HOMD Banner
Taxonomy: V4.3   |  16S rRNA RefSeq: V16.03   |  Genomic RefSeq: V11.03   |  Viruses: V1.2

BAKTAGenome Explorer: Prevotella intermedia (GCA_002794335.1)

Select a Genome:
BAKTA Annotations for GCA_002794335.1
Genome Selected: Prevotella intermedia
ContigsBases CDSrRNA tmRNAtRNA
3 2798400 2404 12 1 48
[Table]   [AA Fasta]      [Browser]   [Text]   [Excel]  
Search & Sort all 4949 Records
Search These Records: Clear
Sort Column:   Molecule   PID   NA   AA   Gene  Gene Product  Reverse
Annotation Table [page:8]    |    Number of Records Found: 4949 [10 Pages]    |    Previous Page <==> Next Page    |    Jump to Page: [ 1  2  3  4  5  6  7  8  9  10  ]
Notes:   1- Column headers only sort the current page. 2- Select [NA] or [AA] links to show sequences.
Region Protein-ID Type Genome
Viewer		 Range
(bp)		 Show Sequences
(length) NA / AA		 BAKTA
Gene		 BAKTA
GeneProduct
3501 PGGD01000001.1 GCA002794335_01692 gene open 1915059-1915694
3502 PGGD01000001.1 GCA002794335_01693 gene open 1916580-1917464 rfbA
3503 PGGD01000001.1 GCA002794335_01694 gene open 1917480-1919984
3504 PGGD01000001.1 GCA002794335_01695 gene open 1919996-1920484
3505 PGGD01000001.1 GCA002794335_01696 gene open 1920743-1921183
3506 PGGD01000001.1 GCA002794335_01697 gene open 1921107-1921439
3507 PGGD01000001.1 GCA002794335_01698 gene open 1921444-1922007
3508 PGGD01000001.1 GCA002794335_01699 gene open 1922422-1922844
3509 PGGD01000001.1 GCA002794335_01700 gene open 1922886-1923851
3510 PGGD01000001.1 GCA002794335_01701 gene open 1923914-1924888
3511 PGGD01000001.1 GCA002794335_01702 gene open 1924905-1925969
3512 PGGD01000001.1 GCA002794335_01703 gene open 1926002-1926868
3513 PGGD01000001.1 GCA002794335_01704 gene open 1926977-1927417
3514 PGGD01000001.1 GCA002794335_01705 gene open 1928212-1929456 hutI
3515 PGGD01000001.1 GCA002794335_01706 gene open 1929453-1930928 hutH
3516 PGGD01000001.1 GCA002794335_01707 gene open 1931011-1933008 hutU
3517 PGGD01000001.1 GCA002794335_01708 gene open 1933022-1934755 ftcD
3518 PGGD01000001.1 GCA002794335_01709 gene open 1935064-1936020
3519 PGGD01000001.1 GCA002794335_01710 gene open 1936091-1936909
3520 PGGD01000001.1 GCA002794335_01711 gene open 1937815-1938771
3521 PGGD01000001.1 GCA002794335_01712 gene open 1938845-1939456
3522 PGGD01000001.1 GCA002794335_01713 gene open 1939467-1940786 cls
3523 PGGD01000001.1 GCA002794335_01714 gene open 1940853-1941803
3524 PGGD01000001.1 GCA002794335_01715 gene open 1941825-1942685 kdsA
3525 PGGD01000001.1 GCA002794335_01716 gene open 1942713-1943639
3526 PGGD01000001.1 GCA002794335_01717 gene open 1943846-1944688
3527 PGGD01000001.1 GCA002794335_01718 gene open 1944692-1945201
3528 PGGD01000001.1 GCA002794335_01719 gene open 1945210-1945749 exbD
3529 PGGD01000001.1 GCA002794335_01720 gene open 1945746-1946210 exbD
3530 PGGD01000001.1 GCA002794335_01721 gene open 1946591-1946989
3531 PGGD01000001.1 GCA002794335_01722 gene open 1947123-1948904 lepA
3532 PGGD01000001.1 GCA002794335_01723 gene open 1948926-1949519
3533 PGGD01000001.1 GCA002794335_01724 gene open 1949563-1950843
3534 PGGD01000001.1 GCA002794335_01725 gene open 1951076-1952845 sppA
3535 PGGD01000001.1 GCA002794335_01726 gene open 1952896-1954083 lpxK
3536 PGGD01000001.1 GCA002794335_01727 gene open 1954193-1954777
3537 PGGD01000001.1 GCA002794335_01728 gene open 1954809-1955909 thiL
3538 PGGD01000001.1 GCA002794335_01730 gene open 1956707-1958266 ahpF
3539 PGGD01000001.1 GCA002794335_01731 gene open 1958460-1959026 ahpC
3540 PGGD01000001.1 GCA002794335_01732 gene open 1959376-1960683 eno
3541 PGGD01000001.1 GCA002794335_01733 gene open 1961021-1961947
3542 PGGD01000001.1 GCA002794335_01734 gene open 1962067-1962768
3543 PGGD01000001.1 GCA002794335_01735 gene open 1963213-1964835
3544 PGGD01000001.1 GCA002794335_01736 gene open 1964895-1967066
3545 PGGD01000001.1 GCA002794335_01737 gene open 1967075-1968991 yidC
3546 PGGD01000001.1 GCA002794335_01738 gene open 1968995-1970602
3547 PGGD01000001.1 GCA002794335_01739 gene open 1971274-1971408
3548 PGGD01000001.1 GCA002794335_01740 gene open 1971431-1972891
3549 PGGD01000001.1 GCA002794335_01741 gene open 1972898-1973341
3550 PGGD01000001.1 GCA002794335_01742 gene open 1973371-1974483
3551 PGGD01000001.1 GCA002794335_01743 gene open 1974630-1975385
3552 PGGD01000001.1 GCA002794335_01744 gene open 1975727-1976788
3553 PGGD01000001.1 GCA002794335_01745 gene open 1976898-1978043
3554 PGGD01000001.1 GCA002794335_01746 gene open 1978040-1979353
3555 PGGD01000001.1 GCA002794335_01747 gene open 1979344-1980891
3556 PGGD01000001.1 GCA002794335_01748 gene open 1980899-1981936
3557 PGGD01000001.1 GCA002794335_01749 gene open 1982110-1984737
3558 PGGD01000001.1 GCA002794335_01750 gene open 1984744-1985364
3559 PGGD01000001.1 GCA002794335_01751 gene open 1985589-1986626 dinB
3560 PGGD01000001.1 GCA002794335_01752 gene open 1987150-1988568
3561 PGGD01000001.1 GCA002794335_01753 gene open 1988729-1989205
3562 PGGD01000001.1 GCA002794335_01754 gene open 1989261-1989974
3563 PGGD01000001.1 GCA002794335_01755 gene open 1989989-1990699
3564 PGGD01000001.1 GCA002794335_01756 gene open 1991119-1991694
3565 PGGD01000001.1 GCA002794335_01757 gene open 1991746-1993140
3566 PGGD01000001.1 GCA002794335_01758 gene open 1993160-1993891
3567 PGGD01000001.1 GCA002794335_01759 gene open 1994184-1994735 rfbC
3568 PGGD01000001.1 GCA002794335_01760 gene open 1994754-1995542
3569 PGGD01000001.1 GCA002794335_01761 gene open 1995615-1996862 serB
3570 PGGD01000001.1 GCA002794335_01762 gene open 1997263-1998750
3571 PGGD01000001.1 GCA002794335_01763 gene open 1999263-2000360
3572 PGGD01000001.1 GCA002794335_01764 gene open 2000366-2001310
3573 PGGD01000001.1 GCA002794335_01765 gene open 2001406-2001816 qdtA
3574 PGGD01000001.1 GCA002794335_01766 gene open 2001875-2003023 rfbB
3575 PGGD01000001.1 GCA002794335_01767 gene open 2003049-2003555
3576 PGGD01000001.1 GCA002794335_01768 gene open 2003563-2004189
3577 PGGD01000001.1 GCA002794335_01769 gene open 2004221-2005570 mepA
3578 PGGD01000001.1 GCA002794335_01770 gene open 2005726-2006328
3579 PGGD01000001.1 GCA002794335_01771 gene open 2006764-2007222
3580 PGGD01000001.1 GCA002794335_01772 gene open 2007366-2007932
3581 PGGD01000001.1 GCA002794335_01773 gene open 2008183-2009418
3582 PGGD01000001.1 GCA002794335_01774 gene open 2009418-2009978
3583 PGGD01000001.1 GCA002794335_01775 gene open 2009989-2010711
3584 PGGD01000001.1 GCA002794335_01776 gene open 2010827-2014087
3585 PGGD01000001.1 GCA002794335_01777 gene open 2014343-2014675
3586 PGGD01000001.1 GCA002794335_01778 gene open 2014756-2015142
3587 PGGD01000001.1 GCA002794335_01779 gene open 2015780-2017309
3588 PGGD01000001.1 GCA002794335_01780 gene open 2017344-2018093
3589 PGGD01000001.1 GCA002794335_01781 gene open 2018138-2019574 lysM
3590 PGGD01000001.1 GCA002794335_01782 gene open 2019627-2020322
3591 PGGD01000001.1 GCA002794335_01783 gene open 2020356-2023196 uvrA
3592 PGGD01000001.1 GCA002794335_01784 gene open 2023525-2024427
3593 PGGD01000001.1 GCA002794335_01785 gene open 2024506-2026683
3594 PGGD01000001.1 GCA002794335_01786 gene open 2027293-2030094
3595 PGGD01000001.1 GCA002794335_01787 gene open 2030125-2030481
3596 PGGD01000001.1 GCA002794335_01788 gene open 2030983-2032086
3597 PGGD01000001.1 GCA002794335_01789 gene open 2032102-2033085
3598 PGGD01000001.1 GCA002794335_01790 gene open 2033037-2033930
3599 PGGD01000001.1 GCA002794335_01791 gene open 2033984-2035480
3600 PGGD01000001.1 GCA002794335_01792 gene open 2035467-2036459
3601 PGGD01000001.1 GCA002794335_01793 gene open 2037142-2038119 pfkA
3602 PGGD01000001.1 GCA002794335_01794 gene open 2038186-2039712 atpD
3603 PGGD01000001.1 GCA002794335_01795 gene open 2039740-2039979
3604 PGGD01000001.1 GCA002794335_01796 gene open 2040019-2040438
3605 PGGD01000001.1 GCA002794335_01797 gene open 2040435-2041547 atpB
3606 PGGD01000001.1 GCA002794335_01798 gene open 2041610-2041852 atpE
3607 PGGD01000001.1 GCA002794335_01799 gene open 2041919-2042428 atpF
3608 PGGD01000001.1 GCA002794335_01800 gene open 2042440-2042976
3609 PGGD01000001.1 GCA002794335_01801 gene open 2042989-2044572 atpA
3610 PGGD01000001.1 GCA002794335_01802 gene open 2044584-2045558
3611 PGGD01000001.1 GCA002794335_01803 gene open 2046299-2046811 yhcR
3612 PGGD01000001.1 GCA002794335_01804 gene open 2046962-2047561
3613 PGGD01000001.1 GCA002794335_01805 gene open 2047550-2048206 rpe
3614 PGGD01000001.1 GCA002794335_01806 gene open 2048211-2048339
3615 PGGD01000001.1 GCA002794335_01807 gene open 2048435-2049238
3616 PGGD01000001.1 GCA002794335_01808 gene open 2049249-2049896
3617 PGGD01000001.1 GCA002794335_01809 gene open 2049919-2050491
3618 PGGD01000001.1 GCA002794335_01810 gene open 2050511-2051074
3619 PGGD01000001.1 GCA002794335_01811 gene open 2051617-2052234
3620 PGGD01000001.1 GCA002794335_01812 gene open 2052231-2054201
3621 PGGD01000001.1 GCA002794335_01813 gene open 2054225-2054677
3622 PGGD01000001.1 GCA002794335_01814 gene open 2055149-2057194 uvrB
3623 PGGD01000001.1 GCA002794335_01815 gene open 2057321-2058154
3624 PGGD01000001.1 GCA002794335_01816 gene open 2058178-2058525
3625 PGGD01000001.1 GCA002794335_01817 gene open 2058522-2058974
3626 PGGD01000001.1 GCA002794335_01818 gene open 2059077-2060060
3627 PGGD01000001.1 GCA002794335_01819 gene open 2060067-2060597
3628 PGGD01000001.1 GCA002794335_01820 gene open 2061284-2062060 ftsE
3629 PGGD01000001.1 GCA002794335_01821 gene open 2062082-2063398
3630 PGGD01000001.1 GCA002794335_01822 gene open 2063406-2064611
3631 PGGD01000001.1 GCA002794335_01823 gene open 2064611-2065774
3632 PGGD01000001.1 GCA002794335_01824 gene open 2065803-2067815
3633 PGGD01000001.1 GCA002794335_01825 gene open 2068325-2068813
3634 PGGD01000001.1 GCA002794335_01826 gene open 2068838-2069632
3635 PGGD01000001.1 GCA002794335_01827 gene open 2069641-2070987
3636 PGGD01000001.1 GCA002794335_01828 gene open 2071008-2073122
3637 PGGD01000001.1 GCA002794335_01829 gene open 2073188-2075047
3638 PGGD01000001.1 GCA002794335_01830 gene open 2075491-2078514
3639 PGGD01000001.1 GCA002794335_01831 gene open 2078613-2080238
3640 PGGD01000001.1 GCA002794335_01832 gene open 2080657-2081622
3641 PGGD01000001.1 GCA002794335_01833 gene open 2081915-2082211
3642 PGGD01000001.1 GCA002794335_01834 gene open 2082479-2082826
3643 PGGD01000001.1 GCA002794335_01835 gene open 2082930-2083157
3644 PGGD01000001.1 GCA002794335_01836 gene open 2083178-2083684
3645 PGGD01000001.1 GCA002794335_01837 gene open 2083810-2084142
3646 PGGD01000001.1 GCA002794335_01838 gene open 2084147-2084710
3647 PGGD01000001.1 GCA002794335_01839 gene open 2084898-2085821
3648 PGGD01000001.1 GCA002794335_01840 gene open 2085863-2086183
3649 PGGD01000001.1 GCA002794335_01841 gene open 2086257-2086430
3650 PGGD01000001.1 GCA002794335_01842 gene open 2086494-2089484
3651 PGGD01000001.1 GCA002794335_01843 gene open 2089481-2089711
3652 PGGD01000001.1 GCA002794335_01844 gene open 2089738-2090460
3653 PGGD01000001.1 GCA002794335_01845 gene open 2090503-2090769
3654 PGGD01000001.1 GCA002794335_01846 gene open 2090916-2091062
3655 PGGD01000001.1 GCA002794335_01847 gene open 2091349-2091582
3656 PGGD01000001.1 GCA002794335_01848 gene open 2091605-2092600
3657 PGGD01000001.1 GCA002794335_01849 gene open 2092600-2092983 erpK
3658 PGGD01000001.1 GCA002794335_01850 gene open 2093027-2093404 terB
3659 PGGD01000001.1 GCA002794335_01851 gene open 2093427-2093996
3660 PGGD01000001.1 GCA002794335_01852 gene open 2094089-2094817
3661 PGGD01000001.1 GCA002794335_01853 gene open 2094820-2095416 terD
3662 PGGD01000001.1 GCA002794335_01854 gene open 2095451-2096029 terD
3663 PGGD01000001.1 GCA002794335_01855 gene open 2096061-2097617
3664 PGGD01000001.1 GCA002794335_01856 gene open 2097983-2099197
3665 PGGD01000001.1 GCA002794335_01857 gene open 2099202-2100380
3666 PGGD01000001.1 GCA002794335_01858 gene open 2100440-2100952
3667 PGGD01000001.1 GCA002794335_01859 gene open 2100964-2101479
3668 PGGD01000001.1 GCA002794335_01860 gene open 2101455-2102576
3669 PGGD01000001.1 GCA002794335_01861 gene open 2102628-2102933
3670 PGGD01000001.1 GCA002794335_01862 gene open 2103318-2103620
3671 PGGD01000001.1 GCA002794335_01863 gene open 2103627-2103905
3672 PGGD01000001.1 GCA002794335_01864 gene open 2103886-2104032
3673 PGGD01000001.1 GCA002794335_01865 gene open 2104351-2105535
3674 PGGD01000001.1 GCA002794335_01866 gene open 2105882-2106853
3675 PGGD01000001.1 GCA002794335_01867 gene open 2107186-2108442 mobV
3676 PGGD01000001.1 GCA002794335_01868 gene open 2108665-2109258
3677 PGGD01000001.1 GCA002794335_01869 gene open 2109231-2110124
3678 PGGD01000001.1 GCA002794335_01870 gene open 2110121-2112304 drt3b
3679 PGGD01000001.1 GCA002794335_01871 gene open 2112473-2112640
3680 PGGD01000001.1 GCA002794335_01872 gene open 2112731-2113708
3681 PGGD01000001.1 GCA002794335_01873 gene open 2113726-2117121 dnaK
3682 PGGD01000001.1 GCA002794335_01874 gene open 2117133-2118749
3683 PGGD01000001.1 GCA002794335_01875 gene open 2118775-2119161
3684 PGGD01000001.1 GCA002794335_01876 gene open 2119173-2120534
3685 PGGD01000001.1 GCA002794335_00090 gene open 94131-94204 trnP
3686 PGGD01000001.1 GCA002794335_00091 gene open 94237-94309 trnG
3687 PGGD01000001.1 GCA002794335_00092 gene open 94357-94436 trnL
3688 PGGD01000001.1 GCA002794335_00093 gene open 94462-94545 trnL
3689 PGGD01000001.1 GCA002794335_00094 gene open 94573-94645 trnG
3690 PGGD01000001.1 GCA002794335_00160 gene open 163795-163868 trnD
3691 PGGD01000001.1 GCA002794335_00161 gene open 163897-163970 trnD
3692 PGGD01000001.1 GCA002794335_00320 gene open 345963-346036 trnR
3693 PGGD01000001.1 GCA002794335_00345 gene open 370301-370378 trnV
3694 PGGD01000001.1 GCA002794335_00346 gene open 370381-370462 trnY
3695 PGGD01000001.1 GCA002794335_00373 gene open 401732-401805 trnT
3696 PGGD01000001.1 GCA002794335_00389 gene open 412795-412868 trnH
3697 PGGD01000001.1 GCA002794335_00480 gene open 513353-513425 trnK
3698 PGGD01000001.1 GCA002794335_00559 gene open 597200-597270 trnC
3699 PGGD01000001.1 GCA002794335_00628 gene open 669327-669401 trnV
3700 PGGD01000001.1 GCA002794335_00629 gene open 669450-669524 trnV
3701 PGGD01000001.1 GCA002794335_00743 gene open 782894-782966 trnW
3702 PGGD01000001.1 GCA002794335_00745 gene open 784278-784349 trnT
3703 PGGD01000001.1 GCA002794335_00746 gene open 784357-784429 trnG
3704 PGGD01000001.1 GCA002794335_00747 gene open 784498-784579 trnY
3705 PGGD01000001.1 GCA002794335_00748 gene open 784600-784673 trnT
3706 PGGD01000001.1 GCA002794335_00815 gene open 863366-863439 trnA
3707 PGGD01000001.1 GCA002794335_00816 gene open 863461-863534 trnI
3708 PGGD01000001.1 GCA002794335_00833 gene open 879998-880069 trnR
3709 PGGD01000001.1 GCA002794335_00849 gene open 900411-900481 trnQ
3710 PGGD01000001.1 GCA002794335_00931 gene open 995690-995771 trnL
3711 PGGD01000001.1 GCA002794335_01031 gene open 1105208-1105293 trnL
3712 PGGD01000001.1 GCA002794335_01133 gene open 1228628-1228701 trnI
3713 PGGD01000001.1 GCA002794335_01186 gene open 1280917-1280989 trnP
3714 PGGD01000001.1 GCA002794335_01201 gene open 1300124-1300197 trnN
3715 PGGD01000001.1 GCA002794335_01285 gene open 1396403-1396474 trnE
3716 PGGD01000001.1 GCA002794335_01497 gene open 1674162-1674232 trnQ
3717 PGGD01000001.1 GCA002794335_01510 gene open 1691396-1691477 trnL
3718 PGGD01000001.1 GCA002794335_01532 gene open 1720418-1720491 trnM
3719 PGGD01000001.1 GCA002794335_01584 gene open 1780417-1780491 trnP
3720 PGGD01000001.1 GCA002794335_01729 gene open 1956130-1956202 trnF
3721 PGGD01000001.1 GCA002794335_00090 tRNA open 94131-94204 trnP tRNA-Pro(tgg)
3722 PGGD01000001.1 GCA002794335_00091 tRNA open 94237-94309 trnG tRNA-Gly(gcc)
3723 PGGD01000001.1 GCA002794335_00092 tRNA open 94357-94436 trnL tRNA-Leu(cag)
3724 PGGD01000001.1 GCA002794335_00093 tRNA open 94462-94545 trnL tRNA-Leu(gag)
3725 PGGD01000001.1 GCA002794335_00094 tRNA open 94573-94645 trnG tRNA-Gly(gcc)
3726 PGGD01000001.1 GCA002794335_00160 tRNA open 163795-163868 trnD tRNA-Asp(gtc)
3727 PGGD01000001.1 GCA002794335_00161 tRNA open 163897-163970 trnD tRNA-Asp(gtc)
3728 PGGD01000001.1 GCA002794335_00320 tRNA open 345963-346036 trnR tRNA-Arg(acg)
3729 PGGD01000001.1 GCA002794335_00345 tRNA open 370301-370378 trnV tRNA-Val(tac)
3730 PGGD01000001.1 GCA002794335_00346 tRNA open 370381-370462 trnY tRNA-Tyr(gta)
3731 PGGD01000001.1 GCA002794335_00373 tRNA open 401732-401805 trnT tRNA-Thr(tgt)
3732 PGGD01000001.1 GCA002794335_00389 tRNA open 412795-412868 trnH tRNA-His(gtg)
3733 PGGD01000001.1 GCA002794335_00480 tRNA open 513353-513425 trnK tRNA-Lys(ttt)
3734 PGGD01000001.1 GCA002794335_00559 tRNA open 597200-597270 trnC tRNA-Cys(gca)
3735 PGGD01000001.1 GCA002794335_00628 tRNA open 669327-669401 trnV tRNA-Val(tac)
3736 PGGD01000001.1 GCA002794335_00629 tRNA open 669450-669524 trnV tRNA-Val(tac)
3737 PGGD01000001.1 GCA002794335_00743 tRNA open 782894-782966 trnW tRNA-Trp(cca)
3738 PGGD01000001.1 GCA002794335_00745 tRNA open 784278-784349 trnT tRNA-Thr(ggt)
3739 PGGD01000001.1 GCA002794335_00746 tRNA open 784357-784429 trnG tRNA-Gly(tcc)
3740 PGGD01000001.1 GCA002794335_00747 tRNA open 784498-784579 trnY tRNA-Tyr(gta)
3741 PGGD01000001.1 GCA002794335_00748 tRNA open 784600-784673 trnT tRNA-Thr(tgt)
3742 PGGD01000001.1 GCA002794335_00815 tRNA open 863366-863439 trnA tRNA-Ala(tgc)
3743 PGGD01000001.1 GCA002794335_00816 tRNA open 863461-863534 trnI tRNA-Ile(gat)
3744 PGGD01000001.1 GCA002794335_00833 tRNA open 879998-880069 trnR tRNA-Arg(cct)
3745 PGGD01000001.1 GCA002794335_00849 tRNA open 900411-900481 trnQ tRNA-Gln(ttg)
3746 PGGD01000001.1 GCA002794335_00931 tRNA open 995690-995771 trnL tRNA-Leu(caa)
3747 PGGD01000001.1 GCA002794335_01031 tRNA open 1105208-1105293 trnL tRNA-Leu(taa)
3748 PGGD01000001.1 GCA002794335_01133 tRNA open 1228628-1228701 trnI tRNA-Ile2(cat)
3749 PGGD01000001.1 GCA002794335_01186 tRNA open 1280917-1280989 trnP tRNA-Pro(cgg)
3750 PGGD01000001.1 GCA002794335_01201 tRNA open 1300124-1300197 trnN tRNA-Asn(gtt)
3751 PGGD01000001.1 GCA002794335_01285 tRNA open 1396403-1396474 trnE tRNA-Glu(ttc)
3752 PGGD01000001.1 GCA002794335_01497 tRNA open 1674162-1674232 trnQ tRNA-Gln(ctg)
3753 PGGD01000001.1 GCA002794335_01510 tRNA open 1691396-1691477 trnL tRNA-Leu(tag)
3754 PGGD01000001.1 GCA002794335_01532 tRNA open 1720418-1720491 trnM tRNA-Met(cat)
3755 PGGD01000001.1 GCA002794335_01584 tRNA open 1780417-1780491 trnP tRNA-Pro(ggg)
3756 PGGD01000001.1 GCA002794335_01729 tRNA open 1956130-1956202 trnF tRNA-Phe(gaa)
3757 PGGD01000002.1 GCA002794335_01943 gene open 73829-75361 rrs
3758 PGGD01000002.1 GCA002794335_01946 gene open 75869-78774 rrl
3759 PGGD01000002.1 GCA002794335_01947 gene open 78884-78996 rrf
3760 PGGD01000002.1 regulatory_region open 128151-128333 Cobalamin riboswitch aptamer
3761 PGGD01000002.1 regulatory_region open 545590-545655 DUF805 RNA
3762 PGGD01000002.1 regulatory_region open 548107-548172 DUF805 RNA
3763 PGGD01000002.1 GCA002794335_01943 rRNA open 73829-75361 rrs 16S ribosomal RNA
3764 PGGD01000002.1 GCA002794335_01946 rRNA open 75869-78774 rrl 23S ribosomal RNA
3765 PGGD01000002.1 GCA002794335_01947 rRNA open 78884-78996 rrf 5S ribosomal RNA
3766 PGGD01000002.1 repeat_region open 66508-66774 CRISPR array with 4 repeats of length 36%2C consensus sequence GTTGTTTTTACCTTGCAAACAGCAGGCAGATGCAAC and spacer length 29
3767 PGGD01000002.1 repeat_region open 66900-67405 CRISPR array with 8 repeats of length 36%2C consensus sequence GTTGTTTTTACCTTGCAAACAGCAGGCAGATGCAAC and spacer length 29
3768 PGGD01000002.1 GCA002794335_01877 CDS open 2281-4266 _na     661_aa GmrSD restriction endonucleases N-terminal domain-containing protein
3769 PGGD01000002.1 GCA002794335_01878 CDS open 4289-4492 _na     67_aa HTH cro/C1-type domain-containing protein
3770 PGGD01000002.1 GCA002794335_01879 CDS open 4849-5157 _na     102_aa DUF3853 domain-containing protein
3771 PGGD01000002.1 GCA002794335_01880 CDS open 5154-6203 _na     349_aa Mobilization protein
3772 PGGD01000002.1 GCA002794335_01881 CDS open 6298-7281 _na     327_aa Mobilization protein
3773 PGGD01000002.1 GCA002794335_01882 CDS open 7384-7731 _na     115_aa Mobilization protein
3774 PGGD01000002.1 GCA002794335_01883 CDS open 7728-8654 _na     308_aa traI Conjugal transfer relaxase TraI
3775 PGGD01000002.1 GCA002794335_01884 CDS open 8676-9335 _na     219_aa Mobilization protein
3776 PGGD01000002.1 GCA002794335_01885 CDS open 9490-10509 _na     339_aa yhcG YhcG PDDEXK nuclease domain-containing protein
3777 PGGD01000002.1 GCA002794335_01886 CDS open 10584-10775 _na     63_aa hypothetical protein
3778 PGGD01000002.1 GCA002794335_01887 CDS open 10756-12132 _na     458_aa Tyr recombinase domain-containing protein
3779 PGGD01000002.1 GCA002794335_01888 CDS open 12585-13430 _na     281_aa Transposase
3780 PGGD01000002.1 GCA002794335_01889 CDS open 13570-14715 _na     381_aa hypothetical protein
3781 PGGD01000002.1 GCA002794335_01890 CDS open 14737-16038 _na     433_aa PKD/Chitinase domain-containing protein
3782 PGGD01000002.1 GCA002794335_01891 CDS open 16062-16415 _na     117_aa Partial transposase in ISPg3
3783 PGGD01000002.1 GCA002794335_01892 CDS open 16419-17027 _na     202_aa IS982 family transposase
3784 PGGD01000002.1 GCA002794335_01893 CDS open 17469-18167 _na     232_aa Four helix bundle protein
3785 PGGD01000002.1 GCA002794335_01894 CDS open 18252-19412 _na     386_aa bifunctional methionine sulfoxide reductase B/A protein
3786 PGGD01000002.1 GCA002794335_01895 CDS open 19641-20126 _na     161_aa Ferritin
3787 PGGD01000002.1 GCA002794335_01896 CDS open 20695-21798 _na     367_aa Iron-sulfur cluster carrier protein
3788 PGGD01000002.1 GCA002794335_01897 CDS open 21946-22431 _na     161_aa hypothetical protein
3789 PGGD01000002.1 GCA002794335_01898 CDS open 22412-22636 _na     74_aa DNA-binding protein
3790 PGGD01000002.1 GCA002794335_01899 CDS open 22809-23774 _na     321_aa Band 7 protein
3791 PGGD01000002.1 GCA002794335_01900 CDS open 24064-24579 _na     171_aa hutD HutD family protein
3792 PGGD01000002.1 GCA002794335_01901 CDS open 24787-25155 _na     122_aa hypothetical protein
3793 PGGD01000002.1 GCA002794335_01902 CDS open 25401-25616 _na     71_aa hypothetical protein
3794 PGGD01000002.1 GCA002794335_01903 CDS open 25698-25823 _na     41_aa hypothetical protein
3795 PGGD01000002.1 GCA002794335_01904 CDS open 25878-27161 _na     427_aa Peptidase
3796 PGGD01000002.1 GCA002794335_01905 CDS open 27369-28130 _na     253_aa DNA-binding protein
3797 PGGD01000002.1 GCA002794335_01906 CDS open 28307-28570 _na     87_aa hypothetical protein
3798 PGGD01000002.1 GCA002794335_01907 CDS open 28493-29311 _na     272_aa Putative 1-acyl-sn-glycerol-3-phosphate acyltransferase
3799 PGGD01000002.1 GCA002794335_01908 CDS open 29333-30508 _na     391_aa Phosphoesterase
3800 PGGD01000002.1 GCA002794335_01909 CDS open 30513-31865 _na     450_aa dihydroorotase
3801 PGGD01000002.1 GCA002794335_01910 CDS open 31898-32758 _na     286_aa DUF4369 domain-containing protein
3802 PGGD01000002.1 GCA002794335_01911 CDS open 32866-33291 _na     141_aa DUF4199 domain-containing protein
3803 PGGD01000002.1 GCA002794335_01912 CDS open 33275-33706 _na     143_aa Septum formation initiator
3804 PGGD01000002.1 GCA002794335_01913 CDS open 33839-35623 _na     594_aa DNA polymerase III subunit gamma/tau
3805 PGGD01000002.1 GCA002794335_01914 CDS open 36209-37204 _na     331_aa putative conserved protein (Some members contain a von Willebrand factor type A (VWA) domain)
3806 PGGD01000002.1 GCA002794335_01915 CDS open 37225-38094 _na     289_aa DUF58 domain-containing protein
3807 PGGD01000002.1 GCA002794335_01916 CDS open 38094-39161 _na     355_aa DUF4381 domain-containing protein
3808 PGGD01000002.1 GCA002794335_01917 CDS open 39180-40148 _na     322_aa batA Aerotolerance-related exported protein BatA
3809 PGGD01000002.1 GCA002794335_01918 CDS open 40191-41213 _na     340_aa VWFA domain-containing protein
3810 PGGD01000002.1 GCA002794335_01919 CDS open 41214-41891 _na     225_aa batC Putative aerotolerance-related exported protein BatC
3811 PGGD01000002.1 GCA002794335_01920 CDS open 41899-44475 _na     858_aa batD Aerotolerance-related exported protein BatD
3812 PGGD01000002.1 GCA002794335_01921 CDS open 44490-45191 _na     233_aa Phosphatidic acid phosphatase type 2/haloperoxidase domain-containing protein
3813 PGGD01000002.1 GCA002794335_01922 CDS open 45204-46478 _na     424_aa queA tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA
3814 PGGD01000002.1 GCA002794335_01923 CDS open 46577-46717 _na     46_aa hypothetical protein
3815 PGGD01000002.1 GCA002794335_01924 CDS open 46751-47941 _na     396_aa DNA mismatch repair protein
3816 PGGD01000002.1 GCA002794335_01925 CDS open 47957-49912 _na     651_aa NAD(+) synthase
3817 PGGD01000002.1 GCA002794335_01926 CDS open 49937-50515 _na     192_aa hypothetical protein
3818 PGGD01000002.1 GCA002794335_01927 CDS open 51265-53295 _na     676_aa Peptidase
3819 PGGD01000002.1 GCA002794335_01928 CDS open 53901-56189 _na     762_aa NADP-dependent malic enzyme
3820 PGGD01000002.1 GCA002794335_01929 CDS open 56326-56943 _na     205_aa putative transcription regulator
3821 PGGD01000002.1 GCA002794335_01930 CDS open 57067-59265 _na     732_aa GTP pyrophosphokinase
3822 PGGD01000002.1 GCA002794335_01931 CDS open 59418-60935 _na     505_aa DUF4301 domain-containing protein
3823 PGGD01000002.1 GCA002794335_01932 CDS open 61097-61735 _na     212_aa KilA-N domain-containing protein
3824 PGGD01000002.1 GCA002794335_01933 CDS open 61739-61897 _na     52_aa KilA-N domain-containing protein
3825 PGGD01000002.1 GCA002794335_01934 CDS open 61915-62076 _na     53_aa hypothetical protein
3826 PGGD01000002.1 GCA002794335_01935 CDS open 62671-65691 _na     1006_aa Por secretion system protein
3827 PGGD01000002.1 GCA002794335_01936 CDS open 65605-65778 _na     57_aa hypothetical protein
3828 PGGD01000002.1 GCA002794335_01937 CDS open 65784-66263 _na     159_aa hypothetical protein
3829 PGGD01000002.1 GCA002794335_01938 CDS open 66274-66489 _na     71_aa Transcriptional regulator
3830 PGGD01000002.1 GCA002794335_01939 CDS open 67467-68027 _na     186_aa csx28 CRISPR-associated protein Csx28
3831 PGGD01000002.1 GCA002794335_01940 CDS open 68032-71391 _na     1119_aa cas13b type VI-B CRISPR-associated RNA-guided ribonuclease Cas13b
3832 PGGD01000002.1 GCA002794335_01941 CDS open 71669-72562 _na     297_aa DUF481 domain-containing protein
3833 PGGD01000002.1 GCA002794335_01942 CDS open 72739-73155 _na     138_aa slyB SlyB protein
3834 PGGD01000002.1 GCA002794335_01948 CDS open 79226-79600 _na     124_aa Transposase
3835 PGGD01000002.1 GCA002794335_01949 CDS open 80034-80603 _na     189_aa transposase
3836 PGGD01000002.1 GCA002794335_01950 CDS open 81137-81700 _na     187_aa IS982 family transposase
3837 PGGD01000002.1 GCA002794335_01951 CDS open 81705-82037 _na     110_aa Partial transposase in ISPi1
3838 PGGD01000002.1 GCA002794335_01952 CDS open 82457-82573 _na     38_aa hypothetical protein
3839 PGGD01000002.1 GCA002794335_01953 CDS open 83007-85253 _na     748_aa pflB formate C-acetyltransferase
3840 PGGD01000002.1 GCA002794335_01954 CDS open 85489-86280 _na     263_aa pflA pyruvate formate-lyase-activating protein
3841 PGGD01000002.1 GCA002794335_01955 CDS open 86487-86951 _na     154_aa Enoyl-CoA hydratase
3842 PGGD01000002.1 GCA002794335_01956 CDS open 87245-87643 _na     132_aa hypothetical protein
3843 PGGD01000002.1 GCA002794335_01957 CDS open 87918-88571 _na     217_aa rbr rubrerythrin
3844 PGGD01000002.1 GCA002794335_01958 CDS open 89254-90546 _na     430_aa ATP-binding protein
3845 PGGD01000002.1 GCA002794335_01959 CDS open 90818-90997 _na     59_aa hypothetical protein
3846 PGGD01000002.1 GCA002794335_01960 CDS open 90908-91375 _na     155_aa nrdG anaerobic ribonucleoside-triphosphate reductase activating protein
3847 PGGD01000002.1 GCA002794335_01961 CDS open 91497-93596 _na     699_aa nrdD anaerobic ribonucleoside-triphosphate reductase
3848 PGGD01000002.1 GCA002794335_01962 CDS open 93873-94109 _na     78_aa hypothetical protein
3849 PGGD01000002.1 GCA002794335_01963 CDS open 93994-94845 _na     283_aa Patatin-like phospholipase
3850 PGGD01000002.1 GCA002794335_01964 CDS open 95087-96229 _na     380_aa Penicillin-binding protein 2
3851 PGGD01000002.1 GCA002794335_01965 CDS open 96347-98821 _na     824_aa feoB ferrous iron transport protein B
3852 PGGD01000002.1 GCA002794335_01966 CDS open 99108-100145 _na     345_aa Membrane protein
3853 PGGD01000002.1 GCA002794335_01967 CDS open 100638-101318 _na     226_aa OmpA-like domain-containing protein
3854 PGGD01000002.1 GCA002794335_01968 CDS open 101588-103069 _na     493_aa proS proline--tRNA ligase
3855 PGGD01000002.1 GCA002794335_01969 CDS open 103448-104023 _na     191_aa hypothetical protein
3856 PGGD01000002.1 GCA002794335_01970 CDS open 104059-104736 _na     225_aa Putative tRNA/rRNA methyltransferase (SpoU)
3857 PGGD01000002.1 GCA002794335_01971 CDS open 104896-107169 _na     757_aa Bacterial surface antigen (D15) domain-containing protein
3858 PGGD01000002.1 GCA002794335_01972 CDS open 107292-108095 _na     267_aa MBL fold metallo-hydrolase
3859 PGGD01000002.1 GCA002794335_01973 CDS open 108172-108483 _na     103_aa hypothetical protein
3860 PGGD01000002.1 GCA002794335_01974 CDS open 108472-110622 _na     716_aa Tetratricopeptide repeat protein
3861 PGGD01000002.1 GCA002794335_01975 CDS open 110724-111623 _na     299_aa SsuA/THI5-like domain-containing protein
3862 PGGD01000002.1 GCA002794335_01976 CDS open 111690-113069 _na     459_aa radA DNA repair protein RadA
3863 PGGD01000002.1 GCA002794335_01977 CDS open 113491-115272 _na     593_aa abc-f ribosomal protection-like ABC-F family protein
3864 PGGD01000002.1 GCA002794335_01978 CDS open 115276-115890 _na     204_aa yihA ribosome biogenesis GTP-binding protein YihA/YsxC
3865 PGGD01000002.1 GCA002794335_01979 CDS open 115901-117292 _na     463_aa glmM phosphoglucosamine mutase
3866 PGGD01000002.1 GCA002794335_01980 CDS open 117359-117997 _na     212_aa DUF4827 domain-containing protein
3867 PGGD01000002.1 GCA002794335_01981 CDS open 118214-120601 _na     795_aa Ferric aerobactin receptor
3868 PGGD01000002.1 GCA002794335_01982 CDS open 120710-120874 _na     54_aa rubredoxin
3869 PGGD01000002.1 GCA002794335_01983 CDS open 120913-121029 _na     38_aa hypothetical protein
3870 PGGD01000002.1 GCA002794335_01984 CDS open 122021-122569 _na     182_aa cinA C-terminal domain of CinA type S
3871 PGGD01000002.1 GCA002794335_01985 CDS open 122582-123616 _na     344_aa tsaD tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD
3872 PGGD01000002.1 GCA002794335_01986 CDS open 123709-124572 _na     287_aa map type I methionyl aminopeptidase
3873 PGGD01000002.1 GCA002794335_01987 CDS open 125069-125368 _na     99_aa hypothetical protein
3874 PGGD01000002.1 GCA002794335_01988 CDS open 125587-127161 _na     524_aa Hemerythrin-like domain-containing protein
3875 PGGD01000002.1 GCA002794335_01989 CDS open 127009-127428 _na     139_aa hypothetical protein
3876 PGGD01000002.1 GCA002794335_01990 CDS open 127727-127876 _na     49_aa hypothetical protein
3877 PGGD01000002.1 GCA002794335_01991 CDS open 128858-129055 _na     65_aa hypothetical protein
3878 PGGD01000002.1 GCA002794335_01992 CDS open 129240-129482 _na     80_aa Secreted protein
3879 PGGD01000002.1 GCA002794335_01993 CDS open 129656-130258 _na     200_aa Outer membrane protein beta-barrel domain-containing protein
3880 PGGD01000002.1 GCA002794335_01994 CDS open 130477-131919 _na     480_aa Peptidase M20 dimerisation domain-containing protein
3881 PGGD01000002.1 GCA002794335_01995 CDS open 132005-132199 _na     64_aa hypothetical protein
3882 PGGD01000002.1 GCA002794335_01996 CDS open 132233-132829 _na     198_aa ompH OmpH family outer membrane protein
3883 PGGD01000002.1 GCA002794335_01997 CDS open 133626-134561 _na     311_aa DUF4412 domain-containing protein
3884 PGGD01000002.1 GCA002794335_01998 CDS open 134625-136928 _na     767_aa peptidoglycan glycosyltransferase
3885 PGGD01000002.1 GCA002794335_01999 CDS open 137103-138050 _na     315_aa pyrB aspartate carbamoyltransferase
3886 PGGD01000002.1 GCA002794335_02000 CDS open 138058-138519 _na     153_aa Aspartate carbamoyltransferase regulatory chain
3887 PGGD01000002.1 GCA002794335_02001 CDS open 138811-140091 _na     426_aa Serine hydroxymethyltransferase
3888 PGGD01000002.1 GCA002794335_02002 CDS open 140027-140464 _na     145_aa hypothetical protein
3889 PGGD01000002.1 GCA002794335_02003 CDS open 140641-145083 _na     1480_aa DUF490 domain-containing protein
3890 PGGD01000002.1 GCA002794335_02004 CDS open 145275-146558 _na     427_aa Na(+)-translocating NADH-quinone reductase subunit A
3891 PGGD01000002.1 GCA002794335_02005 CDS open 146607-147761 _na     384_aa NADH:ubiquinone reductase (Na(+)-transporting) subunit B
3892 PGGD01000002.1 GCA002794335_02006 CDS open 147777-148487 _na     236_aa nqrC NADH:ubiquinone reductase (Na(+)-transporting) subunit C
3893 PGGD01000002.1 GCA002794335_02007 CDS open 148523-149152 _na     209_aa NADH:ubiquinone reductase (Na(+)-transporting) subunit D
3894 PGGD01000002.1 GCA002794335_02008 CDS open 149155-149781 _na     208_aa nqrE NADH:ubiquinone reductase (Na(+)-transporting) subunit E
3895 PGGD01000002.1 GCA002794335_02009 CDS open 149790-151058 _na     422_aa nqrF NADH:ubiquinone reductase (Na(+)-transporting) subunit F
3896 PGGD01000002.1 GCA002794335_02010 CDS open 151265-152011 _na     248_aa Eco47II restriction endonuclease
3897 PGGD01000002.1 GCA002794335_02011 CDS open 152016-153248 _na     410_aa Cytosine-specific methyltransferase
3898 PGGD01000002.1 GCA002794335_02012 CDS open 153943-154815 _na     290_aa rpoD RNA polymerase sigma-70 domain-containing protein
3899 PGGD01000002.1 GCA002794335_02013 CDS open 155109-156656 _na     515_aa THUMP domain-containing protein
3900 PGGD01000002.1 GCA002794335_02014 CDS open 156646-158850 _na     734_aa Dipeptidyl peptidase IV
3901 PGGD01000002.1 GCA002794335_02015 CDS open 158918-160186 _na     422_aa Phosphoribosylamine--glycine ligase
3902 PGGD01000002.1 GCA002794335_02016 CDS open 160390-161325 _na     311_aa Glycosyltransferase RgtA/B/C/D-like domain-containing protein
3903 PGGD01000002.1 GCA002794335_02017 CDS open 161967-163193 _na     408_aa Nucleoside transporter/FeoB GTPase Gate domain-containing protein
3904 PGGD01000002.1 GCA002794335_02018 CDS open 163210-164703 _na     497_aa Polysaccharide biosynthesis protein C-terminal domain-containing protein
3905 PGGD01000002.1 GCA002794335_02019 CDS open 164743-166866 _na     707_aa Dipeptidyl-peptidase
3906 PGGD01000002.1 GCA002794335_02020 CDS open 167646-168200 _na     184_aa Fe-S-containing hydro-lyase
3907 PGGD01000002.1 GCA002794335_02021 CDS open 168226-169068 _na     280_aa fumarate hydratase
3908 PGGD01000002.1 GCA002794335_02022 CDS open 169069-170013 _na     314_aa Lantibiotic ABC transporter
3909 PGGD01000002.1 GCA002794335_02023 CDS open 170158-170478 _na     106_aa Acyl-CoA synthetase
3910 PGGD01000002.1 GCA002794335_02024 CDS open 170503-171879 _na     458_aa 3-methylaspartate ammonia-lyase
3911 PGGD01000002.1 GCA002794335_02025 CDS open 171924-173162 _na     412_aa methylaspartate ammonia-lyase
3912 PGGD01000002.1 GCA002794335_02026 CDS open 173290-174048 _na     252_aa methylaspartate mutase subunit E
3913 PGGD01000002.1 GCA002794335_02027 CDS open 174045-174746 _na     233_aa methylaspartate mutase subunit E
3914 PGGD01000002.1 GCA002794335_02028 CDS open 174774-176159 _na     461_aa glmL methylaspartate mutase accessory protein GlmL
3915 PGGD01000002.1 GCA002794335_02029 CDS open 176163-176579 _na     138_aa glmS methylaspartate mutase subunit S
3916 PGGD01000002.1 GCA002794335_02030 CDS open 176748-176945 _na     65_aa Transcriptional regulator
3917 PGGD01000002.1 GCA002794335_02031 CDS open 177127-178056 _na     309_aa Peptidoglycan hydrolase
3918 PGGD01000002.1 GCA002794335_02032 CDS open 178623-180398 _na     591_aa rpsA 30S ribosomal protein S1
3919 PGGD01000002.1 GCA002794335_02034 CDS open 181525-181917 _na     130_aa Transglycosylase SLT domain-containing protein
3920 PGGD01000002.1 GCA002794335_02035 CDS open 182010-183218 _na     402_aa L-serine ammonia-lyase
3921 PGGD01000002.1 GCA002794335_02036 CDS open 183487-185526 _na     679_aa rho transcription termination factor Rho
3922 PGGD01000002.1 GCA002794335_02037 CDS open 185539-185709 _na     56_aa hypothetical protein
3923 PGGD01000002.1 GCA002794335_02038 CDS open 185682-186725 _na     347_aa DDH domain-containing protein
3924 PGGD01000002.1 GCA002794335_02039 CDS open 186802-187713 _na     303_aa Nucleotidyltransferase
3925 PGGD01000002.1 GCA002794335_02040 CDS open 188161-188493 _na     110_aa Partial transposase in ISPi1
3926 PGGD01000002.1 GCA002794335_02041 CDS open 188498-189061 _na     187_aa IS982 family transposase
3927 PGGD01000002.1 GCA002794335_02042 CDS open 189620-190780 _na     386_aa Initiator Rep protein WH1 domain-containing protein
3928 PGGD01000002.1 GCA002794335_02043 CDS open 190821-191330 _na     169_aa DUF4375 domain-containing protein
3929 PGGD01000002.1 GCA002794335_02044 CDS open 191323-191802 _na     159_aa smpB SsrA-binding protein SmpB
3930 PGGD01000002.1 GCA002794335_02045 CDS open 192040-192486 _na     148_aa hypothetical protein
3931 PGGD01000002.1 GCA002794335_02046 CDS open 192343-192813 _na     156_aa rlmH 23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH
3932 PGGD01000002.1 GCA002794335_02047 CDS open 192810-193121 _na     103_aa DUF4491 domain-containing protein
3933 PGGD01000002.1 GCA002794335_02048 CDS open 193345-195090 _na     581_aa Phospho-sugar mutase
3934 PGGD01000002.1 GCA002794335_02049 CDS open 195361-196041 _na     226_aa peptidylprolyl isomerase
3935 PGGD01000002.1 GCA002794335_02050 CDS open 196060-197286 _na     408_aa yjiA putative GTP-binding protein YjiA
3936 PGGD01000002.1 GCA002794335_02051 CDS open 197876-199018 _na     380_aa Cytochrome D ubiquinol oxidase subunit II
3937 PGGD01000002.1 GCA002794335_02052 CDS open 199015-200550 _na     511_aa Cytochrome d ubiquinol oxidase subunit I
3938 PGGD01000002.1 GCA002794335_02053 CDS open 200734-200952 _na     72_aa DUF4492 domain-containing protein
3939 PGGD01000002.1 GCA002794335_02054 CDS open 201115-202629 _na     504_aa Alkaline protease aprF/outer membrane efflux protein
3940 PGGD01000002.1 GCA002794335_02055 CDS open 202742-203728 _na     328_aa RND efflux pump membrane fusion protein barrel-sandwich domain-containing protein
3941 PGGD01000002.1 GCA002794335_02056 CDS open 203772-204935 _na     387_aa ABC-2 type transporter transmembrane domain-containing protein
3942 PGGD01000002.1 GCA002794335_02057 CDS open 205056-206357 _na     433_aa ABC-2 type transporter transmembrane domain-containing protein
3943 PGGD01000002.1 GCA002794335_02059 CDS open 207111-207869 _na     252_aa ydfG NADP-dependent L-serine/L-allo-threonine dehydrogenase ydfG
3944 PGGD01000002.1 GCA002794335_02060 CDS open 207986-208252 _na     88_aa Phosphoglycolate phosphatase
3945 PGGD01000002.1 GCA002794335_02061 CDS open 208260-208928 _na     222_aa Pseudouridine synthase RsuA/RluA-like domain-containing protein
3946 PGGD01000002.1 GCA002794335_02062 CDS open 208994-209740 _na     248_aa fabG 3-oxoacyl-[acyl-carrier-protein] reductase
3947 PGGD01000002.1 GCA002794335_02063 CDS open 209821-210438 _na     205_aa HTH tetR-type domain-containing protein
3948 PGGD01000002.1 GCA002794335_02064 CDS open 210728-211489 _na     253_aa Metallo-beta-lactamase domain-containing protein
3949 PGGD01000002.1 GCA002794335_02065 CDS open 211499-212524 _na     341_aa murB UDP-N-acetylmuramate dehydrogenase
3950 PGGD01000002.1 GCA002794335_02066 CDS open 212556-213410 _na     284_aa DUF4348 domain-containing protein
3951 PGGD01000002.1 GCA002794335_02067 CDS open 213574-214614 _na     346_aa pheS phenylalanine--tRNA ligase subunit alpha
3952 PGGD01000002.1 GCA002794335_02068 CDS open 215015-215524 _na     169_aa Gamma carbonic anhydrase family protein
3953 PGGD01000002.1 GCA002794335_02069 CDS open 215579-216154 _na     191_aa dTTP/UTP pyrophosphatase
3954 PGGD01000002.1 GCA002794335_02070 CDS open 216235-216753 _na     172_aa 3-deoxy-D-manno-octulosonate 8-phosphate phosphatase
3955 PGGD01000002.1 GCA002794335_02071 CDS open 216790-217563 _na     257_aa DUF2520 domain-containing protein
3956 PGGD01000002.1 GCA002794335_02072 CDS open 217701-218678 _na     325_aa BioF2-like acetyltransferase domain-containing protein
3957 PGGD01000002.1 GCA002794335_02073 CDS open 218818-219606 _na     262_aa Class I SAM-dependent methyltransferase
3958 PGGD01000002.1 GCA002794335_02074 CDS open 219639-220397 _na     252_aa kdsB 3-deoxy-manno-octulosonate cytidylyltransferase
3959 PGGD01000002.1 GCA002794335_02075 CDS open 220574-220873 _na     99_aa Transposase
3960 PGGD01000002.1 GCA002794335_02076 CDS open 220885-221841 _na     318_aa ftsY signal recognition particle-docking protein FtsY
3961 PGGD01000002.1 GCA002794335_02077 CDS open 221905-223206 _na     433_aa rimO 30S ribosomal protein S12 methylthiotransferase RimO
3962 PGGD01000002.1 GCA002794335_02078 CDS open 223265-223552 _na     95_aa Integration host factor subunit alpha
3963 PGGD01000002.1 GCA002794335_02079 CDS open 223552-224706 _na     384_aa DNA-binding protein
3964 PGGD01000002.1 GCA002794335_02080 CDS open 225241-225480 _na     79_aa hypothetical protein
3965 PGGD01000002.1 GCA002794335_02081 CDS open 225609-226130 _na     173_aa DUF3347 domain-containing protein
3966 PGGD01000002.1 GCA002794335_02082 CDS open 226231-226812 _na     193_aa ruvC crossover junction endodeoxyribonuclease RuvC
3967 PGGD01000002.1 GCA002794335_02083 CDS open 226817-227461 _na     214_aa Metallo-beta-lactamase domain-containing protein
3968 PGGD01000002.1 GCA002794335_02084 CDS open 227516-228142 _na     208_aa rsmG 16S rRNA (guanine(527)-N(7))-methyltransferase RsmG
3969 PGGD01000002.1 GCA002794335_02085 CDS open 228156-228920 _na     254_aa DUF3298 domain-containing protein
3970 PGGD01000002.1 GCA002794335_02086 CDS open 228957-229607 _na     216_aa Putative HAD hydrolase family IA
3971 PGGD01000002.1 GCA002794335_02087 CDS open 229629-230447 _na     272_aa panB 3-methyl-2-oxobutanoate hydroxymethyltransferase
3972 PGGD01000002.1 GCA002794335_02088 CDS open 230881-231954 _na     357_aa FMN-binding domain-containing protein
3973 PGGD01000002.1 GCA002794335_02089 CDS open 232310-234133 _na     607_aa lipA lipoyl synthase
3974 PGGD01000002.1 GCA002794335_02090 CDS open 234609-234989 _na     126_aa yjbR YjbR protein
3975 PGGD01000002.1 GCA002794335_02091 CDS open 235012-235488 _na     158_aa ribH 6%2C7-dimethyl-8-ribityllumazine synthase
3976 PGGD01000002.1 GCA002794335_02092 CDS open 235502-236176 _na     224_aa cpoB Ancillary SecYEG translocon subunit/Cell division coordinator CpoB TPR domain-containing protein
3977 PGGD01000002.1 GCA002794335_02093 CDS open 237020-237961 _na     313_aa trxB thioredoxin-disulfide reductase
3978 PGGD01000002.1 GCA002794335_02094 CDS open 238053-238673 _na     206_aa Deoxynucleoside kinase domain-containing protein
3979 PGGD01000002.1 GCA002794335_02095 CDS open 238713-239327 _na     204_aa Deoxynucleoside kinase domain-containing protein
3980 PGGD01000002.1 GCA002794335_02096 CDS open 239342-240772 _na     476_aa Alkaline phosphatase
3981 PGGD01000002.1 GCA002794335_02097 CDS open 241467-241961 _na     164_aa Pyridoxamine 5'-phosphate oxidase family protein
3982 PGGD01000002.1 GCA002794335_02098 CDS open 242106-244253 _na     715_aa Dipeptidyl carboxypeptidase Dcp
3983 PGGD01000002.1 GCA002794335_02099 CDS open 244914-246275 _na     453_aa dipeptidase
3984 PGGD01000002.1 GCA002794335_02100 CDS open 246810-247352 _na     180_aa KAP NTPase domain-containing protein
3985 PGGD01000002.1 GCA002794335_02101 CDS open 247367-248272 _na     301_aa KAP NTPase domain-containing protein
3986 PGGD01000002.1 GCA002794335_02102 CDS open 248395-250929 _na     844_aa Carboxypeptidase-like regulatory domain-containing protein
3987 PGGD01000002.1 GCA002794335_02103 CDS open 250958-252265 _na     435_aa Myo-inositol-1-phosphate synthase GAPDH-like domain-containing protein
3988 PGGD01000002.1 GCA002794335_02104 CDS open 252341-253042 _na     233_aa N-formylglutamate deformylase
3989 PGGD01000002.1 GCA002794335_02105 CDS open 253049-254002 _na     317_aa CDP-alcohol phosphatidyltransferase
3990 PGGD01000002.1 GCA002794335_02106 CDS open 254048-254836 _na     262_aa ATP-grasp domain-containing protein
3991 PGGD01000002.1 GCA002794335_02107 CDS open 254824-255561 _na     245_aa Nucleotidyl transferase domain-containing protein
3992 PGGD01000002.1 GCA002794335_02108 CDS open 256170-257546 _na     458_aa ABC transporter permease
3993 PGGD01000002.1 GCA002794335_02109 CDS open 257604-258308 _na     234_aa ABC transporter domain-containing protein
3994 PGGD01000002.1 GCA002794335_02110 CDS open 258341-259213 _na     290_aa GLPGLI family protein
3995 PGGD01000002.1 GCA002794335_02111 CDS open 259210-260061 _na     283_aa GLPGLI family protein
3996 PGGD01000002.1 GCA002794335_02112 CDS open 260186-262741 _na     851_aa Collagen-binding protein
3997 PGGD01000002.1 GCA002794335_02113 CDS open 263018-263392 _na     124_aa crcB fluoride efflux transporter CrcB
3998 PGGD01000002.1 GCA002794335_02114 CDS open 263531-266164 _na     877_aa mutS2 endonuclease MutS2
3999 PGGD01000002.1 GCA002794335_02115 CDS open 266491-267897 _na     468_aa tRNA(Ile)-lysidine synthase
4000 PGGD01000002.1 GCA002794335_02116 CDS open 267887-269095 _na     402_aa PUA domain-containing protein