HOMD Banner
Taxonomy: V4.3   |  16S rRNA RefSeq: V16.03   |  Genomic RefSeq: V11.03   |  Viruses: V1.2

BAKTAGenome Explorer: Streptococcus oralis subsp. oralis (GCA_003942875.1)

Select a Genome:
BAKTA Annotations for GCA_003942875.1
Genome Selected: Streptococcus oralis subsp. oralis
ContigsBases CDSrRNA tmRNAtRNA
22 2089314 1943 5 1 52
[Table]   [AA Fasta]      [Browser]   [Text]   [Excel]  
Search & Sort all 4066 Records
Search These Records: Clear
Sort Column:   Molecule   PID   NA   AA   Gene  Gene Product  Reverse
Annotation Table [page:4]    |    Number of Records Found: 4066 [9 Pages]    |    Previous Page <==> Next Page    |    Jump to Page: [ 1  2  3  4  5  6  7  8  9  ]
Notes:   1- Column headers only sort the current page. 2- Select [NA] or [AA] links to show sequences.
Region Protein-ID Type Genome
Viewer		 Range
(bp)		 Show Sequences
(length) NA / AA		 BAKTA
Gene		 BAKTA
GeneProduct
1501 RMVK01000003.1 GCA003942875_00800 CDS open 78572-79468 _na     298_aa dnaI primosomal protein DnaI
1502 RMVK01000003.1 GCA003942875_00801 CDS open 79465-80178 _na     237_aa nfnB NADPH-dependent oxidoreductase
1503 RMVK01000003.1 GCA003942875_00802 CDS open 80192-81502 _na     436_aa der ribosome biogenesis GTPase Der
1504 RMVK01000003.1 GCA003942875_00803 CDS open 81730-82581 _na     283_aa TPM domain-containing protein
1505 RMVK01000003.1 GCA003942875_00804 CDS open 82742-83338 _na     198_aa lemA LemA family protein
1506 RMVK01000003.1 GCA003942875_00805 CDS open 83471-83761 _na     96_aa speK SpeK
1507 RMVK01000003.1 GCA003942875_00806 CDS open 83906-84661 _na     251_aa DNA alkylation repair protein
1508 RMVK01000003.1 GCA003942875_00807 CDS open 84792-87305 _na     837_aa secA preprotein translocase subunit SecA
1509 RMVK01000003.1 GCA003942875_00808 CDS open 87385-88416 _na     343_aa aroG1 3-deoxy-7-phosphoheptulonate synthase
1510 RMVK01000003.1 GCA003942875_00809 CDS open 88418-89449 _na     343_aa aroG1 3-deoxy-7-phosphoheptulonate synthase
1511 RMVK01000003.1 GCA003942875_00810 CDS open 89488-89856 _na     122_aa acpS Holo-[acyl-carrier-protein] synthase
1512 RMVK01000003.1 GCA003942875_00811 CDS open 89846-90949 _na     367_aa alr alanine racemase
1513 RMVK01000003.1 GCA003942875_00812 CDS open 90971-92986 _na     671_aa recG ATP-dependent DNA helicase RecG
1514 RMVK01000003.1 GCA003942875_00814 CDS open 93304-94284 _na     326_aa axe1 Acetyl xylan esterase
1515 RMVK01000003.1 GCA003942875_00815 CDS open 94621-98013 _na     1130_aa SIALI-17 repeat-containing surface protein
1516 RMVK01000003.1 GCA003942875_00816 CDS open 98247-98945 _na     232_aa nanE Putative N-acetylmannosamine-6-phosphate 2-epimerase
1517 RMVK01000003.1 GCA003942875_00817 CDS open 99060-100388 _na     442_aa ugpB Putative ABC transporter substrate-binding protein YesO
1518 RMVK01000003.1 GCA003942875_00818 CDS open 100587-101474 _na     295_aa ugpA ABC transporter membrane protein
1519 RMVK01000003.1 GCA003942875_00819 CDS open 101490-102329 _na     279_aa ugpE ABC transmembrane type-1 domain-containing protein
1520 RMVK01000003.1 GCA003942875_00820 CDS open 102719-103171 _na     150_aa nanQ Beta-galactosidase%2C beta subunit
1521 RMVK01000003.1 GCA003942875_00821 CDS open 103192-103836 _na     214_aa DUF624 domain-containing protein
1522 RMVK01000003.1 GCA003942875_00822 CDS open 104008-104925 _na     305_aa N-acetylneuraminate lyase
1523 RMVK01000003.1 GCA003942875_00823 CDS open 104943-105839 _na     298_aa nagC ROK family protein
1524 RMVK01000003.1 GCA003942875_00824 CDS open 106284-107048 _na     254_aa ubiE Methyltransferase domain protein
1525 RMVK01000003.1 GCA003942875_00825 CDS open 107184-108035 _na     283_aa ybbH Putative HTH-type transcriptional regulator YbbH
1526 RMVK01000003.1 GCA003942875_00826 CDS open 108291-110336 _na     681_aa pbp2b penicillin-binding protein PBP2B
1527 RMVK01000003.1 GCA003942875_00827 CDS open 110347-110943 _na     198_aa recR recombination mediator RecR
1528 RMVK01000003.1 GCA003942875_00828 CDS open 111246-111521 _na     91_aa TIGR04197 family type VII secretion effector
1529 RMVK01000003.1 GCA003942875_00829 CDS open 111524-111880 _na     118_aa Cingulin
1530 RMVK01000003.1 GCA003942875_00830 CDS open 111871-113445 _na     524_aa LXG domain-containing protein
1531 RMVK01000003.1 GCA003942875_00831 CDS open 113456-114064 _na     202_aa Phage protein
1532 RMVK01000003.1 GCA003942875_00832 CDS open 114061-114687 _na     208_aa Phage protein
1533 RMVK01000003.1 GCA003942875_00833 CDS open 114684-115298 _na     204_aa Phage protein
1534 RMVK01000003.1 GCA003942875_00834 CDS open 115295-115924 _na     209_aa DUF402 domain-containing protein
1535 RMVK01000003.1 GCA003942875_00835 CDS open 115921-116553 _na     210_aa Phage protein
1536 RMVK01000003.1 GCA003942875_00836 CDS open 116550-117179 _na     209_aa DUF402 domain-containing protein
1537 RMVK01000003.1 GCA003942875_00837 CDS open 117176-117802 _na     208_aa Phage protein
1538 RMVK01000003.1 GCA003942875_00838 CDS open 117799-118413 _na     204_aa DUF402 domain-containing protein
1539 RMVK01000003.1 GCA003942875_00839 CDS open 118410-119039 _na     209_aa Phage protein
1540 RMVK01000003.1 GCA003942875_00840 CDS open 119094-119627 _na     177_aa Thiol-disulfide isomerase
1541 RMVK01000003.1 GCA003942875_00841 CDS open 119713-120237 _na     174_aa Thiol-disulfide isomerase
1542 RMVK01000003.1 GCA003942875_00842 CDS open 120416-121042 _na     208_aa tipC TipC family immunity protein
1543 RMVK01000003.1 GCA003942875_00843 CDS open 121138-121734 _na     198_aa hypothetical protein
1544 RMVK01000003.1 GCA003942875_00844 CDS open 121784-122314 _na     176_aa hypothetical protein
1545 RMVK01000003.1 GCA003942875_00845 CDS open 122458-122964 _na     168_aa Lipoprotein
1546 RMVK01000003.1 GCA003942875_00846 CDS open 123214-123378 _na     54_aa hypothetical protein
1547 RMVK01000003.1 GCA003942875_00847 CDS open 123507-123734 _na     75_aa Bacterial toxin 44 domain-containing protein
1548 RMVK01000003.1 GCA003942875_00848 CDS open 123731-124219 _na     162_aa hypothetical protein
1549 RMVK01000003.1 GCA003942875_00849 CDS open 124324-125367 _na     347_aa ddl D-alanine--D-alanine ligase
1550 RMVK01000003.1 GCA003942875_00850 CDS open 125452-126825 _na     457_aa murF UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase
1551 RMVK01000003.1 GCA003942875_00851 CDS open 126812-127423 _na     203_aa yjhB Nudix hydrolase domain-containing protein
1552 RMVK01000003.1 GCA003942875_00852 CDS open 127618-128322 _na     234_aa Integral membrane protein
1553 RMVK01000003.1 GCA003942875_00853 CDS open 128559-129929 _na     456_aa ftsA cell division protein FtsA
1554 RMVK01000003.1 GCA003942875_00854 CDS open 129946-131202 _na     418_aa ftsZ cell division protein FtsZ
1555 RMVK01000003.1 GCA003942875_00855 CDS open 131206-131877 _na     223_aa Pyridoxal phosphate homeostasis protein
1556 RMVK01000003.1 GCA003942875_00856 CDS open 131887-132417 _na     176_aa sepF Cell division protein SepF
1557 RMVK01000003.1 GCA003942875_00857 CDS open 132417-132677 _na     86_aa YGGT family protein
1558 RMVK01000003.1 GCA003942875_00858 CDS open 132674-133465 _na     263_aa RNA-binding protein
1559 RMVK01000003.1 GCA003942875_00859 CDS open 133474-133728 _na     84_aa Putative septum site-determining protein divIVA
1560 RMVK01000003.1 GCA003942875_00860 CDS open 133745-134539 _na     264_aa DivIVA domain protein
1561 RMVK01000003.1 GCA003942875_00861 CDS open 134791-137583 _na     930_aa ileS isoleucine--tRNA ligase
1562 RMVK01000003.1 GCA003942875_00862 CDS open 137685-137807 _na     40_aa hypothetical protein
1563 RMVK01000003.1 GCA003942875_00863 CDS open 137878-145308 _na     2476_aa SIALI-17 repeat-containing surface protein
1564 RMVK01000003.1 GCA003942875_00864 CDS open 145558-151983 _na     2141_aa Immunoglobulin A1 protease
1565 RMVK01000003.1 GCA003942875_00865 CDS open 152231-152611 _na     126_aa Prophage Lp1 protein 6
1566 RMVK01000003.1 GCA003942875_00866 CDS open 152845-158364 _na     1839_aa zmpA zinc metalloprotease A
1567 RMVK01000003.1 GCA003942875_00867 CDS open 158516-158896 _na     126_aa Prophage Lp1 protein 6
1568 RMVK01000003.1 GCA003942875_00868 CDS open 159209-159901 _na     230_aa gpmA phosphoglycerate mutase
1569 RMVK01000003.1 GCA003942875_00869 CDS open 160027-160599 _na     190_aa TetR/AcrR family transcriptional regulator
1570 RMVK01000003.1 GCA003942875_00870 CDS open 160740-161441 _na     233_aa ABC transporter ATP-binding protein
1571 RMVK01000003.1 GCA003942875_00871 CDS open 161443-164142 _na     899_aa Efflux ABC transporter%2C permease protein
1572 RMVK01000003.1 GCA003942875_00872 CDS open 164287-164556 _na     89_aa rpsO 30S ribosomal protein S15
1573 RMVK01000003.1 GCA003942875_00873 CDS open 165169-166215 _na     348_aa ABC-transporter Fe3+-siderophore%2C permease
1574 RMVK01000003.1 GCA003942875_00874 CDS open 166217-166972 _na     251_aa ABC-transporter%2C Fe3+-siderophore%2C ATP-binding protein
1575 RMVK01000003.1 GCA003942875_00875 CDS open 166992-168002 _na     336_aa Periplasmic binding protein
1576 RMVK01000003.1 GCA003942875_00876 CDS open 167983-168675 _na     230_aa Esterase
1577 RMVK01000003.1 GCA003942875_00877 CDS open 168718-169467 _na     249_aa plsC 1-acyl-sn-glycerol-3-phosphate acyltransferase
1578 RMVK01000003.1 GCA003942875_00878 CDS open 169600-171936 _na     778_aa exp7 putative cation-transporting ATPase exp7
1579 RMVK01000003.1 GCA003942875_00879 CDS open 172038-172715 _na     225_aa trmK Bcl-2 family protein
1580 RMVK01000003.1 GCA003942875_00880 CDS open 172702-173499 _na     265_aa nIF3 Nif3-like dinuclear metal center hexameric protein
1581 RMVK01000003.1 GCA003942875_00881 CDS open 173516-174619 _na     367_aa hcnC Hydrogen cyanide synthase subunit HcnC
1582 RMVK01000003.1 GCA003942875_00882 CDS open 174722-175741 _na     339_aa galE UDP-glucose 4-epimerase GalE
1583 RMVK01000003.1 GCA003942875_00883 CDS open 175725-176708 _na     327_aa Bactoprenol glucosyl transferase-like protein
1584 RMVK01000003.1 GCA003942875_00884 CDS open 177034-177540 _na     168_aa SAG1386/EF1546 family surface-associated protein
1585 RMVK01000003.1 GCA003942875_00885 CDS open 177550-178224 _na     224_aa cmk (d)CMP kinase
1586 RMVK01000003.1 GCA003942875_00886 CDS open 178343-178849 _na     168_aa Dihydrofolate reductase
1587 RMVK01000003.1 GCA003942875_00887 CDS open 178849-179019 _na     56_aa Membrane associated protein
1588 RMVK01000003.1 GCA003942875_00888 CDS open 179075-180283 _na     402_aa clpX ATP-dependent Clp protease ATP-binding subunit ClpX
1589 RMVK01000003.1 GCA003942875_00889 CDS open 180292-180879 _na     195_aa yihA ribosome biogenesis GTP-binding protein YihA/YsxC
1590 RMVK01000003.1 GCA003942875_00890 CDS open 180889-181269 _na     126_aa ridA Enamine/imine deaminase
1591 RMVK01000003.1 GCA003942875_00891 CDS open 181321-182211 _na     296_aa rapZ RNase adapter RapZ
1592 RMVK01000003.1 GCA003942875_00892 CDS open 182208-183185 _na     325_aa cofD Putative gluconeogenesis factor
1593 RMVK01000003.1 GCA003942875_00893 CDS open 183182-184093 _na     303_aa whiA DNA-binding protein WhiA
1594 RMVK01000003.1 GCA003942875_00894 CDS open 184125-185093 _na     322_aa trxB Ferredoxin--NADP reductase
1595 RMVK01000003.1 GCA003942875_00895 CDS open 185173-186087 _na     304_aa cdaA diadenylate cyclase CdaA
1596 RMVK01000003.1 GCA003942875_00896 CDS open 186074-186871 _na     265_aa YbbR-like protein
1597 RMVK01000003.1 GCA003942875_00897 CDS open 186901-188253 _na     450_aa glmM phosphoglucosamine mutase
1598 RMVK01000003.1 GCA003942875_00898 CDS open 188327-188701 _na     124_aa Transposase
1599 RMVK01000003.1 GCA003942875_00899 CDS open 188704-189552 _na     282_aa degV EDD domain protein%2C DegV family
1600 RMVK01000003.1 GCA003942875_00900 CDS open 189929-190696 _na     255_aa dapB 4-hydroxy-tetrahydrodipicolinate reductase
1601 RMVK01000003.1 GCA003942875_00901 CDS open 190693-191892 _na     399_aa cca CCA tRNA nucleotidyltransferase
1602 RMVK01000003.1 GCA003942875_00902 CDS open 191889-193757 _na     622_aa abc-f ribosomal protection-like ABC-F family protein
1603 RMVK01000003.1 GCA003942875_00903 CDS open 193757-194365 _na     202_aa Gram-positive signal peptide protein%2C YSIRK family
1604 RMVK01000003.1 GCA003942875_00904 CDS open 194419-195612 _na     397_aa mntE CDF family manganese efflux transporter MntE
1605 RMVK01000003.1 GCA003942875_00905 CDS open 195919-198615 _na     898_aa mgtA Calcium-transporting ATPase
1606 RMVK01000003.1 GCA003942875_00906 CDS open 198720-199130 _na     136_aa peptide deformylase
1607 RMVK01000003.1 GCA003942875_00907 CDS open 199142-200737 _na     531_aa Cell shape-determining protein
1608 RMVK01000003.1 GCA003942875_00908 CDS open 201034-201762 _na     242_aa yaaA peroxide stress protein YaaA
1609 RMVK01000003.1 GCA003942875_00909 CDS open 201794-202342 _na     182_aa ssuE NADPH-dependent FMN reductase-like domain-containing protein
1610 RMVK01000003.1 GCA003942875_00910 CDS open 202434-202880 _na     148_aa mhqR HTH-type transcriptional regulator MhqR
1611 RMVK01000003.1 GCA003942875_00911 CDS open 203113-203475 _na     120_aa DUF5590 domain-containing protein
1612 RMVK01000003.1 GCA003942875_00912 CDS open 203485-204663 _na     392_aa Aminotransferase
1613 RMVK01000003.1 GCA003942875_00913 CDS open 204816-206159 _na     447_aa asnS asparagine--tRNA ligase
1614 RMVK01000003.1 GCA003942875_00914 CDS open 206283-207491 _na     402_aa Major facilitator superfamily (MFS) profile domain-containing protein
1615 RMVK01000003.1 GCA003942875_00915 CDS open 207633-207923 _na     96_aa rpsF 30S ribosomal protein S6
1616 RMVK01000003.1 GCA003942875_00916 CDS open 207935-208405 _na     156_aa ssbA single-stranded DNA-binding protein SsbA
1617 RMVK01000003.1 GCA003942875_00917 CDS open 208437-208676 _na     79_aa rpsR 30S ribosomal protein S18
1618 RMVK01000003.1 GCA003942875_00918 CDS open 208934-209443 _na     169_aa N-acetyltransferase domain-containing protein
1619 RMVK01000003.1 GCA003942875_00919 CDS open 209881-211029 _na     382_aa wecB non-hydrolyzing UDP-N-acetylglucosamine 2-epimerase
1620 RMVK01000003.1 GCA003942875_00920 CDS open 211036-211815 _na     259_aa GGDEF domain-containing protein
1621 RMVK01000003.1 GCA003942875_00921 CDS open 211825-211965 _na     46_aa DUF3149 domain-containing protein
1622 RMVK01000003.1 GCA003942875_00922 CDS open 211958-213268 _na     436_aa Beta-monoglucosyldiacylglycerol synthase
1623 RMVK01000003.1 GCA003942875_00923 CDS open 213277-214380 _na     367_aa Glucanase
1624 RMVK01000003.1 GCA003942875_00924 CDS open 214503-215903 _na     466_aa ppiB Peptidyl-prolyl cis-trans isomerase
1625 RMVK01000003.1 GCA003942875_00925 CDS open 215905-216264 _na     119_aa S1 RNA-binding domain-containing protein
1626 RMVK01000003.1 GCA003942875_00926 CDS open 216318-217067 _na     249_aa trmN6 Methyltransferase small domain-containing protein
1627 RMVK01000003.1 GCA003942875_00927 CDS open 217057-217341 _na     94_aa GIY-YIG domain-containing protein
1628 RMVK01000003.1 GCA003942875_00928 CDS open 217427-218362 _na     311_aa ppaC manganese-dependent inorganic pyrophosphatase
1629 RMVK01000003.1 GCA003942875_00929 CDS open 218416-218742 _na     108_aa DUF2568 domain-containing protein
1630 RMVK01000003.1 GCA003942875_00930 CDS open 218865-219377 _na     170_aa UDP-N-acetylmuramoylalanyl-D-glutamate--2%2C 6-diaminopimelate ligase
1631 RMVK01000003.1 GCA003942875_00931 CDS open 219361-220011 _na     216_aa DUF1803 domain-containing protein
1632 RMVK01000003.1 GCA003942875_00932 CDS open 220113-220313 _na     66_aa CsbD-like protein
1633 RMVK01000003.1 GCA003942875_00933 CDS open 220345-221790 _na     481_aa murE UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--L-lysine ligase
1634 RMVK01000003.1 GCA003942875_00934 CDS open 221896-223518 _na     540_aa spoVB Putative cell division protein YtgP
1635 RMVK01000003.1 GCA003942875_00935 CDS open 223721-225679 _na     652_aa Peptide ABC transporter ATP-binding protein
1636 RMVK01000003.1 GCA003942875_00936 CDS open 225825-226919 _na     364_aa metC cystathionine gamma-synthase
1637 RMVK01000003.1 GCA003942875_00937 CDS open 226927-228093 _na     388_aa cysteine-S-conjugate beta-lyase
1638 RMVK01000003.1 GCA003942875_00938 CDS open 228185-231280 _na     1031_aa SNF2 family N-terminal domain protein
1639 RMVK01000003.1 GCA003942875_00939 CDS open 231328-231939 _na     203_aa Cystathionine gamma-synthase
1640 RMVK01000003.1 GCA003942875_00940 CDS open 231951-233285 _na     444_aa murC UDP-N-acetylmuramate--L-alanine ligase
1641 RMVK01000003.1 GCA003942875_00941 CDS open 233295-233762 _na     155_aa GNAT family N-acetyltransferase
1642 RMVK01000003.1 GCA003942875_00942 CDS open 233759-234262 _na     167_aa GNAT family N-acetyltransferase
1643 RMVK01000003.1 GCA003942875_00943 CDS open 234337-236082 _na     581_aa Endolytic murein transglycosylase
1644 RMVK01000003.1 GCA003942875_00944 CDS open 236145-236627 _na     160_aa greA transcription elongation factor GreA
1645 RMVK01000003.1 GCA003942875_00945 CDS open 236704-238068 _na     454_aa Amino acid permease
1646 RMVK01000003.1 GCA003942875_00946 CDS open 238169-238579 _na     136_aa Acetyltransferase%2C GNAT family
1647 RMVK01000003.1 GCA003942875_00947 CDS open 238781-238990 _na     69_aa xRE HTH cro/C1-type domain-containing protein
1648 RMVK01000003.1 GCA003942875_00948 CDS open 238980-239468 _na     162_aa Bifunctional GMP synthase/glutamine amidotransferase protein
1649 RMVK01000003.1 GCA003942875_00949 CDS open 239585-241045 _na     486_aa pncB nicotinate phosphoribosyltransferase
1650 RMVK01000003.1 GCA003942875_00950 CDS open 241042-241866 _na     274_aa nadE ammonia-dependent NAD(+) synthetase
1651 RMVK01000003.1 GCA003942875_00951 CDS open 242163-242714 _na     183_aa ydaF Putative ribosomal N-acetyltransferase YdaF
1652 RMVK01000003.1 GCA003942875_00952 CDS open 242878-243588 _na     236_aa ccdA2 thiol-disulfide oxidoreductase-associated membrane protein CcdA2
1653 RMVK01000003.1 GCA003942875_00953 CDS open 243602-244165 _na     187_aa Thioredoxin domain-containing protein
1654 RMVK01000003.1 GCA003942875_00954 CDS open 244175-245287 _na     370_aa msrAB2 bifunctional methionine sulfoxide reductase B/A protein
1655 RMVK01000003.1 GCA003942875_00955 CDS open 245358-246095 _na     245_aa yesN Response regulator
1656 RMVK01000003.1 GCA003942875_00956 CDS open 246092-247783 _na     563_aa yesM Sensor histidine kinase
1657 RMVK01000003.1 GCA003942875_00957 CDS open 247893-248456 _na     187_aa UPF0340 protein HMPREF8571_1353
1658 RMVK01000003.1 GCA003942875_00958 CDS open 248722-250437 _na     571_aa pabB aminodeoxychorismate synthase component I
1659 RMVK01000003.1 GCA003942875_00959 CDS open 250557-252998 _na     813_aa Putative endo-beta-N-acetylglucosaminidase
1660 RMVK01000003.1 GCA003942875_00960 CDS open 253103-254062 _na     319_aa nagC Glucokinase
1661 RMVK01000003.1 GCA003942875_00961 CDS open 254162-255001 _na     279_aa thyA thymidylate synthase
1662 RMVK01000003.1 GCA003942875_00710 gene open 605-1540 birA
1663 RMVK01000003.1 GCA003942875_00711 gene open 1537-2397
1664 RMVK01000003.1 GCA003942875_00712 gene open 2505-4667
1665 RMVK01000003.1 GCA003942875_00713 gene open 4702-5952
1666 RMVK01000003.1 GCA003942875_00714 gene open 5971-6843 lacF
1667 RMVK01000003.1 GCA003942875_00715 gene open 6860-7693
1668 RMVK01000003.1 GCA003942875_00716 gene open 7900-9342 gtfA
1669 RMVK01000003.1 GCA003942875_00717 gene open 9397-10668
1670 RMVK01000003.1 GCA003942875_00718 gene open 10814-11257 marR
1671 RMVK01000003.1 GCA003942875_00719 gene open 11261-12025
1672 RMVK01000003.1 GCA003942875_00720 gene open 12040-12768 egtUA
1673 RMVK01000003.1 GCA003942875_00721 gene open 12761-14281 egtUBC
1674 RMVK01000003.1 GCA003942875_00722 gene open 14771-15373
1675 RMVK01000003.1 GCA003942875_00723 gene open 15370-16164 ecfT
1676 RMVK01000003.1 GCA003942875_00724 gene open 16140-16976 ecfA2
1677 RMVK01000003.1 GCA003942875_00725 gene open 16963-17763 ecfA2
1678 RMVK01000003.1 GCA003942875_00726 gene open 17988-18149 hsdD
1679 RMVK01000003.1 GCA003942875_00727 gene open 18377-18613
1680 RMVK01000003.1 GCA003942875_00728 gene open 18606-19301
1681 RMVK01000003.1 GCA003942875_00729 gene open 19398-19748 pnuC
1682 RMVK01000003.1 GCA003942875_00730 gene open 19882-20214
1683 RMVK01000003.1 GCA003942875_00731 gene open 20241-20906
1684 RMVK01000003.1 GCA003942875_00732 gene open 20928-21818
1685 RMVK01000003.1 GCA003942875_00733 gene open 21854-22858 galR
1686 RMVK01000003.1 GCA003942875_00734 gene open 23022-24200 galK
1687 RMVK01000003.1 GCA003942875_00735 gene open 24219-25700 galT
1688 RMVK01000003.1 GCA003942875_00736 gene open 25770-26174 paaI
1689 RMVK01000003.1 GCA003942875_00737 gene open 26207-27469 uraA
1690 RMVK01000003.1 GCA003942875_00738 gene open 27469-28050 xpt
1691 RMVK01000003.1 GCA003942875_00739 gene open 28648-29034
1692 RMVK01000003.1 GCA003942875_00740 gene open 29046-29873 exoA
1693 RMVK01000003.1 GCA003942875_00741 gene open 30007-30462
1694 RMVK01000003.1 GCA003942875_00742 gene open 30459-31094
1695 RMVK01000003.1 GCA003942875_00743 gene open 31301-33046 mdlB
1696 RMVK01000003.1 GCA003942875_00744 gene open 33036-34778 exp8
1697 RMVK01000003.1 GCA003942875_00745 gene open 34962-35654 wcaJ
1698 RMVK01000003.1 GCA003942875_00746 gene open 35697-36923 wecE
1699 RMVK01000003.1 GCA003942875_00747 gene open 37354-38532 trpB
1700 RMVK01000003.1 GCA003942875_00748 gene open 39059-40420 trpE
1701 RMVK01000003.1 GCA003942875_00749 gene open 40417-40983 pabA
1702 RMVK01000003.1 GCA003942875_00750 gene open 40994-41998 trpD
1703 RMVK01000003.1 GCA003942875_00751 gene open 41995-42762 trpC
1704 RMVK01000003.1 GCA003942875_00752 gene open 42749-43348 trpF
1705 RMVK01000003.1 GCA003942875_00753 gene open 43326-44549 trpB
1706 RMVK01000003.1 GCA003942875_00754 gene open 44542-45318 trpA
1707 RMVK01000003.1 GCA003942875_00755 gene open 45408-46307
1708 RMVK01000003.1 GCA003942875_00756 gene open 46386-46841
1709 RMVK01000003.1 GCA003942875_00757 gene open 46830-47492
1710 RMVK01000003.1 GCA003942875_00758 gene open 47562-48017
1711 RMVK01000003.1 GCA003942875_00759 gene open 48121-48645
1712 RMVK01000003.1 GCA003942875_00760 gene open 48715-49236
1713 RMVK01000003.1 GCA003942875_00761 gene open 49453-49656
1714 RMVK01000003.1 GCA003942875_00762 gene open 49698-50282
1715 RMVK01000003.1 GCA003942875_00763 gene open 50294-50464
1716 RMVK01000003.1 GCA003942875_00764 gene open 50476-51039 amaP
1717 RMVK01000003.1 GCA003942875_00765 gene open 51139-51375
1718 RMVK01000003.1 GCA003942875_00766 gene open 51672-53153
1719 RMVK01000003.1 GCA003942875_00768 gene open 53624-54895 rarA
1720 RMVK01000003.1 GCA003942875_00769 gene open 55011-55481
1721 RMVK01000003.1 GCA003942875_00770 gene open 55519-56061
1722 RMVK01000003.1 GCA003942875_00771 gene open 56111-56545
1723 RMVK01000003.1 GCA003942875_00772 gene open 56682-57632 prmA
1724 RMVK01000003.1 GCA003942875_00773 gene open 57634-58377 rsmE
1725 RMVK01000003.1 GCA003942875_00774 gene open 58388-60184 pepF
1726 RMVK01000003.1 GCA003942875_00775 gene open 60276-61244
1727 RMVK01000003.1 GCA003942875_00776 gene open 61436-62107
1728 RMVK01000003.1 GCA003942875_00777 gene open 62243-62941
1729 RMVK01000003.1 GCA003942875_00778 gene open 63162-63878
1730 RMVK01000003.1 GCA003942875_00779 gene open 64015-64692
1731 RMVK01000003.1 GCA003942875_00780 gene open 64702-65985
1732 RMVK01000003.1 GCA003942875_00781 gene open 65973-66389
1733 RMVK01000003.1 GCA003942875_00782 gene open 66383-66697
1734 RMVK01000003.1 GCA003942875_00783 gene open 66820-67611
1735 RMVK01000003.1 GCA003942875_00784 gene open 67721-68389 glpF
1736 RMVK01000003.1 GCA003942875_00785 gene open 68447-68938 queF
1737 RMVK01000003.1 GCA003942875_00786 gene open 68956-69672 queE
1738 RMVK01000003.1 GCA003942875_00787 gene open 69665-70108 queD
1739 RMVK01000003.1 GCA003942875_00788 gene open 70108-70761 queC
1740 RMVK01000003.1 GCA003942875_00789 gene open 70964-71278 trxA
1741 RMVK01000003.1 GCA003942875_00790 gene open 71294-71515
1742 RMVK01000003.1 GCA003942875_00791 gene open 71613-71993
1743 RMVK01000003.1 GCA003942875_00792 gene open 72190-72564
1744 RMVK01000003.1 GCA003942875_00793 gene open 72561-73256 lrgB
1745 RMVK01000003.1 GCA003942875_00794 gene open 73309-74856
1746 RMVK01000003.1 GCA003942875_00795 gene open 74984-75712
1747 RMVK01000003.1 GCA003942875_00796 gene open 75728-76423 skfE
1748 RMVK01000003.1 GCA003942875_00797 gene open 76428-76793 ytrA
1749 RMVK01000003.1 GCA003942875_00798 gene open 76934-77407 nrdR
1750 RMVK01000003.1 GCA003942875_00799 gene open 77408-78571 dnaD
1751 RMVK01000003.1 GCA003942875_00800 gene open 78572-79468 dnaI
1752 RMVK01000003.1 GCA003942875_00801 gene open 79465-80178 nfnB
1753 RMVK01000003.1 GCA003942875_00802 gene open 80192-81502 der
1754 RMVK01000003.1 GCA003942875_00803 gene open 81730-82581
1755 RMVK01000003.1 GCA003942875_00804 gene open 82742-83338 lemA
1756 RMVK01000003.1 GCA003942875_00805 gene open 83471-83761 speK
1757 RMVK01000003.1 GCA003942875_00806 gene open 83906-84661
1758 RMVK01000003.1 GCA003942875_00807 gene open 84792-87305 secA
1759 RMVK01000003.1 GCA003942875_00808 gene open 87385-88416 aroG1
1760 RMVK01000003.1 GCA003942875_00809 gene open 88418-89449 aroG1
1761 RMVK01000003.1 GCA003942875_00810 gene open 89488-89856 acpS
1762 RMVK01000003.1 GCA003942875_00811 gene open 89846-90949 alr
1763 RMVK01000003.1 GCA003942875_00812 gene open 90971-92986 recG
1764 RMVK01000003.1 GCA003942875_00814 gene open 93304-94284 axe1
1765 RMVK01000003.1 GCA003942875_00815 gene open 94621-98013
1766 RMVK01000003.1 GCA003942875_00816 gene open 98247-98945 nanE
1767 RMVK01000003.1 GCA003942875_00817 gene open 99060-100388 ugpB
1768 RMVK01000003.1 GCA003942875_00818 gene open 100587-101474 ugpA
1769 RMVK01000003.1 GCA003942875_00819 gene open 101490-102329 ugpE
1770 RMVK01000003.1 GCA003942875_00820 gene open 102719-103171 nanQ
1771 RMVK01000003.1 GCA003942875_00821 gene open 103192-103836
1772 RMVK01000003.1 GCA003942875_00822 gene open 104008-104925
1773 RMVK01000003.1 GCA003942875_00823 gene open 104943-105839 nagC
1774 RMVK01000003.1 GCA003942875_00824 gene open 106284-107048 ubiE
1775 RMVK01000003.1 GCA003942875_00825 gene open 107184-108035 ybbH
1776 RMVK01000003.1 GCA003942875_00826 gene open 108291-110336 pbp2b
1777 RMVK01000003.1 GCA003942875_00827 gene open 110347-110943 recR
1778 RMVK01000003.1 GCA003942875_00828 gene open 111246-111521
1779 RMVK01000003.1 GCA003942875_00829 gene open 111524-111880
1780 RMVK01000003.1 GCA003942875_00830 gene open 111871-113445
1781 RMVK01000003.1 GCA003942875_00831 gene open 113456-114064
1782 RMVK01000003.1 GCA003942875_00832 gene open 114061-114687
1783 RMVK01000003.1 GCA003942875_00833 gene open 114684-115298
1784 RMVK01000003.1 GCA003942875_00834 gene open 115295-115924
1785 RMVK01000003.1 GCA003942875_00835 gene open 115921-116553
1786 RMVK01000003.1 GCA003942875_00836 gene open 116550-117179
1787 RMVK01000003.1 GCA003942875_00837 gene open 117176-117802
1788 RMVK01000003.1 GCA003942875_00838 gene open 117799-118413
1789 RMVK01000003.1 GCA003942875_00839 gene open 118410-119039
1790 RMVK01000003.1 GCA003942875_00840 gene open 119094-119627
1791 RMVK01000003.1 GCA003942875_00841 gene open 119713-120237
1792 RMVK01000003.1 GCA003942875_00842 gene open 120416-121042 tipC
1793 RMVK01000003.1 GCA003942875_00843 gene open 121138-121734
1794 RMVK01000003.1 GCA003942875_00844 gene open 121784-122314
1795 RMVK01000003.1 GCA003942875_00845 gene open 122458-122964
1796 RMVK01000003.1 GCA003942875_00846 gene open 123214-123378
1797 RMVK01000003.1 GCA003942875_00847 gene open 123507-123734
1798 RMVK01000003.1 GCA003942875_00848 gene open 123731-124219
1799 RMVK01000003.1 GCA003942875_00849 gene open 124324-125367 ddl
1800 RMVK01000003.1 GCA003942875_00850 gene open 125452-126825 murF
1801 RMVK01000003.1 GCA003942875_00851 gene open 126812-127423 yjhB
1802 RMVK01000003.1 GCA003942875_00852 gene open 127618-128322
1803 RMVK01000003.1 GCA003942875_00853 gene open 128559-129929 ftsA
1804 RMVK01000003.1 GCA003942875_00854 gene open 129946-131202 ftsZ
1805 RMVK01000003.1 GCA003942875_00855 gene open 131206-131877
1806 RMVK01000003.1 GCA003942875_00856 gene open 131887-132417 sepF
1807 RMVK01000003.1 GCA003942875_00857 gene open 132417-132677
1808 RMVK01000003.1 GCA003942875_00858 gene open 132674-133465
1809 RMVK01000003.1 GCA003942875_00859 gene open 133474-133728
1810 RMVK01000003.1 GCA003942875_00860 gene open 133745-134539
1811 RMVK01000003.1 GCA003942875_00861 gene open 134791-137583 ileS
1812 RMVK01000003.1 GCA003942875_00862 gene open 137685-137807
1813 RMVK01000003.1 GCA003942875_00863 gene open 137878-145308
1814 RMVK01000003.1 GCA003942875_00864 gene open 145558-151983
1815 RMVK01000003.1 GCA003942875_00865 gene open 152231-152611
1816 RMVK01000003.1 GCA003942875_00866 gene open 152845-158364 zmpA
1817 RMVK01000003.1 GCA003942875_00867 gene open 158516-158896
1818 RMVK01000003.1 GCA003942875_00868 gene open 159209-159901 gpmA
1819 RMVK01000003.1 GCA003942875_00869 gene open 160027-160599
1820 RMVK01000003.1 GCA003942875_00870 gene open 160740-161441
1821 RMVK01000003.1 GCA003942875_00871 gene open 161443-164142
1822 RMVK01000003.1 GCA003942875_00872 gene open 164287-164556 rpsO
1823 RMVK01000003.1 GCA003942875_00873 gene open 165169-166215
1824 RMVK01000003.1 GCA003942875_00874 gene open 166217-166972
1825 RMVK01000003.1 GCA003942875_00875 gene open 166992-168002
1826 RMVK01000003.1 GCA003942875_00876 gene open 167983-168675
1827 RMVK01000003.1 GCA003942875_00877 gene open 168718-169467 plsC
1828 RMVK01000003.1 GCA003942875_00878 gene open 169600-171936 exp7
1829 RMVK01000003.1 GCA003942875_00879 gene open 172038-172715 trmK
1830 RMVK01000003.1 GCA003942875_00880 gene open 172702-173499 nIF3
1831 RMVK01000003.1 GCA003942875_00881 gene open 173516-174619 hcnC
1832 RMVK01000003.1 GCA003942875_00882 gene open 174722-175741 galE
1833 RMVK01000003.1 GCA003942875_00883 gene open 175725-176708
1834 RMVK01000003.1 GCA003942875_00884 gene open 177034-177540
1835 RMVK01000003.1 GCA003942875_00885 gene open 177550-178224 cmk
1836 RMVK01000003.1 GCA003942875_00886 gene open 178343-178849
1837 RMVK01000003.1 GCA003942875_00887 gene open 178849-179019
1838 RMVK01000003.1 GCA003942875_00888 gene open 179075-180283 clpX
1839 RMVK01000003.1 GCA003942875_00889 gene open 180292-180879 yihA
1840 RMVK01000003.1 GCA003942875_00890 gene open 180889-181269 ridA
1841 RMVK01000003.1 GCA003942875_00891 gene open 181321-182211 rapZ
1842 RMVK01000003.1 GCA003942875_00892 gene open 182208-183185 cofD
1843 RMVK01000003.1 GCA003942875_00893 gene open 183182-184093 whiA
1844 RMVK01000003.1 GCA003942875_00894 gene open 184125-185093 trxB
1845 RMVK01000003.1 GCA003942875_00895 gene open 185173-186087 cdaA
1846 RMVK01000003.1 GCA003942875_00896 gene open 186074-186871
1847 RMVK01000003.1 GCA003942875_00897 gene open 186901-188253 glmM
1848 RMVK01000003.1 GCA003942875_00898 gene open 188327-188701
1849 RMVK01000003.1 GCA003942875_00899 gene open 188704-189552 degV
1850 RMVK01000003.1 GCA003942875_00900 gene open 189929-190696 dapB
1851 RMVK01000003.1 GCA003942875_00901 gene open 190693-191892 cca
1852 RMVK01000003.1 GCA003942875_00902 gene open 191889-193757 abc-f
1853 RMVK01000003.1 GCA003942875_00903 gene open 193757-194365
1854 RMVK01000003.1 GCA003942875_00904 gene open 194419-195612 mntE
1855 RMVK01000003.1 GCA003942875_00905 gene open 195919-198615 mgtA
1856 RMVK01000003.1 GCA003942875_00906 gene open 198720-199130
1857 RMVK01000003.1 GCA003942875_00907 gene open 199142-200737
1858 RMVK01000003.1 GCA003942875_00908 gene open 201034-201762 yaaA
1859 RMVK01000003.1 GCA003942875_00909 gene open 201794-202342 ssuE
1860 RMVK01000003.1 GCA003942875_00910 gene open 202434-202880 mhqR
1861 RMVK01000003.1 GCA003942875_00911 gene open 203113-203475
1862 RMVK01000003.1 GCA003942875_00912 gene open 203485-204663
1863 RMVK01000003.1 GCA003942875_00913 gene open 204816-206159 asnS
1864 RMVK01000003.1 GCA003942875_00914 gene open 206283-207491
1865 RMVK01000003.1 GCA003942875_00915 gene open 207633-207923 rpsF
1866 RMVK01000003.1 GCA003942875_00916 gene open 207935-208405 ssbA
1867 RMVK01000003.1 GCA003942875_00917 gene open 208437-208676 rpsR
1868 RMVK01000003.1 GCA003942875_00918 gene open 208934-209443
1869 RMVK01000003.1 GCA003942875_00919 gene open 209881-211029 wecB
1870 RMVK01000003.1 GCA003942875_00920 gene open 211036-211815
1871 RMVK01000003.1 GCA003942875_00921 gene open 211825-211965
1872 RMVK01000003.1 GCA003942875_00922 gene open 211958-213268
1873 RMVK01000003.1 GCA003942875_00923 gene open 213277-214380
1874 RMVK01000003.1 GCA003942875_00924 gene open 214503-215903 ppiB
1875 RMVK01000003.1 GCA003942875_00925 gene open 215905-216264
1876 RMVK01000003.1 GCA003942875_00926 gene open 216318-217067 trmN6
1877 RMVK01000003.1 GCA003942875_00927 gene open 217057-217341
1878 RMVK01000003.1 GCA003942875_00928 gene open 217427-218362 ppaC
1879 RMVK01000003.1 GCA003942875_00929 gene open 218416-218742
1880 RMVK01000003.1 GCA003942875_00930 gene open 218865-219377
1881 RMVK01000003.1 GCA003942875_00931 gene open 219361-220011
1882 RMVK01000003.1 GCA003942875_00932 gene open 220113-220313
1883 RMVK01000003.1 GCA003942875_00933 gene open 220345-221790 murE
1884 RMVK01000003.1 GCA003942875_00934 gene open 221896-223518 spoVB
1885 RMVK01000003.1 GCA003942875_00935 gene open 223721-225679
1886 RMVK01000003.1 GCA003942875_00936 gene open 225825-226919 metC
1887 RMVK01000003.1 GCA003942875_00937 gene open 226927-228093
1888 RMVK01000003.1 GCA003942875_00938 gene open 228185-231280
1889 RMVK01000003.1 GCA003942875_00939 gene open 231328-231939
1890 RMVK01000003.1 GCA003942875_00940 gene open 231951-233285 murC
1891 RMVK01000003.1 GCA003942875_00941 gene open 233295-233762
1892 RMVK01000003.1 GCA003942875_00942 gene open 233759-234262
1893 RMVK01000003.1 GCA003942875_00943 gene open 234337-236082
1894 RMVK01000003.1 GCA003942875_00944 gene open 236145-236627 greA
1895 RMVK01000003.1 GCA003942875_00945 gene open 236704-238068
1896 RMVK01000003.1 GCA003942875_00946 gene open 238169-238579
1897 RMVK01000003.1 GCA003942875_00947 gene open 238781-238990 xRE
1898 RMVK01000003.1 GCA003942875_00948 gene open 238980-239468
1899 RMVK01000003.1 GCA003942875_00949 gene open 239585-241045 pncB
1900 RMVK01000003.1 GCA003942875_00950 gene open 241042-241866 nadE
1901 RMVK01000003.1 GCA003942875_00951 gene open 242163-242714 ydaF
1902 RMVK01000003.1 GCA003942875_00952 gene open 242878-243588 ccdA2
1903 RMVK01000003.1 GCA003942875_00953 gene open 243602-244165
1904 RMVK01000003.1 GCA003942875_00954 gene open 244175-245287 msrAB2
1905 RMVK01000003.1 GCA003942875_00955 gene open 245358-246095 yesN
1906 RMVK01000003.1 GCA003942875_00956 gene open 246092-247783 yesM
1907 RMVK01000003.1 GCA003942875_00957 gene open 247893-248456
1908 RMVK01000003.1 GCA003942875_00958 gene open 248722-250437 pabB
1909 RMVK01000003.1 GCA003942875_00959 gene open 250557-252998
1910 RMVK01000003.1 GCA003942875_00960 gene open 253103-254062 nagC
1911 RMVK01000003.1 GCA003942875_00961 gene open 254162-255001 thyA
1912 RMVK01000003.1 GCA003942875_00704 gene open 1-72
1913 RMVK01000003.1 GCA003942875_00705 gene open 91-164 trnfM
1914 RMVK01000003.1 GCA003942875_00706 gene open 168-240 trnF
1915 RMVK01000003.1 GCA003942875_00707 gene open 257-327 trnG
1916 RMVK01000003.1 GCA003942875_00708 gene open 361-434 trnI
1917 RMVK01000003.1 GCA003942875_00709 gene open 441-528 trnS
1918 RMVK01000003.1 GCA003942875_00767 gene open 53288-53360 trnK
1919 RMVK01000003.1 GCA003942875_00704 tRNA open 1-72 tRNA-Xxx
1920 RMVK01000003.1 GCA003942875_00705 tRNA open 91-164 trnfM tRNA-fMet(cat)
1921 RMVK01000003.1 GCA003942875_00706 tRNA open 168-240 trnF tRNA-Phe(gaa)
1922 RMVK01000003.1 GCA003942875_00707 tRNA open 257-327 trnG tRNA-Gly(tcc)
1923 RMVK01000003.1 GCA003942875_00708 tRNA open 361-434 trnI tRNA-Ile(gat)
1924 RMVK01000003.1 GCA003942875_00709 tRNA open 441-528 trnS tRNA-Ser(gct)
1925 RMVK01000003.1 GCA003942875_00767 tRNA open 53288-53360 trnK tRNA-Lys(ctt)
1926 RMVK01000004.1 GCA003942875_01043 gene open 86846-86996 rli38
1927 RMVK01000004.1 GCA003942875_01043 ncRNA open 86846-86996 Listeria sRNA rli38
1928 RMVK01000004.1 regulatory_region open 85738-85873 Ribosomal protein L10 leader
1929 RMVK01000004.1 regulatory_region open 141618-141680 pemK RNA
1930 RMVK01000004.1 repeat_region open 39752-40234 CRISPR array with 7 repeats of length 28%2C consensus sequence CCTATCTACCTCGAGAGGGGACGGAAAC and spacer length 46
1931 RMVK01000004.1 repeat_region open 40470-40659 CRISPR array with 3 repeats of length 37%2C consensus sequence GTATAGCTACCTATCAACCTCGAGAGGGGCCGGAAAC and spacer length 34
1932 RMVK01000004.1 repeat_region open 40914-41328 CRISPR array with 6 repeats of length 40%2C consensus sequence TGTATAGCTACCTATCTACCTCGCGAGGGGCCGGAAACAT and spacer length 33
1933 RMVK01000004.1 GCA003942875_00962 CDS open 164-1483 _na     439_aa Cell wall anchor
1934 RMVK01000004.1 GCA003942875_00963 CDS open 2076-5438 _na     1120_aa Alcohol dehydrogenase
1935 RMVK01000004.1 GCA003942875_00964 CDS open 5646-6386 _na     246_aa Demethylrebeccamycin-D-glucose O-methyltransferase
1936 RMVK01000004.1 GCA003942875_00965 CDS open 6921-7859 _na     312_aa TIGR01212 family radical SAM protein
1937 RMVK01000004.1 GCA003942875_00966 CDS open 7861-8418 _na     185_aa 16S rRNA (Cytosine(1402)-N(4))-methyltransferase
1938 RMVK01000004.1 GCA003942875_00967 CDS open 8411-8665 _na     84_aa Phage protein
1939 RMVK01000004.1 GCA003942875_00968 CDS open 8677-10731 _na     684_aa Sodium/hydrogen exchanger family protein
1940 RMVK01000004.1 GCA003942875_00969 CDS open 10761-11621 _na     286_aa yihY YihY family protein
1941 RMVK01000004.1 GCA003942875_00970 CDS open 11661-12689 _na     342_aa queA tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA
1942 RMVK01000004.1 GCA003942875_00971 CDS open 12840-13547 _na     235_aa nagB Glucosamine-6-phosphate deaminase
1943 RMVK01000004.1 GCA003942875_00972 CDS open 13701-14012 _na     103_aa Transcriptional regulator
1944 RMVK01000004.1 GCA003942875_00973 CDS open 14153-14329 _na     58_aa rpsU 30S ribosomal protein S21
1945 RMVK01000004.1 GCA003942875_00974 CDS open 14394-15356 _na     320_aa hypothetical protein
1946 RMVK01000004.1 GCA003942875_00975 CDS open 15493-16428 _na     311_aa hprK HPr(Ser) kinase/phosphatase
1947 RMVK01000004.1 GCA003942875_00976 CDS open 16421-17209 _na     262_aa lgt prolipoprotein diacylglyceryl transferase
1948 RMVK01000004.1 GCA003942875_00977 CDS open 17210-17593 _na     127_aa Methyl-accepting chemotaxis family domain protein
1949 RMVK01000004.1 GCA003942875_00978 CDS open 17609-18007 _na     132_aa Late embryogeneis abundant protein
1950 RMVK01000004.1 GCA003942875_00979 CDS open 18080-19210 _na     376_aa hemW radical SAM family heme chaperone HemW
1951 RMVK01000004.1 GCA003942875_00980 CDS open 19215-19952 _na     245_aa Acyl-ACP thioesterase%2C putative
1952 RMVK01000004.1 GCA003942875_00981 CDS open 19959-20732 _na     257_aa nagD Acid sugar phosphatase
1953 RMVK01000004.1 GCA003942875_00982 CDS open 20722-21342 _na     206_aa TIGR01906 family membrane protein
1954 RMVK01000004.1 GCA003942875_00983 CDS open 21560-21961 _na     133_aa spx Global transcriptional regulator Spx
1955 RMVK01000004.1 GCA003942875_00984 CDS open 21962-22240 _na     92_aa yktA UPF0223 protein SPH_1535
1956 RMVK01000004.1 GCA003942875_00985 CDS open 22230-23003 _na     257_aa Inositol monophosphatase family protein
1957 RMVK01000004.1 GCA003942875_00986 CDS open 23004-24308 _na     434_aa ncl1 SAM-dependent MTase RsmB/NOP-type domain-containing protein
1958 RMVK01000004.1 GCA003942875_00987 CDS open 24519-25397 _na     292_aa Phosphate-binding protein
1959 RMVK01000004.1 GCA003942875_00988 CDS open 25397-26314 _na     305_aa pstC phosphate ABC transporter permease subunit PstC
1960 RMVK01000004.1 GCA003942875_00989 CDS open 26304-27188 _na     294_aa pstA phosphate ABC transporter permease PstA
1961 RMVK01000004.1 GCA003942875_00990 CDS open 27199-28002 _na     267_aa pstB phosphate ABC transporter ATP-binding protein PstB
1962 RMVK01000004.1 GCA003942875_00991 CDS open 28015-28773 _na     252_aa pstB phosphate ABC transporter ATP-binding protein PstB
1963 RMVK01000004.1 GCA003942875_00992 CDS open 28785-29438 _na     217_aa phoU phosphate signaling complex protein PhoU
1964 RMVK01000004.1 GCA003942875_00993 CDS open 29529-29996 _na     155_aa Diadenosine hexaphosphate hydrolase
1965 RMVK01000004.1 GCA003942875_00994 CDS open 30116-30931 _na     271_aa Solute-binding protein family 3/N-terminal domain-containing protein
1966 RMVK01000004.1 GCA003942875_00995 CDS open 30951-32222 _na     423_aa gntR Transcriptional regulator%2C GntR family
1967 RMVK01000004.1 GCA003942875_00996 CDS open 32367-33098 _na     243_aa budA acetolactate decarboxylase
1968 RMVK01000004.1 GCA003942875_00997 CDS open 33108-33860 _na     250_aa Membrane peptidase
1969 RMVK01000004.1 GCA003942875_00998 CDS open 33972-34877 _na     301_aa murB UDP-N-acetylmuramate dehydrogenase
1970 RMVK01000004.1 GCA003942875_00999 CDS open 35017-36174 _na     385_aa potA Spermidine/putrescine import ATP-binding protein PotA
1971 RMVK01000004.1 GCA003942875_01000 CDS open 36155-36961 _na     268_aa potB Spermidine/putrescine ABC transporter permease
1972 RMVK01000004.1 GCA003942875_01001 CDS open 36958-37731 _na     257_aa potC ABC transmembrane type-1 domain-containing protein
1973 RMVK01000004.1 GCA003942875_01002 CDS open 37728-38798 _na     356_aa potD Putrescine-binding periplasmic protein
1974 RMVK01000004.1 GCA003942875_01003 CDS open 38930-39319 _na     129_aa CRISPR-associated endonuclease Cas1
1975 RMVK01000004.1 GCA003942875_01004 CDS open 39322-39651 _na     109_aa cas2 CRISPR-associated endonuclease Cas2
1976 RMVK01000004.1 GCA003942875_01005 CDS open 41750-41914 _na     54_aa hypothetical protein
1977 RMVK01000004.1 GCA003942875_01006 CDS open 43255-43986 _na     243_aa cas6 CRISPR-associated endoribonuclease Cas6
1978 RMVK01000004.1 GCA003942875_01007 CDS open 43967-46210 _na     747_aa cas10 type III-A CRISPR-associated protein Cas10/Csm1
1979 RMVK01000004.1 GCA003942875_01008 CDS open 46211-46591 _na     126_aa CRISPR system Cms protein Csm2
1980 RMVK01000004.1 GCA003942875_01009 CDS open 46591-47253 _na     220_aa csm3 type III-A CRISPR-associated RAMP protein Csm3
1981 RMVK01000004.1 GCA003942875_01010 CDS open 47255-48160 _na     301_aa csm4 type III-A CRISPR-associated RAMP protein Csm4
1982 RMVK01000004.1 GCA003942875_01011 CDS open 48157-49236 _na     359_aa csm5 type III-A CRISPR-associated RAMP protein Csm5
1983 RMVK01000004.1 GCA003942875_01012 CDS open 49233-50393 _na     386_aa csm6 type III-A CRISPR-associated CARF protein Csm6
1984 RMVK01000004.1 GCA003942875_01013 CDS open 50410-51699 _na     429_aa csm6 type III-A CRISPR-associated CARF protein Csm6
1985 RMVK01000004.1 GCA003942875_01014 CDS open 51998-52483 _na     161_aa UDP-N-acetylenolpyruvoylglucosamine reductase
1986 RMVK01000004.1 GCA003942875_01015 CDS open 52505-55123 _na     872_aa alaS alanine--tRNA ligase
1987 RMVK01000004.1 GCA003942875_01016 CDS open 55211-56659 _na     482_aa amyA alpha-amylase
1988 RMVK01000004.1 GCA003942875_01017 CDS open 56932-58095 _na     387_aa 23S rRNA methyltransferase
1989 RMVK01000004.1 GCA003942875_01018 CDS open 58092-58769 _na     225_aa aroD 3-dehydroquinate dehydratase
1990 RMVK01000004.1 GCA003942875_01019 CDS open 58759-59613 _na     284_aa aroE shikimate dehydrogenase
1991 RMVK01000004.1 GCA003942875_01020 CDS open 59632-60699 _na     355_aa aroB 3-dehydroquinate synthase
1992 RMVK01000004.1 GCA003942875_01021 CDS open 60709-61875 _na     388_aa aroC chorismate synthase
1993 RMVK01000004.1 GCA003942875_01022 CDS open 61885-62988 _na     367_aa tyrA prephenate dehydrogenase
1994 RMVK01000004.1 GCA003942875_01023 CDS open 62999-63337 _na     112_aa YlbF/YmcA family competence regulator
1995 RMVK01000004.1 GCA003942875_01024 CDS open 63427-64710 _na     427_aa aroA 3-phosphoshikimate 1-carboxyvinyltransferase
1996 RMVK01000004.1 GCA003942875_01025 CDS open 64703-65179 _na     158_aa aroK Shikimate kinase
1997 RMVK01000004.1 GCA003942875_01026 CDS open 65176-66024 _na     282_aa pheA prephenate dehydratase
1998 RMVK01000004.1 GCA003942875_01027 CDS open 66021-67316 _na     431_aa msrR Regulatory protein MsrR
1999 RMVK01000004.1 GCA003942875_01028 CDS open 67464-68300 _na     278_aa licD LicD/FKTN/FKRP nucleotidyltransferase domain-containing protein
2000 RMVK01000004.1 GCA003942875_01029 CDS open 68297-69265 _na     322_aa Galactosyl transferase