HOMD Banner
Taxonomy: V4.3   |  16S rRNA RefSeq: V16.03   |  Genomic RefSeq: V11.03   |  Viruses: V1.2

BAKTAGenome Explorer: Streptococcus vestibularis (GCA_003438185.1)

Select a Genome:
BAKTA Annotations for GCA_003438185.1
Genome Selected: Streptococcus vestibularis
ContigsBases CDSrRNA tmRNAtRNA
52 1898011 1794 3 1 37
[Table]   [AA Fasta]      [Browser]   [Text]   [Excel]  
Search & Sort all 3742 Records
Search These Records: Clear
Sort Column:   Molecule   PID   NA   AA   Gene  Gene Product  Reverse
Annotation Table [page:4]    |    Number of Records Found: 3742 [8 Pages]    |    Previous Page <==> Next Page    |    Jump to Page: [ 1  2  3  4  5  6  7  8  ]
Notes:   1- Column headers only sort the current page. 2- Select [NA] or [AA] links to show sequences.
Region Protein-ID Type Genome
Viewer		 Range
(bp)		 Show Sequences
(length) NA / AA		 BAKTA
Gene		 BAKTA
GeneProduct
1501 QSTK01000007.1 GCA003438185_01643 CDS open 42186-42452 _na     88_aa ireB IreB family regulatory phosphoprotein
1502 QSTK01000007.1 GCA003438185_01644 CDS open 42579-42767 _na     62_aa rpmB 50S ribosomal protein L28
1503 QSTK01000007.1 GCA003438185_01645 CDS open 42937-44205 _na     422_aa rarA Chromosome segregation helicase
1504 QSTK01000007.1 GCA003438185_01648 CDS open 44646-45785 _na     379_aa xerD Tyr recombinase domain-containing protein
1505 QSTK01000007.1 GCA003438185_01649 CDS open 45787-45975 _na     62_aa DUF3173 domain-containing protein
1506 QSTK01000007.1 GCA003438185_01650 CDS open 45987-46964 _na     325_aa Replication initiation factor
1507 QSTK01000007.1 GCA003438185_01651 CDS open 47401-47913 _na     170_aa hipB HTH cro/C1-type domain-containing protein
1508 QSTK01000007.1 GCA003438185_01652 CDS open 48133-48648 _na     171_aa Acid-resistance membrane protein
1509 QSTK01000007.1 GCA003438185_01653 CDS open 49335-49940 _na     201_aa DUF1269 domain-containing protein
1510 QSTK01000007.1 GCA003438185_01654 CDS open 50029-50385 _na     118_aa XRE family transcriptional regulator
1511 QSTK01000007.1 GCA003438185_01655 CDS open 50600-51745 _na     381_aa ltrA Low temperature requirement protein LtrA
1512 QSTK01000007.1 GCA003438185_01656 CDS open 52244-52753 _na     169_aa DNA topology modulation protein
1513 QSTK01000007.1 GCA003438185_01657 CDS open 53017-54309 _na     430_aa purA adenylosuccinate synthase
1514 QSTK01000007.1 GCA003438185_01658 CDS open 54591-55025 _na     144_aa protein-tyrosine-phosphatase
1515 QSTK01000007.1 GCA003438185_01659 CDS open 55022-55426 _na     134_aa MORN repeat protein
1516 QSTK01000007.1 GCA003438185_01660 CDS open 55423-57246 _na     607_aa oafA Acyltransferase
1517 QSTK01000007.1 GCA003438185_01661 CDS open 57337-58338 _na     333_aa ruvB Holliday junction branch migration DNA helicase RuvB
1518 QSTK01000007.1 GCA003438185_01662 CDS open 58583-58891 _na     102_aa rpsJ 30S ribosomal protein S10
1519 QSTK01000007.1 GCA003438185_01663 CDS open 59005-59631 _na     208_aa rplC 50S ribosomal protein L3
1520 QSTK01000007.1 GCA003438185_01664 CDS open 59656-60279 _na     207_aa rplD 50S ribosomal protein L4
1521 QSTK01000007.1 GCA003438185_01665 CDS open 60279-60575 _na     98_aa rplW 50S ribosomal protein L23
1522 QSTK01000007.1 GCA003438185_01666 CDS open 60593-61426 _na     277_aa rplB 50S ribosomal protein L2
1523 QSTK01000007.1 GCA003438185_01667 CDS open 61520-61798 _na     92_aa rpsS 30S ribosomal protein S19
1524 QSTK01000007.1 GCA003438185_01668 CDS open 61814-62158 _na     114_aa rplV 50S ribosomal protein L22
1525 QSTK01000007.1 GCA003438185_01669 CDS open 62171-62824 _na     217_aa rpsC 30S ribosomal protein S3
1526 QSTK01000007.1 GCA003438185_01670 CDS open 62828-63241 _na     137_aa rplP 50S ribosomal protein L16
1527 QSTK01000007.1 GCA003438185_01671 CDS open 63251-63457 _na     68_aa rpmC 50S ribosomal protein L29
1528 QSTK01000007.1 GCA003438185_01672 CDS open 63485-63745 _na     86_aa rpsQ 30S ribosomal protein S17
1529 QSTK01000007.1 GCA003438185_01673 CDS open 63770-64138 _na     122_aa rplN 50S ribosomal protein L14
1530 QSTK01000007.1 GCA003438185_01674 CDS open 64219-64524 _na     101_aa rplX 50S ribosomal protein L24
1531 QSTK01000007.1 GCA003438185_01675 CDS open 64551-65093 _na     180_aa rplE 50S ribosomal protein L5
1532 QSTK01000007.1 GCA003438185_01676 CDS open 65111-65296 _na     61_aa rpsZ type Z 30S ribosomal protein S14
1533 QSTK01000007.1 GCA003438185_01677 CDS open 65419-65817 _na     132_aa rpsH 30S ribosomal protein S8
1534 QSTK01000007.1 GCA003438185_01678 CDS open 65944-66480 _na     178_aa rplF 50S ribosomal protein L6
1535 QSTK01000007.1 GCA003438185_01679 CDS open 66570-66926 _na     118_aa rplR 50S ribosomal protein L18
1536 QSTK01000007.1 GCA003438185_01680 CDS open 66945-67439 _na     164_aa rpsE 30S ribosomal protein S5
1537 QSTK01000007.1 GCA003438185_01681 CDS open 67454-67636 _na     60_aa rpmD 50S ribosomal protein L30
1538 QSTK01000007.1 GCA003438185_01682 CDS open 67764-68204 _na     146_aa rplO 50S ribosomal protein L15
1539 QSTK01000007.1 GCA003438185_01683 CDS open 68221-69516 _na     431_aa secY preprotein translocase subunit SecY
1540 QSTK01000007.1 GCA003438185_01684 CDS open 69648-70286 _na     212_aa adenylate kinase
1541 QSTK01000007.1 GCA003438185_01685 CDS open 70404-70622 _na     72_aa infA translation initiation factor IF-1
1542 QSTK01000007.1 GCA003438185_01686 CDS open 70648-70764 _na     38_aa rpmJ 50S ribosomal protein L36
1543 QSTK01000007.1 GCA003438185_01687 CDS open 70782-71147 _na     121_aa rpsM 30S ribosomal protein S13
1544 QSTK01000007.1 GCA003438185_01688 CDS open 71174-71557 _na     127_aa rpsK 30S ribosomal protein S11
1545 QSTK01000007.1 GCA003438185_01689 CDS open 71606-72544 _na     312_aa rpoA DNA-directed RNA polymerase subunit alpha
1546 QSTK01000007.1 GCA003438185_01690 CDS open 72562-72948 _na     128_aa rplQ 50S ribosomal protein L17
1547 QSTK01000007.1 GCA003438185_01691 CDS open 73201-74496 _na     431_aa Gamma-glutamylcysteine synthetase
1548 QSTK01000007.1 GCA003438185_01693 CDS open 74911-75792 _na     293_aa fba class II fructose-bisphosphate aldolase
1549 QSTK01000007.1 GCA003438185_01694 CDS open 75957-76313 _na     118_aa hypothetical protein
1550 QSTK01000007.1 GCA003438185_01695 CDS open 76358-76684 _na     108_aa DUF3397 domain-containing protein
1551 QSTK01000007.1 GCA003438185_01696 CDS open 76700-77260 _na     186_aa ywlG UPF0340 protein stu1894
1552 QSTK01000007.1 GCA003438185_01697 CDS open 77314-78024 _na     236_aa treR trehalose operon repressor
1553 QSTK01000007.1 GCA003438185_01698 CDS open 78181-80118 _na     645_aa treB PTS trehalose transporter subunit IIBC
1554 QSTK01000007.1 GCA003438185_01699 CDS open 80182-81807 _na     541_aa treC alpha%2Calpha-phosphotrehalase
1555 QSTK01000007.1 GCA003438185_01700 CDS open 81889-83784 _na     631_aa pepO Neprilysin
1556 QSTK01000007.1 GCA003438185_01701 CDS open 83926-86514 _na     862_aa adhE bifunctional acetaldehyde-CoA/alcohol dehydrogenase
1557 QSTK01000007.1 GCA003438185_01702 CDS open 86952-88436 _na     494_aa thrC threonine synthase
1558 QSTK01000007.1 GCA003438185_01703 CDS open 88495-89781 _na     428_aa norM putative multidrug resistance protein NorM
1559 QSTK01000007.1 GCA003438185_01704 CDS open 89893-90258 _na     121_aa yloU putative protein Spy1614
1560 QSTK01000007.1 GCA003438185_01705 CDS open 90258-91925 _na     555_aa fakA DhaL domain-containing protein
1561 QSTK01000007.1 GCA003438185_01596 gene open 100-2064 gdpP
1562 QSTK01000007.1 GCA003438185_01597 gene open 2066-2524 rplI
1563 QSTK01000007.1 GCA003438185_01598 gene open 2568-3929 dnaB
1564 QSTK01000007.1 GCA003438185_01599 gene open 3955-4257
1565 QSTK01000007.1 GCA003438185_01600 gene open 4455-5066 rpsD
1566 QSTK01000007.1 GCA003438185_01601 gene open 5253-5441
1567 QSTK01000007.1 GCA003438185_01602 gene open 5557-5919
1568 QSTK01000007.1 GCA003438185_01603 gene open 5994-6533 acrR
1569 QSTK01000007.1 GCA003438185_01604 gene open 6661-9030 yhgE
1570 QSTK01000007.1 GCA003438185_01605 gene open 9068-9913
1571 QSTK01000007.1 GCA003438185_01606 gene open 9983-10405
1572 QSTK01000007.1 GCA003438185_01607 gene open 10479-10805 padR
1573 QSTK01000007.1 GCA003438185_01608 gene open 10968-11576
1574 QSTK01000007.1 GCA003438185_01609 gene open 12057-12335
1575 QSTK01000007.1 GCA003438185_01610 gene open 12424-12918
1576 QSTK01000007.1 GCA003438185_01611 gene open 13644-14951
1577 QSTK01000007.1 GCA003438185_01612 gene open 14955-15695 lolD
1578 QSTK01000007.1 GCA003438185_01613 gene open 16004-17269
1579 QSTK01000007.1 GCA003438185_01614 gene open 17370-17630 alpA
1580 QSTK01000007.1 GCA003438185_01615 gene open 17707-18981
1581 QSTK01000007.1 GCA003438185_01616 gene open 19141-19884
1582 QSTK01000007.1 GCA003438185_01617 gene open 19884-20414
1583 QSTK01000007.1 GCA003438185_01618 gene open 20421-20855
1584 QSTK01000007.1 GCA003438185_01619 gene open 20942-21214
1585 QSTK01000007.1 GCA003438185_01620 gene open 21361-21774
1586 QSTK01000007.1 GCA003438185_01621 gene open 21970-22935
1587 QSTK01000007.1 GCA003438185_01622 gene open 23014-23349
1588 QSTK01000007.1 GCA003438185_01623 gene open 23510-26536
1589 QSTK01000007.1 GCA003438185_01624 gene open 26547-26789
1590 QSTK01000007.1 GCA003438185_01626 gene open 27036-27872
1591 QSTK01000007.1 GCA003438185_01627 gene open 27916-28269
1592 QSTK01000007.1 GCA003438185_01628 gene open 28568-28717 rpmG
1593 QSTK01000007.1 GCA003438185_01629 gene open 28733-28915 rpmF
1594 QSTK01000007.1 GCA003438185_01630 gene open 29145-30257
1595 QSTK01000007.1 GCA003438185_01631 gene open 30507-31787 hisS
1596 QSTK01000007.1 GCA003438185_01632 gene open 31795-32217
1597 QSTK01000007.1 GCA003438185_01633 gene open 32339-34078 aspS
1598 QSTK01000007.1 GCA003438185_01634 gene open 34071-35012 yitT
1599 QSTK01000007.1 GCA003438185_01635 gene open 35099-35839 yaaA
1600 QSTK01000007.1 GCA003438185_01636 gene open 35859-36464 nrdG
1601 QSTK01000007.1 GCA003438185_01637 gene open 36469-36969
1602 QSTK01000007.1 GCA003438185_01638 gene open 36971-37102
1603 QSTK01000007.1 GCA003438185_01639 gene open 37192-39396 nrdD
1604 QSTK01000007.1 GCA003438185_01640 gene open 39495-41141
1605 QSTK01000007.1 GCA003438185_01641 gene open 41354-41659 yrzB
1606 QSTK01000007.1 GCA003438185_01642 gene open 41767-42186 ruvX
1607 QSTK01000007.1 GCA003438185_01643 gene open 42186-42452 ireB
1608 QSTK01000007.1 GCA003438185_01644 gene open 42579-42767 rpmB
1609 QSTK01000007.1 GCA003438185_01645 gene open 42937-44205 rarA
1610 QSTK01000007.1 GCA003438185_01648 gene open 44646-45785 xerD
1611 QSTK01000007.1 GCA003438185_01649 gene open 45787-45975
1612 QSTK01000007.1 GCA003438185_01650 gene open 45987-46964
1613 QSTK01000007.1 GCA003438185_01651 gene open 47401-47913 hipB
1614 QSTK01000007.1 GCA003438185_01652 gene open 48133-48648
1615 QSTK01000007.1 GCA003438185_01653 gene open 49335-49940
1616 QSTK01000007.1 GCA003438185_01654 gene open 50029-50385
1617 QSTK01000007.1 GCA003438185_01655 gene open 50600-51745 ltrA
1618 QSTK01000007.1 GCA003438185_01656 gene open 52244-52753
1619 QSTK01000007.1 GCA003438185_01657 gene open 53017-54309 purA
1620 QSTK01000007.1 GCA003438185_01658 gene open 54591-55025
1621 QSTK01000007.1 GCA003438185_01659 gene open 55022-55426
1622 QSTK01000007.1 GCA003438185_01660 gene open 55423-57246 oafA
1623 QSTK01000007.1 GCA003438185_01661 gene open 57337-58338 ruvB
1624 QSTK01000007.1 GCA003438185_01662 gene open 58583-58891 rpsJ
1625 QSTK01000007.1 GCA003438185_01663 gene open 59005-59631 rplC
1626 QSTK01000007.1 GCA003438185_01664 gene open 59656-60279 rplD
1627 QSTK01000007.1 GCA003438185_01665 gene open 60279-60575 rplW
1628 QSTK01000007.1 GCA003438185_01666 gene open 60593-61426 rplB
1629 QSTK01000007.1 GCA003438185_01667 gene open 61520-61798 rpsS
1630 QSTK01000007.1 GCA003438185_01668 gene open 61814-62158 rplV
1631 QSTK01000007.1 GCA003438185_01669 gene open 62171-62824 rpsC
1632 QSTK01000007.1 GCA003438185_01670 gene open 62828-63241 rplP
1633 QSTK01000007.1 GCA003438185_01671 gene open 63251-63457 rpmC
1634 QSTK01000007.1 GCA003438185_01672 gene open 63485-63745 rpsQ
1635 QSTK01000007.1 GCA003438185_01673 gene open 63770-64138 rplN
1636 QSTK01000007.1 GCA003438185_01674 gene open 64219-64524 rplX
1637 QSTK01000007.1 GCA003438185_01675 gene open 64551-65093 rplE
1638 QSTK01000007.1 GCA003438185_01676 gene open 65111-65296 rpsZ
1639 QSTK01000007.1 GCA003438185_01677 gene open 65419-65817 rpsH
1640 QSTK01000007.1 GCA003438185_01678 gene open 65944-66480 rplF
1641 QSTK01000007.1 GCA003438185_01679 gene open 66570-66926 rplR
1642 QSTK01000007.1 GCA003438185_01680 gene open 66945-67439 rpsE
1643 QSTK01000007.1 GCA003438185_01681 gene open 67454-67636 rpmD
1644 QSTK01000007.1 GCA003438185_01682 gene open 67764-68204 rplO
1645 QSTK01000007.1 GCA003438185_01683 gene open 68221-69516 secY
1646 QSTK01000007.1 GCA003438185_01684 gene open 69648-70286
1647 QSTK01000007.1 GCA003438185_01685 gene open 70404-70622 infA
1648 QSTK01000007.1 GCA003438185_01686 gene open 70648-70764 rpmJ
1649 QSTK01000007.1 GCA003438185_01687 gene open 70782-71147 rpsM
1650 QSTK01000007.1 GCA003438185_01688 gene open 71174-71557 rpsK
1651 QSTK01000007.1 GCA003438185_01689 gene open 71606-72544 rpoA
1652 QSTK01000007.1 GCA003438185_01690 gene open 72562-72948 rplQ
1653 QSTK01000007.1 GCA003438185_01691 gene open 73201-74496
1654 QSTK01000007.1 GCA003438185_01693 gene open 74911-75792 fba
1655 QSTK01000007.1 GCA003438185_01694 gene open 75957-76313
1656 QSTK01000007.1 GCA003438185_01695 gene open 76358-76684
1657 QSTK01000007.1 GCA003438185_01696 gene open 76700-77260 ywlG
1658 QSTK01000007.1 GCA003438185_01697 gene open 77314-78024 treR
1659 QSTK01000007.1 GCA003438185_01698 gene open 78181-80118 treB
1660 QSTK01000007.1 GCA003438185_01699 gene open 80182-81807 treC
1661 QSTK01000007.1 GCA003438185_01700 gene open 81889-83784 pepO
1662 QSTK01000007.1 GCA003438185_01701 gene open 83926-86514 adhE
1663 QSTK01000007.1 GCA003438185_01702 gene open 86952-88436 thrC
1664 QSTK01000007.1 GCA003438185_01703 gene open 88495-89781 norM
1665 QSTK01000007.1 GCA003438185_01704 gene open 89893-90258 yloU
1666 QSTK01000007.1 GCA003438185_01705 gene open 90258-91925 fakA
1667 QSTK01000007.1 GCA003438185_01647 gene open 44487-44559 trnK
1668 QSTK01000007.1 GCA003438185_01692 gene open 74680-74765 trnL
1669 QSTK01000007.1 GCA003438185_01647 tRNA open 44487-44559 trnK tRNA-Lys(ctt)
1670 QSTK01000007.1 GCA003438185_01692 tRNA open 74680-74765 trnL tRNA-Leu(aag)
1671 QSTK01000008.1 GCA003438185_01706 gene open 531-642 Srn266
1672 QSTK01000008.1 GCA003438185_01706 ncRNA open 531-642 Streptococcus RNA 266
1673 QSTK01000008.1 regulatory_region open 81090-81188 azaaromatic riboswitch aptamer (yjdF RNA)
1674 QSTK01000008.1 regulatory_region open 84826-84924 azaaromatic riboswitch aptamer (yjdF RNA)
1675 QSTK01000008.1 GCA003438185_01707 CDS open 1242-1523 _na     93_aa Helix-turn-helix domain-containing protein
1676 QSTK01000008.1 GCA003438185_01708 CDS open 1548-1745 _na     65_aa hypothetical protein
1677 QSTK01000008.1 GCA003438185_01709 CDS open 2073-2570 _na     165_aa Transcriptional regulator%2C competence factor%2CRNA polymerase sigma factor
1678 QSTK01000008.1 GCA003438185_01710 CDS open 2673-3515 _na     280_aa mscS Putative MscS family protein YkuT
1679 QSTK01000008.1 GCA003438185_01711 CDS open 3658-4941 _na     427_aa tig trigger factor
1680 QSTK01000008.1 GCA003438185_01712 CDS open 5099-5671 _na     190_aa rpoE DNA-directed RNA polymerase subunit delta
1681 QSTK01000008.1 GCA003438185_01713 CDS open 5922-7526 _na     534_aa pyrG CTP synthase
1682 QSTK01000008.1 GCA003438185_01714 CDS open 7621-8091 _na     156_aa DUF3013 domain-containing protein
1683 QSTK01000008.1 GCA003438185_01715 CDS open 8107-8553 _na     148_aa Nudix hydrolase domain-containing protein
1684 QSTK01000008.1 GCA003438185_01716 CDS open 8554-9507 _na     317_aa prmA 50S ribosomal protein L11 methyltransferase
1685 QSTK01000008.1 GCA003438185_01717 CDS open 9508-10251 _na     247_aa rsmE 16S rRNA (uracil(1498)-N(3))-methyltransferase
1686 QSTK01000008.1 GCA003438185_01718 CDS open 10416-11021 _na     201_aa 2'%2C3'-cyclic-nucleotide 2'-phosphodiesterase
1687 QSTK01000008.1 GCA003438185_01719 CDS open 11097-11336 _na     79_aa hypothetical protein
1688 QSTK01000008.1 GCA003438185_01720 CDS open 11531-11989 _na     152_aa nrdI class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI
1689 QSTK01000008.1 GCA003438185_01721 CDS open 12157-14376 _na     739_aa spoT GTP diphosphokinase
1690 QSTK01000008.1 GCA003438185_01722 CDS open 14389-14832 _na     147_aa dtd D-aminoacyl-tRNA deacylase
1691 QSTK01000008.1 GCA003438185_01723 CDS open 15206-15466 _na     86_aa hypothetical protein
1692 QSTK01000008.1 GCA003438185_01724 CDS open 15583-16833 _na     416_aa ilvA threonine ammonia-lyase IlvA
1693 QSTK01000008.1 GCA003438185_01725 CDS open 16849-17496 _na     215_aa hypothetical protein
1694 QSTK01000008.1 GCA003438185_01726 CDS open 17972-20551 _na     859_aa SEC10/PgrA surface exclusion domain-containing protein
1695 QSTK01000008.1 GCA003438185_01727 CDS open 20694-21308 _na     204_aa def peptide deformylase
1696 QSTK01000008.1 GCA003438185_01728 CDS open 21402-22040 _na     212_aa crp Transcriptional regulator
1697 QSTK01000008.1 GCA003438185_01729 CDS open 22147-23310 _na     387_aa cynX MFS transporter
1698 QSTK01000008.1 GCA003438185_01730 CDS open 23459-23728 _na     89_aa rpsO 30S ribosomal protein S15
1699 QSTK01000008.1 GCA003438185_01731 CDS open 23921-24502 _na     193_aa Glycopeptide antibiotics resistance protein
1700 QSTK01000008.1 GCA003438185_01732 CDS open 24791-27118 _na     775_aa Chromosome partition protein Smc
1701 QSTK01000008.1 GCA003438185_01733 CDS open 27205-27945 _na     246_aa glnQ Amino acid ABC transporter ATP-binding protein
1702 QSTK01000008.1 GCA003438185_01734 CDS open 27945-29492 _na     515_aa hisJ Amino acid ABC transporter substrate-binding protein
1703 QSTK01000008.1 GCA003438185_01735 CDS open 29695-30549 _na     284_aa uppP undecaprenyl-diphosphate phosphatase
1704 QSTK01000008.1 GCA003438185_01736 CDS open 31174-31923 _na     249_aa mecA adaptor protein MecA
1705 QSTK01000008.1 GCA003438185_01737 CDS open 31927-33084 _na     385_aa rfe Polysaccharide biosynthesis protein
1706 QSTK01000008.1 GCA003438185_01738 CDS open 33247-34017 _na     256_aa sufC Fe-S cluster assembly ATPase SufC
1707 QSTK01000008.1 GCA003438185_01739 CDS open 34054-35316 _na     420_aa sufD Fe-S cluster assembly protein SufD
1708 QSTK01000008.1 GCA003438185_01740 CDS open 35370-36602 _na     410_aa csdA Cysteine desulfurase
1709 QSTK01000008.1 GCA003438185_01741 CDS open 36589-37020 _na     143_aa sufU Fe-S cluster assembly sulfur transfer protein SufU
1710 QSTK01000008.1 GCA003438185_01742 CDS open 37096-38514 _na     472_aa sufB Fe-S cluster assembly protein SufB
1711 QSTK01000008.1 GCA003438185_01743 CDS open 38798-40444 _na     548_aa oppA Oligopeptide-binding protein OppA
1712 QSTK01000008.1 GCA003438185_01744 CDS open 40575-41489 _na     304_aa oppB Oligopeptide transport system permease protein OppB
1713 QSTK01000008.1 GCA003438185_01745 CDS open 41500-42531 _na     343_aa oppC Oligopeptide transport system permease protein OppC
1714 QSTK01000008.1 GCA003438185_01746 CDS open 42545-43585 _na     346_aa oppD Oligopeptide ABC transporter%2C ATP-binding protein OppD
1715 QSTK01000008.1 GCA003438185_01747 CDS open 43587-44525 _na     312_aa yejF Oligopeptide ABC uptake transporter membrane-spanning protein
1716 QSTK01000008.1 GCA003438185_01748 CDS open 45036-45902 _na     288_aa hslO Hsp33 family molecular chaperone HslO
1717 QSTK01000008.1 GCA003438185_01749 CDS open 45895-46872 _na     325_aa dusB tRNA dihydrouridine synthase DusB
1718 QSTK01000008.1 GCA003438185_01750 CDS open 47101-48369 _na     422_aa Transporter%2C major facilitator family protein
1719 QSTK01000008.1 GCA003438185_01751 CDS open 48475-48918 _na     147_aa marR zinc-dependent MarR family transcriptional regulator
1720 QSTK01000008.1 GCA003438185_01752 CDS open 48920-49627 _na     235_aa znuC High-affinity zinc uptake system ATP-binding protein ZnuC
1721 QSTK01000008.1 GCA003438185_01753 CDS open 49620-50432 _na     270_aa znuB Zinc (Zn2+) ABC uptake transporter membrane-spanning protein
1722 QSTK01000008.1 GCA003438185_01754 CDS open 50595-51533 _na     312_aa yfdV Auxin efflux carrier
1723 QSTK01000008.1 GCA003438185_01755 CDS open 51685-53871 _na     728_aa PTS system%2C maltose and glucose-specific IIA%2C IIB%2C and IIC component
1724 QSTK01000008.1 GCA003438185_01756 CDS open 53970-54785 _na     271_aa elsH Maltose 6'-phosphate phosphatase
1725 QSTK01000008.1 GCA003438185_01757 CDS open 54890-56239 _na     449_aa glucose-6-phosphate isomerase
1726 QSTK01000008.1 GCA003438185_01758 CDS open 56427-57143 _na     238_aa tACO1 YebC/PmpR family DNA-binding transcriptional regulator
1727 QSTK01000008.1 GCA003438185_01759 CDS open 57269-57607 _na     112_aa yajC Preprotein translocase subunit YajC
1728 QSTK01000008.1 GCA003438185_01760 CDS open 57736-58485 _na     249_aa uppS isoprenyl transferase
1729 QSTK01000008.1 GCA003438185_01761 CDS open 58498-59292 _na     264_aa cdsA Phosphatidate cytidylyltransferase
1730 QSTK01000008.1 GCA003438185_01762 CDS open 59308-60570 _na     420_aa rseP RIP metalloprotease RseP
1731 QSTK01000008.1 GCA003438185_01763 CDS open 60656-62503 _na     615_aa proS proline--tRNA ligase
1732 QSTK01000008.1 GCA003438185_01764 CDS open 63102-65042 _na     646_aa ABC transporter permease
1733 QSTK01000008.1 GCA003438185_01765 CDS open 65042-65845 _na     267_aa ABC transporter ATP-binding protein
1734 QSTK01000008.1 GCA003438185_01766 CDS open 66011-66298 _na     95_aa groES co-chaperone GroES
1735 QSTK01000008.1 GCA003438185_01767 CDS open 66343-67962 _na     539_aa groL chaperonin GroEL
1736 QSTK01000008.1 GCA003438185_01768 CDS open 68041-68904 _na     287_aa Superinfection immunity protein
1737 QSTK01000008.1 GCA003438185_01769 CDS open 68998-69303 _na     101_aa DUF2752 domain-containing protein
1738 QSTK01000008.1 GCA003438185_01770 CDS open 69303-69635 _na     110_aa TM2 domain-containing protein
1739 QSTK01000008.1 GCA003438185_01771 CDS open 69819-70688 _na     289_aa Pseudouridine synthase
1740 QSTK01000008.1 GCA003438185_01772 CDS open 70754-73081 _na     775_aa pbp2a penicillin-binding protein PBP2A
1741 QSTK01000008.1 GCA003438185_01773 CDS open 73291-73467 _na     58_aa secE preprotein translocase subunit SecE
1742 QSTK01000008.1 GCA003438185_01774 CDS open 73668-74207 _na     179_aa nusG transcription termination/antitermination protein NusG
1743 QSTK01000008.1 GCA003438185_01775 CDS open 74338-74823 _na     161_aa PAP2 family protein
1744 QSTK01000008.1 GCA003438185_01776 CDS open 74954-75763 _na     269_aa Phosphatase
1745 QSTK01000008.1 GCA003438185_01777 CDS open 75756-76523 _na     255_aa glcR HTH-type transcriptional repressor GlcR
1746 QSTK01000008.1 GCA003438185_01778 CDS open 76717-79218 _na     833_aa leuS leucine--tRNA ligase
1747 QSTK01000008.1 GCA003438185_01779 CDS open 79319-79774 _na     151_aa marR MarR family winged helix-turn-helix transcriptional regulator
1748 QSTK01000008.1 GCA003438185_01780 CDS open 79831-81063 _na     410_aa Acyl-CoA thioesterase
1749 QSTK01000008.1 GCA003438185_01781 CDS open 81223-81615 _na     130_aa DUF2992 domain-containing protein
1750 QSTK01000008.1 GCA003438185_01782 CDS open 82108-82974 _na     288_aa drrA Daunorubicin/doxorubicin resistance ATP-binding protein DrrA
1751 QSTK01000008.1 GCA003438185_01783 CDS open 82974-83816 _na     280_aa ABC-2 type transporter
1752 QSTK01000008.1 GCA003438185_01784 CDS open 83835-84290 _na     151_aa lytR Autolysis response regulater LytR
1753 QSTK01000008.1 GCA003438185_01785 CDS open 84300-84728 _na     142_aa DUF3021 domain-containing protein
1754 QSTK01000008.1 GCA003438185_01786 CDS open 84939-85352 _na     137_aa DUF2992 domain-containing protein
1755 QSTK01000008.1 GCA003438185_01787 CDS open 85446-85751 _na     101_aa YCII-related domain-containing protein
1756 QSTK01000008.1 GCA003438185_01788 CDS open 85839-86156 _na     105_aa HTH hxlR-type domain-containing protein
1757 QSTK01000008.1 GCA003438185_01789 CDS open 86280-86774 _na     164_aa ABC transporter ATP-binding protein
1758 QSTK01000008.1 GCA003438185_01790 CDS open 86800-88254 _na     484_aa pncB nicotinate phosphoribosyltransferase
1759 QSTK01000008.1 GCA003438185_01791 CDS open 88266-89087 _na     273_aa nadE ammonia-dependent NAD(+) synthetase
1760 QSTK01000008.1 GCA003438185_01792 CDS open 89104-89544 _na     146_aa DUF805 domain-containing protein
1761 QSTK01000008.1 GCA003438185_01793 CDS open 89646-90983 _na     445_aa pepC aminopeptidase C
1762 QSTK01000008.1 GCA003438185_01707 gene open 1242-1523
1763 QSTK01000008.1 GCA003438185_01708 gene open 1548-1745
1764 QSTK01000008.1 GCA003438185_01709 gene open 2073-2570
1765 QSTK01000008.1 GCA003438185_01710 gene open 2673-3515 mscS
1766 QSTK01000008.1 GCA003438185_01711 gene open 3658-4941 tig
1767 QSTK01000008.1 GCA003438185_01712 gene open 5099-5671 rpoE
1768 QSTK01000008.1 GCA003438185_01713 gene open 5922-7526 pyrG
1769 QSTK01000008.1 GCA003438185_01714 gene open 7621-8091
1770 QSTK01000008.1 GCA003438185_01715 gene open 8107-8553
1771 QSTK01000008.1 GCA003438185_01716 gene open 8554-9507 prmA
1772 QSTK01000008.1 GCA003438185_01717 gene open 9508-10251 rsmE
1773 QSTK01000008.1 GCA003438185_01718 gene open 10416-11021
1774 QSTK01000008.1 GCA003438185_01719 gene open 11097-11336
1775 QSTK01000008.1 GCA003438185_01720 gene open 11531-11989 nrdI
1776 QSTK01000008.1 GCA003438185_01721 gene open 12157-14376 spoT
1777 QSTK01000008.1 GCA003438185_01722 gene open 14389-14832 dtd
1778 QSTK01000008.1 GCA003438185_01723 gene open 15206-15466
1779 QSTK01000008.1 GCA003438185_01724 gene open 15583-16833 ilvA
1780 QSTK01000008.1 GCA003438185_01725 gene open 16849-17496
1781 QSTK01000008.1 GCA003438185_01726 gene open 17972-20551
1782 QSTK01000008.1 GCA003438185_01727 gene open 20694-21308 def
1783 QSTK01000008.1 GCA003438185_01728 gene open 21402-22040 crp
1784 QSTK01000008.1 GCA003438185_01729 gene open 22147-23310 cynX
1785 QSTK01000008.1 GCA003438185_01730 gene open 23459-23728 rpsO
1786 QSTK01000008.1 GCA003438185_01731 gene open 23921-24502
1787 QSTK01000008.1 GCA003438185_01732 gene open 24791-27118
1788 QSTK01000008.1 GCA003438185_01733 gene open 27205-27945 glnQ
1789 QSTK01000008.1 GCA003438185_01734 gene open 27945-29492 hisJ
1790 QSTK01000008.1 GCA003438185_01735 gene open 29695-30549 uppP
1791 QSTK01000008.1 GCA003438185_01736 gene open 31174-31923 mecA
1792 QSTK01000008.1 GCA003438185_01737 gene open 31927-33084 rfe
1793 QSTK01000008.1 GCA003438185_01738 gene open 33247-34017 sufC
1794 QSTK01000008.1 GCA003438185_01739 gene open 34054-35316 sufD
1795 QSTK01000008.1 GCA003438185_01740 gene open 35370-36602 csdA
1796 QSTK01000008.1 GCA003438185_01741 gene open 36589-37020 sufU
1797 QSTK01000008.1 GCA003438185_01742 gene open 37096-38514 sufB
1798 QSTK01000008.1 GCA003438185_01743 gene open 38798-40444 oppA
1799 QSTK01000008.1 GCA003438185_01744 gene open 40575-41489 oppB
1800 QSTK01000008.1 GCA003438185_01745 gene open 41500-42531 oppC
1801 QSTK01000008.1 GCA003438185_01746 gene open 42545-43585 oppD
1802 QSTK01000008.1 GCA003438185_01747 gene open 43587-44525 yejF
1803 QSTK01000008.1 GCA003438185_01748 gene open 45036-45902 hslO
1804 QSTK01000008.1 GCA003438185_01749 gene open 45895-46872 dusB
1805 QSTK01000008.1 GCA003438185_01750 gene open 47101-48369
1806 QSTK01000008.1 GCA003438185_01751 gene open 48475-48918 marR
1807 QSTK01000008.1 GCA003438185_01752 gene open 48920-49627 znuC
1808 QSTK01000008.1 GCA003438185_01753 gene open 49620-50432 znuB
1809 QSTK01000008.1 GCA003438185_01754 gene open 50595-51533 yfdV
1810 QSTK01000008.1 GCA003438185_01755 gene open 51685-53871
1811 QSTK01000008.1 GCA003438185_01756 gene open 53970-54785 elsH
1812 QSTK01000008.1 GCA003438185_01757 gene open 54890-56239
1813 QSTK01000008.1 GCA003438185_01758 gene open 56427-57143 tACO1
1814 QSTK01000008.1 GCA003438185_01759 gene open 57269-57607 yajC
1815 QSTK01000008.1 GCA003438185_01760 gene open 57736-58485 uppS
1816 QSTK01000008.1 GCA003438185_01761 gene open 58498-59292 cdsA
1817 QSTK01000008.1 GCA003438185_01762 gene open 59308-60570 rseP
1818 QSTK01000008.1 GCA003438185_01763 gene open 60656-62503 proS
1819 QSTK01000008.1 GCA003438185_01764 gene open 63102-65042
1820 QSTK01000008.1 GCA003438185_01765 gene open 65042-65845
1821 QSTK01000008.1 GCA003438185_01766 gene open 66011-66298 groES
1822 QSTK01000008.1 GCA003438185_01767 gene open 66343-67962 groL
1823 QSTK01000008.1 GCA003438185_01768 gene open 68041-68904
1824 QSTK01000008.1 GCA003438185_01769 gene open 68998-69303
1825 QSTK01000008.1 GCA003438185_01770 gene open 69303-69635
1826 QSTK01000008.1 GCA003438185_01771 gene open 69819-70688
1827 QSTK01000008.1 GCA003438185_01772 gene open 70754-73081 pbp2a
1828 QSTK01000008.1 GCA003438185_01773 gene open 73291-73467 secE
1829 QSTK01000008.1 GCA003438185_01774 gene open 73668-74207 nusG
1830 QSTK01000008.1 GCA003438185_01775 gene open 74338-74823
1831 QSTK01000008.1 GCA003438185_01776 gene open 74954-75763
1832 QSTK01000008.1 GCA003438185_01777 gene open 75756-76523 glcR
1833 QSTK01000008.1 GCA003438185_01778 gene open 76717-79218 leuS
1834 QSTK01000008.1 GCA003438185_01779 gene open 79319-79774 marR
1835 QSTK01000008.1 GCA003438185_01780 gene open 79831-81063
1836 QSTK01000008.1 GCA003438185_01781 gene open 81223-81615
1837 QSTK01000008.1 GCA003438185_01782 gene open 82108-82974 drrA
1838 QSTK01000008.1 GCA003438185_01783 gene open 82974-83816
1839 QSTK01000008.1 GCA003438185_01784 gene open 83835-84290 lytR
1840 QSTK01000008.1 GCA003438185_01785 gene open 84300-84728
1841 QSTK01000008.1 GCA003438185_01786 gene open 84939-85352
1842 QSTK01000008.1 GCA003438185_01787 gene open 85446-85751
1843 QSTK01000008.1 GCA003438185_01788 gene open 85839-86156
1844 QSTK01000008.1 GCA003438185_01789 gene open 86280-86774
1845 QSTK01000008.1 GCA003438185_01790 gene open 86800-88254 pncB
1846 QSTK01000008.1 GCA003438185_01791 gene open 88266-89087 nadE
1847 QSTK01000008.1 GCA003438185_01792 gene open 89104-89544
1848 QSTK01000008.1 GCA003438185_01793 gene open 89646-90983 pepC
1849 QSTK01000009.1 GCA003438185_01799 gene open 14308-14417 Srn266
1850 QSTK01000009.1 GCA003438185_01799 ncRNA open 14308-14417 Streptococcus RNA 266
1851 QSTK01000009.1 repeat_region open 5374-5675 CRISPR array with 4 repeats of length 59%2C consensus sequence GCTGGCTGAACGGCAGCTTCACCTTCGTGGCCAACTTCTTGTGTACCATTGGCGCTAAT and spacer length 22
1852 QSTK01000009.1 repeat_region open 28090-29713 CRISPR array with 27 repeats of length 28%2C consensus sequence GGATCACCCCCGCGTGTGCGGGAAAAAC and spacer length 33
1853 QSTK01000009.1 GCA003438185_01794 CDS open 213-689 _na     158_aa Transposase
1854 QSTK01000009.1 GCA003438185_01795 CDS open 7242-7337 _na     31_aa IS3 family transposase
1855 QSTK01000009.1 GCA003438185_01796 CDS open 7765-9633 _na     622_aa ABC transporter%2C ATP-binding protein
1856 QSTK01000009.1 GCA003438185_01797 CDS open 9623-11368 _na     581_aa ABC transporter%2C ATP-binding protein
1857 QSTK01000009.1 GCA003438185_01798 CDS open 12005-14269 _na     754_aa gshB bifunctional glutamate--cysteine ligase GshA/glutathione synthetase GshB
1858 QSTK01000009.1 GCA003438185_01800 CDS open 14422-15522 _na     366_aa Transposase
1859 QSTK01000009.1 GCA003438185_01801 CDS open 15717-19244 _na     1175_aa Glycosyl hydrolase family 25
1860 QSTK01000009.1 GCA003438185_01802 CDS open 19507-21246 _na     579_aa lpdA dihydrolipoyl dehydrogenase
1861 QSTK01000009.1 GCA003438185_01803 CDS open 21491-22861 _na     456_aa aceF dihydrolipoamide acetyltransferase
1862 QSTK01000009.1 GCA003438185_01804 CDS open 23108-24106 _na     332_aa acoB Acetoin dehydrogenase E1 component (TPP-dependent beta subunit)
1863 QSTK01000009.1 GCA003438185_01805 CDS open 24131-25102 _na     323_aa acoA Acetoin dehydrogenase E1 component (TPP-dependent alpha subunit)
1864 QSTK01000009.1 GCA003438185_01806 CDS open 25701-26549 _na     282_aa hypothetical protein
1865 QSTK01000009.1 GCA003438185_01807 CDS open 26539-27828 _na     429_aa Sensory transduction protein kinase
1866 QSTK01000009.1 GCA003438185_01808 CDS open 29724-30629 _na     301_aa cas2e type I-E CRISPR-associated endoribonuclease Cas2e
1867 QSTK01000009.1 GCA003438185_01809 CDS open 30631-31572 _na     313_aa cas1e type I-E CRISPR-associated endonuclease Cas1e
1868 QSTK01000009.1 GCA003438185_01810 CDS open 31576-32214 _na     212_aa cas6e type I-E CRISPR-associated protein Cas6/Cse3/CasE
1869 QSTK01000009.1 GCA003438185_01811 CDS open 32219-32944 _na     241_aa cas5e type I-E CRISPR-associated protein Cas5/CasD
1870 QSTK01000009.1 GCA003438185_01812 CDS open 32958-34025 _na     355_aa cas7e type I-E CRISPR-associated protein Cas7/Cse4/CasC
1871 QSTK01000009.1 GCA003438185_01813 CDS open 34015-34608 _na     197_aa casB type I-E CRISPR-associated protein Cse2/CasB
1872 QSTK01000009.1 GCA003438185_01814 CDS open 34618-36285 _na     555_aa casA type I-E CRISPR-associated protein Cse1/CasA
1873 QSTK01000009.1 GCA003438185_01815 CDS open 36272-39052 _na     926_aa cas3 CRISPR-associated nuclease/helicase Cas3
1874 QSTK01000009.1 GCA003438185_01816 CDS open 39354-41297 _na     647_aa DUF2207 domain-containing protein
1875 QSTK01000009.1 GCA003438185_01817 CDS open 41373-42641 _na     422_aa pyrC dihydroorotase
1876 QSTK01000009.1 GCA003438185_01818 CDS open 42661-43314 _na     217_aa ung uracil-DNA glycosylase
1877 QSTK01000009.1 GCA003438185_01819 CDS open 43528-44724 _na     398_aa fieF Cobalt-zinc-cadmium resistance protein
1878 QSTK01000009.1 GCA003438185_01820 CDS open 44963-46309 _na     448_aa dacA D-alanyl-D-alanine carboxypeptidase DacA
1879 QSTK01000009.1 GCA003438185_01821 CDS open 46479-47330 _na     283_aa yjjU Serine protease
1880 QSTK01000009.1 GCA003438185_01822 CDS open 47327-47947 _na     206_aa GDSL-like protein
1881 QSTK01000009.1 GCA003438185_01823 CDS open 47951-49528 _na     525_aa aarF ABC1 atypical kinase-like domain-containing protein
1882 QSTK01000009.1 GCA003438185_01824 CDS open 49546-49824 _na     92_aa phaF Phasin family protein
1883 QSTK01000009.1 GCA003438185_01825 CDS open 50072-50302 _na     76_aa hypothetical protein
1884 QSTK01000009.1 GCA003438185_01826 CDS open 50392-50574 _na     60_aa hypothetical protein
1885 QSTK01000009.1 GCA003438185_01827 CDS open 50656-51072 _na     138_aa 6-phospho-beta-glucosidase
1886 QSTK01000009.1 GCA003438185_01828 CDS open 51035-51229 _na     64_aa 6-phospho-beta-glucosidase
1887 QSTK01000009.1 GCA003438185_01829 CDS open 51175-51402 _na     75_aa family 1 glycosylhydrolase
1888 QSTK01000009.1 GCA003438185_01830 CDS open 51625-52761 _na     378_aa perM ATP synthase F0%2C A subunit
1889 QSTK01000009.1 GCA003438185_01831 CDS open 52840-53436 _na     198_aa Histidine phosphatase family protein
1890 QSTK01000009.1 GCA003438185_01832 CDS open 53433-54041 _na     202_aa Phosphoglycerate mutase family 5
1891 QSTK01000009.1 GCA003438185_01833 CDS open 54038-54640 _na     200_aa phosphoglycerate mutase (2%2C3-diphosphoglycerate-dependent)
1892 QSTK01000009.1 GCA003438185_01834 CDS open 54645-54827 _na     60_aa Haloacid dehalogenase-like hydrolase
1893 QSTK01000009.1 GCA003438185_01835 CDS open 54854-55351 _na     165_aa Haloacid dehalogenase-like hydrolase
1894 QSTK01000009.1 GCA003438185_01836 CDS open 55358-55447 _na     29_aa HAD hydrolase family protein
1895 QSTK01000009.1 GCA003438185_01837 CDS open 55634-56611 _na     325_aa Phosphodiester glycosidase family protein
1896 QSTK01000009.1 GCA003438185_01838 CDS open 56643-57695 _na     350_aa wbbI Beta-1%2C6-galactofuranosyltransferase WbbI
1897 QSTK01000009.1 GCA003438185_01839 CDS open 57706-58698 _na     330_aa stealth family protein
1898 QSTK01000009.1 GCA003438185_01840 CDS open 58695-59795 _na     366_aa glf UDP-galactopyranose mutase
1899 QSTK01000009.1 GCA003438185_01841 CDS open 59806-61221 _na     471_aa rfbX Flippase
1900 QSTK01000009.1 GCA003438185_01842 CDS open 61218-62372 _na     384_aa Polysaccharide polymerase
1901 QSTK01000009.1 GCA003438185_01843 CDS open 62406-63476 _na     356_aa epsJ Putative glycosyltransferase EpsJ
1902 QSTK01000009.1 GCA003438185_01844 CDS open 63473-64441 _na     322_aa Glycosyltransferase%2C family 8
1903 QSTK01000009.1 GCA003438185_01845 CDS open 64438-65079 _na     213_aa Capsular polysaccharide biosynthesis protein
1904 QSTK01000009.1 GCA003438185_01846 CDS open 65081-66229 _na     382_aa rfaB Glycosyl transferase family protein
1905 QSTK01000009.1 GCA003438185_01847 CDS open 66232-67404 _na     390_aa cps2T beta 1-4 rhamnosyltransferase Cps2T
1906 QSTK01000009.1 GCA003438185_01848 CDS open 67437-68804 _na     455_aa wcaJ Eps3E
1907 QSTK01000009.1 GCA003438185_01849 CDS open 68860-69609 _na     249_aa cpsD Tyrosine-protein kinase CpsD
1908 QSTK01000009.1 GCA003438185_01850 CDS open 69619-70311 _na     230_aa cpsC Capsular polysaccharide biosynthesis protein CpsC
1909 QSTK01000009.1 GCA003438185_01851 CDS open 70320-71051 _na     243_aa cps4B capsular polysaccharide biosynthesis protein Cps4B
1910 QSTK01000009.1 GCA003438185_01852 CDS open 71052-72512 _na     486_aa cps2a Eps1A
1911 QSTK01000009.1 GCA003438185_01853 CDS open 72831-73613 _na     260_aa deoD purine-nucleoside phosphorylase
1912 QSTK01000009.1 GCA003438185_01854 CDS open 73878-74591 _na     237_aa GMP synthase [glutamine-hydrolyzing]
1913 QSTK01000009.1 GCA003438185_01855 CDS open 74588-75835 _na     415_aa clcA H(+)/Cl(-) exchange transporter ClcA
1914 QSTK01000009.1 GCA003438185_01856 CDS open 75839-76648 _na     269_aa xapA purine-nucleoside phosphorylase
1915 QSTK01000009.1 GCA003438185_01857 CDS open 76668-77210 _na     180_aa Phosphopentomutase
1916 QSTK01000009.1 GCA003438185_01858 CDS open 77212-78423 _na     403_aa phosphopentomutase
1917 QSTK01000009.1 GCA003438185_01859 CDS open 78548-79228 _na     226_aa rpiA ribose-5-phosphate isomerase RpiA
1918 QSTK01000009.1 GCA003438185_01860 CDS open 79725-80309 _na     194_aa udg4 Uracil-DNA glycosylase-like domain-containing protein
1919 QSTK01000009.1 GCA003438185_01794 gene open 213-689
1920 QSTK01000009.1 GCA003438185_01795 gene open 7242-7337
1921 QSTK01000009.1 GCA003438185_01796 gene open 7765-9633
1922 QSTK01000009.1 GCA003438185_01797 gene open 9623-11368
1923 QSTK01000009.1 GCA003438185_01798 gene open 12005-14269 gshB
1924 QSTK01000009.1 GCA003438185_01800 gene open 14422-15522
1925 QSTK01000009.1 GCA003438185_01801 gene open 15717-19244
1926 QSTK01000009.1 GCA003438185_01802 gene open 19507-21246 lpdA
1927 QSTK01000009.1 GCA003438185_01803 gene open 21491-22861 aceF
1928 QSTK01000009.1 GCA003438185_01804 gene open 23108-24106 acoB
1929 QSTK01000009.1 GCA003438185_01805 gene open 24131-25102 acoA
1930 QSTK01000009.1 GCA003438185_01806 gene open 25701-26549
1931 QSTK01000009.1 GCA003438185_01807 gene open 26539-27828
1932 QSTK01000009.1 GCA003438185_01808 gene open 29724-30629 cas2e
1933 QSTK01000009.1 GCA003438185_01809 gene open 30631-31572 cas1e
1934 QSTK01000009.1 GCA003438185_01810 gene open 31576-32214 cas6e
1935 QSTK01000009.1 GCA003438185_01811 gene open 32219-32944 cas5e
1936 QSTK01000009.1 GCA003438185_01812 gene open 32958-34025 cas7e
1937 QSTK01000009.1 GCA003438185_01813 gene open 34015-34608 casB
1938 QSTK01000009.1 GCA003438185_01814 gene open 34618-36285 casA
1939 QSTK01000009.1 GCA003438185_01815 gene open 36272-39052 cas3
1940 QSTK01000009.1 GCA003438185_01816 gene open 39354-41297
1941 QSTK01000009.1 GCA003438185_01817 gene open 41373-42641 pyrC
1942 QSTK01000009.1 GCA003438185_01818 gene open 42661-43314 ung
1943 QSTK01000009.1 GCA003438185_01819 gene open 43528-44724 fieF
1944 QSTK01000009.1 GCA003438185_01820 gene open 44963-46309 dacA
1945 QSTK01000009.1 GCA003438185_01821 gene open 46479-47330 yjjU
1946 QSTK01000009.1 GCA003438185_01822 gene open 47327-47947
1947 QSTK01000009.1 GCA003438185_01823 gene open 47951-49528 aarF
1948 QSTK01000009.1 GCA003438185_01824 gene open 49546-49824 phaF
1949 QSTK01000009.1 GCA003438185_01825 gene open 50072-50302
1950 QSTK01000009.1 GCA003438185_01826 gene open 50392-50574
1951 QSTK01000009.1 GCA003438185_01827 gene open 50656-51072
1952 QSTK01000009.1 GCA003438185_01828 gene open 51035-51229
1953 QSTK01000009.1 GCA003438185_01829 gene open 51175-51402
1954 QSTK01000009.1 GCA003438185_01830 gene open 51625-52761 perM
1955 QSTK01000009.1 GCA003438185_01831 gene open 52840-53436
1956 QSTK01000009.1 GCA003438185_01832 gene open 53433-54041
1957 QSTK01000009.1 GCA003438185_01833 gene open 54038-54640
1958 QSTK01000009.1 GCA003438185_01834 gene open 54645-54827
1959 QSTK01000009.1 GCA003438185_01835 gene open 54854-55351
1960 QSTK01000009.1 GCA003438185_01836 gene open 55358-55447
1961 QSTK01000009.1 GCA003438185_01837 gene open 55634-56611
1962 QSTK01000009.1 GCA003438185_01838 gene open 56643-57695 wbbI
1963 QSTK01000009.1 GCA003438185_01839 gene open 57706-58698
1964 QSTK01000009.1 GCA003438185_01840 gene open 58695-59795 glf
1965 QSTK01000009.1 GCA003438185_01841 gene open 59806-61221 rfbX
1966 QSTK01000009.1 GCA003438185_01842 gene open 61218-62372
1967 QSTK01000009.1 GCA003438185_01843 gene open 62406-63476 epsJ
1968 QSTK01000009.1 GCA003438185_01844 gene open 63473-64441
1969 QSTK01000009.1 GCA003438185_01845 gene open 64438-65079
1970 QSTK01000009.1 GCA003438185_01846 gene open 65081-66229 rfaB
1971 QSTK01000009.1 GCA003438185_01847 gene open 66232-67404 cps2T
1972 QSTK01000009.1 GCA003438185_01848 gene open 67437-68804 wcaJ
1973 QSTK01000009.1 GCA003438185_01849 gene open 68860-69609 cpsD
1974 QSTK01000009.1 GCA003438185_01850 gene open 69619-70311 cpsC
1975 QSTK01000009.1 GCA003438185_01851 gene open 70320-71051 cps4B
1976 QSTK01000009.1 GCA003438185_01852 gene open 71052-72512 cps2a
1977 QSTK01000009.1 GCA003438185_01853 gene open 72831-73613 deoD
1978 QSTK01000009.1 GCA003438185_01854 gene open 73878-74591
1979 QSTK01000009.1 GCA003438185_01855 gene open 74588-75835 clcA
1980 QSTK01000009.1 GCA003438185_01856 gene open 75839-76648 xapA
1981 QSTK01000009.1 GCA003438185_01857 gene open 76668-77210
1982 QSTK01000009.1 GCA003438185_01858 gene open 77212-78423
1983 QSTK01000009.1 GCA003438185_01859 gene open 78548-79228 rpiA
1984 QSTK01000009.1 GCA003438185_01860 gene open 79725-80309 udg4
1985 QSTK01000010.1 GCA003438185_00212 gene open 13185-13449 5_ureB_sRNA
1986 QSTK01000010.1 GCA003438185_00261 gene open 56758-57125 RNaseP_bact_b
1987 QSTK01000010.1 GCA003438185_00212 ncRNA open 13185-13449 5' ureB small RNA
1988 QSTK01000010.1 GCA003438185_00261 ncRNA open 56758-57125 Bacterial RNase P class B
1989 QSTK01000010.1 regulatory_region open 21641-21763 FMN riboswitch aptamer (RFN element)
1990 QSTK01000010.1 regulatory_region open 22399-22496 23S methyl RNA motif
1991 QSTK01000010.1 GCA003438185_00198 CDS open 62-1270 _na     402_aa sstT serine/threonine transporter SstT
1992 QSTK01000010.1 GCA003438185_00199 CDS open 1393-2085 _na     230_aa metP ABC transporter permease
1993 QSTK01000010.1 GCA003438185_00200 CDS open 2085-3152 _na     355_aa metN Methionine import ATP-binding protein MetN
1994 QSTK01000010.1 GCA003438185_00201 CDS open 3145-4518 _na     457_aa Peptidase M20 dimerisation domain-containing protein
1995 QSTK01000010.1 GCA003438185_00202 CDS open 4579-5481 _na     300_aa nlpA Lipoprotein
1996 QSTK01000010.1 GCA003438185_00203 CDS open 5641-6489 _na     282_aa yxeM Putative amino-acid-binding protein YxeM
1997 QSTK01000010.1 GCA003438185_00204 CDS open 6654-7370 _na     238_aa ecfA2 Nickel transport ATP-binding protein
1998 QSTK01000010.1 GCA003438185_00205 CDS open 7372-8151 _na     259_aa ecfT Nickel permease
1999 QSTK01000010.1 GCA003438185_00206 CDS open 8148-9125 _na     325_aa cbiM cobalt transporter CbiM
2000 QSTK01000010.1 GCA003438185_00207 CDS open 9129-9968 _na     279_aa ureD Urease accessory protein UreD