HOMD Banner
Taxonomy: V4.3   |  16S rRNA RefSeq: V16.03   |  Genomic RefSeq: V11.03   |  Viruses: V1.2

BAKTAGenome Explorer: Staphylococcus hominis (GCA_022695885.1)

Select a Genome:
BAKTA Annotations for GCA_022695885.1
Genome Selected: Staphylococcus hominis
ContigsBases CDSrRNA tmRNAtRNA
5 2,315,909 2187 19 1 63
[Table]   [AA Fasta]      [Browser]   [Text]   [Excel]  
Search & Sort all 4677 Records
Search These Records: Clear
Sort Column:   Molecule   PID   NA   AA   Gene  Gene Product  Reverse
Annotation Table [page:1]    |    Number of Records Found: 4677 [10 Pages]    |    Previous Page <==> Next Page    |    Jump to Page: [ 1  2  3  4  5  6  7  8  9  10  ]
Notes:   1- Column headers only sort the current page. 2- Select [NA] or [AA] links to show sequences.
Region Protein-ID Type Genome
Viewer		 Range
(bp)		 Show Sequences
(length) NA / AA		 BAKTA
Gene		 BAKTA
GeneProduct
1 JAKUUV010000001.1 GCA022695885_01808 gene open 1801929-1802287 ssrA
2 JAKUUV010000001.1 GCA022695885_01808 tmRNA open 1801929-1802287 ssrA transfer-messenger RNA%2C SsrA
3 JAKUUV010000001.1 oriT open 181824-182060
4 JAKUUV010000001.1 GCA022695885_00027 gene open 31757-31982 tsr24
5 JAKUUV010000001.1 GCA022695885_00040 gene open 42863-43005 psm_mec_RNA
6 JAKUUV010000001.1 GCA022695885_00078 gene open 81052-81277 tsr24
7 JAKUUV010000001.1 GCA022695885_00101 gene open 106190-106415 tsr24
8 JAKUUV010000001.1 GCA022695885_00105 gene open 108447-108544 rli23
9 JAKUUV010000001.1 GCA022695885_00166 gene open 169181-169279 fstAT
10 JAKUUV010000001.1 GCA022695885_00177 gene open 179266-179491 tsr24
11 JAKUUV010000001.1 GCA022695885_00220 gene open 219317-219606 5_ureB_sRNA
12 JAKUUV010000001.1 GCA022695885_00284 gene open 288725-288828 sau-13
13 JAKUUV010000001.1 GCA022695885_00357 gene open 371625-371722 rli23
14 JAKUUV010000001.1 GCA022695885_00372 gene open 386560-386785 tsr24
15 JAKUUV010000001.1 GCA022695885_00441 gene open 459330-459555 tsr24
16 JAKUUV010000001.1 GCA022695885_00504 gene open 525456-525681 tsr24
17 JAKUUV010000001.1 GCA022695885_00556 gene open 594488-594585 rli23
18 JAKUUV010000001.1 GCA022695885_00563 gene open 601664-601889 tsr24
19 JAKUUV010000001.1 GCA022695885_00570 gene open 606933-607085 RsaOG
20 JAKUUV010000001.1 GCA022695885_00709 gene open 727021-728571 rrs
21 JAKUUV010000001.1 GCA022695885_00710 gene open 728872-731793 rrl
22 JAKUUV010000001.1 GCA022695885_00711 gene open 731861-731975 rrf
23 JAKUUV010000001.1 GCA022695885_00745 gene open 759485-759553 tsr31
24 JAKUUV010000001.1 GCA022695885_00748 gene open 762906-763131 tsr24
25 JAKUUV010000001.1 GCA022695885_00809 gene open 814337-815887 rrs
26 JAKUUV010000001.1 GCA022695885_00810 gene open 816188-819109 rrl
27 JAKUUV010000001.1 GCA022695885_00811 gene open 819177-819291 rrf
28 JAKUUV010000001.1 GCA022695885_00821 gene open 830154-830354 rli60
29 JAKUUV010000001.1 GCA022695885_00836 gene open 843613-844038 RNAIII
30 JAKUUV010000001.1 GCA022695885_00890 gene open 899336-899433 rli23
31 JAKUUV010000001.1 GCA022695885_00902 gene open 908763-908988 tsr24
32 JAKUUV010000001.1 GCA022695885_00903 gene open 909005-909234 tsr24
33 JAKUUV010000001.1 GCA022695885_00921 gene open 926209-927759 rrs
34 JAKUUV010000001.1 GCA022695885_00924 gene open 928175-931096 rrl
35 JAKUUV010000001.1 GCA022695885_00925 gene open 931164-931278 rrf
36 JAKUUV010000001.1 GCA022695885_00983 gene open 962784-962886 S774
37 JAKUUV010000001.1 GCA022695885_01012 gene open 979144-979241 rli23
38 JAKUUV010000001.1 GCA022695885_01078 gene open 1062424-1062645 tsr24
39 JAKUUV010000001.1 GCA022695885_01138 gene open 1128986-1129176 6S
40 JAKUUV010000001.1 GCA022695885_01176 gene open 1163412-1163637 tsr24
41 JAKUUV010000001.1 GCA022695885_01197 gene open 1183955-1184180 tsr24
42 JAKUUV010000001.1 GCA022695885_01303 gene open 1289091-1289477 RNaseP_bact_b
43 JAKUUV010000001.1 GCA022695885_01325 gene open 1306603-1306777 S414
44 JAKUUV010000001.1 GCA022695885_01342 gene open 1323610-1323835 tsr24
45 JAKUUV010000001.1 GCA022695885_01389 gene open 1380348-1380573 tsr24
46 JAKUUV010000001.1 GCA022695885_01459 gene open 1454873-1455161 rliD
47 JAKUUV010000001.1 GCA022695885_01491 gene open 1493651-1493875 tsr24
48 JAKUUV010000001.1 GCA022695885_01631 gene open 1632843-1632970 sau-59
49 JAKUUV010000001.1 GCA022695885_01638 gene open 1638409-1638506 rli23
50 JAKUUV010000001.1 GCA022695885_01701 gene open 1701520-1701617 rsaE
51 JAKUUV010000001.1 GCA022695885_01835 gene open 1826392-1826617 tsr24
52 JAKUUV010000001.1 GCA022695885_01874 gene open 1870460-1870685 tsr24
53 JAKUUV010000001.1 GCA022695885_01882 gene open 1879286-1879383 rli23
54 JAKUUV010000001.1 GCA022695885_01905 gene open 1902232-1902457 tsr24
55 JAKUUV010000001.1 GCA022695885_01923 gene open 1916729-1916826 rli23
56 JAKUUV010000001.1 GCA022695885_01947 gene open 1940256-1940445 rsaD
57 JAKUUV010000001.1 GCA022695885_02005 gene open 1995811-1995933 rsaA
58 JAKUUV010000001.1 GCA022695885_02077 gene open 2075723-2075837 rrf
59 JAKUUV010000001.1 GCA022695885_02078 gene open 2075905-2078826 rrl
60 JAKUUV010000001.1 GCA022695885_02080 gene open 2079148-2080698 rrs
61 JAKUUV010000001.1 GCA022695885_02081 gene open 2080914-2081028 rrf
62 JAKUUV010000001.1 GCA022695885_02082 gene open 2081096-2084017 rrl
63 JAKUUV010000001.1 GCA022695885_02083 gene open 2084318-2085868 rrs
64 JAKUUV010000001.1 GCA022695885_02092 gene open 2086707-2086821 rrf
65 JAKUUV010000001.1 GCA022695885_02130 gene open 2123779-2123893 rrf
66 JAKUUV010000001.1 GCA022695885_02131 gene open 2123960-2126881 rrl
67 JAKUUV010000001.1 GCA022695885_02132 gene open 2127182-2128732 rrs
68 JAKUUV010000001.1 GCA022695885_02137 gene open 2132924-2133193 Bacteria_large_SRP
69 JAKUUV010000001.1 GCA022695885_02138 gene open 2132976-2133075 Bacteria_small_SRP
70 JAKUUV010000001.1 GCA022695885_02169 gene open 2168046-2168143 rli23
71 JAKUUV010000001.1 GCA022695885_02200 gene open 2193190-2193287 rli23
72 JAKUUV010000001.1 GCA022695885_02207 gene open 2199221-2199326 sRNA71
73 JAKUUV010000001.1 GCA022695885_00027 ncRNA open 31757-31982 S. aureus tsr24 small RNA
74 JAKUUV010000001.1 GCA022695885_00040 ncRNA open 42863-43005 psm_mec locus RNA
75 JAKUUV010000001.1 GCA022695885_00078 ncRNA open 81052-81277 S. aureus tsr24 small RNA
76 JAKUUV010000001.1 GCA022695885_00101 ncRNA open 106190-106415 S. aureus tsr24 small RNA
77 JAKUUV010000001.1 GCA022695885_00105 ncRNA open 108447-108544 Listeria snRNA rli23
78 JAKUUV010000001.1 GCA022695885_00166 ncRNA open 169181-169279 Fst antitoxin sRNA
79 JAKUUV010000001.1 GCA022695885_00177 ncRNA open 179266-179491 S. aureus tsr24 small RNA
80 JAKUUV010000001.1 GCA022695885_00220 ncRNA open 219317-219606 5' ureB small RNA
81 JAKUUV010000001.1 GCA022695885_00284 ncRNA open 288725-288828 Staphylococcus sRNA sau-13
82 JAKUUV010000001.1 GCA022695885_00357 ncRNA open 371625-371722 Listeria snRNA rli23
83 JAKUUV010000001.1 GCA022695885_00372 ncRNA open 386560-386785 S. aureus tsr24 small RNA
84 JAKUUV010000001.1 GCA022695885_00441 ncRNA open 459330-459555 S. aureus tsr24 small RNA
85 JAKUUV010000001.1 GCA022695885_00504 ncRNA open 525456-525681 S. aureus tsr24 small RNA
86 JAKUUV010000001.1 GCA022695885_00556 ncRNA open 594488-594585 Listeria snRNA rli23
87 JAKUUV010000001.1 GCA022695885_00563 ncRNA open 601664-601889 S. aureus tsr24 small RNA
88 JAKUUV010000001.1 GCA022695885_00570 ncRNA open 606933-607085 RNA S.aureus Orsay G
89 JAKUUV010000001.1 GCA022695885_00745 ncRNA open 759485-759553 S. aureus tsr31 small RNA
90 JAKUUV010000001.1 GCA022695885_00748 ncRNA open 762906-763131 S. aureus tsr24 small RNA
91 JAKUUV010000001.1 GCA022695885_00821 ncRNA open 830154-830354 Listeria sRNA rli60
92 JAKUUV010000001.1 GCA022695885_00836 ncRNA open 843613-844038 RNAIII
93 JAKUUV010000001.1 GCA022695885_00890 ncRNA open 899336-899433 Listeria snRNA rli23
94 JAKUUV010000001.1 GCA022695885_00902 ncRNA open 908763-908988 S. aureus tsr24 small RNA
95 JAKUUV010000001.1 GCA022695885_00903 ncRNA open 909005-909234 S. aureus tsr24 small RNA
96 JAKUUV010000001.1 GCA022695885_00983 ncRNA open 962784-962886 Staphylococcus sRNA 774
97 JAKUUV010000001.1 GCA022695885_01012 ncRNA open 979144-979241 Listeria snRNA rli23
98 JAKUUV010000001.1 GCA022695885_01078 ncRNA open 1062424-1062645 S. aureus tsr24 small RNA
99 JAKUUV010000001.1 GCA022695885_01138 ncRNA open 1128986-1129176 6S / SsrS RNA
100 JAKUUV010000001.1 GCA022695885_01176 ncRNA open 1163412-1163637 S. aureus tsr24 small RNA
101 JAKUUV010000001.1 GCA022695885_01197 ncRNA open 1183955-1184180 S. aureus tsr24 small RNA
102 JAKUUV010000001.1 GCA022695885_01303 ncRNA open 1289091-1289477 Bacterial RNase P class B
103 JAKUUV010000001.1 GCA022695885_01325 ncRNA open 1306603-1306777 Staphylococcus sRNA 414
104 JAKUUV010000001.1 GCA022695885_01342 ncRNA open 1323610-1323835 S. aureus tsr24 small RNA
105 JAKUUV010000001.1 GCA022695885_01389 ncRNA open 1380348-1380573 S. aureus tsr24 small RNA
106 JAKUUV010000001.1 GCA022695885_01459 ncRNA open 1454873-1455161 rliD Listeria sRNA rliD
107 JAKUUV010000001.1 GCA022695885_01491 ncRNA open 1493651-1493875 S. aureus tsr24 small RNA
108 JAKUUV010000001.1 GCA022695885_01631 ncRNA open 1632843-1632970 Staphylococcus sRNA sau-59
109 JAKUUV010000001.1 GCA022695885_01638 ncRNA open 1638409-1638506 Listeria snRNA rli23
110 JAKUUV010000001.1 GCA022695885_01701 ncRNA open 1701520-1701617 rsaE RNA Staph. aureus E (RoxS)
111 JAKUUV010000001.1 GCA022695885_01835 ncRNA open 1826392-1826617 S. aureus tsr24 small RNA
112 JAKUUV010000001.1 GCA022695885_01874 ncRNA open 1870460-1870685 S. aureus tsr24 small RNA
113 JAKUUV010000001.1 GCA022695885_01882 ncRNA open 1879286-1879383 Listeria snRNA rli23
114 JAKUUV010000001.1 GCA022695885_01905 ncRNA open 1902232-1902457 S. aureus tsr24 small RNA
115 JAKUUV010000001.1 GCA022695885_01923 ncRNA open 1916729-1916826 Listeria snRNA rli23
116 JAKUUV010000001.1 GCA022695885_01947 ncRNA open 1940256-1940445 rsaD RNA Staph. aureus D
117 JAKUUV010000001.1 GCA022695885_02005 ncRNA open 1995811-1995933 rsaA RNA Staph. aureus A
118 JAKUUV010000001.1 GCA022695885_02137 ncRNA open 2132924-2133193 Bacterial large signal recognition particle RNA
119 JAKUUV010000001.1 GCA022695885_02138 ncRNA open 2132976-2133075 Bacterial small signal recognition particle RNA
120 JAKUUV010000001.1 GCA022695885_02169 ncRNA open 2168046-2168143 Listeria snRNA rli23
121 JAKUUV010000001.1 GCA022695885_02200 ncRNA open 2193190-2193287 Listeria snRNA rli23
122 JAKUUV010000001.1 GCA022695885_02207 ncRNA open 2199221-2199326 Staphylococcus sRNA71 small RNA
123 JAKUUV010000001.1 regulatory_region open 10262-10465 T-box leader
124 JAKUUV010000001.1 regulatory_region open 13219-13319 SAM riboswitch aptamer (S box leader)
125 JAKUUV010000001.1 regulatory_region open 144463-144566 TPP riboswitch aptamer (THI element)
126 JAKUUV010000001.1 regulatory_region open 144666-144764 TPP riboswitch aptamer (THI element)
127 JAKUUV010000001.1 regulatory_region open 156988-157091 TPP riboswitch aptamer (THI element)
128 JAKUUV010000001.1 regulatory_region open 291173-291273 SAM riboswitch aptamer (S box leader)
129 JAKUUV010000001.1 regulatory_region open 299449-299550 TPP riboswitch aptamer (THI element)
130 JAKUUV010000001.1 regulatory_region open 336486-336592 SAM riboswitch aptamer (S box leader)
131 JAKUUV010000001.1 regulatory_region open 355190-355304 SAM riboswitch aptamer (S box leader)
132 JAKUUV010000001.1 regulatory_region open 423541-423650 TPP riboswitch aptamer (THI element)
133 JAKUUV010000001.1 regulatory_region open 672164-672221 Ribosomal protein L13 leader
134 JAKUUV010000001.1 regulatory_region open 735953-736163 glmS glucosamine-6-phosphate activated ribozyme aptamer
135 JAKUUV010000001.1 regulatory_region open 770056-770085 L31-Firmicutes ribosomal protein leader
136 JAKUUV010000001.1 regulatory_region open 790034-790136 TPP riboswitch aptamer (THI element)
137 JAKUUV010000001.1 regulatory_region open 969530-969642 SAM riboswitch aptamer (S box leader)
138 JAKUUV010000001.1 regulatory_region open 981289-981424 FMN riboswitch aptamer (RFN element)
139 JAKUUV010000001.1 regulatory_region open 990622-990812 T-box leader
140 JAKUUV010000001.1 regulatory_region open 1083558-1083733 Lysine riboswitch aptamer
141 JAKUUV010000001.1 regulatory_region open 1085442-1085569 Ribosomal protein L20 leader
142 JAKUUV010000001.1 regulatory_region open 1100204-1100430 T-box leader
143 JAKUUV010000001.1 regulatory_region open 1109053-1109136 Ribosomal protein L21 leader
144 JAKUUV010000001.1 regulatory_region open 1210441-1210562 Glycine riboswitch aptamer
145 JAKUUV010000001.1 regulatory_region open 1252089-1252216 FMN riboswitch aptamer (RFN element)
146 JAKUUV010000001.1 regulatory_region open 1333833-1334008 Lysine riboswitch aptamer
147 JAKUUV010000001.1 regulatory_region open 1494897-1494939 Ribosomal protein L19 leader
148 JAKUUV010000001.1 regulatory_region open 1540209-1540368 PyrR binding site
149 JAKUUV010000001.1 regulatory_region open 1634283-1634384 TPP riboswitch aptamer (THI element)
150 JAKUUV010000001.1 regulatory_region open 1683076-1683208 Manganese Mn2+ riboswitch aptamer (yybP-ykoY)
151 JAKUUV010000001.1 regulatory_region open 1788789-1788893 SAM riboswitch aptamer (S box leader)
152 JAKUUV010000001.1 regulatory_region open 2054770-2054923 Ribosomal protein L10 leader
153 JAKUUV010000001.1 regulatory_region open 2188047-2188149 Purine riboswitch aptamer
154 JAKUUV010000001.1 GCA022695885_00709 rRNA open 727021-728571 rrs 16S ribosomal RNA
155 JAKUUV010000001.1 GCA022695885_00710 rRNA open 728872-731793 rrl 23S ribosomal RNA
156 JAKUUV010000001.1 GCA022695885_00711 rRNA open 731861-731975 rrf 5S ribosomal RNA
157 JAKUUV010000001.1 GCA022695885_00809 rRNA open 814337-815887 rrs 16S ribosomal RNA
158 JAKUUV010000001.1 GCA022695885_00810 rRNA open 816188-819109 rrl 23S ribosomal RNA
159 JAKUUV010000001.1 GCA022695885_00811 rRNA open 819177-819291 rrf 5S ribosomal RNA
160 JAKUUV010000001.1 GCA022695885_00921 rRNA open 926209-927759 rrs 16S ribosomal RNA
161 JAKUUV010000001.1 GCA022695885_00924 rRNA open 928175-931096 rrl 23S ribosomal RNA
162 JAKUUV010000001.1 GCA022695885_00925 rRNA open 931164-931278 rrf 5S ribosomal RNA
163 JAKUUV010000001.1 GCA022695885_02077 rRNA open 2075723-2075837 rrf 5S ribosomal RNA
164 JAKUUV010000001.1 GCA022695885_02078 rRNA open 2075905-2078826 rrl 23S ribosomal RNA
165 JAKUUV010000001.1 GCA022695885_02080 rRNA open 2079148-2080698 rrs 16S ribosomal RNA
166 JAKUUV010000001.1 GCA022695885_02081 rRNA open 2080914-2081028 rrf 5S ribosomal RNA
167 JAKUUV010000001.1 GCA022695885_02082 rRNA open 2081096-2084017 rrl 23S ribosomal RNA
168 JAKUUV010000001.1 GCA022695885_02083 rRNA open 2084318-2085868 rrs 16S ribosomal RNA
169 JAKUUV010000001.1 GCA022695885_02092 rRNA open 2086707-2086821 rrf 5S ribosomal RNA
170 JAKUUV010000001.1 GCA022695885_02130 rRNA open 2123779-2123893 rrf 5S ribosomal RNA
171 JAKUUV010000001.1 GCA022695885_02131 rRNA open 2123960-2126881 rrl 23S ribosomal RNA
172 JAKUUV010000001.1 GCA022695885_02132 rRNA open 2127182-2128732 rrs 16S ribosomal RNA
173 JAKUUV010000001.1 repeat_region open 2241660-2242517 CRISPR array with 13 repeats of length 36%2C consensus sequence GTTTTAGTACTCTGTAATTTTAGGTATGAGGTAGAC and spacer length 29
174 JAKUUV010000001.1 GCA022695885_00001 CDS open 1-1353 _na     450_aa dnaA chromosomal replication initiator protein DnaA
175 JAKUUV010000001.1 GCA022695885_00002 CDS open 1646-2776 _na     376_aa dnaN DNA polymerase III subunit beta
176 JAKUUV010000001.1 GCA022695885_00003 CDS open 3145-3378 _na     77_aa ybcJ S4 domain-containing protein YaaA
177 JAKUUV010000001.1 GCA022695885_00004 CDS open 3375-4490 _na     371_aa recF DNA replication/repair protein RecF
178 JAKUUV010000001.1 GCA022695885_00005 CDS open 4500-6434 _na     644_aa gyrB DNA topoisomerase (ATP-hydrolyzing) subunit B
179 JAKUUV010000001.1 GCA022695885_00006 CDS open 6476-9130 _na     884_aa gyrA DNA gyrase subunit A
180 JAKUUV010000001.1 GCA022695885_00007 CDS open 9179-9991 _na     270_aa nnr2 ADP-dependent (S)-NAD(P)H-hydrate dehydratase
181 JAKUUV010000001.1 GCA022695885_00008 CDS open 10541-11824 _na     427_aa serS serine--tRNA ligase
182 JAKUUV010000001.1 GCA022695885_00009 CDS open 12112-12807 _na     231_aa azlC Azaleucine resistance protein AzlC
183 JAKUUV010000001.1 GCA022695885_00010 CDS open 12804-13133 _na     109_aa azlD AzlD domain-containing protein
184 JAKUUV010000001.1 GCA022695885_00011 CDS open 13391-14359 _na     322_aa mET2 Alpha/beta fold hydrolase
185 JAKUUV010000001.1 GCA022695885_00012 CDS open 14449-15360 _na     303_aa DUF2232 domain-containing protein
186 JAKUUV010000001.1 GCA022695885_00013 CDS open 15388-17355 _na     655_aa Cyclic-di-AMP phosphodiesterase
187 JAKUUV010000001.1 GCA022695885_00014 CDS open 17352-17798 _na     148_aa rplI 50S ribosomal protein L9
188 JAKUUV010000001.1 GCA022695885_00015 CDS open 17916-19307 _na     463_aa dnaB replicative DNA helicase
189 JAKUUV010000001.1 GCA022695885_00016 CDS open 19587-20870 _na     427_aa purA adenylosuccinate synthase
190 JAKUUV010000001.1 GCA022695885_00019 CDS open 21902-22603 _na     233_aa yycF response regulator YycF
191 JAKUUV010000001.1 GCA022695885_00020 CDS open 22616-24442 _na     608_aa walK cell wall metabolism sensor histidine kinase WalK
192 JAKUUV010000001.1 GCA022695885_00021 CDS open 24432-25763 _na     443_aa yycH Regulatory protein YycH domain-containing protein
193 JAKUUV010000001.1 GCA022695885_00022 CDS open 25764-26555 _na     263_aa Regulatory protein YycH-like domain-containing protein
194 JAKUUV010000001.1 GCA022695885_00023 CDS open 26820-27611 _na     263_aa MBL fold metallo-hydrolase
195 JAKUUV010000001.1 GCA022695885_00024 CDS open 28031-28510 _na     159_aa rlmH 23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH
196 JAKUUV010000001.1 GCA022695885_00025 CDS open 28730-29986 _na     418_aa Protein NO VEIN%2C C-terminal
197 JAKUUV010000001.1 GCA022695885_00026 CDS open 30081-31769 _na     562_aa tnp IS1182 family transposase
198 JAKUUV010000001.1 GCA022695885_00028 CDS open 32311-32553 _na     80_aa hypothetical protein
199 JAKUUV010000001.1 GCA022695885_00029 CDS open 32581-33255 _na     224_aa tnp IS6 family IS257R2 transposase
200 JAKUUV010000001.1 GCA022695885_00030 CDS open 33355-34311 _na     318_aa thyA thymidylate synthase
201 JAKUUV010000001.1 GCA022695885_00031 CDS open 34353-34838 _na     161_aa dfrS1 trimethoprim-resistant dihydrofolate reductase DfrS1
202 JAKUUV010000001.1 GCA022695885_00032 CDS open 34848-35270 _na     140_aa degV DegV domain-containing protein
203 JAKUUV010000001.1 GCA022695885_00033 CDS open 35302-35976 _na     224_aa tnp IS6 family IS257R1 transposase
204 JAKUUV010000001.1 GCA022695885_00034 CDS open 36234-36401 _na     55_aa pksG hydroxymethylglutaryl-CoA synthase
205 JAKUUV010000001.1 GCA022695885_00035 CDS open 37278-38021 _na     247_aa ugpQ Glycerophosphoryl diester phosphodiesterase
206 JAKUUV010000001.1 GCA022695885_00036 CDS open 38118-38546 _na     142_aa maoC Acyl dehydratase
207 JAKUUV010000001.1 GCA022695885_00037 CDS open 38592-40598 _na     668_aa mecA PBP2a family beta-lactam-resistant peptidoglycan transpeptidase MecA
208 JAKUUV010000001.1 GCA022695885_00038 CDS open 40698-42455 _na     585_aa mecR1 beta-lactam sensor/signal transducer MecR1
209 JAKUUV010000001.1 GCA022695885_00039 CDS open 42455-42826 _na     123_aa mecI mecA-type methicillin resistance repressor MecI
210 JAKUUV010000001.1 GCA022695885_00042 CDS open 43075-43749 _na     224_aa tnp IS6 family IS431mec transposase
211 JAKUUV010000001.1 GCA022695885_00043 CDS open 44104-44445 _na     113_aa HAD family hydrolase
212 JAKUUV010000001.1 GCA022695885_00044 CDS open 44714-46042 _na     442_aa cstB persulfide dioxygenase-sulfurtransferase CstB
213 JAKUUV010000001.1 GCA022695885_00045 CDS open 46061-47128 _na     355_aa Dihydroneopterin aldolase
214 JAKUUV010000001.1 GCA022695885_00046 CDS open 47267-47527 _na     86_aa cstR persulfide-sensing transcriptional repressor CstR
215 JAKUUV010000001.1 GCA022695885_00047 CDS open 47524-48282 _na     252_aa putative membrane transporter protein
216 JAKUUV010000001.1 GCA022695885_00048 CDS open 48494-48661 _na     55_aa ATPase copper transport
217 JAKUUV010000001.1 GCA022695885_00049 CDS open 48679-49224 _na     181_aa DUF1541 domain-containing protein
218 JAKUUV010000001.1 GCA022695885_00050 CDS open 50114-51031 _na     305_aa apbE FAD:protein FMN transferase
219 JAKUUV010000001.1 GCA022695885_00051 CDS open 51114-54131 _na     1005_aa Putative NADH-dependent flavin oxidoreductase
220 JAKUUV010000001.1 GCA022695885_00052 CDS open 54153-55532 _na     459_aa uhpC Quinolone resistance protein NorB
221 JAKUUV010000001.1 GCA022695885_00053 CDS open 55723-55908 _na     61_aa Diacetyl reductase [(S)-acetoin forming]
222 JAKUUV010000001.1 GCA022695885_00054 CDS open 56283-56780 _na     165_aa rimL GNAT family N-acetyltransferase
223 JAKUUV010000001.1 GCA022695885_00055 CDS open 58190-58972 _na     260_aa SMODS-associating 2TM beta-strand rich effector domain-containing protein
224 JAKUUV010000001.1 GCA022695885_00056 CDS open 59328-59711 _na     127_aa Lipoprotein
225 JAKUUV010000001.1 GCA022695885_00057 CDS open 59723-60355 _na     210_aa Proteophosphoglycan 5
226 JAKUUV010000001.1 GCA022695885_00058 CDS open 60494-60889 _na     131_aa arsC arsenate reductase (thioredoxin)
227 JAKUUV010000001.1 GCA022695885_00059 CDS open 60908-62200 _na     430_aa arsB arsenite efflux transporter membrane subunit ArsB
228 JAKUUV010000001.1 GCA022695885_00060 CDS open 62200-62514 _na     104_aa arsR HTH arsR-type domain-containing protein
229 JAKUUV010000001.1 GCA022695885_00061 CDS open 62511-64175 _na     554_aa Putative dehydrogenases
230 JAKUUV010000001.1 GCA022695885_00062 CDS open 64175-65902 _na     575_aa arsA arsenical pump-driving ATPase
231 JAKUUV010000001.1 GCA022695885_00063 CDS open 65883-66230 _na     115_aa arsD arsenite efflux transporter metallochaperone ArsD
232 JAKUUV010000001.1 GCA022695885_00064 CDS open 66512-66706 _na     64_aa Phage protein
233 JAKUUV010000001.1 GCA022695885_00065 CDS open 66752-67072 _na     106_aa arsR ArsR family transcriptional regulator
234 JAKUUV010000001.1 GCA022695885_00066 CDS open 67160-68044 _na     294_aa yraQ Permease
235 JAKUUV010000001.1 GCA022695885_00067 CDS open 68058-68186 _na     42_aa Alcohol dehydrogenase
236 JAKUUV010000001.1 GCA022695885_00068 CDS open 68897-70960 _na     687_aa copB putative copper-transporting P-type ATPase B
237 JAKUUV010000001.1 GCA022695885_00069 CDS open 70975-72408 _na     477_aa mco Multicopper oxidase mco
238 JAKUUV010000001.1 GCA022695885_00070 CDS open 72486-72815 _na     109_aa ydhK YdhK family protein
239 JAKUUV010000001.1 GCA022695885_00071 CDS open 73276-74223 _na     315_aa 2-dehydropantoate 2-reductase
240 JAKUUV010000001.1 GCA022695885_00072 CDS open 74497-75582 _na     361_aa yadH ABC transporter permease
241 JAKUUV010000001.1 GCA022695885_00073 CDS open 75579-76307 _na     242_aa rbbA ABC transporter ATP-binding protein
242 JAKUUV010000001.1 GCA022695885_00074 CDS open 76456-77016 _na     186_aa TetR/AcrR family transcriptional regulator
243 JAKUUV010000001.1 GCA022695885_00075 CDS open 77296-77763 _na     155_aa bstA bacillithiol transferase BstA
244 JAKUUV010000001.1 GCA022695885_00076 CDS open 78319-79470 _na     383_aa tdh Alcohol dehydrogenase
245 JAKUUV010000001.1 GCA022695885_00077 CDS open 80173-80712 _na     179_aa hypothetical protein
246 JAKUUV010000001.1 GCA022695885_00079 CDS open 81265-82998 _na     577_aa tnp IS1182 family transposase
247 JAKUUV010000001.1 GCA022695885_00080 CDS open 82935-83975 _na     346_aa NAD(P)-dependent alcohol dehydrogenase
248 JAKUUV010000001.1 GCA022695885_00081 CDS open 84264-84905 _na     213_aa NAD(P)-binding domain-containing protein
249 JAKUUV010000001.1 GCA022695885_00082 CDS open 85164-85655 _na     163_aa Tryptophan-rich sensory protein
250 JAKUUV010000001.1 GCA022695885_00083 CDS open 85797-85997 _na     66_aa cspA Cold shock protein CspA
251 JAKUUV010000001.1 GCA022695885_00084 CDS open 86301-87707 _na     468_aa Glycosyltransferase
252 JAKUUV010000001.1 GCA022695885_00085 CDS open 88125-89486 _na     453_aa melB Sugar transporter
253 JAKUUV010000001.1 GCA022695885_00086 CDS open 89773-90972 _na     399_aa GTP-binding protein
254 JAKUUV010000001.1 GCA022695885_00087 CDS open 91293-91625 _na     110_aa DUF4870 domain-containing protein
255 JAKUUV010000001.1 GCA022695885_00088 CDS open 91817-92281 _na     154_aa DUF2975 domain-containing protein
256 JAKUUV010000001.1 GCA022695885_00089 CDS open 92367-92879 _na     170_aa Universal stress protein
257 JAKUUV010000001.1 GCA022695885_00090 CDS open 93066-93944 _na     292_aa mscS Mechanosensitive ion channel protein MscS
258 JAKUUV010000001.1 GCA022695885_00091 CDS open 94139-94339 _na     66_aa xkdX XkdX family protein
259 JAKUUV010000001.1 GCA022695885_00092 CDS open 94399-94797 _na     132_aa arsC arsenate reductase (thioredoxin)
260 JAKUUV010000001.1 GCA022695885_00093 CDS open 94837-96384 _na     515_aa sdcS Sodium-dependent dicarboxylate transporter SdcS
261 JAKUUV010000001.1 GCA022695885_00094 CDS open 96849-97832 _na     327_aa ABC transporter substrate-binding protein
262 JAKUUV010000001.1 GCA022695885_00095 CDS open 98018-98242 _na     74_aa DUF1447 domain-containing protein
263 JAKUUV010000001.1 GCA022695885_00096 CDS open 98457-99815 _na     452_aa brnQ branched-chain amino acid transport system II carrier protein
264 JAKUUV010000001.1 GCA022695885_00097 CDS open 99953-102073 _na     706_aa AAA family ATPase
265 JAKUUV010000001.1 GCA022695885_00098 CDS open 102070-103104 _na     344_aa mcrC 5-methylcytosine-specific restriction endonuclease system specificity protein McrC
266 JAKUUV010000001.1 GCA022695885_00099 CDS open 103194-104501 _na     435_aa NtaA/DmoA family FMN-dependent monooxygenase
267 JAKUUV010000001.1 GCA022695885_00100 CDS open 104580-105956 _na     458_aa Amino acid permease
268 JAKUUV010000001.1 GCA022695885_00102 CDS open 106403-108073 _na     556_aa tnp IS1182 family transposase
269 JAKUUV010000001.1 GCA022695885_00103 CDS open 108175-108351 _na     58_aa hypothetical protein
270 JAKUUV010000001.1 GCA022695885_00104 CDS open 108348-109190 _na     280_aa tnp IS3 family ISSau4 transposase ORF B
271 JAKUUV010000001.1 GCA022695885_00106 CDS open 109175-109489 _na     104_aa tnp IS3 family ISSau4 transposase ORF A
272 JAKUUV010000001.1 GCA022695885_00107 CDS open 109579-110070 _na     163_aa Nitroreductase family protein
273 JAKUUV010000001.1 GCA022695885_00108 CDS open 110279-112288 _na     669_aa Catalase
274 JAKUUV010000001.1 GCA022695885_00109 CDS open 112488-113018 _na     176_aa VOC family protein
275 JAKUUV010000001.1 GCA022695885_00110 CDS open 113145-113438 _na     97_aa Phage gp6-like head-tail connector protein
276 JAKUUV010000001.1 GCA022695885_00111 CDS open 113655-115967 _na     770_aa lip YSIRK-targeted triacylglycerol lipase
277 JAKUUV010000001.1 GCA022695885_00112 CDS open 116361-117872 _na     503_aa norB Quinolone resistance protein NorB
278 JAKUUV010000001.1 GCA022695885_00114 CDS open 118334-119206 _na     290_aa Serine protease
279 JAKUUV010000001.1 GCA022695885_00115 CDS open 119328-120248 _na     306_aa Lipoprotein
280 JAKUUV010000001.1 GCA022695885_00116 CDS open 120275-121150 _na     291_aa HTH domain-containing protein
281 JAKUUV010000001.1 GCA022695885_00117 CDS open 121269-122123 _na     284_aa oxidoreductase
282 JAKUUV010000001.1 GCA022695885_00118 CDS open 122206-123033 _na     275_aa panB 3-methyl-2-oxobutanoate hydroxymethyltransferase
283 JAKUUV010000001.1 GCA022695885_00119 CDS open 123017-123868 _na     283_aa panC pantoate--beta-alanine ligase
284 JAKUUV010000001.1 GCA022695885_00120 CDS open 123874-124257 _na     127_aa panD aspartate 1-decarboxylase
285 JAKUUV010000001.1 GCA022695885_00121 CDS open 124392-125843 _na     483_aa Sulfate permease
286 JAKUUV010000001.1 GCA022695885_00122 CDS open 125890-126561 _na     223_aa M15 family metallopeptidase
287 JAKUUV010000001.1 GCA022695885_00123 CDS open 126766-127641 _na     291_aa Lipoprotein
288 JAKUUV010000001.1 GCA022695885_00124 CDS open 127968-129116 _na     382_aa arsB arsenite efflux transporter membrane subunit ArsB
289 JAKUUV010000001.1 GCA022695885_00125 CDS open 129294-130688 _na     464_aa abgT AbgT family transporter
290 JAKUUV010000001.1 GCA022695885_00126 CDS open 130807-131991 _na     394_aa MFS transporter
291 JAKUUV010000001.1 GCA022695885_00127 CDS open 132122-133012 _na     296_aa Transcriptional regulator
292 JAKUUV010000001.1 GCA022695885_00128 CDS open 133119-133898 _na     259_aa (S)-acetoin forming diacetyl reductase
293 JAKUUV010000001.1 GCA022695885_00129 CDS open 134348-134587 _na     79_aa hypothetical protein
294 JAKUUV010000001.1 GCA022695885_00130 CDS open 134740-136083 _na     447_aa Sugar porter family MFS transporter
295 JAKUUV010000001.1 GCA022695885_00131 CDS open 136184-137887 _na     567_aa ATPase
296 JAKUUV010000001.1 GCA022695885_00132 CDS open 138254-138694 _na     146_aa sarZ HTH-type transcriptional regulator SarZ
297 JAKUUV010000001.1 GCA022695885_00133 CDS open 138712-140055 _na     447_aa NAD(P)/FAD-dependent oxidoreductase
298 JAKUUV010000001.1 GCA022695885_00134 CDS open 140190-141047 _na     285_aa ABC transporter substrate-binding protein
299 JAKUUV010000001.1 GCA022695885_00135 CDS open 141096-141863 _na     255_aa SDR family oxidoreductase
300 JAKUUV010000001.1 GCA022695885_00136 CDS open 141885-143318 _na     477_aa Acyl-CoA reductase
301 JAKUUV010000001.1 GCA022695885_00137 CDS open 143330-144397 _na     355_aa Long-chain fatty acid--CoA ligase
302 JAKUUV010000001.1 GCA022695885_00138 CDS open 144869-145441 _na     190_aa ECF transporter S component
303 JAKUUV010000001.1 GCA022695885_00139 CDS open 145523-146515 _na     330_aa yeiH UPF0324 membrane protein SERP0111
304 JAKUUV010000001.1 GCA022695885_00140 CDS open 146629-147450 _na     273_aa lysR Transcriptional regulator%2C LysR family
305 JAKUUV010000001.1 GCA022695885_00141 CDS open 147521-148207 _na     228_aa Type 1 glutamine amidotransferase domain-containing protein
306 JAKUUV010000001.1 GCA022695885_00142 CDS open 148499-149011 _na     170_aa hdeD HdeD family acid-resistance protein
307 JAKUUV010000001.1 GCA022695885_00143 CDS open 149190-150386 _na     398_aa 3M3SH-releasing C-S lyase
308 JAKUUV010000001.1 GCA022695885_00144 CDS open 150403-150810 _na     135_aa Carboxymuconolactone decarboxylase family protein
309 JAKUUV010000001.1 GCA022695885_00145 CDS open 150856-151473 _na     205_aa cadD CadD family cadmium resistance transporter
310 JAKUUV010000001.1 GCA022695885_00146 CDS open 151733-153085 _na     450_aa lpdA dihydrolipoyl dehydrogenase
311 JAKUUV010000001.1 GCA022695885_00147 CDS open 153127-154080 _na     317_aa acoA Acetoin dehydrogenase%2C E1 component%2C alpha subunit
312 JAKUUV010000001.1 GCA022695885_00148 CDS open 154150-155190 _na     346_aa acoB Pyruvate dehydrogenase E1 component subunit beta
313 JAKUUV010000001.1 GCA022695885_00149 CDS open 155205-156488 _na     427_aa Dihydrolipoamide acetyltransferase component of pyruvate dehydrogenase complex
314 JAKUUV010000001.1 GCA022695885_00150 CDS open 156584-156799 _na     71_aa GTP-binding protein
315 JAKUUV010000001.1 GCA022695885_00151 CDS open 157290-159032 _na     580_aa thiC phosphomethylpyrimidine synthase ThiC
316 JAKUUV010000001.1 GCA022695885_00152 CDS open 159169-160074 _na     301_aa rarD EamA family transporter RarD
317 JAKUUV010000001.1 GCA022695885_00153 CDS open 160147-160281 _na     44_aa hypothetical protein
318 JAKUUV010000001.1 GCA022695885_00154 CDS open 160306-160428 _na     40_aa hypothetical protein
319 JAKUUV010000001.1 GCA022695885_00155 CDS open 160614-160787 _na     57_aa hypothetical protein
320 JAKUUV010000001.1 GCA022695885_00156 CDS open 161032-161550 _na     172_aa isaB immunodominant staphylococcal antigen IsaB family protein
321 JAKUUV010000001.1 GCA022695885_00157 CDS open 161600-161764 _na     54_aa Mid2-like cell wall stress sensor domain protein
322 JAKUUV010000001.1 GCA022695885_00158 CDS open 162091-162279 _na     62_aa hypothetical protein
323 JAKUUV010000001.1 GCA022695885_00159 CDS open 162962-163141 _na     59_aa DNA-binding protein
324 JAKUUV010000001.1 GCA022695885_00160 CDS open 163438-163644 _na     68_aa Mid2-like cell wall stress sensor domain protein
325 JAKUUV010000001.1 GCA022695885_00161 CDS open 163887-164099 _na     70_aa vraH VraH family protein
326 JAKUUV010000001.1 GCA022695885_00162 CDS open 164548-164706 _na     52_aa Fe3+ hydroxamate ABC transporter substrate-binding protein
327 JAKUUV010000001.1 GCA022695885_00163 CDS open 164751-165398 _na     215_aa Stage II sporulation protein M
328 JAKUUV010000001.1 GCA022695885_00164 CDS open 165930-168188 _na     752_aa UvrABC system protein A
329 JAKUUV010000001.1 GCA022695885_00165 CDS open 168462-168656 _na     64_aa Alcohol dehydrogenase
330 JAKUUV010000001.1 GCA022695885_00167 CDS open 169379-170587 _na     402_aa apeA ApeA N-terminal domain-containing protein
331 JAKUUV010000001.1 GCA022695885_00168 CDS open 170678-171352 _na     224_aa tnp IS6 family IS431mec transposase
332 JAKUUV010000001.1 GCA022695885_00169 CDS open 171677-173023 _na     448_aa mntH Nramp family divalent metal transporter
333 JAKUUV010000001.1 GCA022695885_00170 CDS open 173223-173642 _na     139_aa DUF4064 domain-containing protein
334 JAKUUV010000001.1 GCA022695885_00171 CDS open 173756-174430 _na     224_aa tnp IS6 family IS431mec transposase
335 JAKUUV010000001.1 GCA022695885_00172 CDS open 174693-175550 _na     285_aa yitT DUF2179 domain-containing protein
336 JAKUUV010000001.1 GCA022695885_00173 CDS open 176424-176567 _na     47_aa marR MarR family transcriptional regulator
337 JAKUUV010000001.1 GCA022695885_00174 CDS open 176578-177120 _na     180_aa Resolvase%2C putative
338 JAKUUV010000001.1 GCA022695885_00175 CDS open 177235-178686 _na     483_aa Sulfate permease family protein
339 JAKUUV010000001.1 GCA022695885_00176 CDS open 178699-179112 _na     137_aa Universal stress protein
340 JAKUUV010000001.1 GCA022695885_00178 CDS open 179479-181221 _na     580_aa tnp IS1182 family transposase
341 JAKUUV010000001.1 GCA022695885_00179 CDS open 181640-181792 _na     50_aa hypothetical protein
342 JAKUUV010000001.1 GCA022695885_00180 CDS open 182031-182321 _na     96_aa Mobilization protein
343 JAKUUV010000001.1 GCA022695885_00181 CDS open 182396-182593 _na     65_aa hypothetical protein
344 JAKUUV010000001.1 GCA022695885_00182 CDS open 182580-182912 _na     110_aa Relaxase/mobilization nuclease domain-containing protein
345 JAKUUV010000001.1 GCA022695885_00183 CDS open 182899-183099 _na     66_aa hypothetical protein
346 JAKUUV010000001.1 GCA022695885_00184 CDS open 183422-183853 _na     143_aa uspA UspA domain-containing protein
347 JAKUUV010000001.1 GCA022695885_00185 CDS open 184451-184606 _na     51_aa hypothetical protein
348 JAKUUV010000001.1 GCA022695885_00186 CDS open 184749-185021 _na     90_aa hypothetical protein
349 JAKUUV010000001.1 GCA022695885_00187 CDS open 185800-186843 _na     347_aa frwC PTS sugar transporter subunit IIC
350 JAKUUV010000001.1 GCA022695885_00188 CDS open 187022-188020 _na     332_aa argF ornithine carbamoyltransferase
351 JAKUUV010000001.1 GCA022695885_00189 CDS open 188041-188970 _na     309_aa arcC carbamate kinase
352 JAKUUV010000001.1 GCA022695885_00190 CDS open 189288-190253 _na     321_aa bioB biotin synthase BioB
353 JAKUUV010000001.1 GCA022695885_00191 CDS open 190370-191977 _na     535_aa BCCT family transporter
354 JAKUUV010000001.1 GCA022695885_00192 CDS open 192198-193352 _na     384_aa nagA N-acetylglucosamine-6-phosphate deacetylase
355 JAKUUV010000001.1 GCA022695885_00193 CDS open 193484-193726 _na     80_aa DUF3923 domain-containing protein
356 JAKUUV010000001.1 GCA022695885_00194 CDS open 193778-194509 _na     243_aa nagB glucosamine-6-phosphate deaminase
357 JAKUUV010000001.1 GCA022695885_00195 CDS open 194531-195205 _na     224_aa Putative N-acetylmannosamine-6-phosphate 2-epimerase
358 JAKUUV010000001.1 GCA022695885_00196 CDS open 195406-196212 _na     268_aa MurR/RpiR family transcriptional regulator
359 JAKUUV010000001.1 GCA022695885_00197 CDS open 196254-197114 _na     286_aa N-acetylmannosamine kinase
360 JAKUUV010000001.1 GCA022695885_00198 CDS open 197344-198225 _na     293_aa N-acetylneuraminate lyase
361 JAKUUV010000001.1 GCA022695885_00199 CDS open 198272-199804 _na     510_aa Na+/proline symporter
362 JAKUUV010000001.1 GCA022695885_00200 CDS open 199912-200739 _na     275_aa CAAX protease
363 JAKUUV010000001.1 GCA022695885_00201 CDS open 200812-201498 _na     228_aa NDxxF motif lipoprotein
364 JAKUUV010000001.1 GCA022695885_00202 CDS open 201603-202406 _na     267_aa CPBP family intramembrane metalloprotease
365 JAKUUV010000001.1 GCA022695885_00203 CDS open 202561-203187 _na     208_aa ATP-binding cassette domain-containing protein
366 JAKUUV010000001.1 GCA022695885_00204 CDS open 203174-203947 _na     257_aa ABC transporter ATP-binding protein
367 JAKUUV010000001.1 GCA022695885_00205 CDS open 203914-204681 _na     255_aa ABC transmembrane type-1 domain-containing protein
368 JAKUUV010000001.1 GCA022695885_00206 CDS open 204671-205630 _na     319_aa ABC transporter permease
369 JAKUUV010000001.1 GCA022695885_00207 CDS open 205623-207185 _na     520_aa Nickel ABC transporter substrate-binding protein
370 JAKUUV010000001.1 GCA022695885_00208 CDS open 207347-207985 _na     212_aa pcp pyroglutamyl-peptidase I
371 JAKUUV010000001.1 GCA022695885_00209 CDS open 208168-208941 _na     257_aa Diacetyl reductase [(S)-acetoin forming]
372 JAKUUV010000001.1 GCA022695885_00210 CDS open 209027-210004 _na     325_aa Choloylglycine hydrolase family protein
373 JAKUUV010000001.1 GCA022695885_00211 CDS open 210024-211214 _na     396_aa MFS transporter
374 JAKUUV010000001.1 GCA022695885_00212 CDS open 211317-212279 _na     320_aa trhO rhodanese-related sulfurtransferase
375 JAKUUV010000001.1 GCA022695885_00213 CDS open 212539-213519 _na     326_aa drp35 Lactonase drp35
376 JAKUUV010000001.1 GCA022695885_00214 CDS open 213698-215344 _na     548_aa Phosphoglucomutase
377 JAKUUV010000001.1 GCA022695885_00215 CDS open 215418-216272 _na     284_aa ureD Urease accessory protein UreD
378 JAKUUV010000001.1 GCA022695885_00216 CDS open 216272-216886 _na     204_aa ureG urease accessory protein UreG
379 JAKUUV010000001.1 GCA022695885_00217 CDS open 216899-217588 _na     229_aa ureF Urease accessory protein UreF
380 JAKUUV010000001.1 GCA022695885_00218 CDS open 217581-218033 _na     150_aa ureE urease accessory protein UreE
381 JAKUUV010000001.1 GCA022695885_00219 CDS open 218045-219760 _na     571_aa ureC urease subunit alpha
382 JAKUUV010000001.1 GCA022695885_00221 CDS open 219760-220167 _na     135_aa urease subunit beta
383 JAKUUV010000001.1 GCA022695885_00222 CDS open 220181-220483 _na     100_aa ureA urease subunit gamma
384 JAKUUV010000001.1 GCA022695885_00223 CDS open 220684-221586 _na     300_aa yut urea transporter
385 JAKUUV010000001.1 GCA022695885_00224 CDS open 221703-222581 _na     292_aa Ribokinase
386 JAKUUV010000001.1 GCA022695885_00225 CDS open 222721-223860 _na     379_aa Polysaccharide deacetylase
387 JAKUUV010000001.1 GCA022695885_00226 CDS open 224026-225177 _na     383_aa pbp4 penicillin-binding protein PBP4
388 JAKUUV010000001.1 GCA022695885_00227 CDS open 225272-225856 _na     194_aa TetR/AcrR family transcriptional regulator
389 JAKUUV010000001.1 GCA022695885_00228 CDS open 226053-227828 _na     591_aa oleate hydratase
390 JAKUUV010000001.1 GCA022695885_00229 CDS open 228249-229034 _na     261_aa Acetyltransferase
391 JAKUUV010000001.1 GCA022695885_00230 CDS open 229114-229749 _na     211_aa ABC-2 transporter permease
392 JAKUUV010000001.1 GCA022695885_00231 CDS open 229749-230594 _na     281_aa ABC transporter ATP-binding protein
393 JAKUUV010000001.1 GCA022695885_00232 CDS open 230625-231347 _na     240_aa DUF3169 domain-containing protein
394 JAKUUV010000001.1 GCA022695885_00233 CDS open 231344-231547 _na     67_aa ygzD putative HTH-type transcriptional regulator YgzD
395 JAKUUV010000001.1 GCA022695885_00234 CDS open 231674-232156 _na     160_aa Rrf2 family transcriptional regulator
396 JAKUUV010000001.1 GCA022695885_00235 CDS open 232292-233212 _na     306_aa DMT family transporter
397 JAKUUV010000001.1 GCA022695885_00236 CDS open 233450-234619 _na     389_aa MFS transporter
398 JAKUUV010000001.1 GCA022695885_00237 CDS open 234685-236226 _na     513_aa Bifunctional metallophosphatase/5'-nucleotidase
399 JAKUUV010000001.1 GCA022695885_00238 CDS open 236327-237964 _na     545_aa DNA-binding protein
400 JAKUUV010000001.1 GCA022695885_00239 CDS open 238215-239177 _na     320_aa phnD Phosphate/phosphite/phosphonate ABC transporter substrate-binding protein
401 JAKUUV010000001.1 GCA022695885_00240 CDS open 239316-240089 _na     257_aa phnC phosphonate ABC transporter ATP-binding protein
402 JAKUUV010000001.1 GCA022695885_00241 CDS open 240091-240891 _na     266_aa phnE phosphonate ABC transporter%2C permease protein PhnE
403 JAKUUV010000001.1 GCA022695885_00242 CDS open 240888-241715 _na     275_aa phnE phosphonate ABC transporter%2C permease protein PhnE
404 JAKUUV010000001.1 GCA022695885_00243 CDS open 242805-243287 _na     160_aa GNAT family N-acetyltransferase
405 JAKUUV010000001.1 GCA022695885_00244 CDS open 243304-243780 _na     158_aa peptide-methionine (S)-S-oxide reductase
406 JAKUUV010000001.1 GCA022695885_00245 CDS open 243831-244184 _na     117_aa doxX DoxX family protein
407 JAKUUV010000001.1 GCA022695885_00246 CDS open 244322-244675 _na     117_aa doxX DoxX family protein
408 JAKUUV010000001.1 GCA022695885_00247 CDS open 244888-246066 _na     392_aa MFS transporter
409 JAKUUV010000001.1 GCA022695885_00248 CDS open 246379-246939 _na     186_aa TetR/AcrR family transcriptional regulator
410 JAKUUV010000001.1 GCA022695885_00249 CDS open 247123-248064 _na     313_aa ABC transporter substrate-binding protein
411 JAKUUV010000001.1 GCA022695885_00250 CDS open 248064-250607 _na     847_aa SSD domain-containing protein
412 JAKUUV010000001.1 GCA022695885_00251 CDS open 250849-251016 _na     55_aa Mid2-like cell wall stress sensor domain protein
413 JAKUUV010000001.1 GCA022695885_00252 CDS open 251270-252154 _na     294_aa lysR LysR family transcriptional regulator
414 JAKUUV010000001.1 GCA022695885_00253 CDS open 252411-253022 _na     203_aa Metallophosphoesterase
415 JAKUUV010000001.1 GCA022695885_00254 CDS open 253141-255384 _na     747_aa Cell wall anchor protein
416 JAKUUV010000001.1 GCA022695885_00255 CDS open 255656-257233 _na     525_aa yfcC YfcC family protein
417 JAKUUV010000001.1 GCA022695885_00256 CDS open 257363-258535 _na     390_aa tnp IS256 family IS256 transposase
418 JAKUUV010000001.1 GCA022695885_00257 CDS open 258665-260104 _na     479_aa aac(6')-Ie bifunctional aminoglycoside N-acetyltransferase AAC(6')-Ie/aminoglycoside O-phosphotransferase APH(2'')-Ia
419 JAKUUV010000001.1 GCA022695885_00258 CDS open 260105-260509 _na     134_aa Acetyltransferase
420 JAKUUV010000001.1 GCA022695885_00259 CDS open 260554-261726 _na     390_aa tnp IS256 family IS256 transposase
421 JAKUUV010000001.1 GCA022695885_00260 CDS open 261862-264060 _na     732_aa amidase domain-containing protein
422 JAKUUV010000001.1 GCA022695885_00261 CDS open 264325-267153 _na     942_aa YhgE/Pip domain-containing protein
423 JAKUUV010000001.1 GCA022695885_00262 CDS open 267209-267715 _na     168_aa DUF4887 domain-containing protein
424 JAKUUV010000001.1 GCA022695885_00263 CDS open 267918-268439 _na     173_aa isaB immunodominant staphylococcal antigen IsaB family protein
425 JAKUUV010000001.1 GCA022695885_00264 CDS open 268485-268769 _na     94_aa YolD-like family protein
426 JAKUUV010000001.1 GCA022695885_00265 CDS open 268964-270076 _na     370_aa xerD Transposase
427 JAKUUV010000001.1 GCA022695885_00266 CDS open 270079-272142 _na     687_aa Transposase B regulatory protein
428 JAKUUV010000001.1 GCA022695885_00267 CDS open 272151-272516 _na     121_aa Transposase
429 JAKUUV010000001.1 GCA022695885_00268 CDS open 272518-273891 _na     457_aa hypothetical protein
430 JAKUUV010000001.1 GCA022695885_00269 CDS open 273945-274355 _na     136_aa YolD-like family protein
431 JAKUUV010000001.1 GCA022695885_00270 CDS open 274618-275790 _na     390_aa tnp IS256 family IS256 transposase
432 JAKUUV010000001.1 GCA022695885_00271 CDS open 275996-276841 _na     281_aa blaZ penicillin-hydrolyzing class A beta-lactamase BlaZ
433 JAKUUV010000001.1 GCA022695885_00272 CDS open 276948-278705 _na     585_aa blaR1 beta-lactam sensor/signal transducer BlaR1
434 JAKUUV010000001.1 GCA022695885_00273 CDS open 278695-279075 _na     126_aa blaI penicillinase repressor BlaI
435 JAKUUV010000001.1 GCA022695885_00274 CDS open 279089-279271 _na     60_aa YolD-like family protein
436 JAKUUV010000001.1 GCA022695885_00275 CDS open 279603-280127 _na     174_aa isaB immunodominant staphylococcal antigen IsaB family protein
437 JAKUUV010000001.1 GCA022695885_00276 CDS open 280380-281615 _na     411_aa arcA arginine deiminase
438 JAKUUV010000001.1 GCA022695885_00277 CDS open 281752-282513 _na     253_aa Esterase family protein
439 JAKUUV010000001.1 GCA022695885_00278 CDS open 282937-284079 _na     380_aa capA Capsule biosynthesis protein CapA
440 JAKUUV010000001.1 GCA022695885_00279 CDS open 284160-285800 _na     546_aa Alpha-keto acid decarboxylase family protein
441 JAKUUV010000001.1 GCA022695885_00280 CDS open 285948-286403 _na     151_aa marR MarR family transcriptional regulator
442 JAKUUV010000001.1 GCA022695885_00281 CDS open 287264-287542 _na     92_aa DUF1361 domain-containing protein
443 JAKUUV010000001.1 GCA022695885_00282 CDS open 287704-287805 _na     33_aa SE2200 family small protein
444 JAKUUV010000001.1 GCA022695885_00283 CDS open 288157-289632 _na     491_aa Alkaline phosphatase
445 JAKUUV010000001.1 GCA022695885_00285 CDS open 289912-291084 _na     390_aa tnp IS256 family IS256 transposase
446 JAKUUV010000001.1 GCA022695885_00286 CDS open 291345-291518 _na     57_aa hypothetical protein
447 JAKUUV010000001.1 GCA022695885_00287 CDS open 291687-291854 _na     55_aa hypothetical protein
448 JAKUUV010000001.1 GCA022695885_00288 CDS open 291867-292532 _na     221_aa Response regulator transcription factor
449 JAKUUV010000001.1 GCA022695885_00289 CDS open 292538-293434 _na     298_aa histidine kinase
450 JAKUUV010000001.1 GCA022695885_00290 CDS open 293566-294315 _na     249_aa ABC transporter ATP-binding protein
451 JAKUUV010000001.1 GCA022695885_00291 CDS open 294317-296272 _na     651_aa ABC transporter permease
452 JAKUUV010000001.1 GCA022695885_00292 CDS open 296360-297124 _na     254_aa DUF4064 domain-containing protein
453 JAKUUV010000001.1 GCA022695885_00293 CDS open 297220-298512 _na     430_aa LLM class flavin-dependent oxidoreductase
454 JAKUUV010000001.1 GCA022695885_00294 CDS open 298576-299325 _na     249_aa 3-oxoacyl-ACP reductase
455 JAKUUV010000001.1 GCA022695885_00295 CDS open 299836-301428 _na     530_aa solute:sodium symporter family transporter
456 JAKUUV010000001.1 GCA022695885_00296 CDS open 301519-302721 _na     400_aa 5%2C10-methylene-tetrahydrofolate dehydrogenase
457 JAKUUV010000001.1 GCA022695885_00297 CDS open 302718-303824 _na     368_aa 5%2C10-methylene-tetrahydrofolate dehydrogenase
458 JAKUUV010000001.1 GCA022695885_00298 CDS open 304269-305000 _na     243_aa cysH phosphoadenylyl-sulfate reductase
459 JAKUUV010000001.1 GCA022695885_00299 CDS open 305163-307016 _na     617_aa assimilatory sulfite reductase (NADPH) flavoprotein subunit
460 JAKUUV010000001.1 GCA022695885_00300 CDS open 307035-308756 _na     573_aa cysI assimilatory sulfite reductase (NADPH) hemoprotein subunit
461 JAKUUV010000001.1 GCA022695885_00301 CDS open 308792-309556 _na     254_aa uroporphyrinogen-III C-methyltransferase
462 JAKUUV010000001.1 GCA022695885_00302 CDS open 309590-310201 _na     203_aa NAD(P)-binding protein
463 JAKUUV010000001.1 GCA022695885_00303 CDS open 310223-311098 _na     291_aa putative membrane transporter protein
464 JAKUUV010000001.1 GCA022695885_00304 CDS open 311141-312322 _na     393_aa Sulfate adenylyltransferase
465 JAKUUV010000001.1 GCA022695885_00305 CDS open 312341-312940 _na     199_aa Adenylyl-sulfate kinase
466 JAKUUV010000001.1 GCA022695885_00306 CDS open 313369-314151 _na     260_aa CHAP domain-containing protein
467 JAKUUV010000001.1 GCA022695885_00307 CDS open 314373-314615 _na     80_aa hypothetical protein
468 JAKUUV010000001.1 GCA022695885_00308 CDS open 314781-316073 _na     430_aa Anaerobic C4-dicarboxylate transporter
469 JAKUUV010000001.1 GCA022695885_00309 CDS open 316503-318125 _na     540_aa BCCT family transporter
470 JAKUUV010000001.1 GCA022695885_00310 CDS open 318218-318772 _na     184_aa cudC choline uptake/conversion transcriptional regulator CudC
471 JAKUUV010000001.1 GCA022695885_00311 CDS open 319011-320501 _na     496_aa betB betaine-aldehyde dehydrogenase
472 JAKUUV010000001.1 GCA022695885_00312 CDS open 320638-322344 _na     568_aa betA choline dehydrogenase
473 JAKUUV010000001.1 GCA022695885_00313 CDS open 322474-323655 _na     393_aa Amidohydrolase
474 JAKUUV010000001.1 GCA022695885_00314 CDS open 323799-323987 _na     62_aa yozE YozE SAM-like domain-containing protein
475 JAKUUV010000001.1 GCA022695885_00315 CDS open 324051-324533 _na     160_aa Signal transduction protein TRAP
476 JAKUUV010000001.1 GCA022695885_00316 CDS open 324677-326269 _na     530_aa mbcS acyl-CoA synthetase MbcS
477 JAKUUV010000001.1 GCA022695885_00317 CDS open 326483-329107 _na     874_aa ppdK pyruvate%2C phosphate dikinase
478 JAKUUV010000001.1 GCA022695885_00318 CDS open 329114-329944 _na     276_aa Putative pyruvate%2C phosphate dikinase regulatory protein
479 JAKUUV010000001.1 GCA022695885_00319 CDS open 330265-331767 _na     500_aa lqo L-lactate dehydrogenase (quinone)
480 JAKUUV010000001.1 GCA022695885_00320 CDS open 331909-332799 _na     296_aa fda fructose bisphosphate aldolase
481 JAKUUV010000001.1 GCA022695885_00321 CDS open 332976-333467 _na     163_aa Topology modulation protein
482 JAKUUV010000001.1 GCA022695885_00322 CDS open 333660-334982 _na     440_aa GTP-binding protein
483 JAKUUV010000001.1 GCA022695885_00323 CDS open 335123-335746 _na     207_aa Cell surface protein
484 JAKUUV010000001.1 GCA022695885_00324 CDS open 335913-336338 _na     141_aa Integral membrane protein
485 JAKUUV010000001.1 GCA022695885_00325 CDS open 336701-337516 _na     271_aa nlpA Lipoprotein
486 JAKUUV010000001.1 GCA022695885_00326 CDS open 337719-339056 _na     445_aa aspartate aminotransferase family protein
487 JAKUUV010000001.1 GCA022695885_00327 CDS open 339184-340635 _na     483_aa Amino acid permease
488 JAKUUV010000001.1 GCA022695885_00328 CDS open 341375-343039 _na     554_aa alsS acetolactate synthase AlsS
489 JAKUUV010000001.1 GCA022695885_00329 CDS open 343068-343772 _na     234_aa budA acetolactate decarboxylase
490 JAKUUV010000001.1 GCA022695885_00330 CDS open 343898-344830 _na     310_aa Zinc ribbon domain-containing protein
491 JAKUUV010000001.1 GCA022695885_00331 CDS open 345089-345805 _na     238_aa queH Epoxyqueuosine reductase QueH
492 JAKUUV010000001.1 GCA022695885_00332 CDS open 345858-346133 _na     91_aa hypothetical protein
493 JAKUUV010000001.1 GCA022695885_00333 CDS open 346205-347275 _na     356_aa quinone-dependent dihydroorotate dehydrogenase
494 JAKUUV010000001.1 GCA022695885_00334 CDS open 347501-348355 _na     284_aa Fructosamine kinase
495 JAKUUV010000001.1 GCA022695885_00335 CDS open 348450-348650 _na     66_aa hypothetical protein
496 JAKUUV010000001.1 GCA022695885_00336 CDS open 348615-348851 _na     78_aa ynzC UPF0291 protein B8W97_03865
497 JAKUUV010000001.1 GCA022695885_00337 CDS open 348864-349808 _na     314_aa ssuD LLM class flavin-dependent oxidoreductase
498 JAKUUV010000001.1 GCA022695885_00338 CDS open 349966-350532 _na     188_aa TetR/AcrR family transcriptional regulator
499 JAKUUV010000001.1 GCA022695885_00339 CDS open 350822-351880 _na     352_aa Phosphotransferase system EIIC domain-containing protein
500 JAKUUV010000001.1 GCA022695885_00340 CDS open 351991-353415 _na     474_aa Phosphate--AMP phosphotransferase