL544003.1 GCA000711965_00988 gene open 66855-68996
6451 KL544003.1 GCA000711965_00989 gene open 68996-69820
6452 KL544003.1 GCA000711965_00990 gene open 69888-70808
6453 KL544003.1 GCA000711965_00991 gene open 70810-71814
6454 KL544003.1 GCA000711965_00992 gene open 71869-72564
6455 KL544003.1 GCA000711965_00993 gene open 72767-73048
6456 KL544003.1 GCA000711965_00994 gene open 73202-74035
6457 KL544003.1 GCA000711965_00995 gene open 74011-75771
6458 KL544003.1 GCA000711965_00996 gene open 75997-76737 nagB
6459 KL544003.1 GCA000711965_00997 gene open 76852-77199
6460 KL544003.1 GCA000711965_00998 gene open 77196-79013
6461 KL544003.1 GCA000711965_00999 gene open 79090-80481
6462 KL544003.1 GCA000711965_01000 gene open 80562-80882 clpS
6463 KL544003.1 GCA000711965_01001 gene open 80882-81556
6464 KL544003.1 GCA000711965_01002 gene open 81600-82469 murI
6465 KL544003.1 GCA000711965_01003 gene open 82498-83313
6466 KL544003.1 GCA000711965_01004 gene open 83493-84203
6467 KL544003.1 GCA000711965_01005 gene open 84082-84321
6468 KL544003.1 GCA000711965_01006 gene open 84380-85087
6469 KL544003.1 GCA000711965_01007 gene open 85084-85896 rph
6470 KL544003.1 GCA000711965_01008 gene open 86097-86741
6471 KL544003.1 GCA000711965_01010 gene open 86878-87075
6472 KL544003.1 GCA000711965_01011 gene open 87201-87386
6473 KL544003.1 GCA000711965_01014 gene open 88033-89097 pip
6474 KL544003.1 GCA000711965_01015 gene open 89246-90190
6475 KL544003.1 GCA000711965_01016 gene open 90560-90943 yccF
6476 KL544003.1 GCA000711965_01017 gene open 90985-91485 ybaK
6477 KL544003.1 GCA000711965_01018 gene open 91610-92587 mmuM
6478 KL544003.1 GCA000711965_01019 gene open 92607-92894
6479 KL544003.1 GCA000711965_01020 gene open 93268-95994
6480 KL544003.1 GCA000711965_01021 gene open 96476-98263
6481 KL544003.1 GCA000711965_01022 gene open 98390-99853
6482 KL544003.1 GCA000711965_01023 gene open 99989-101539
6483 KL544003.1 GCA000711965_01024 gene open 101543-103045
6484 KL544003.1 GCA000711965_01025 gene open 103130-104686
6485 KL544003.1 GCA000711965_01026 gene open 104758-105579
6486 KL544003.1 GCA000711965_01027 gene open 105600-106838
6487 KL544003.1 GCA000711965_01028 gene open 107232-108080
6488 KL544003.1 GCA000711965_01029 gene open 108147-109256
6489 KL544003.1 GCA000711965_01030 gene open 109448-111286 luxR
6490 KL544003.1 GCA000711965_01031 gene open 111417-113015 gltX
6491 KL544003.1 GCA000711965_01035 gene open 113660-115354
6492 KL544003.1 GCA000711965_01036 gene open 115370-116344 pfkB
6493 KL544003.1 GCA000711965_01037 gene open 116405-119272 ftsK
6494 KL544003.1 GCA000711965_01038 gene open 119349-120572 capA
6495 KL544003.1 GCA000711965_01039 gene open 120814-121521 pgsA
6496 KL544003.1 GCA000711965_01040 gene open 121518-122033 cinA
6497 KL544003.1 GCA000711965_01041 gene open 122227-122589
6498 KL544003.1 GCA000711965_01042 gene open 122745-122978
6499 KL544003.1 GCA000711965_01043 gene open 123200-124426 recA
6500 KL544003.1 GCA000711965_01044 gene open 124426-124920 recX