HOMD Banner
Taxonomy: V4.3   |  16S rRNA RefSeq: V16.03   |  Genomic RefSeq: V11.03   |  Viruses: V1.2

BAKTAGenome Explorer: Streptococcus intermedius (GCA_003943155.1)

Select a Genome:
BAKTA Annotations for GCA_003943155.1
Genome Selected: Streptococcus intermedius
ContigsBases CDSrRNA tmRNAtRNA
33 1,993,716 1925 4 1 55
[Table]   [AA Fasta]      [Browser]   [Text]   [Excel]  
Search & Sort all 4019 Records
Search These Records: Clear
Sort Column:   Molecule   PID   NA   AA   Gene  Gene Product  Reverse
Annotation Table [page:7]    |    Number of Records Found: 4019 [9 Pages]    |    Previous Page <==> Next Page    |    Jump to Page: [ 1  2  3  4  5  6  7  8  9  ]
Notes:   1- Column headers only sort the current page. 2- Select [NA] or [AA] links to show sequences.
Region Protein-ID Type Genome
Viewer		 Range
(bp)		 Show Sequences
(length) NA / AA		 BAKTA
Gene		 BAKTA
GeneProduct
3001 RJOR01000007.1 GCA003943155_01509 CDS open 22588-23058 _na     156_aa DUF3013 domain-containing protein
3002 RJOR01000007.1 GCA003943155_01510 CDS open 23062-23424 _na     120_aa Glyoxalase
3003 RJOR01000007.1 GCA003943155_01511 CDS open 23450-23908 _na     152_aa mutT DNA mismatch repair protein MutT
3004 RJOR01000007.1 GCA003943155_01512 CDS open 23905-24375 _na     156_aa Putative acetyltransferase
3005 RJOR01000007.1 GCA003943155_01513 CDS open 24519-25472 _na     317_aa prmA 50S ribosomal protein L11 methyltransferase
3006 RJOR01000007.1 GCA003943155_01514 CDS open 25473-26216 _na     247_aa 16S rRNA (uracil(1498)-N(3))-methyltransferase
3007 RJOR01000007.1 GCA003943155_01515 CDS open 26835-29051 _na     738_aa GTP diphosphokinase
3008 RJOR01000007.1 GCA003943155_01516 CDS open 29131-29574 _na     147_aa dtd D-aminoacyl-tRNA deacylase
3009 RJOR01000007.1 GCA003943155_01517 CDS open 29638-30288 _na     216_aa Manganese transport regulator
3010 RJOR01000007.1 GCA003943155_01518 CDS open 30443-31372 _na     309_aa Manganese ABC transporter substrate-binding lipoprotein
3011 RJOR01000007.1 GCA003943155_01519 CDS open 31401-32255 _na     284_aa Manganese ABC transporter permease
3012 RJOR01000007.1 GCA003943155_01520 CDS open 32257-32976 _na     239_aa ABC transporter ATP-binding protein
3013 RJOR01000007.1 GCA003943155_01521 CDS open 33152-35047 _na     631_aa Putative endopeptidase O
3014 RJOR01000007.1 GCA003943155_01522 CDS open 35188-37689 _na     833_aa leuS leucine--tRNA ligase
3015 RJOR01000007.1 GCA003943155_01523 CDS open 38465-42172 _na     1235_aa pullulanase
3016 RJOR01000007.1 GCA003943155_01524 CDS open 42361-43215 _na     284_aa 5'-nucleotidase%2C lipoprotein e(P4) family
3017 RJOR01000007.1 GCA003943155_01525 CDS open 43500-47894 _na     1464_aa PolC-type DNA polymerase III
3018 RJOR01000007.1 GCA003943155_01526 CDS open 48088-49329 _na     413_aa Aminopeptidase PepS%2C putative
3019 RJOR01000007.1 GCA003943155_01527 CDS open 49412-49642 _na     76_aa Transglycosylase associated protein
3020 RJOR01000007.1 GCA003943155_01528 CDS open 49704-50318 _na     204_aa def peptide deformylase
3021 RJOR01000007.1 GCA003943155_01529 CDS open 50614-52395 _na     593_aa GDP-L-fucose synthase
3022 RJOR01000007.1 GCA003943155_01530 CDS open 52465-53298 _na     277_aa Putative membrane protein
3023 RJOR01000007.1 GCA003943155_01531 CDS open 53311-55143 _na     610_aa DUF2194 domain-containing protein
3024 RJOR01000007.1 GCA003943155_01532 CDS open 55159-56565 _na     468_aa pelF GT4 family glycosyltransferase PelF
3025 RJOR01000007.1 GCA003943155_01533 CDS open 56565-58010 _na     481_aa Transmembrane protein
3026 RJOR01000007.1 GCA003943155_01534 CDS open 58003-59775 _na     590_aa Fibronectin type-III domain-containing protein
3027 RJOR01000007.1 GCA003943155_01535 CDS open 59762-60496 _na     244_aa VTC domain-containing protein
3028 RJOR01000007.1 GCA003943155_01536 CDS open 60515-61186 _na     223_aa DUF4956 domain-containing protein
3029 RJOR01000007.1 GCA003943155_01537 CDS open 61167-62573 _na     468_aa DUF4832 domain-containing protein
3030 RJOR01000007.1 GCA003943155_01538 CDS open 62703-63875 _na     390_aa Major facilitator superfamily (MFS) profile domain-containing protein
3031 RJOR01000007.1 GCA003943155_01539 CDS open 63862-64593 _na     243_aa Pseudouridine synthase
3032 RJOR01000007.1 GCA003943155_01540 CDS open 64723-64992 _na     89_aa rpsO 30S ribosomal protein S15
3033 RJOR01000007.1 GCA003943155_01541 CDS open 66117-66872 _na     251_aa Lipoprotein
3034 RJOR01000007.1 GCA003943155_01542 CDS open 67039-68838 _na     599_aa pepF oligoendopeptidase F
3035 RJOR01000007.1 GCA003943155_01543 CDS open 69237-71417 _na     726_aa pnp polyribonucleotide nucleotidyltransferase
3036 RJOR01000007.1 GCA003943155_01544 CDS open 71467-72051 _na     194_aa cysE serine O-acetyltransferase
3037 RJOR01000007.1 GCA003943155_01545 CDS open 72095-72862 _na     255_aa Uridine phosphorylase
3038 RJOR01000007.1 GCA003943155_01546 CDS open 73017-74288 _na     423_aa cysS cysteine--tRNA ligase
3039 RJOR01000007.1 GCA003943155_01547 CDS open 74281-74685 _na     134_aa Mini-ribonuclease 3
3040 RJOR01000007.1 GCA003943155_01548 CDS open 74672-75544 _na     290_aa pucR PucR C-terminal helix-turn-helix domain-containing protein
3041 RJOR01000007.1 GCA003943155_01549 CDS open 75655-76785 _na     376_aa malK ABC transporter family protein
3042 RJOR01000007.1 GCA003943155_01550 CDS open 76942-77670 _na     242_aa rlmB 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB
3043 RJOR01000007.1 GCA003943155_01551 CDS open 78105-78974 _na     289_aa degV DegV family protein
3044 RJOR01000007.1 GCA003943155_01552 CDS open 79156-79602 _na     148_aa rplM 50S ribosomal protein L13
3045 RJOR01000007.1 GCA003943155_01553 CDS open 79622-80014 _na     130_aa rpsI 30S ribosomal protein S9
3046 RJOR01000007.1 GCA003943155_01554 CDS open 80124-80999 _na     291_aa Putative integrase/recombinase
3047 RJOR01000007.1 GCA003943155_01555 CDS open 80945-81331 _na     128_aa hypothetical protein
3048 RJOR01000007.1 GCA003943155_01556 CDS open 81403-81663 _na     86_aa alpA Helix-turn-helix domain-containing protein
3049 RJOR01000007.1 GCA003943155_01557 CDS open 81722-82750 _na     342_aa nicK Replication initiation factor domain-containing protein
3050 RJOR01000007.1 GCA003943155_01558 CDS open 82753-83175 _na     140_aa Phage protein
3051 RJOR01000007.1 GCA003943155_01559 CDS open 83456-83899 _na     147_aa Transposase
3052 RJOR01000007.1 GCA003943155_01560 CDS open 84059-84823 _na     254_aa Cro/CI family transcriptional regulator
3053 RJOR01000007.1 GCA003943155_01561 CDS open 84983-85510 _na     175_aa sdpI SdpI family protein
3054 RJOR01000007.1 GCA003943155_01562 CDS open 85618-85815 _na     65_aa ABC transporter ATP-binding protein
3055 RJOR01000007.1 GCA003943155_01563 CDS open 86017-86628 _na     203_aa protein adenylyltransferase
3056 RJOR01000007.1 GCA003943155_01564 CDS open 86621-86809 _na     62_aa Phage protein
3057 RJOR01000007.1 GCA003943155_01565 CDS open 86947-87447 _na     166_aa Phage protein
3058 RJOR01000007.1 GCA003943155_01566 CDS open 87806-88387 _na     193_aa Mutator family transposase
3059 RJOR01000007.1 GCA003943155_01567 CDS open 88568-88846 _na     92_aa Gram-positive signal peptide protein%2C YSIRK family
3060 RJOR01000007.1 GCA003943155_01568 CDS open 88848-90911 _na     687_aa zntA Cd(2+)-exporting ATPase
3061 RJOR01000007.1 GCA003943155_01482 gene open 62-412
3062 RJOR01000007.1 GCA003943155_01483 gene open 549-1613 pepA
3063 RJOR01000007.1 GCA003943155_01484 gene open 1733-2020
3064 RJOR01000007.1 GCA003943155_01485 gene open 2017-2334 ytpP
3065 RJOR01000007.1 GCA003943155_01486 gene open 2351-2977 ytpR
3066 RJOR01000007.1 GCA003943155_01487 gene open 3049-3444
3067 RJOR01000007.1 GCA003943155_01488 gene open 3661-4647
3068 RJOR01000007.1 GCA003943155_01489 gene open 4647-5960
3069 RJOR01000007.1 GCA003943155_01490 gene open 5953-6636
3070 RJOR01000007.1 GCA003943155_01491 gene open 6633-7919
3071 RJOR01000007.1 GCA003943155_01492 gene open 8167-8604
3072 RJOR01000007.1 GCA003943155_01493 gene open 8629-9123
3073 RJOR01000007.1 GCA003943155_01494 gene open 9156-10004
3074 RJOR01000007.1 GCA003943155_01495 gene open 10006-10836
3075 RJOR01000007.1 GCA003943155_01496 gene open 10851-11141
3076 RJOR01000007.1 GCA003943155_01497 gene open 11286-11567 groES
3077 RJOR01000007.1 GCA003943155_01498 gene open 11600-13222 groL
3078 RJOR01000007.1 GCA003943155_01499 gene open 13602-14369 queH
3079 RJOR01000007.1 GCA003943155_01500 gene open 15461-15841
3080 RJOR01000007.1 GCA003943155_01501 gene open 16043-16345
3081 RJOR01000007.1 GCA003943155_01502 gene open 16395-17771
3082 RJOR01000007.1 GCA003943155_01503 gene open 18036-18455
3083 RJOR01000007.1 GCA003943155_01504 gene open 18460-19470
3084 RJOR01000007.1 GCA003943155_01505 gene open 19490-19672
3085 RJOR01000007.1 GCA003943155_01506 gene open 19674-20801
3086 RJOR01000007.1 GCA003943155_01508 gene open 21229-22500
3087 RJOR01000007.1 GCA003943155_01509 gene open 22588-23058
3088 RJOR01000007.1 GCA003943155_01510 gene open 23062-23424
3089 RJOR01000007.1 GCA003943155_01511 gene open 23450-23908 mutT
3090 RJOR01000007.1 GCA003943155_01512 gene open 23905-24375
3091 RJOR01000007.1 GCA003943155_01513 gene open 24519-25472 prmA
3092 RJOR01000007.1 GCA003943155_01514 gene open 25473-26216
3093 RJOR01000007.1 GCA003943155_01515 gene open 26835-29051
3094 RJOR01000007.1 GCA003943155_01516 gene open 29131-29574 dtd
3095 RJOR01000007.1 GCA003943155_01517 gene open 29638-30288
3096 RJOR01000007.1 GCA003943155_01518 gene open 30443-31372
3097 RJOR01000007.1 GCA003943155_01519 gene open 31401-32255
3098 RJOR01000007.1 GCA003943155_01520 gene open 32257-32976
3099 RJOR01000007.1 GCA003943155_01521 gene open 33152-35047
3100 RJOR01000007.1 GCA003943155_01522 gene open 35188-37689 leuS
3101 RJOR01000007.1 GCA003943155_01523 gene open 38465-42172
3102 RJOR01000007.1 GCA003943155_01524 gene open 42361-43215
3103 RJOR01000007.1 GCA003943155_01525 gene open 43500-47894
3104 RJOR01000007.1 GCA003943155_01526 gene open 48088-49329
3105 RJOR01000007.1 GCA003943155_01527 gene open 49412-49642
3106 RJOR01000007.1 GCA003943155_01528 gene open 49704-50318 def
3107 RJOR01000007.1 GCA003943155_01529 gene open 50614-52395
3108 RJOR01000007.1 GCA003943155_01530 gene open 52465-53298
3109 RJOR01000007.1 GCA003943155_01531 gene open 53311-55143
3110 RJOR01000007.1 GCA003943155_01532 gene open 55159-56565 pelF
3111 RJOR01000007.1 GCA003943155_01533 gene open 56565-58010
3112 RJOR01000007.1 GCA003943155_01534 gene open 58003-59775
3113 RJOR01000007.1 GCA003943155_01535 gene open 59762-60496
3114 RJOR01000007.1 GCA003943155_01536 gene open 60515-61186
3115 RJOR01000007.1 GCA003943155_01537 gene open 61167-62573
3116 RJOR01000007.1 GCA003943155_01538 gene open 62703-63875
3117 RJOR01000007.1 GCA003943155_01539 gene open 63862-64593
3118 RJOR01000007.1 GCA003943155_01540 gene open 64723-64992 rpsO
3119 RJOR01000007.1 GCA003943155_01541 gene open 66117-66872
3120 RJOR01000007.1 GCA003943155_01542 gene open 67039-68838 pepF
3121 RJOR01000007.1 GCA003943155_01543 gene open 69237-71417 pnp
3122 RJOR01000007.1 GCA003943155_01544 gene open 71467-72051 cysE
3123 RJOR01000007.1 GCA003943155_01545 gene open 72095-72862
3124 RJOR01000007.1 GCA003943155_01546 gene open 73017-74288 cysS
3125 RJOR01000007.1 GCA003943155_01547 gene open 74281-74685
3126 RJOR01000007.1 GCA003943155_01548 gene open 74672-75544 pucR
3127 RJOR01000007.1 GCA003943155_01549 gene open 75655-76785 malK
3128 RJOR01000007.1 GCA003943155_01550 gene open 76942-77670 rlmB
3129 RJOR01000007.1 GCA003943155_01551 gene open 78105-78974 degV
3130 RJOR01000007.1 GCA003943155_01552 gene open 79156-79602 rplM
3131 RJOR01000007.1 GCA003943155_01553 gene open 79622-80014 rpsI
3132 RJOR01000007.1 GCA003943155_01554 gene open 80124-80999
3133 RJOR01000007.1 GCA003943155_01555 gene open 80945-81331
3134 RJOR01000007.1 GCA003943155_01556 gene open 81403-81663 alpA
3135 RJOR01000007.1 GCA003943155_01557 gene open 81722-82750 nicK
3136 RJOR01000007.1 GCA003943155_01558 gene open 82753-83175
3137 RJOR01000007.1 GCA003943155_01559 gene open 83456-83899
3138 RJOR01000007.1 GCA003943155_01560 gene open 84059-84823
3139 RJOR01000007.1 GCA003943155_01561 gene open 84983-85510 sdpI
3140 RJOR01000007.1 GCA003943155_01562 gene open 85618-85815
3141 RJOR01000007.1 GCA003943155_01563 gene open 86017-86628
3142 RJOR01000007.1 GCA003943155_01564 gene open 86621-86809
3143 RJOR01000007.1 GCA003943155_01565 gene open 86947-87447
3144 RJOR01000007.1 GCA003943155_01566 gene open 87806-88387
3145 RJOR01000007.1 GCA003943155_01567 gene open 88568-88846
3146 RJOR01000007.1 GCA003943155_01568 gene open 88848-90911 zntA
3147 RJOR01000007.1 GCA003943155_01507 gene open 20884-20956 trnK
3148 RJOR01000007.1 GCA003943155_01507 tRNA open 20884-20956 trnK tRNA-Lys(ctt)
3149 RJOR01000008.1 GCA003943155_01586 gene open 6636-6727 csRNA
3150 RJOR01000008.1 GCA003943155_01586 ncRNA open 6636-6727 Cia-dependent small RNA csRNA1
3151 RJOR01000008.1 regulatory_region open 23469-23526 Lacto-rpoB RNA
3152 RJOR01000008.1 regulatory_region open 77492-77581 THF (Tetrahydrofolate) riboswitch aptamer
3153 RJOR01000008.1 GCA003943155_01581 CDS open 1892-2197 _na     101_aa yybR HTH-type transcriptional regulator YybR
3154 RJOR01000008.1 GCA003943155_01582 CDS open 2238-2645 _na     135_aa Pyridoxamine 5'-phosphate oxidase family protein
3155 RJOR01000008.1 GCA003943155_01583 CDS open 3456-3698 _na     80_aa hypothetical protein
3156 RJOR01000008.1 GCA003943155_01584 CDS open 3795-4694 _na     299_aa galU UTP--glucose-1-phosphate uridylyltransferase GalU
3157 RJOR01000008.1 GCA003943155_01585 CDS open 4722-5738 _na     338_aa NAD(P)H-dependent glycerol-3-phosphate dehydrogenase
3158 RJOR01000008.1 GCA003943155_01587 CDS open 6802-7836 _na     344_aa Murein peptide carboxypeptidase
3159 RJOR01000008.1 GCA003943155_01588 CDS open 7930-8373 _na     147_aa dut dUTP diphosphatase
3160 RJOR01000008.1 GCA003943155_01589 CDS open 8383-8853 _na     156_aa pncA Isochorismatase-like domain-containing protein
3161 RJOR01000008.1 GCA003943155_01590 CDS open 8811-10226 _na     471_aa radA DNA repair protein RadA
3162 RJOR01000008.1 GCA003943155_01591 CDS open 10435-11892 _na     485_aa gltX glutamate--tRNA ligase
3163 RJOR01000008.1 GCA003943155_01592 CDS open 12010-12708 _na     232_aa dapD 2%2C3%2C4%2C5-tetrahydropyridine-2%2C6-dicarboxylate N-acetyltransferase
3164 RJOR01000008.1 GCA003943155_01593 CDS open 12721-13851 _na     376_aa N-acetyldiaminopimelate deacetylase
3165 RJOR01000008.1 GCA003943155_01594 CDS open 13897-14424 _na     175_aa 5-formyltetrahydrofolate cyclo-ligase
3166 RJOR01000008.1 GCA003943155_01595 CDS open 14417-15097 _na     226_aa Edopeptidase
3167 RJOR01000008.1 GCA003943155_01596 CDS open 15155-15991 _na     278_aa 23S rRNA (Guanine(745)-N(1))-methyltransferase
3168 RJOR01000008.1 GCA003943155_01597 CDS open 16235-17491 _na     418_aa tyrS tyrosine--tRNA ligase
3169 RJOR01000008.1 GCA003943155_01598 CDS open 17673-20012 _na     779_aa pbp1b penicillin-binding protein PBP1B
3170 RJOR01000008.1 GCA003943155_01599 CDS open 20299-20580 _na     93_aa Lactococcin 972 family bacteriocin
3171 RJOR01000008.1 GCA003943155_01600 CDS open 20688-22661 _na     657_aa Bacteriocin-associated integral membrane protein
3172 RJOR01000008.1 GCA003943155_01601 CDS open 22663-23280 _na     205_aa yxdL ABC transporter ATP-binding protein YxdL
3173 RJOR01000008.1 GCA003943155_01602 CDS open 23687-27253 _na     1188_aa rpoB DNA-directed RNA polymerase subunit beta
3174 RJOR01000008.1 GCA003943155_01603 CDS open 27292-30930 _na     1212_aa rpoC DNA-directed RNA polymerase subunit beta'
3175 RJOR01000008.1 GCA003943155_01604 CDS open 31062-32258 _na     398_aa pgk Phosphoglycerate kinase
3176 RJOR01000008.1 GCA003943155_01605 CDS open 32807-36739 _na     1310_aa pas antigen I/II family LPXTG-anchored adhesin
3177 RJOR01000008.1 GCA003943155_01606 CDS open 37147-37827 _na     226_aa N-acetylmuramoyl-L-alanine amidase
3178 RJOR01000008.1 GCA003943155_01607 CDS open 38002-38532 _na     176_aa Aromatic acid exporter family protein
3179 RJOR01000008.1 GCA003943155_01608 CDS open 38609-38968 _na     119_aa merR MerR family transcriptional regulator
3180 RJOR01000008.1 GCA003943155_01609 CDS open 39007-40353 _na     448_aa glnA type I glutamate--ammonia ligase
3181 RJOR01000008.1 GCA003943155_01610 CDS open 40575-40940 _na     121_aa DNA binding protein
3182 RJOR01000008.1 GCA003943155_01611 CDS open 41009-41950 _na     313_aa comGA competence type IV pilus ATPase ComGA
3183 RJOR01000008.1 GCA003943155_01612 CDS open 41913-42914 _na     333_aa comGB competence type IV pilus assembly protein ComGB
3184 RJOR01000008.1 GCA003943155_01613 CDS open 42911-43228 _na     105_aa comGC competence type IV pilus major pilin ComGC
3185 RJOR01000008.1 GCA003943155_01614 CDS open 43188-43616 _na     142_aa comGD competence type IV pilus minor pilin ComGD
3186 RJOR01000008.1 GCA003943155_01615 CDS open 43588-43881 _na     97_aa comGE competence type IV pilus minor pilin ComGE
3187 RJOR01000008.1 GCA003943155_01616 CDS open 43865-44302 _na     145_aa comGF competence type IV pilus minor pilin ComGF
3188 RJOR01000008.1 GCA003943155_01617 CDS open 44313-44609 _na     98_aa comGG competence type IV pilus minor pilin ComGG
3189 RJOR01000008.1 GCA003943155_01618 CDS open 44700-45653 _na     317_aa Adenine-specific DNA methylase
3190 RJOR01000008.1 GCA003943155_01619 CDS open 45700-46899 _na     399_aa Acetate kinase
3191 RJOR01000008.1 GCA003943155_01620 CDS open 47281-49095 _na     604_aa glmS glutamine--fructose-6-phosphate transaminase (isomerizing)
3192 RJOR01000008.1 GCA003943155_01621 CDS open 49291-49677 _na     128_aa DUF1310 domain-containing protein
3193 RJOR01000008.1 GCA003943155_01622 CDS open 49679-49861 _na     60_aa PRC-barrel domain-containing protein
3194 RJOR01000008.1 GCA003943155_01623 CDS open 49916-50302 _na     128_aa DUF1310 domain-containing protein
3195 RJOR01000008.1 GCA003943155_01624 CDS open 50305-50487 _na     60_aa PRC-barrel domain-containing protein
3196 RJOR01000008.1 GCA003943155_01625 CDS open 50530-50916 _na     128_aa DUF1310 domain-containing protein
3197 RJOR01000008.1 GCA003943155_01626 CDS open 50928-52190 _na     420_aa DUF2974 domain-containing protein
3198 RJOR01000008.1 GCA003943155_01627 CDS open 52172-52582 _na     136_aa fliJ Flagellar FliJ protein
3199 RJOR01000008.1 GCA003943155_01628 CDS open 52582-52887 _na     101_aa Phage protein
3200 RJOR01000008.1 GCA003943155_01629 CDS open 53264-55393 _na     709_aa Putative ATP-dependent Clp protease ATP-binding subunit
3201 RJOR01000008.1 GCA003943155_01630 CDS open 55562-57022 _na     486_aa PTS ascorbate transporter subunit IIC
3202 RJOR01000008.1 GCA003943155_01631 CDS open 57053-57334 _na     93_aa Ascorbate-specific PTS system%2C EIIB component
3203 RJOR01000008.1 GCA003943155_01632 CDS open 57536-58021 _na     161_aa Ascorbate-specific PTS system EIIA component
3204 RJOR01000008.1 GCA003943155_01633 CDS open 58067-58732 _na     221_aa ulaD 3-keto-L-gulonate-6-phosphate decarboxylase
3205 RJOR01000008.1 GCA003943155_01634 CDS open 58738-59601 _na     287_aa sgaU L-ribulose-5-phosphate 3-epimerase
3206 RJOR01000008.1 GCA003943155_01635 CDS open 59604-60311 _na     235_aa araD L-ribulose-5-phosphate 4-epimerase
3207 RJOR01000008.1 GCA003943155_01636 CDS open 60515-62185 _na     556_aa Phosphotransferase
3208 RJOR01000008.1 GCA003943155_01637 CDS open 62347-63438 _na     363_aa ulaG L-ascorbate 6-phosphate lactonase
3209 RJOR01000008.1 GCA003943155_01638 CDS open 63579-65555 _na     658_aa tkt transketolase
3210 RJOR01000008.1 GCA003943155_01639 CDS open 66233-66571 _na     112_aa yajC preprotein translocase subunit YajC
3211 RJOR01000008.1 GCA003943155_01640 CDS open 67035-67784 _na     249_aa isoprenyl transferase
3212 RJOR01000008.1 GCA003943155_01641 CDS open 67793-68596 _na     267_aa Phosphatidate cytidylyltransferase
3213 RJOR01000008.1 GCA003943155_01642 CDS open 68748-70019 _na     423_aa rseP RIP metalloprotease RseP
3214 RJOR01000008.1 GCA003943155_01643 CDS open 70053-71912 _na     619_aa proline--tRNA ligase
3215 RJOR01000008.1 GCA003943155_01644 CDS open 72093-72488 _na     131_aa DUF1310 domain-containing protein
3216 RJOR01000008.1 GCA003943155_01645 CDS open 72511-72705 _na     64_aa hypothetical protein
3217 RJOR01000008.1 GCA003943155_01646 CDS open 72730-73119 _na     129_aa DUF1310 domain-containing protein
3218 RJOR01000008.1 GCA003943155_01647 CDS open 73112-74431 _na     439_aa DUF2974 domain-containing protein
3219 RJOR01000008.1 GCA003943155_01648 CDS open 74413-74805 _na     130_aa fliJ Flagellar FliJ protein
3220 RJOR01000008.1 GCA003943155_01649 CDS open 74822-75118 _na     98_aa hypothetical protein
3221 RJOR01000008.1 GCA003943155_01650 CDS open 75395-76075 _na     226_aa CAAX amino terminal protease family protein
3222 RJOR01000008.1 GCA003943155_01651 CDS open 76108-77433 _na     441_aa tetrahydrofolate synthase
3223 RJOR01000008.1 GCA003943155_01652 CDS open 77615-78172 _na     185_aa Folate family ECF transporter S component
3224 RJOR01000008.1 GCA003943155_01581 gene open 1892-2197 yybR
3225 RJOR01000008.1 GCA003943155_01582 gene open 2238-2645
3226 RJOR01000008.1 GCA003943155_01583 gene open 3456-3698
3227 RJOR01000008.1 GCA003943155_01584 gene open 3795-4694 galU
3228 RJOR01000008.1 GCA003943155_01585 gene open 4722-5738
3229 RJOR01000008.1 GCA003943155_01587 gene open 6802-7836
3230 RJOR01000008.1 GCA003943155_01588 gene open 7930-8373 dut
3231 RJOR01000008.1 GCA003943155_01589 gene open 8383-8853 pncA
3232 RJOR01000008.1 GCA003943155_01590 gene open 8811-10226 radA
3233 RJOR01000008.1 GCA003943155_01591 gene open 10435-11892 gltX
3234 RJOR01000008.1 GCA003943155_01592 gene open 12010-12708 dapD
3235 RJOR01000008.1 GCA003943155_01593 gene open 12721-13851
3236 RJOR01000008.1 GCA003943155_01594 gene open 13897-14424
3237 RJOR01000008.1 GCA003943155_01595 gene open 14417-15097
3238 RJOR01000008.1 GCA003943155_01596 gene open 15155-15991
3239 RJOR01000008.1 GCA003943155_01597 gene open 16235-17491 tyrS
3240 RJOR01000008.1 GCA003943155_01598 gene open 17673-20012 pbp1b
3241 RJOR01000008.1 GCA003943155_01599 gene open 20299-20580
3242 RJOR01000008.1 GCA003943155_01600 gene open 20688-22661
3243 RJOR01000008.1 GCA003943155_01601 gene open 22663-23280 yxdL
3244 RJOR01000008.1 GCA003943155_01602 gene open 23687-27253 rpoB
3245 RJOR01000008.1 GCA003943155_01603 gene open 27292-30930 rpoC
3246 RJOR01000008.1 GCA003943155_01604 gene open 31062-32258 pgk
3247 RJOR01000008.1 GCA003943155_01605 gene open 32807-36739 pas
3248 RJOR01000008.1 GCA003943155_01606 gene open 37147-37827
3249 RJOR01000008.1 GCA003943155_01607 gene open 38002-38532
3250 RJOR01000008.1 GCA003943155_01608 gene open 38609-38968 merR
3251 RJOR01000008.1 GCA003943155_01609 gene open 39007-40353 glnA
3252 RJOR01000008.1 GCA003943155_01610 gene open 40575-40940
3253 RJOR01000008.1 GCA003943155_01611 gene open 41009-41950 comGA
3254 RJOR01000008.1 GCA003943155_01612 gene open 41913-42914 comGB
3255 RJOR01000008.1 GCA003943155_01613 gene open 42911-43228 comGC
3256 RJOR01000008.1 GCA003943155_01614 gene open 43188-43616 comGD
3257 RJOR01000008.1 GCA003943155_01615 gene open 43588-43881 comGE
3258 RJOR01000008.1 GCA003943155_01616 gene open 43865-44302 comGF
3259 RJOR01000008.1 GCA003943155_01617 gene open 44313-44609 comGG
3260 RJOR01000008.1 GCA003943155_01618 gene open 44700-45653
3261 RJOR01000008.1 GCA003943155_01619 gene open 45700-46899
3262 RJOR01000008.1 GCA003943155_01620 gene open 47281-49095 glmS
3263 RJOR01000008.1 GCA003943155_01621 gene open 49291-49677
3264 RJOR01000008.1 GCA003943155_01622 gene open 49679-49861
3265 RJOR01000008.1 GCA003943155_01623 gene open 49916-50302
3266 RJOR01000008.1 GCA003943155_01624 gene open 50305-50487
3267 RJOR01000008.1 GCA003943155_01625 gene open 50530-50916
3268 RJOR01000008.1 GCA003943155_01626 gene open 50928-52190
3269 RJOR01000008.1 GCA003943155_01627 gene open 52172-52582 fliJ
3270 RJOR01000008.1 GCA003943155_01628 gene open 52582-52887
3271 RJOR01000008.1 GCA003943155_01629 gene open 53264-55393
3272 RJOR01000008.1 GCA003943155_01630 gene open 55562-57022
3273 RJOR01000008.1 GCA003943155_01631 gene open 57053-57334
3274 RJOR01000008.1 GCA003943155_01632 gene open 57536-58021
3275 RJOR01000008.1 GCA003943155_01633 gene open 58067-58732 ulaD
3276 RJOR01000008.1 GCA003943155_01634 gene open 58738-59601 sgaU
3277 RJOR01000008.1 GCA003943155_01635 gene open 59604-60311 araD
3278 RJOR01000008.1 GCA003943155_01636 gene open 60515-62185
3279 RJOR01000008.1 GCA003943155_01637 gene open 62347-63438 ulaG
3280 RJOR01000008.1 GCA003943155_01638 gene open 63579-65555 tkt
3281 RJOR01000008.1 GCA003943155_01639 gene open 66233-66571 yajC
3282 RJOR01000008.1 GCA003943155_01640 gene open 67035-67784
3283 RJOR01000008.1 GCA003943155_01641 gene open 67793-68596
3284 RJOR01000008.1 GCA003943155_01642 gene open 68748-70019 rseP
3285 RJOR01000008.1 GCA003943155_01643 gene open 70053-71912
3286 RJOR01000008.1 GCA003943155_01644 gene open 72093-72488
3287 RJOR01000008.1 GCA003943155_01645 gene open 72511-72705
3288 RJOR01000008.1 GCA003943155_01646 gene open 72730-73119
3289 RJOR01000008.1 GCA003943155_01647 gene open 73112-74431
3290 RJOR01000008.1 GCA003943155_01648 gene open 74413-74805 fliJ
3291 RJOR01000008.1 GCA003943155_01649 gene open 74822-75118
3292 RJOR01000008.1 GCA003943155_01650 gene open 75395-76075
3293 RJOR01000008.1 GCA003943155_01651 gene open 76108-77433
3294 RJOR01000008.1 GCA003943155_01652 gene open 77615-78172
3295 RJOR01000008.1 GCA003943155_01569 gene open 167-239 trnV
3296 RJOR01000008.1 GCA003943155_01570 gene open 248-318 trnG
3297 RJOR01000008.1 GCA003943155_01571 gene open 354-427 trnI
3298 RJOR01000008.1 GCA003943155_01572 gene open 443-514 trnE
3299 RJOR01000008.1 GCA003943155_01573 gene open 523-612 trnS
3300 RJOR01000008.1 GCA003943155_01574 gene open 625-698 trnfM
3301 RJOR01000008.1 GCA003943155_01575 gene open 705-777 trnF
3302 RJOR01000008.1 GCA003943155_01576 gene open 792-872 trnY
3303 RJOR01000008.1 GCA003943155_01577 gene open 879-949 trnW
3304 RJOR01000008.1 GCA003943155_01578 gene open 962-1034 trnH
3305 RJOR01000008.1 GCA003943155_01579 gene open 1054-1125 trnQ
3306 RJOR01000008.1 GCA003943155_01580 gene open 1134-1217 trnL
3307 RJOR01000008.1 GCA003943155_01569 tRNA open 167-239 trnV tRNA-Val(tac)
3308 RJOR01000008.1 GCA003943155_01570 tRNA open 248-318 trnG tRNA-Gly(tcc)
3309 RJOR01000008.1 GCA003943155_01571 tRNA open 354-427 trnI tRNA-Ile(gat)
3310 RJOR01000008.1 GCA003943155_01572 tRNA open 443-514 trnE tRNA-Glu(ttc)
3311 RJOR01000008.1 GCA003943155_01573 tRNA open 523-612 trnS tRNA-Ser(tga)
3312 RJOR01000008.1 GCA003943155_01574 tRNA open 625-698 trnfM tRNA-fMet(cat)
3313 RJOR01000008.1 GCA003943155_01575 tRNA open 705-777 trnF tRNA-Phe(gaa)
3314 RJOR01000008.1 GCA003943155_01576 tRNA open 792-872 trnY tRNA-Tyr(gta)
3315 RJOR01000008.1 GCA003943155_01577 tRNA open 879-949 trnW tRNA-Trp(cca)
3316 RJOR01000008.1 GCA003943155_01578 tRNA open 962-1034 trnH tRNA-His(gtg)
3317 RJOR01000008.1 GCA003943155_01579 tRNA open 1054-1125 trnQ tRNA-Gln(ttg)
3318 RJOR01000008.1 GCA003943155_01580 tRNA open 1134-1217 trnL tRNA-Leu(caa)
3319 RJOR01000009.1 regulatory_region open 33033-33128 23S methyl RNA motif
3320 RJOR01000009.1 regulatory_region open 33732-33958 FMN riboswitch aptamer (RFN element)
3321 RJOR01000009.1 GCA003943155_01653 CDS open 2-250 _na     82_aa Glucose-specific phosphotransferase enzyme IIA component
3322 RJOR01000009.1 GCA003943155_01654 CDS open 268-1083 _na     271_aa Endonuclease/exonuclease/phosphatase domain-containing protein
3323 RJOR01000009.1 GCA003943155_01655 CDS open 1135-1617 _na     160_aa Streptodornase
3324 RJOR01000009.1 GCA003943155_01656 CDS open 1816-2289 _na     157_aa nrdR transcriptional regulator NrdR
3325 RJOR01000009.1 GCA003943155_01657 CDS open 2290-3441 _na     383_aa Replication initiation and membrane attachment protein
3326 RJOR01000009.1 GCA003943155_01658 CDS open 3442-4341 _na     299_aa dnaI primosomal protein DnaI
3327 RJOR01000009.1 GCA003943155_01659 CDS open 4373-5980 _na     535_aa LXG domain-containing protein
3328 RJOR01000009.1 GCA003943155_01660 CDS open 6019-6690 _na     223_aa Membrane protein
3329 RJOR01000009.1 GCA003943155_01661 CDS open 6741-7427 _na     228_aa Membrane protein
3330 RJOR01000009.1 GCA003943155_01662 CDS open 7457-7888 _na     143_aa DUF5085 domain-containing protein
3331 RJOR01000009.1 GCA003943155_01663 CDS open 7890-8336 _na     148_aa DUF5085 domain-containing protein
3332 RJOR01000009.1 GCA003943155_01664 CDS open 8464-9774 _na     436_aa der ribosome biogenesis GTPase Der
3333 RJOR01000009.1 GCA003943155_01665 CDS open 9987-13097 _na     1036_aa SNF2 family protein
3334 RJOR01000009.1 GCA003943155_01666 CDS open 13139-13777 _na     212_aa Cystathionine gamma-synthase
3335 RJOR01000009.1 GCA003943155_01667 CDS open 13860-15191 _na     443_aa murC UDP-N-acetylmuramate--L-alanine ligase
3336 RJOR01000009.1 GCA003943155_01668 CDS open 15181-15705 _na     174_aa N-acetyltransferase domain-containing protein
3337 RJOR01000009.1 GCA003943155_01669 CDS open 15702-16199 _na     165_aa GNAT family acetyltransferase
3338 RJOR01000009.1 GCA003943155_01670 CDS open 16308-17912 _na     534_aa Endolytic murein transglycosylase
3339 RJOR01000009.1 GCA003943155_01671 CDS open 18116-18598 _na     160_aa greA transcription elongation factor GreA
3340 RJOR01000009.1 GCA003943155_01672 CDS open 18675-19139 _na     154_aa 8-oxo-dGTP diphosphatase
3341 RJOR01000009.1 GCA003943155_01673 CDS open 19271-20188 _na     305_aa yidC membrane protein insertase YidC
3342 RJOR01000009.1 GCA003943155_01674 CDS open 20268-20546 _na     92_aa acylphosphatase
3343 RJOR01000009.1 GCA003943155_01675 CDS open 20577-21317 _na     246_aa Putative rRNA methylase
3344 RJOR01000009.1 GCA003943155_01676 CDS open 21363-21854 _na     163_aa HD domain-containing protein
3345 RJOR01000009.1 GCA003943155_01677 CDS open 21881-22564 _na     227_aa Integral membrane protein
3346 RJOR01000009.1 GCA003943155_01678 CDS open 22673-23923 _na     416_aa Diaminopimelate decarboxylase
3347 RJOR01000009.1 GCA003943155_01679 CDS open 23978-24226 _na     82_aa UPF0154 protein SIR_0372
3348 RJOR01000009.1 GCA003943155_01680 CDS open 24319-25113 _na     264_aa racE glutamate racemase
3349 RJOR01000009.1 GCA003943155_01681 CDS open 25110-26096 _na     328_aa nucleoside-triphosphate diphosphatase
3350 RJOR01000009.1 GCA003943155_01682 CDS open 26072-26593 _na     173_aa Phosphoesterase
3351 RJOR01000009.1 GCA003943155_01683 CDS open 26590-27051 _na     153_aa cbpB cyclic-di-AMP-binding protein CbpB
3352 RJOR01000009.1 GCA003943155_01684 CDS open 27048-27779 _na     243_aa xerD site-specific tyrosine recombinase XerD
3353 RJOR01000009.1 GCA003943155_01685 CDS open 27779-28489 _na     236_aa segregation/condensation protein A
3354 RJOR01000009.1 GCA003943155_01686 CDS open 28482-29048 _na     188_aa scpB SMC-Scp complex subunit ScpB
3355 RJOR01000009.1 GCA003943155_01687 CDS open 29035-29760 _na     241_aa Pseudouridine synthase
3356 RJOR01000009.1 GCA003943155_01688 CDS open 29760-30014 _na     84_aa yidD membrane protein insertion efficiency factor YidD
3357 RJOR01000009.1 GCA003943155_01689 CDS open 30047-31486 _na     479_aa Cation transport protein
3358 RJOR01000009.1 GCA003943155_01690 CDS open 31490-32839 _na     449_aa trkA Trk system potassium transporter TrkA
3359 RJOR01000009.1 GCA003943155_01691 CDS open 33163-33675 _na     170_aa Putative tRNA (cytidine(34)-2'-O)-methyltransferase
3360 RJOR01000009.1 GCA003943155_01692 CDS open 34108-34671 _na     187_aa Riboflavin transporter
3361 RJOR01000009.1 GCA003943155_01693 CDS open 34661-35311 _na     216_aa bcrC Undecaprenyl-diphosphatase BcrC
3362 RJOR01000009.1 GCA003943155_01694 CDS open 35333-35656 _na     107_aa DNA methyltransferase protein
3363 RJOR01000009.1 GCA003943155_01695 CDS open 35706-36641 _na     311_aa TIGR01212 family radical SAM protein
3364 RJOR01000009.1 GCA003943155_01696 CDS open 36635-37183 _na     182_aa Methyltransferase
3365 RJOR01000009.1 GCA003943155_01697 CDS open 37196-37450 _na     84_aa 50S ribosomal protein L29
3366 RJOR01000009.1 GCA003943155_01698 CDS open 37462-39516 _na     684_aa sodium:proton antiporter
3367 RJOR01000009.1 GCA003943155_01699 CDS open 39590-39889 _na     99_aa Ribose-5-phosphate isomerase A
3368 RJOR01000009.1 GCA003943155_01700 CDS open 39953-40402 _na     149_aa Nudix hydrolase domain-containing protein
3369 RJOR01000009.1 GCA003943155_01701 CDS open 40559-41452 _na     297_aa Putative transcriptional regulator
3370 RJOR01000009.1 GCA003943155_01702 CDS open 41512-42117 _na     201_aa GyrI-like small molecule binding domain-containing protein
3371 RJOR01000009.1 GCA003943155_01703 CDS open 42164-44431 _na     755_aa Putative ATP-dependent Clp protease subunit
3372 RJOR01000009.1 GCA003943155_01704 CDS open 44671-44901 _na     76_aa Cytoplasmic protein
3373 RJOR01000009.1 GCA003943155_01705 CDS open 45070-45570 _na     166_aa Ferrous iron transport protein A
3374 RJOR01000009.1 GCA003943155_01706 CDS open 45536-47680 _na     714_aa feoB ferrous iron transport protein B
3375 RJOR01000009.1 GCA003943155_01707 CDS open 47689-47823 _na     44_aa FeoB-associated Cys-rich membrane protein
3376 RJOR01000009.1 GCA003943155_01708 CDS open 47955-48497 _na     180_aa Cytosolic protein
3377 RJOR01000009.1 GCA003943155_01709 CDS open 48941-50329 _na     462_aa ABC superfamily ATP binding cassette transporter
3378 RJOR01000009.1 GCA003943155_01710 CDS open 50353-51000 _na     215_aa ABC transporter ATP-binding protein
3379 RJOR01000009.1 GCA003943155_01711 CDS open 51012-52304 _na     430_aa ABC3 transporter permease protein domain-containing protein
3380 RJOR01000009.1 GCA003943155_01712 CDS open 52573-53427 _na     284_aa bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase
3381 RJOR01000009.1 GCA003943155_01713 CDS open 53533-54372 _na     279_aa ADP-dependent (S)-NAD(P)H-hydrate dehydratase
3382 RJOR01000009.1 GCA003943155_01714 CDS open 54465-55805 _na     446_aa xseA exodeoxyribonuclease VII large subunit
3383 RJOR01000009.1 GCA003943155_01715 CDS open 55783-55995 _na     70_aa xseB exodeoxyribonuclease VII small subunit
3384 RJOR01000009.1 GCA003943155_01716 CDS open 55992-56894 _na     300_aa Putative synthase or transferase
3385 RJOR01000009.1 GCA003943155_01717 CDS open 56860-57675 _na     271_aa Ribosomal RNA large subunit methyltransferase J
3386 RJOR01000009.1 GCA003943155_01718 CDS open 57668-58099 _na     143_aa Arginine repressor
3387 RJOR01000009.1 GCA003943155_01719 CDS open 58107-59765 _na     552_aa recN DNA repair protein RecN
3388 RJOR01000009.1 GCA003943155_01720 CDS open 60076-60807 _na     243_aa Putative serine/threonine protein phosphatase 1
3389 RJOR01000009.1 GCA003943155_01721 CDS open 60870-61841 _na     323_aa Putative ABC transporter%2C periplasmic component
3390 RJOR01000009.1 GCA003943155_01722 CDS open 61863-62615 _na     250_aa Iron complex transport system ATP-binding protein
3391 RJOR01000009.1 GCA003943155_01723 CDS open 62616-63578 _na     320_aa Putative ABC transporter permease
3392 RJOR01000009.1 GCA003943155_01724 CDS open 63571-64524 _na     317_aa Iron compound ABC transporter permease protein
3393 RJOR01000009.1 GCA003943155_01725 CDS open 64760-65593 _na     277_aa degV DegV family protein
3394 RJOR01000009.1 GCA003943155_01726 CDS open 65722-65997 _na     91_aa hupA DNA-binding protein HU-beta
3395 RJOR01000009.1 GCA003943155_01727 CDS open 66165-66626 _na     153_aa Fe/Zn uptake regulation protein
3396 RJOR01000009.1 GCA003943155_01728 CDS open 66764-67456 _na     230_aa gpmA phosphoglycerate mutase
3397 RJOR01000009.1 GCA003943155_01729 CDS open 67625-69673 _na     682_aa pbp2b penicillin-binding protein PBP2B
3398 RJOR01000009.1 GCA003943155_01730 CDS open 69684-70280 _na     198_aa recR recombination mediator RecR
3399 RJOR01000009.1 GCA003943155_01731 CDS open 70405-71457 _na     350_aa D-alanine--D-alanine ligase
3400 RJOR01000009.1 GCA003943155_01732 CDS open 71711-73081 _na     456_aa UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase
3401 RJOR01000009.1 GCA003943155_01733 CDS open 73071-73619 _na     182_aa DUF1697 domain-containing protein
3402 RJOR01000009.1 GCA003943155_01734 CDS open 73626-74330 _na     234_aa Major facilitator superfamily permease
3403 RJOR01000009.1 GCA003943155_01735 CDS open 74334-75011 _na     225_aa Major facilitator superfamily permease
3404 RJOR01000009.1 GCA003943155_01653 gene open 2-250
3405 RJOR01000009.1 GCA003943155_01654 gene open 268-1083
3406 RJOR01000009.1 GCA003943155_01655 gene open 1135-1617
3407 RJOR01000009.1 GCA003943155_01656 gene open 1816-2289 nrdR
3408 RJOR01000009.1 GCA003943155_01657 gene open 2290-3441
3409 RJOR01000009.1 GCA003943155_01658 gene open 3442-4341 dnaI
3410 RJOR01000009.1 GCA003943155_01659 gene open 4373-5980
3411 RJOR01000009.1 GCA003943155_01660 gene open 6019-6690
3412 RJOR01000009.1 GCA003943155_01661 gene open 6741-7427
3413 RJOR01000009.1 GCA003943155_01662 gene open 7457-7888
3414 RJOR01000009.1 GCA003943155_01663 gene open 7890-8336
3415 RJOR01000009.1 GCA003943155_01664 gene open 8464-9774 der
3416 RJOR01000009.1 GCA003943155_01665 gene open 9987-13097
3417 RJOR01000009.1 GCA003943155_01666 gene open 13139-13777
3418 RJOR01000009.1 GCA003943155_01667 gene open 13860-15191 murC
3419 RJOR01000009.1 GCA003943155_01668 gene open 15181-15705
3420 RJOR01000009.1 GCA003943155_01669 gene open 15702-16199
3421 RJOR01000009.1 GCA003943155_01670 gene open 16308-17912
3422 RJOR01000009.1 GCA003943155_01671 gene open 18116-18598 greA
3423 RJOR01000009.1 GCA003943155_01672 gene open 18675-19139
3424 RJOR01000009.1 GCA003943155_01673 gene open 19271-20188 yidC
3425 RJOR01000009.1 GCA003943155_01674 gene open 20268-20546
3426 RJOR01000009.1 GCA003943155_01675 gene open 20577-21317
3427 RJOR01000009.1 GCA003943155_01676 gene open 21363-21854
3428 RJOR01000009.1 GCA003943155_01677 gene open 21881-22564
3429 RJOR01000009.1 GCA003943155_01678 gene open 22673-23923
3430 RJOR01000009.1 GCA003943155_01679 gene open 23978-24226
3431 RJOR01000009.1 GCA003943155_01680 gene open 24319-25113 racE
3432 RJOR01000009.1 GCA003943155_01681 gene open 25110-26096
3433 RJOR01000009.1 GCA003943155_01682 gene open 26072-26593
3434 RJOR01000009.1 GCA003943155_01683 gene open 26590-27051 cbpB
3435 RJOR01000009.1 GCA003943155_01684 gene open 27048-27779 xerD
3436 RJOR01000009.1 GCA003943155_01685 gene open 27779-28489
3437 RJOR01000009.1 GCA003943155_01686 gene open 28482-29048 scpB
3438 RJOR01000009.1 GCA003943155_01687 gene open 29035-29760
3439 RJOR01000009.1 GCA003943155_01688 gene open 29760-30014 yidD
3440 RJOR01000009.1 GCA003943155_01689 gene open 30047-31486
3441 RJOR01000009.1 GCA003943155_01690 gene open 31490-32839 trkA
3442 RJOR01000009.1 GCA003943155_01691 gene open 33163-33675
3443 RJOR01000009.1 GCA003943155_01692 gene open 34108-34671
3444 RJOR01000009.1 GCA003943155_01693 gene open 34661-35311 bcrC
3445 RJOR01000009.1 GCA003943155_01694 gene open 35333-35656
3446 RJOR01000009.1 GCA003943155_01695 gene open 35706-36641
3447 RJOR01000009.1 GCA003943155_01696 gene open 36635-37183
3448 RJOR01000009.1 GCA003943155_01697 gene open 37196-37450
3449 RJOR01000009.1 GCA003943155_01698 gene open 37462-39516
3450 RJOR01000009.1 GCA003943155_01699 gene open 39590-39889
3451 RJOR01000009.1 GCA003943155_01700 gene open 39953-40402
3452 RJOR01000009.1 GCA003943155_01701 gene open 40559-41452
3453 RJOR01000009.1 GCA003943155_01702 gene open 41512-42117
3454 RJOR01000009.1 GCA003943155_01703 gene open 42164-44431
3455 RJOR01000009.1 GCA003943155_01704 gene open 44671-44901
3456 RJOR01000009.1 GCA003943155_01705 gene open 45070-45570
3457 RJOR01000009.1 GCA003943155_01706 gene open 45536-47680 feoB
3458 RJOR01000009.1 GCA003943155_01707 gene open 47689-47823
3459 RJOR01000009.1 GCA003943155_01708 gene open 47955-48497
3460 RJOR01000009.1 GCA003943155_01709 gene open 48941-50329
3461 RJOR01000009.1 GCA003943155_01710 gene open 50353-51000
3462 RJOR01000009.1 GCA003943155_01711 gene open 51012-52304
3463 RJOR01000009.1 GCA003943155_01712 gene open 52573-53427
3464 RJOR01000009.1 GCA003943155_01713 gene open 53533-54372
3465 RJOR01000009.1 GCA003943155_01714 gene open 54465-55805 xseA
3466 RJOR01000009.1 GCA003943155_01715 gene open 55783-55995 xseB
3467 RJOR01000009.1 GCA003943155_01716 gene open 55992-56894
3468 RJOR01000009.1 GCA003943155_01717 gene open 56860-57675
3469 RJOR01000009.1 GCA003943155_01718 gene open 57668-58099
3470 RJOR01000009.1 GCA003943155_01719 gene open 58107-59765 recN
3471 RJOR01000009.1 GCA003943155_01720 gene open 60076-60807
3472 RJOR01000009.1 GCA003943155_01721 gene open 60870-61841
3473 RJOR01000009.1 GCA003943155_01722 gene open 61863-62615
3474 RJOR01000009.1 GCA003943155_01723 gene open 62616-63578
3475 RJOR01000009.1 GCA003943155_01724 gene open 63571-64524
3476 RJOR01000009.1 GCA003943155_01725 gene open 64760-65593 degV
3477 RJOR01000009.1 GCA003943155_01726 gene open 65722-65997 hupA
3478 RJOR01000009.1 GCA003943155_01727 gene open 66165-66626
3479 RJOR01000009.1 GCA003943155_01728 gene open 66764-67456 gpmA
3480 RJOR01000009.1 GCA003943155_01729 gene open 67625-69673 pbp2b
3481 RJOR01000009.1 GCA003943155_01730 gene open 69684-70280 recR
3482 RJOR01000009.1 GCA003943155_01731 gene open 70405-71457
3483 RJOR01000009.1 GCA003943155_01732 gene open 71711-73081
3484 RJOR01000009.1 GCA003943155_01733 gene open 73071-73619
3485 RJOR01000009.1 GCA003943155_01734 gene open 73626-74330
3486 RJOR01000009.1 GCA003943155_01735 gene open 74334-75011
3487 RJOR01000010.1 regulatory_region open 31699-31808 PreQ1-II (pre queuosine) riboswitch aptamer
3488 RJOR01000010.1 repeat_region open 7238-8734 CRISPR array with 23 repeats of length 36%2C consensus sequence GTTTTACAGTTACTTAAATCTTGAGAGTACAAAAAC and spacer length 29
3489 RJOR01000010.1 GCA003943155_01736 CDS open 286-1005 _na     239_aa DUF4176 domain-containing protein
3490 RJOR01000010.1 GCA003943155_01737 CDS open 1002-1292 _na     96_aa hypothetical protein
3491 RJOR01000010.1 GCA003943155_01738 CDS open 1307-1714 _na     135_aa DUF5082 domain-containing protein
3492 RJOR01000010.1 GCA003943155_01739 CDS open 1823-2590 _na     255_aa ribonuclease HII
3493 RJOR01000010.1 GCA003943155_01740 CDS open 2577-3428 _na     283_aa ylqF ribosome biogenesis GTPase YlqF
3494 RJOR01000010.1 GCA003943155_01741 CDS open 3832-4008 _na     58_aa rpsU 30S ribosomal protein S21
3495 RJOR01000010.1 GCA003943155_01742 CDS open 4157-4495 _na     112_aa ATP cone domain protein
3496 RJOR01000010.1 GCA003943155_01743 CDS open 4744-7077 _na     777_aa Gram-positive cocci surface proteins LPxTG domain-containing protein
3497 RJOR01000010.1 GCA003943155_01744 CDS open 8796-9839 _na     347_aa CRISPR-associated protein Cas7
3498 RJOR01000010.1 GCA003943155_01745 CDS open 9836-10159 _na     107_aa cas2 CRISPR-associated endonuclease Cas2
3499 RJOR01000010.1 GCA003943155_01746 CDS open 10159-11070 _na     303_aa cas1 type II CRISPR-associated endonuclease Cas1
3500 RJOR01000010.1 GCA003943155_01747 CDS open 11231-14608 _na     1125_aa cas9 type II CRISPR RNA-guided endonuclease Cas9