HOMD Banner
Taxonomy: V4.3   |  16S rRNA RefSeq: V16.03   |  Genomic RefSeq: V11.03   |  Viruses: V1.2

BAKTAGenome Explorer: Streptococcus vestibularis (GCA_003438185.1)

Select a Genome:
BAKTA Annotations for GCA_003438185.1
Genome Selected: Streptococcus vestibularis
ContigsBases CDSrRNA tmRNAtRNA
52 1,898,011 1794 3 1 37
[Table]   [AA Fasta]      [Browser]   [Text]   [Excel]  
Search & Sort all 3742 Records
Search These Records: Clear
Sort Column:   Molecule   PID   NA   AA   Gene  Gene Product  Reverse
Annotation Table [page:1]    |    Number of Records Found: 3742 [8 Pages]    |    Previous Page <==> Next Page    |    Jump to Page: [ 1  2  3  4  5  6  7  8  ]
Notes:   1- Column headers only sort the current page. 2- Select [NA] or [AA] links to show sequences.
Region Protein-ID Type Genome
Viewer		 Range
(bp)		 Show Sequences
(length) NA / AA		 BAKTA
Gene		 BAKTA
GeneProduct
1 QSTK01000001.1 GCA003438185_00128 gene open 124603-124718 rrf
2 QSTK01000001.1 GCA003438185_00129 gene open 124802-127701 rrl
3 QSTK01000001.1 GCA003438185_00131 gene open 127975-129522 rrs
4 QSTK01000001.1 GCA003438185_00164 gene open 161367-161452 Bacteria_small_SRP
5 QSTK01000001.1 GCA003438185_00164 ncRNA open 161367-161452 Bacterial small signal recognition particle RNA
6 QSTK01000001.1 regulatory_region open 184670-184727 Lacto-rpoB RNA
7 QSTK01000001.1 GCA003438185_00128 rRNA open 124603-124718 rrf 5S ribosomal RNA
8 QSTK01000001.1 GCA003438185_00129 rRNA open 124802-127701 rrl 23S ribosomal RNA
9 QSTK01000001.1 GCA003438185_00131 rRNA open 127975-129522 rrs 16S ribosomal RNA
10 QSTK01000001.1 GCA003438185_00001 CDS open 114-1061 _na     315_aa ampC Beta-lactamase-related domain-containing protein
11 QSTK01000001.1 GCA003438185_00002 CDS open 1061-1816 _na     251_aa cppA CppA protein
12 QSTK01000001.1 GCA003438185_00003 CDS open 2179-2460 _na     93_aa lysostaphin resistance A-like protein
13 QSTK01000001.1 GCA003438185_00004 CDS open 2759-5026 _na     755_aa pepX Xaa-Pro dipeptidyl-peptidase
14 QSTK01000001.1 GCA003438185_00005 CDS open 5238-5639 _na     133_aa Membrane associated protein
15 QSTK01000001.1 GCA003438185_00006 CDS open 5765-5935 _na     56_aa hypothetical protein
16 QSTK01000001.1 GCA003438185_00007 CDS open 5969-6136 _na     55_aa Putative membrane protein
17 QSTK01000001.1 GCA003438185_00008 CDS open 6492-6617 _na     41_aa hypothetical protein
18 QSTK01000001.1 GCA003438185_00009 CDS open 6881-7087 _na     68_aa Immunity protein
19 QSTK01000001.1 GCA003438185_00010 CDS open 7103-7282 _na     59_aa Blp family class II bacteriocin
20 QSTK01000001.1 GCA003438185_00011 CDS open 7463-8191 _na     242_aa traX Conjugal transfer protein TraX
21 QSTK01000001.1 GCA003438185_00012 CDS open 8570-10318 _na     582_aa mdlB ABC transporter ATP-binding protein exp8
22 QSTK01000001.1 GCA003438185_00013 CDS open 10308-12068 _na     586_aa mdlB Putative multidrug resistance ABC transporter ATP-binding/permease protein YheI
23 QSTK01000001.1 GCA003438185_00014 CDS open 12168-12470 _na     100_aa hypothetical protein
24 QSTK01000001.1 GCA003438185_00015 CDS open 12547-13074 _na     175_aa vanZ VanZ-like domain-containing protein
25 QSTK01000001.1 GCA003438185_00016 CDS open 13076-14245 _na     389_aa rlmN 23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN
26 QSTK01000001.1 GCA003438185_00017 CDS open 14249-14977 _na     242_aa yutD Transcriptional regulator
27 QSTK01000001.1 GCA003438185_00018 CDS open 15032-16432 _na     466_aa ushA Calcineurin-like phosphoesterase domain-containing protein
28 QSTK01000001.1 GCA003438185_00019 CDS open 16661-16891 _na     76_aa Bacteriocin class II with double-glycine leader peptide
29 QSTK01000001.1 GCA003438185_00020 CDS open 17258-18658 _na     466_aa srmB DEAD-box ATP-dependent RNA helicase CshB
30 QSTK01000001.1 GCA003438185_00021 CDS open 18674-19696 _na     340_aa mraY phospho-N-acetylmuramoyl-pentapeptide-transferase
31 QSTK01000001.1 GCA003438185_00022 CDS open 19698-21965 _na     755_aa pbp2X penicillin-binding protein PBP2X
32 QSTK01000001.1 GCA003438185_00023 CDS open 21969-22289 _na     106_aa ftsL cell division protein FtsL
33 QSTK01000001.1 GCA003438185_00024 CDS open 22292-23242 _na     316_aa rsmH 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH
34 QSTK01000001.1 GCA003438185_00025 CDS open 23362-24174 _na     270_aa Lipoprotein
35 QSTK01000001.1 GCA003438185_00026 CDS open 24411-24851 _na     146_aa cpsC Capsular polysaccharide biosynthesis protein CpsC
36 QSTK01000001.1 GCA003438185_00027 CDS open 25021-25449 _na     142_aa TM2 domain-containing protein
37 QSTK01000001.1 GCA003438185_00028 CDS open 25452-26330 _na     292_aa LPXTG cell wall anchor domain-containing protein
38 QSTK01000001.1 GCA003438185_00029 CDS open 26720-27970 _na     416_aa proA glutamate-5-semialdehyde dehydrogenase
39 QSTK01000001.1 GCA003438185_00030 CDS open 27972-28775 _na     267_aa proB Glutamate 5-kinase
40 QSTK01000001.1 GCA003438185_00031 CDS open 28896-30485 _na     529_aa ABC transporter permease
41 QSTK01000001.1 GCA003438185_00032 CDS open 30488-31219 _na     243_aa rbbA Multidrug ABC transporter ATPase
42 QSTK01000001.1 GCA003438185_00033 CDS open 31494-32225 _na     243_aa DUF554 domain-containing protein
43 QSTK01000001.1 GCA003438185_00034 CDS open 32619-36272 _na     1217_aa addA helicase-exonuclease AddAB subunit AddA
44 QSTK01000001.1 GCA003438185_00035 CDS open 36262-39654 _na     1130_aa rexB ATP-dependent nuclease subunit B
45 QSTK01000001.1 GCA003438185_00036 CDS open 40064-40744 _na     226_aa Cell wall-active antibiotics response LiaF-like C-terminal domain-containing protein
46 QSTK01000001.1 GCA003438185_00037 CDS open 40749-41195 _na     148_aa lytTR HTH LytTR-type domain-containing protein
47 QSTK01000001.1 GCA003438185_00038 CDS open 41408-42250 _na     280_aa tcaA TcaA 4th domain-containing protein
48 QSTK01000001.1 GCA003438185_00039 CDS open 42488-43546 _na     352_aa DUF6574 domain-containing protein
49 QSTK01000001.1 GCA003438185_00040 CDS open 43664-45049 _na     461_aa mazG2 Cof-type HAD-IIB family hydrolase
50 QSTK01000001.1 GCA003438185_00041 CDS open 45166-46089 _na     307_aa ansA L-asparaginase 2
51 QSTK01000001.1 GCA003438185_00042 CDS open 46093-46236 _na     47_aa hypothetical protein
52 QSTK01000001.1 GCA003438185_00043 CDS open 46288-46500 _na     70_aa Putative transcriptional regulator
53 QSTK01000001.1 GCA003438185_00044 CDS open 46509-47117 _na     202_aa DUF2975 domain-containing protein
54 QSTK01000001.1 GCA003438185_00045 CDS open 47309-47746 _na     145_aa DUF2975 domain-containing protein
55 QSTK01000001.1 GCA003438185_00046 CDS open 48282-48455 _na     57_aa hypothetical protein
56 QSTK01000001.1 GCA003438185_00047 CDS open 48467-50497 _na     676_aa recG ATP-dependent DNA helicase RecG
57 QSTK01000001.1 GCA003438185_00048 CDS open 50616-51719 _na     367_aa alr alanine racemase
58 QSTK01000001.1 GCA003438185_00049 CDS open 51723-52100 _na     125_aa acpS Holo-[acyl-carrier-protein] synthase
59 QSTK01000001.1 GCA003438185_00050 CDS open 52103-53134 _na     343_aa 3-deoxy-7-phosphoheptulonate synthase
60 QSTK01000001.1 GCA003438185_00051 CDS open 53219-54250 _na     343_aa aroG1 3-deoxy-7-phosphoheptulonate synthase
61 QSTK01000001.1 GCA003438185_00052 CDS open 54274-56823 _na     849_aa secA preprotein translocase subunit SecA
62 QSTK01000001.1 GCA003438185_00053 CDS open 57006-57350 _na     114_aa hypothetical protein
63 QSTK01000001.1 GCA003438185_00054 CDS open 57353-58300 _na     315_aa manA mannose-6-phosphate isomerase%2C class I
64 QSTK01000001.1 GCA003438185_00055 CDS open 58366-59259 _na     297_aa scrK fructokinase ScrK
65 QSTK01000001.1 GCA003438185_00056 CDS open 59443-61344 _na     633_aa nagE PTS system beta-glucoside-specific EIIBCA component
66 QSTK01000001.1 GCA003438185_00057 CDS open 61533-62975 _na     480_aa sacC Sucrose-6-phosphate hydrolase
67 QSTK01000001.1 GCA003438185_00058 CDS open 62984-63949 _na     321_aa purR Sucrose operon repressor
68 QSTK01000001.1 GCA003438185_00059 CDS open 64039-64473 _na     144_aa nusB transcription antitermination factor NusB
69 QSTK01000001.1 GCA003438185_00060 CDS open 64466-64855 _na     129_aa yloU Asp23/Gls24 family envelope stress response protein
70 QSTK01000001.1 GCA003438185_00061 CDS open 64926-65486 _na     186_aa efp elongation factor P
71 QSTK01000001.1 GCA003438185_00062 CDS open 65599-66054 _na     151_aa comE Competence protein ComE
72 QSTK01000001.1 GCA003438185_00063 CDS open 66073-67134 _na     353_aa pepP Xaa-Pro aminopeptidase
73 QSTK01000001.1 GCA003438185_00064 CDS open 67266-67988 _na     240_aa ABC-2 family transporter protein
74 QSTK01000001.1 GCA003438185_00065 CDS open 67978-68799 _na     273_aa ecsA ABC-type transporter ATP-binding protein EcsA
75 QSTK01000001.1 GCA003438185_00066 CDS open 68935-69087 _na     50_aa Bacteriocin-type signal sequence
76 QSTK01000001.1 GCA003438185_00067 CDS open 69100-69249 _na     49_aa Bacteriocin
77 QSTK01000001.1 GCA003438185_00068 CDS open 69278-69412 _na     44_aa Bacteriocin
78 QSTK01000001.1 GCA003438185_00069 CDS open 69843-69992 _na     49_aa Bacteriocin-type signal sequence
79 QSTK01000001.1 GCA003438185_00070 CDS open 70166-70408 _na     80_aa DUF3923 domain-containing protein
80 QSTK01000001.1 GCA003438185_00071 CDS open 70503-73328 _na     941_aa uvrA excinuclease ABC subunit UvrA
81 QSTK01000001.1 GCA003438185_00072 CDS open 73623-74567 _na     314_aa corA CorA cation transporter (MIT) family protein
82 QSTK01000001.1 GCA003438185_00073 CDS open 74635-75306 _na     223_aa DUF1129 domain-containing protein
83 QSTK01000001.1 GCA003438185_00074 CDS open 75417-76298 _na     293_aa DUF4300 domain-containing protein
84 QSTK01000001.1 GCA003438185_00075 CDS open 76422-76661 _na     79_aa rpsR 30S ribosomal protein S18
85 QSTK01000001.1 GCA003438185_00076 CDS open 76703-77221 _na     172_aa ssb Single-stranded DNA-binding protein
86 QSTK01000001.1 GCA003438185_00077 CDS open 77233-77523 _na     96_aa rpsF 30S ribosomal protein S6
87 QSTK01000001.1 GCA003438185_00078 CDS open 77727-78680 _na     317_aa Cytosolic protein
88 QSTK01000001.1 GCA003438185_00079 CDS open 79880-81031 _na     383_aa mutY A/G-specific adenine glycosylase
89 QSTK01000001.1 GCA003438185_00080 CDS open 81217-81333 _na     38_aa hypothetical protein
90 QSTK01000001.1 GCA003438185_00081 CDS open 81337-83976 _na     879_aa polA DNA polymerase I
91 QSTK01000001.1 GCA003438185_00082 CDS open 84124-86499 _na     791_aa mutS2 endonuclease MutS2
92 QSTK01000001.1 GCA003438185_00083 CDS open 86567-86794 _na     75_aa DUF4190 domain-containing protein
93 QSTK01000001.1 GCA003438185_00084 CDS open 86931-87584 _na     217_aa Manganese transport regulator
94 QSTK01000001.1 GCA003438185_00085 CDS open 88713-89645 _na     310_aa fimA Metal ABC transporter substrate-binding lipoprotein FimA
95 QSTK01000001.1 GCA003438185_00086 CDS open 89666-90499 _na     277_aa scaB Manganese import system permease protein ScaB
96 QSTK01000001.1 GCA003438185_00087 CDS open 90496-91218 _na     240_aa ABC transporter domain-containing protein
97 QSTK01000001.1 GCA003438185_00088 CDS open 91264-91479 _na     71_aa Transposase
98 QSTK01000001.1 GCA003438185_00089 CDS open 91591-92133 _na     180_aa cvpA CvpA family protein
99 QSTK01000001.1 GCA003438185_00090 CDS open 92130-92369 _na     79_aa zapA Cell division protein ZapA
100 QSTK01000001.1 GCA003438185_00091 CDS open 92759-93649 _na     296_aa rnhC ribonuclease HIII
101 QSTK01000001.1 GCA003438185_00092 CDS open 93668-94309 _na     213_aa lepB signal peptidase I
102 QSTK01000001.1 GCA003438185_00093 CDS open 94370-96874 _na     834_aa recD ATP-dependent RecD2 DNA helicase
103 QSTK01000001.1 GCA003438185_00094 CDS open 96929-97255 _na     108_aa azlD2 Branched-chain amino acid transport protein azlD
104 QSTK01000001.1 GCA003438185_00095 CDS open 97242-97934 _na     230_aa azlC AzlC family ABC transporter permease
105 QSTK01000001.1 GCA003438185_00096 CDS open 97986-98999 _na     337_aa tsaD tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD
106 QSTK01000001.1 GCA003438185_00097 CDS open 98999-99439 _na     146_aa rimI ribosomal protein S18-alanine N-acetyltransferase
107 QSTK01000001.1 GCA003438185_00098 CDS open 99414-100100 _na     228_aa tsaB tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB
108 QSTK01000001.1 GCA003438185_00099 CDS open 100361-100591 _na     76_aa rpoY DNA-directed RNA polymerase subunit epsilon
109 QSTK01000001.1 GCA003438185_00100 CDS open 100596-102278 _na     560_aa rnjA ribonuclease J1
110 QSTK01000001.1 GCA003438185_00101 CDS open 102905-104248 _na     447_aa glnA type I glutamate--ammonia ligase
111 QSTK01000001.1 GCA003438185_00102 CDS open 104297-104671 _na     124_aa soxR Transcriptional regulator%2C repressor of the glutamine synthetase%2C MerR family
112 QSTK01000001.1 GCA003438185_00103 CDS open 104845-105348 _na     167_aa ygaE Aromatic acid exporter family protein
113 QSTK01000001.1 GCA003438185_00104 CDS open 105502-106701 _na     399_aa pgk Phosphoglycerate kinase
114 QSTK01000001.1 GCA003438185_00105 CDS open 107052-107474 _na     140_aa hypothetical protein
115 QSTK01000001.1 GCA003438185_00106 CDS open 107657-108670 _na     337_aa gap type I glyceraldehyde-3-phosphate dehydrogenase
116 QSTK01000001.1 GCA003438185_00107 CDS open 108858-110939 _na     693_aa fusA elongation factor G
117 QSTK01000001.1 GCA003438185_00108 CDS open 111152-111622 _na     156_aa rpsG 30S ribosomal protein S7
118 QSTK01000001.1 GCA003438185_00109 CDS open 111641-112054 _na     137_aa rpsL 30S ribosomal protein S12
119 QSTK01000001.1 GCA003438185_00110 CDS open 112274-113098 _na     274_aa purR pur operon repressor
120 QSTK01000001.1 GCA003438185_00111 CDS open 113192-114133 _na     313_aa yhaM 3'-5' exonuclease
121 QSTK01000001.1 GCA003438185_00112 CDS open 114123-115397 _na     424_aa rmuC DNA recombination protein RmuC
122 QSTK01000001.1 GCA003438185_00113 CDS open 115399-116031 _na     210_aa thiamine diphosphokinase
123 QSTK01000001.1 GCA003438185_00114 CDS open 116024-116683 _na     219_aa rpe ribulose-phosphate 3-epimerase
124 QSTK01000001.1 GCA003438185_00115 CDS open 116691-117563 _na     290_aa rsgA ribosome small subunit-dependent GTPase A
125 QSTK01000001.1 GCA003438185_00117 CDS open 117821-118693 _na     290_aa rsmA 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA
126 QSTK01000001.1 GCA003438185_00118 CDS open 118837-119397 _na     186_aa rnmV ribonuclease M5
127 QSTK01000001.1 GCA003438185_00119 CDS open 119390-120166 _na     258_aa tatD D-amino acyl-tRNA deacylase
128 QSTK01000001.1 GCA003438185_00120 CDS open 120220-120651 _na     143_aa yccU CoA-binding domain-containing protein
129 QSTK01000001.1 GCA003438185_00121 CDS open 120712-121026 _na     104_aa trxA thioredoxin
130 QSTK01000001.1 GCA003438185_00122 CDS open 121222-122004 _na     260_aa ymdB protein-ADP-ribose hydrolase
131 QSTK01000001.1 GCA003438185_00123 CDS open 122128-122628 _na     166_aa transposase
132 QSTK01000001.1 GCA003438185_00124 CDS open 122843-123097 _na     84_aa Transposase IS4-like domain-containing protein
133 QSTK01000001.1 GCA003438185_00125 CDS open 123392-123640 _na     82_aa Transposase DDE domain-containing protein
134 QSTK01000001.1 GCA003438185_00126 CDS open 124079-124414 _na     111_aa trxA Bacteriocin transport accessory protein%2C putative
135 QSTK01000001.1 GCA003438185_00132 CDS open 130209-131351 _na     380_aa tgt tRNA guanosine(34) transglycosylase Tgt
136 QSTK01000001.1 GCA003438185_00133 CDS open 131732-131941 _na     69_aa Transposase IS200 like protein
137 QSTK01000001.1 GCA003438185_00134 CDS open 132382-132516 _na     44_aa rpmH 50S ribosomal protein L34
138 QSTK01000001.1 GCA003438185_00135 CDS open 132866-133027 _na     53_aa hypothetical protein
139 QSTK01000001.1 GCA003438185_00136 CDS open 133740-134324 _na     194_aa Integrase catalytic domain-containing protein
140 QSTK01000001.1 GCA003438185_00137 CDS open 134401-135450 _na     349_aa jag RNA-binding cell elongation regulator Jag/EloR
141 QSTK01000001.1 GCA003438185_00138 CDS open 135462-136316 _na     284_aa yidC Membrane protein insertase YidC
142 QSTK01000001.1 GCA003438185_00139 CDS open 136384-136719 _na     111_aa rnpA ribonuclease P protein component
143 QSTK01000001.1 GCA003438185_00140 CDS open 136804-138189 _na     461_aa argH argininosuccinate lyase
144 QSTK01000001.1 GCA003438185_00141 CDS open 138516-139715 _na     399_aa argG argininosuccinate synthase
145 QSTK01000001.1 GCA003438185_00142 CDS open 141152-141283 _na     43_aa hypothetical protein
146 QSTK01000001.1 GCA003438185_00143 CDS open 141680-143134 _na     484_aa gltX glutamate--tRNA ligase
147 QSTK01000001.1 GCA003438185_00144 CDS open 143316-145286 _na     656_aa amiA Oligopeptide-binding protein AmiA
148 QSTK01000001.1 GCA003438185_00145 CDS open 145466-146155 _na     229_aa rplA 50S ribosomal protein L1
149 QSTK01000001.1 GCA003438185_00146 CDS open 146255-146680 _na     141_aa Large ribosomal subunit protein uL11
150 QSTK01000001.1 GCA003438185_00147 CDS open 146852-147205 _na     117_aa Integral membrane protein
151 QSTK01000001.1 GCA003438185_00148 CDS open 147299-147796 _na     165_aa Carbonate dehydratase
152 QSTK01000001.1 GCA003438185_00149 CDS open 147947-148642 _na     231_aa TIGR00266 family protein
153 QSTK01000001.1 GCA003438185_00150 CDS open 148729-149976 _na     415_aa radA DNA repair protein RadA
154 QSTK01000001.1 GCA003438185_00151 CDS open 150269-150715 _na     148_aa dut dUTP diphosphatase
155 QSTK01000001.1 GCA003438185_00152 CDS open 150930-151532 _na     200_aa Fumarate reductase%2C flavoprotein subunit
156 QSTK01000001.1 GCA003438185_00153 CDS open 151551-152801 _na     416_aa NAD(P)H-dependent oxidoreductase
157 QSTK01000001.1 GCA003438185_00154 CDS open 152917-153708 _na     263_aa nirC Nitrite transporter NirC
158 QSTK01000001.1 GCA003438185_00155 CDS open 153717-154277 _na     186_aa Trep-Strep domain-containing protein
159 QSTK01000001.1 GCA003438185_00156 CDS open 154396-155418 _na     340_aa gpsA NAD(P)H-dependent glycerol-3-phosphate dehydrogenase
160 QSTK01000001.1 GCA003438185_00157 CDS open 155436-156350 _na     304_aa galU UTP--glucose-1-phosphate uridylyltransferase GalU
161 QSTK01000001.1 GCA003438185_00158 CDS open 156396-157070 _na     224_aa glpG Rhomboid protease GluP
162 QSTK01000001.1 GCA003438185_00159 CDS open 157061-157588 _na     175_aa fAU1 5-formyltetrahydrofolate cyclo-ligase
163 QSTK01000001.1 GCA003438185_00160 CDS open 157657-158790 _na     377_aa abgB N-acetyldiaminopimelate deacetylase
164 QSTK01000001.1 GCA003438185_00161 CDS open 158868-159566 _na     232_aa dapD 2%2C3%2C4%2C5-tetrahydropyridine-2%2C6-dicarboxylate N-acetyltransferase
165 QSTK01000001.1 GCA003438185_00162 CDS open 159652-160419 _na     255_aa HAD family hydrolase
166 QSTK01000001.1 GCA003438185_00163 CDS open 160519-161352 _na     277_aa Ribosomal RNA large subunit methyltransferase
167 QSTK01000001.1 GCA003438185_00165 CDS open 161773-161931 _na     52_aa blpM Bacteriocin BlpM
168 QSTK01000001.1 GCA003438185_00166 CDS open 161951-162118 _na     55_aa Class IIb bacteriocin%2C lactobin A/cerein 7B family
169 QSTK01000001.1 GCA003438185_00167 CDS open 162166-162417 _na     83_aa Bacteriocin immunity protein
170 QSTK01000001.1 GCA003438185_00168 CDS open 162504-163022 _na     172_aa tadA tRNA adenosine(34) deaminase TadA
171 QSTK01000001.1 GCA003438185_00169 CDS open 163749-164141 _na     130_aa ssb single-stranded DNA-binding protein
172 QSTK01000001.1 GCA003438185_00170 CDS open 164346-164573 _na     75_aa tusA UPF0033 domain-containing protein
173 QSTK01000001.1 GCA003438185_00171 CDS open 164588-165619 _na     343_aa Conserved hypothetical%2C putative membrane protein (TMS9)
174 QSTK01000001.1 GCA003438185_00172 CDS open 165757-166380 _na     207_aa ytpR YtpR family tRNA-binding protein
175 QSTK01000001.1 GCA003438185_00173 CDS open 166390-166704 _na     104_aa trxA Thioredoxin
176 QSTK01000001.1 GCA003438185_00174 CDS open 166701-166985 _na     94_aa DUF4651 domain-containing protein
177 QSTK01000001.1 GCA003438185_00175 CDS open 167085-168152 _na     355_aa pepA glutamyl aminopeptidase
178 QSTK01000001.1 GCA003438185_00176 CDS open 168168-168938 _na     256_aa proC pyrroline-5-carboxylate reductase
179 QSTK01000001.1 GCA003438185_00177 CDS open 168964-169626 _na     220_aa ydiL Membrane-bound protease%2C CAAn family
180 QSTK01000001.1 GCA003438185_00178 CDS open 169726-170169 _na     147_aa CAAX amino terminal protease family protein
181 QSTK01000001.1 GCA003438185_00179 CDS open 170183-170380 _na     65_aa xRE Transcriptional regulator
182 QSTK01000001.1 GCA003438185_00180 CDS open 170631-171824 _na     397_aa ackA Acetate kinase
183 QSTK01000001.1 GCA003438185_00181 CDS open 171881-172837 _na     318_aa ytxK Adenine-specific methyltransferase
184 QSTK01000001.1 GCA003438185_00182 CDS open 172882-173199 _na     105_aa comGG competence type IV pilus minor pilin ComGG
185 QSTK01000001.1 GCA003438185_00183 CDS open 173177-173614 _na     145_aa comGF competence type IV pilus minor pilin ComGF
186 QSTK01000001.1 GCA003438185_00184 CDS open 173601-173831 _na     76_aa comGE competence type IV pilus minor pilin ComGE
187 QSTK01000001.1 GCA003438185_00185 CDS open 173863-174300 _na     145_aa comGD competence type IV pilus minor pilin ComGD
188 QSTK01000001.1 GCA003438185_00186 CDS open 174251-174577 _na     108_aa comGC competence type IV pilus major pilin ComGC
189 QSTK01000001.1 GCA003438185_00187 CDS open 174574-175398 _na     274_aa comGB competence type IV pilus assembly protein ComGB
190 QSTK01000001.1 GCA003438185_00188 CDS open 175556-176497 _na     313_aa comGA competence type IV pilus ATPase ComGA
191 QSTK01000001.1 GCA003438185_00189 CDS open 176578-176940 _na     120_aa DNA binding protein
192 QSTK01000001.1 GCA003438185_00190 CDS open 177103-180741 _na     1212_aa rpoC DNA-directed RNA polymerase subunit beta'
193 QSTK01000001.1 GCA003438185_00191 CDS open 180842-184423 _na     1193_aa rpoB DNA-directed RNA polymerase subunit beta
194 QSTK01000001.1 GCA003438185_00192 CDS open 184783-187206 _na     807_aa pbp1b penicillin-binding protein PBP1B
195 QSTK01000001.1 GCA003438185_00193 CDS open 187308-188564 _na     418_aa tyrS tyrosine--tRNA ligase
196 QSTK01000001.1 GCA003438185_00194 CDS open 188688-189710 _na     340_aa ilvC ketol-acid reductoisomerase
197 QSTK01000001.1 GCA003438185_00195 CDS open 189786-190262 _na     158_aa ilvN acetolactate synthase small subunit
198 QSTK01000001.1 GCA003438185_00196 CDS open 190255-191955 _na     566_aa ilvB acetolactate synthase large subunit
199 QSTK01000001.1 GCA003438185_00197 CDS open 192089-193798 _na     569_aa ilvD dihydroxy-acid dehydratase
200 QSTK01000001.1 GCA003438185_00001 gene open 114-1061 ampC
201 QSTK01000001.1 GCA003438185_00002 gene open 1061-1816 cppA
202 QSTK01000001.1 GCA003438185_00003 gene open 2179-2460
203 QSTK01000001.1 GCA003438185_00004 gene open 2759-5026 pepX
204 QSTK01000001.1 GCA003438185_00005 gene open 5238-5639
205 QSTK01000001.1 GCA003438185_00006 gene open 5765-5935
206 QSTK01000001.1 GCA003438185_00007 gene open 5969-6136
207 QSTK01000001.1 GCA003438185_00008 gene open 6492-6617
208 QSTK01000001.1 GCA003438185_00009 gene open 6881-7087
209 QSTK01000001.1 GCA003438185_00010 gene open 7103-7282
210 QSTK01000001.1 GCA003438185_00011 gene open 7463-8191 traX
211 QSTK01000001.1 GCA003438185_00012 gene open 8570-10318 mdlB
212 QSTK01000001.1 GCA003438185_00013 gene open 10308-12068 mdlB
213 QSTK01000001.1 GCA003438185_00014 gene open 12168-12470
214 QSTK01000001.1 GCA003438185_00015 gene open 12547-13074 vanZ
215 QSTK01000001.1 GCA003438185_00016 gene open 13076-14245 rlmN
216 QSTK01000001.1 GCA003438185_00017 gene open 14249-14977 yutD
217 QSTK01000001.1 GCA003438185_00018 gene open 15032-16432 ushA
218 QSTK01000001.1 GCA003438185_00019 gene open 16661-16891
219 QSTK01000001.1 GCA003438185_00020 gene open 17258-18658 srmB
220 QSTK01000001.1 GCA003438185_00021 gene open 18674-19696 mraY
221 QSTK01000001.1 GCA003438185_00022 gene open 19698-21965 pbp2X
222 QSTK01000001.1 GCA003438185_00023 gene open 21969-22289 ftsL
223 QSTK01000001.1 GCA003438185_00024 gene open 22292-23242 rsmH
224 QSTK01000001.1 GCA003438185_00025 gene open 23362-24174
225 QSTK01000001.1 GCA003438185_00026 gene open 24411-24851 cpsC
226 QSTK01000001.1 GCA003438185_00027 gene open 25021-25449
227 QSTK01000001.1 GCA003438185_00028 gene open 25452-26330
228 QSTK01000001.1 GCA003438185_00029 gene open 26720-27970 proA
229 QSTK01000001.1 GCA003438185_00030 gene open 27972-28775 proB
230 QSTK01000001.1 GCA003438185_00031 gene open 28896-30485
231 QSTK01000001.1 GCA003438185_00032 gene open 30488-31219 rbbA
232 QSTK01000001.1 GCA003438185_00033 gene open 31494-32225
233 QSTK01000001.1 GCA003438185_00034 gene open 32619-36272 addA
234 QSTK01000001.1 GCA003438185_00035 gene open 36262-39654 rexB
235 QSTK01000001.1 GCA003438185_00036 gene open 40064-40744
236 QSTK01000001.1 GCA003438185_00037 gene open 40749-41195 lytTR
237 QSTK01000001.1 GCA003438185_00038 gene open 41408-42250 tcaA
238 QSTK01000001.1 GCA003438185_00039 gene open 42488-43546
239 QSTK01000001.1 GCA003438185_00040 gene open 43664-45049 mazG2
240 QSTK01000001.1 GCA003438185_00041 gene open 45166-46089 ansA
241 QSTK01000001.1 GCA003438185_00042 gene open 46093-46236
242 QSTK01000001.1 GCA003438185_00043 gene open 46288-46500
243 QSTK01000001.1 GCA003438185_00044 gene open 46509-47117
244 QSTK01000001.1 GCA003438185_00045 gene open 47309-47746
245 QSTK01000001.1 GCA003438185_00046 gene open 48282-48455
246 QSTK01000001.1 GCA003438185_00047 gene open 48467-50497 recG
247 QSTK01000001.1 GCA003438185_00048 gene open 50616-51719 alr
248 QSTK01000001.1 GCA003438185_00049 gene open 51723-52100 acpS
249 QSTK01000001.1 GCA003438185_00050 gene open 52103-53134
250 QSTK01000001.1 GCA003438185_00051 gene open 53219-54250 aroG1
251 QSTK01000001.1 GCA003438185_00052 gene open 54274-56823 secA
252 QSTK01000001.1 GCA003438185_00053 gene open 57006-57350
253 QSTK01000001.1 GCA003438185_00054 gene open 57353-58300 manA
254 QSTK01000001.1 GCA003438185_00055 gene open 58366-59259 scrK
255 QSTK01000001.1 GCA003438185_00056 gene open 59443-61344 nagE
256 QSTK01000001.1 GCA003438185_00057 gene open 61533-62975 sacC
257 QSTK01000001.1 GCA003438185_00058 gene open 62984-63949 purR
258 QSTK01000001.1 GCA003438185_00059 gene open 64039-64473 nusB
259 QSTK01000001.1 GCA003438185_00060 gene open 64466-64855 yloU
260 QSTK01000001.1 GCA003438185_00061 gene open 64926-65486 efp
261 QSTK01000001.1 GCA003438185_00062 gene open 65599-66054 comE
262 QSTK01000001.1 GCA003438185_00063 gene open 66073-67134 pepP
263 QSTK01000001.1 GCA003438185_00064 gene open 67266-67988
264 QSTK01000001.1 GCA003438185_00065 gene open 67978-68799 ecsA
265 QSTK01000001.1 GCA003438185_00066 gene open 68935-69087
266 QSTK01000001.1 GCA003438185_00067 gene open 69100-69249
267 QSTK01000001.1 GCA003438185_00068 gene open 69278-69412
268 QSTK01000001.1 GCA003438185_00069 gene open 69843-69992
269 QSTK01000001.1 GCA003438185_00070 gene open 70166-70408
270 QSTK01000001.1 GCA003438185_00071 gene open 70503-73328 uvrA
271 QSTK01000001.1 GCA003438185_00072 gene open 73623-74567 corA
272 QSTK01000001.1 GCA003438185_00073 gene open 74635-75306
273 QSTK01000001.1 GCA003438185_00074 gene open 75417-76298
274 QSTK01000001.1 GCA003438185_00075 gene open 76422-76661 rpsR
275 QSTK01000001.1 GCA003438185_00076 gene open 76703-77221 ssb
276 QSTK01000001.1 GCA003438185_00077 gene open 77233-77523 rpsF
277 QSTK01000001.1 GCA003438185_00078 gene open 77727-78680
278 QSTK01000001.1 GCA003438185_00079 gene open 79880-81031 mutY
279 QSTK01000001.1 GCA003438185_00080 gene open 81217-81333
280 QSTK01000001.1 GCA003438185_00081 gene open 81337-83976 polA
281 QSTK01000001.1 GCA003438185_00082 gene open 84124-86499 mutS2
282 QSTK01000001.1 GCA003438185_00083 gene open 86567-86794
283 QSTK01000001.1 GCA003438185_00084 gene open 86931-87584
284 QSTK01000001.1 GCA003438185_00085 gene open 88713-89645 fimA
285 QSTK01000001.1 GCA003438185_00086 gene open 89666-90499 scaB
286 QSTK01000001.1 GCA003438185_00087 gene open 90496-91218
287 QSTK01000001.1 GCA003438185_00088 gene open 91264-91479
288 QSTK01000001.1 GCA003438185_00089 gene open 91591-92133 cvpA
289 QSTK01000001.1 GCA003438185_00090 gene open 92130-92369 zapA
290 QSTK01000001.1 GCA003438185_00091 gene open 92759-93649 rnhC
291 QSTK01000001.1 GCA003438185_00092 gene open 93668-94309 lepB
292 QSTK01000001.1 GCA003438185_00093 gene open 94370-96874 recD
293 QSTK01000001.1 GCA003438185_00094 gene open 96929-97255 azlD2
294 QSTK01000001.1 GCA003438185_00095 gene open 97242-97934 azlC
295 QSTK01000001.1 GCA003438185_00096 gene open 97986-98999 tsaD
296 QSTK01000001.1 GCA003438185_00097 gene open 98999-99439 rimI
297 QSTK01000001.1 GCA003438185_00098 gene open 99414-100100 tsaB
298 QSTK01000001.1 GCA003438185_00099 gene open 100361-100591 rpoY
299 QSTK01000001.1 GCA003438185_00100 gene open 100596-102278 rnjA
300 QSTK01000001.1 GCA003438185_00101 gene open 102905-104248 glnA
301 QSTK01000001.1 GCA003438185_00102 gene open 104297-104671 soxR
302 QSTK01000001.1 GCA003438185_00103 gene open 104845-105348 ygaE
303 QSTK01000001.1 GCA003438185_00104 gene open 105502-106701 pgk
304 QSTK01000001.1 GCA003438185_00105 gene open 107052-107474
305 QSTK01000001.1 GCA003438185_00106 gene open 107657-108670 gap
306 QSTK01000001.1 GCA003438185_00107 gene open 108858-110939 fusA
307 QSTK01000001.1 GCA003438185_00108 gene open 111152-111622 rpsG
308 QSTK01000001.1 GCA003438185_00109 gene open 111641-112054 rpsL
309 QSTK01000001.1 GCA003438185_00110 gene open 112274-113098 purR
310 QSTK01000001.1 GCA003438185_00111 gene open 113192-114133 yhaM
311 QSTK01000001.1 GCA003438185_00112 gene open 114123-115397 rmuC
312 QSTK01000001.1 GCA003438185_00113 gene open 115399-116031
313 QSTK01000001.1 GCA003438185_00114 gene open 116024-116683 rpe
314 QSTK01000001.1 GCA003438185_00115 gene open 116691-117563 rsgA
315 QSTK01000001.1 GCA003438185_00117 gene open 117821-118693 rsmA
316 QSTK01000001.1 GCA003438185_00118 gene open 118837-119397 rnmV
317 QSTK01000001.1 GCA003438185_00119 gene open 119390-120166 tatD
318 QSTK01000001.1 GCA003438185_00120 gene open 120220-120651 yccU
319 QSTK01000001.1 GCA003438185_00121 gene open 120712-121026 trxA
320 QSTK01000001.1 GCA003438185_00122 gene open 121222-122004 ymdB
321 QSTK01000001.1 GCA003438185_00123 gene open 122128-122628
322 QSTK01000001.1 GCA003438185_00124 gene open 122843-123097
323 QSTK01000001.1 GCA003438185_00125 gene open 123392-123640
324 QSTK01000001.1 GCA003438185_00126 gene open 124079-124414 trxA
325 QSTK01000001.1 GCA003438185_00132 gene open 130209-131351 tgt
326 QSTK01000001.1 GCA003438185_00133 gene open 131732-131941
327 QSTK01000001.1 GCA003438185_00134 gene open 132382-132516 rpmH
328 QSTK01000001.1 GCA003438185_00135 gene open 132866-133027
329 QSTK01000001.1 GCA003438185_00136 gene open 133740-134324
330 QSTK01000001.1 GCA003438185_00137 gene open 134401-135450 jag
331 QSTK01000001.1 GCA003438185_00138 gene open 135462-136316 yidC
332 QSTK01000001.1 GCA003438185_00139 gene open 136384-136719 rnpA
333 QSTK01000001.1 GCA003438185_00140 gene open 136804-138189 argH
334 QSTK01000001.1 GCA003438185_00141 gene open 138516-139715 argG
335 QSTK01000001.1 GCA003438185_00142 gene open 141152-141283
336 QSTK01000001.1 GCA003438185_00143 gene open 141680-143134 gltX
337 QSTK01000001.1 GCA003438185_00144 gene open 143316-145286 amiA
338 QSTK01000001.1 GCA003438185_00145 gene open 145466-146155 rplA
339 QSTK01000001.1 GCA003438185_00146 gene open 146255-146680
340 QSTK01000001.1 GCA003438185_00147 gene open 146852-147205
341 QSTK01000001.1 GCA003438185_00148 gene open 147299-147796
342 QSTK01000001.1 GCA003438185_00149 gene open 147947-148642
343 QSTK01000001.1 GCA003438185_00150 gene open 148729-149976 radA
344 QSTK01000001.1 GCA003438185_00151 gene open 150269-150715 dut
345 QSTK01000001.1 GCA003438185_00152 gene open 150930-151532
346 QSTK01000001.1 GCA003438185_00153 gene open 151551-152801
347 QSTK01000001.1 GCA003438185_00154 gene open 152917-153708 nirC
348 QSTK01000001.1 GCA003438185_00155 gene open 153717-154277
349 QSTK01000001.1 GCA003438185_00156 gene open 154396-155418 gpsA
350 QSTK01000001.1 GCA003438185_00157 gene open 155436-156350 galU
351 QSTK01000001.1 GCA003438185_00158 gene open 156396-157070 glpG
352 QSTK01000001.1 GCA003438185_00159 gene open 157061-157588 fAU1
353 QSTK01000001.1 GCA003438185_00160 gene open 157657-158790 abgB
354 QSTK01000001.1 GCA003438185_00161 gene open 158868-159566 dapD
355 QSTK01000001.1 GCA003438185_00162 gene open 159652-160419
356 QSTK01000001.1 GCA003438185_00163 gene open 160519-161352
357 QSTK01000001.1 GCA003438185_00165 gene open 161773-161931 blpM
358 QSTK01000001.1 GCA003438185_00166 gene open 161951-162118
359 QSTK01000001.1 GCA003438185_00167 gene open 162166-162417
360 QSTK01000001.1 GCA003438185_00168 gene open 162504-163022 tadA
361 QSTK01000001.1 GCA003438185_00169 gene open 163749-164141 ssb
362 QSTK01000001.1 GCA003438185_00170 gene open 164346-164573 tusA
363 QSTK01000001.1 GCA003438185_00171 gene open 164588-165619
364 QSTK01000001.1 GCA003438185_00172 gene open 165757-166380 ytpR
365 QSTK01000001.1 GCA003438185_00173 gene open 166390-166704 trxA
366 QSTK01000001.1 GCA003438185_00174 gene open 166701-166985
367 QSTK01000001.1 GCA003438185_00175 gene open 167085-168152 pepA
368 QSTK01000001.1 GCA003438185_00176 gene open 168168-168938 proC
369 QSTK01000001.1 GCA003438185_00177 gene open 168964-169626 ydiL
370 QSTK01000001.1 GCA003438185_00178 gene open 169726-170169
371 QSTK01000001.1 GCA003438185_00179 gene open 170183-170380 xRE
372 QSTK01000001.1 GCA003438185_00180 gene open 170631-171824 ackA
373 QSTK01000001.1 GCA003438185_00181 gene open 171881-172837 ytxK
374 QSTK01000001.1 GCA003438185_00182 gene open 172882-173199 comGG
375 QSTK01000001.1 GCA003438185_00183 gene open 173177-173614 comGF
376 QSTK01000001.1 GCA003438185_00184 gene open 173601-173831 comGE
377 QSTK01000001.1 GCA003438185_00185 gene open 173863-174300 comGD
378 QSTK01000001.1 GCA003438185_00186 gene open 174251-174577 comGC
379 QSTK01000001.1 GCA003438185_00187 gene open 174574-175398 comGB
380 QSTK01000001.1 GCA003438185_00188 gene open 175556-176497 comGA
381 QSTK01000001.1 GCA003438185_00189 gene open 176578-176940
382 QSTK01000001.1 GCA003438185_00190 gene open 177103-180741 rpoC
383 QSTK01000001.1 GCA003438185_00191 gene open 180842-184423 rpoB
384 QSTK01000001.1 GCA003438185_00192 gene open 184783-187206 pbp1b
385 QSTK01000001.1 GCA003438185_00193 gene open 187308-188564 tyrS
386 QSTK01000001.1 GCA003438185_00194 gene open 188688-189710 ilvC
387 QSTK01000001.1 GCA003438185_00195 gene open 189786-190262 ilvN
388 QSTK01000001.1 GCA003438185_00196 gene open 190255-191955 ilvB
389 QSTK01000001.1 GCA003438185_00197 gene open 192089-193798 ilvD
390 QSTK01000001.1 GCA003438185_00116 gene open 117700-117782 trnL
391 QSTK01000001.1 GCA003438185_00127 gene open 124524-124597 trnN
392 QSTK01000001.1 GCA003438185_00130 gene open 127848-127920 trnA
393 QSTK01000001.1 GCA003438185_00116 tRNA open 117700-117782 trnL tRNA-Leu(cag)
394 QSTK01000001.1 GCA003438185_00127 tRNA open 124524-124597 trnN tRNA-Asn(gtt)
395 QSTK01000001.1 GCA003438185_00130 tRNA open 127848-127920 trnA tRNA-Ala(tgc)
396 QSTK01000002.1 GCA003438185_00731 gene open 69497-69606 Srn266
397 QSTK01000002.1 GCA003438185_00734 gene open 80429-80538 Srn266
398 QSTK01000002.1 GCA003438185_00731 ncRNA open 69497-69606 Streptococcus RNA 266
399 QSTK01000002.1 GCA003438185_00734 ncRNA open 80429-80538 Streptococcus RNA 266
400 QSTK01000002.1 repeat_region open 321-498 CRISPR array with 3 repeats of length 40%2C consensus sequence ACAGGTTTTTGTACTCTCAAGATTTAAGTAACTGTACAAC and spacer length 26
401 QSTK01000002.1 GCA003438185_00661 CDS open 532-1347 _na     271_aa ycgQ TIGR03943 family putative permease subunit
402 QSTK01000002.1 GCA003438185_00662 CDS open 1347-2249 _na     300_aa yraQ Permease
403 QSTK01000002.1 GCA003438185_00663 CDS open 2255-2386 _na     43_aa SPJ_0845 family protein
404 QSTK01000002.1 GCA003438185_00664 CDS open 2667-4799 _na     710_aa tex S1 motif domain-containing protein
405 QSTK01000002.1 GCA003438185_00665 CDS open 5292-5555 _na     87_aa pspC Phage shock protein PspC N-terminal domain-containing protein
406 QSTK01000002.1 GCA003438185_00666 CDS open 5682-6611 _na     309_aa hprK HPr(Ser) kinase/phosphatase
407 QSTK01000002.1 GCA003438185_00667 CDS open 6611-7402 _na     263_aa lgt prolipoprotein diacylglyceryl transferase
408 QSTK01000002.1 GCA003438185_00668 CDS open 7527-7925 _na     132_aa DUF948 domain-containing protein
409 QSTK01000002.1 GCA003438185_00669 CDS open 7938-8378 _na     146_aa ytxH YtxH domain-containing protein
410 QSTK01000002.1 GCA003438185_00670 CDS open 8436-8732 _na     98_aa DUF3270 domain-containing protein
411 QSTK01000002.1 GCA003438185_00671 CDS open 8971-9900 _na     309_aa rlhA Protease
412 QSTK01000002.1 GCA003438185_00672 CDS open 9998-11284 _na     428_aa rlhA Peptidase family U32 C-terminal domain-containing protein
413 QSTK01000002.1 GCA003438185_00673 CDS open 11647-12186 _na     179_aa bioY Biotin transporter
414 QSTK01000002.1 GCA003438185_00674 CDS open 12283-12567 _na     94_aa YolD-like protein
415 QSTK01000002.1 GCA003438185_00675 CDS open 12692-12904 _na     70_aa Transcriptional coactivator p15 (PC4) C-terminal domain-containing protein
416 QSTK01000002.1 GCA003438185_00676 CDS open 12938-14272 _na     444_aa mntH Nramp family divalent metal transporter
417 QSTK01000002.1 GCA003438185_00677 CDS open 14467-14775 _na     102_aa ABC transporter permease
418 QSTK01000002.1 GCA003438185_00678 CDS open 14811-15176 _na     121_aa hypothetical protein
419 QSTK01000002.1 GCA003438185_00679 CDS open 15412-16902 _na     496_aa lysS lysine--tRNA ligase
420 QSTK01000002.1 GCA003438185_00680 CDS open 17130-18431 _na     433_aa lysM LysM peptidoglycan-binding domain-containing protein
421 QSTK01000002.1 GCA003438185_00681 CDS open 18445-18924 _na     159_aa Valyl-tRNA synthetase
422 QSTK01000002.1 GCA003438185_00682 CDS open 19247-20149 _na     300_aa yigB Hydrolase
423 QSTK01000002.1 GCA003438185_00683 CDS open 20208-20357 _na     49_aa hypothetical protein
424 QSTK01000002.1 GCA003438185_00684 CDS open 20714-21364 _na     216_aa Histidine phosphatase family protein
425 QSTK01000002.1 GCA003438185_00685 CDS open 21367-21840 _na     157_aa ebsC Cys-tRNA(Pro)/Cys-tRNA(Cys) deacylase
426 QSTK01000002.1 GCA003438185_00686 CDS open 21955-22902 _na     315_aa acm N-acetylmuramoyl-L-alanine amidase
427 QSTK01000002.1 GCA003438185_00687 CDS open 23094-23483 _na     129_aa Sodium transporter
428 QSTK01000002.1 GCA003438185_00688 CDS open 23716-23880 _na     54_aa hypothetical protein
429 QSTK01000002.1 GCA003438185_00689 CDS open 24126-24329 _na     67_aa Haloacid dehalogenase-like hydrolase domain protein
430 QSTK01000002.1 GCA003438185_00690 CDS open 24365-24991 _na     208_aa Pr6Pr family membrane protein
431 QSTK01000002.1 GCA003438185_00691 CDS open 25103-26260 _na     385_aa DUF2974 domain-containing protein
432 QSTK01000002.1 GCA003438185_00692 CDS open 26292-27056 _na     254_aa ydfG NADP-dependent 3-hydroxy acid dehydrogenase YdfG
433 QSTK01000002.1 GCA003438185_00693 CDS open 27178-28869 _na     563_aa type I site-specific deoxyribonuclease
434 QSTK01000002.1 GCA003438185_00694 CDS open 28853-30247 _na     464_aa Type I restriction-modification system%2C restriction subunit R
435 QSTK01000002.1 GCA003438185_00695 CDS open 30247-31851 _na     534_aa site-specific DNA-methyltransferase (adenine-specific)
436 QSTK01000002.1 GCA003438185_00696 CDS open 31844-33094 _na     416_aa restriction endonuclease subunit S
437 QSTK01000002.1 GCA003438185_00697 CDS open 33130-34878 _na     582_aa ATP-dependent endonuclease
438 QSTK01000002.1 GCA003438185_00698 CDS open 34878-36476 _na     532_aa UvrD-helicase domain-containing protein
439 QSTK01000002.1 GCA003438185_00699 CDS open 36712-37407 _na     231_aa DNA-entry nuclease
440 QSTK01000002.1 GCA003438185_00700 CDS open 37519-37857 _na     112_aa Plasmid maintenance system killer protein
441 QSTK01000002.1 GCA003438185_00701 CDS open 37850-38935 _na     361_aa higA HigA family addiction module antitoxin
442 QSTK01000002.1 GCA003438185_00702 CDS open 39023-39934 _na     303_aa Transposase
443 QSTK01000002.1 GCA003438185_00703 CDS open 40537-40854 _na     105_aa hypothetical protein
444 QSTK01000002.1 GCA003438185_00704 CDS open 40999-42000 _na     333_aa Extracellular nuclease 2 Mitogenic factor 2
445 QSTK01000002.1 GCA003438185_00705 CDS open 42150-42710 _na     186_aa lemA LemA family protein
446 QSTK01000002.1 GCA003438185_00706 CDS open 42712-43611 _na     299_aa htpX zinc metalloprotease HtpX
447 QSTK01000002.1 GCA003438185_00707 CDS open 43729-44202 _na     157_aa mreD Rod shape-determining protein MreD
448 QSTK01000002.1 GCA003438185_00708 CDS open 44199-44594 _na     131_aa Transcobalamin-like C-terminal domain-containing protein
449 QSTK01000002.1 GCA003438185_00709 CDS open 44769-47591 _na     940_aa ppc phosphoenolpyruvate carboxylase
450 QSTK01000002.1 GCA003438185_00710 CDS open 47659-48693 _na     344_aa holA DNA polymerase III subunit delta
451 QSTK01000002.1 GCA003438185_00711 CDS open 48788-49393 _na     201_aa sodA Superoxide dismutase [Mn/Fe]
452 QSTK01000002.1 GCA003438185_00712 CDS open 49489-50868 _na     459_aa penP Beta-lactamase class A catalytic domain-containing protein
453 QSTK01000002.1 GCA003438185_00713 CDS open 50909-51547 _na     212_aa gspO Prepilin peptidase type IV
454 QSTK01000002.1 GCA003438185_00714 CDS open 51663-52184 _na     173_aa dps Non-specific DNA-binding protein Dps / Iron-binding ferritin-like antioxidant protein / Ferroxidase
455 QSTK01000002.1 GCA003438185_00715 CDS open 52273-52710 _na     145_aa fur Ferric transport regulator protein
456 QSTK01000002.1 GCA003438185_00716 CDS open 52821-53027 _na     68_aa DUF910 domain-containing protein
457 QSTK01000002.1 GCA003438185_00717 CDS open 53020-53988 _na     322_aa nagC Glucokinase
458 QSTK01000002.1 GCA003438185_00718 CDS open 54127-55977 _na     616_aa typA translational GTPase TypA
459 QSTK01000002.1 GCA003438185_00719 CDS open 55997-56269 _na     90_aa DUF3165 domain-containing protein
460 QSTK01000002.1 GCA003438185_00720 CDS open 56393-57745 _na     450_aa murD UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase
461 QSTK01000002.1 GCA003438185_00721 CDS open 57749-58819 _na     356_aa murG UDP-N-acetylglucosamine--N-acetylmuramyl-(pentapeptide) pyrophosphoryl-undecaprenol N-acetylglucosamine transferase
462 QSTK01000002.1 GCA003438185_00722 CDS open 58829-59953 _na     374_aa ftsQ Cell division protein DivIB
463 QSTK01000002.1 GCA003438185_00723 CDS open 60079-61455 _na     458_aa ftsA cell division protein FtsA
464 QSTK01000002.1 GCA003438185_00724 CDS open 61484-62806 _na     440_aa ftsZ cell division protein FtsZ
465 QSTK01000002.1 GCA003438185_00725 CDS open 62809-63492 _na     227_aa yggS Pyridoxal phosphate homeostasis protein
466 QSTK01000002.1 GCA003438185_00726 CDS open 63497-64072 _na     191_aa sepF Cell division protein SepF
467 QSTK01000002.1 GCA003438185_00727 CDS open 64076-64333 _na     85_aa yggT YggT family protein
468 QSTK01000002.1 GCA003438185_00728 CDS open 64333-65127 _na     264_aa ylmH RNA-binding S4 domain-containing protein
469 QSTK01000002.1 GCA003438185_00729 CDS open 65378-66253 _na     291_aa Cell division initiation protein DivIVA
470 QSTK01000002.1 GCA003438185_00730 CDS open 66501-69299 _na     932_aa ileS isoleucine--tRNA ligase
471 QSTK01000002.1 GCA003438185_00732 CDS open 70069-80076 _na     3335_aa YSIRK-type signal peptide-containing protein
472 QSTK01000002.1 GCA003438185_00733 CDS open 80120-80257 _na     45_aa hypothetical protein
473 QSTK01000002.1 GCA003438185_00735 CDS open 80648-81910 _na     420_aa Divalent metal cation transporter
474 QSTK01000002.1 GCA003438185_00736 CDS open 82032-82274 _na     80_aa rpmE2 type B 50S ribosomal protein L31
475 QSTK01000002.1 GCA003438185_00737 CDS open 82381-83313 _na     310_aa FAD:protein FMN transferase
476 QSTK01000002.1 GCA003438185_00738 CDS open 83300-84244 _na     314_aa nrnA NanoRNase (Oligoribonuclease) (3'->5'short substrates%2C 5'->3' long substrates)%2C 3'%2C5'-bisphosphate nucleotidase
477 QSTK01000002.1 GCA003438185_00739 CDS open 84324-85112 _na     262_aa yghU glutathione-dependent disulfide-bond oxidoreductase
478 QSTK01000002.1 GCA003438185_00740 CDS open 85285-86295 _na     336_aa add adenosine deaminase
479 QSTK01000002.1 GCA003438185_00741 CDS open 86480-87076 _na     198_aa thymidine kinase
480 QSTK01000002.1 GCA003438185_00742 CDS open 87114-88193 _na     359_aa prfA peptide chain release factor 1
481 QSTK01000002.1 GCA003438185_00743 CDS open 88190-89023 _na     277_aa prmC peptide chain release factor N(5)-glutamine methyltransferase
482 QSTK01000002.1 GCA003438185_00744 CDS open 89013-89615 _na     200_aa tsaC L-threonylcarbamoyladenylate synthase
483 QSTK01000002.1 GCA003438185_00745 CDS open 89710-90960 _na     416_aa glyA Serine hydroxymethyltransferase
484 QSTK01000002.1 GCA003438185_00746 CDS open 90967-91944 _na     325_aa Nucleoid-associated protein
485 QSTK01000002.1 GCA003438185_00747 CDS open 91946-92557 _na     203_aa CwlT-like lysozyme domain-containing protein
486 QSTK01000002.1 GCA003438185_00748 CDS open 92589-94328 _na     579_aa msbA Lipid A export ATP-binding/permease protein MsbA
487 QSTK01000002.1 GCA003438185_00749 CDS open 94318-96066 _na     582_aa mdlB Multidrug/protein/lipid ABC transporter family%2C ATP-binding and permease protein
488 QSTK01000002.1 GCA003438185_00750 CDS open 96381-97931 _na     516_aa dltA D-alanine--poly(phosphoribitol) ligase subunit DltA
489 QSTK01000002.1 GCA003438185_00751 CDS open 97928-99175 _na     415_aa dltB D-alanyl-lipoteichoic acid biosynthesis protein DltB
490 QSTK01000002.1 GCA003438185_00752 CDS open 99193-99432 _na     79_aa dltC D-alanine--poly(phosphoribitol) ligase subunit DltC
491 QSTK01000002.1 GCA003438185_00753 CDS open 99425-100693 _na     422_aa dltD D-alanyl-lipoteichoic acid biosynthesis protein DltD
492 QSTK01000002.1 GCA003438185_00754 CDS open 100861-103497 _na     878_aa mgtA calcium-translocating P-type ATPase%2C PMCA-type
493 QSTK01000002.1 GCA003438185_00755 CDS open 103672-105390 _na     572_aa pabB aminodeoxychorismate synthase component I
494 QSTK01000002.1 GCA003438185_00756 CDS open 105537-105890 _na     117_aa Phage protein
495 QSTK01000002.1 GCA003438185_00757 CDS open 106210-108459 _na     749_aa metE 5-methyltetrahydropteroyltriglutamate--homocysteine S-methyltransferase
496 QSTK01000002.1 GCA003438185_00758 CDS open 108643-109518 _na     291_aa metF methylenetetrahydrofolate reductase [NAD(P)H]
497 QSTK01000002.1 GCA003438185_00759 CDS open 109658-111376 _na     572_aa manB Phosphoglucomutase
498 QSTK01000002.1 GCA003438185_00760 CDS open 111457-112029 _na     190_aa Thiamine transporter protein (Thia_YuaJ)
499 QSTK01000002.1 GCA003438185_00761 CDS open 112022-112585 _na     187_aa coaC phosphopantothenoylcysteine decarboxylase
500 QSTK01000002.1 GCA003438185_00762 CDS open 112578-113261 _na     227_aa coaBC phosphopantothenate--cysteine ligase