HOMD Banner
Taxonomy: V4.3   |  16S rRNA RefSeq: V16.03   |  Genomic RefSeq: V11.03   |  Viruses: V1.2

BAKTAGenome Explorer: Prevotella intermedia (GCA_905372255.1)

Select a Genome:
BAKTA Annotations for GCA_905372255.1
Genome Selected: Prevotella intermedia
ContigsBases CDSrRNA tmRNAtRNA
75 2,550,728 2138 0 1 44
[Table]   [AA Fasta]      [Browser]   [Text]   [Excel]  
Search & Sort all 4386 Records
Search These Records: Clear
Sort Column:   Molecule   PID   NA   AA   Gene  Gene Product  Reverse
Annotation Table [page:8]    |    Number of Records Found: 4386 [9 Pages]    |    Previous Page <==> Next Page    |    Jump to Page: [ 1  2  3  4  5  6  7  8  9  ]
Notes:   1- Column headers only sort the current page. 2- Select [NA] or [AA] links to show sequences.
Region Protein-ID Type Genome
Viewer		 Range
(bp)		 Show Sequences
(length) NA / AA		 BAKTA
Gene		 BAKTA
GeneProduct
3501 CAJPOK010000034.1 GCA905372255_01748 gene open 24660-25406 fabG
3502 CAJPOK010000034.1 GCA905372255_01749 gene open 25472-26140
3503 CAJPOK010000034.1 GCA905372255_01750 gene open 26148-26414
3504 CAJPOK010000034.1 GCA905372255_01751 gene open 26531-27289 ydfG
3505 CAJPOK010000035.1 GCA905372255_01752 CDS open 516-1910 _na     464_aa peptidase
3506 CAJPOK010000035.1 GCA905372255_01753 CDS open 2628-4022 _na     464_aa Peptidase
3507 CAJPOK010000035.1 GCA905372255_01754 CDS open 4649-6499 _na     616_aa Peptidase C25 gingipain C-terminal domain-containing protein
3508 CAJPOK010000035.1 GCA905372255_01755 CDS open 6999-7406 _na     135_aa osmC Stress-induced protein OsmC
3509 CAJPOK010000035.1 GCA905372255_01756 CDS open 7726-8439 _na     237_aa DUF2975 domain-containing protein
3510 CAJPOK010000035.1 GCA905372255_01757 CDS open 8454-8666 _na     70_aa Transcriptional regulator
3511 CAJPOK010000035.1 GCA905372255_01758 CDS open 8906-11725 _na     939_aa Peptidase M16 family/putative zinc protease
3512 CAJPOK010000035.1 GCA905372255_01759 CDS open 12766-13443 _na     225_aa hmuY Heme-binding protein HmuY
3513 CAJPOK010000035.1 GCA905372255_01760 CDS open 13565-15886 _na     773_aa TonB-dependent receptor
3514 CAJPOK010000035.1 GCA905372255_01761 CDS open 16025-20434 _na     1469_aa cobN Aerobic cobaltochelatase subunit CobN
3515 CAJPOK010000035.1 GCA905372255_01762 CDS open 20442-21140 _na     232_aa Sodium:proton antiporter
3516 CAJPOK010000035.1 GCA905372255_01763 CDS open 21190-21786 _na     198_aa MotA/TolQ/ExbB proton channel domain-containing protein
3517 CAJPOK010000035.1 GCA905372255_01764 CDS open 21790-22125 _na     111_aa DUF2149 domain-containing protein
3518 CAJPOK010000035.1 GCA905372255_01765 CDS open 22107-22592 _na     161_aa hypothetical protein
3519 CAJPOK010000035.1 GCA905372255_01766 CDS open 22914-23072 _na     52_aa Partial transposase
3520 CAJPOK010000035.1 GCA905372255_01767 CDS open 23200-23433 _na     77_aa Partial transposase in ISPi2
3521 CAJPOK010000035.1 GCA905372255_01768 CDS open 23704-24948 _na     414_aa Lipoprotein
3522 CAJPOK010000035.1 GCA905372255_01769 CDS open 24962-26275 _na     437_aa peptidoglycan DD-metalloendopeptidase family protein
3523 CAJPOK010000035.1 GCA905372255_01752 gene open 516-1910
3524 CAJPOK010000035.1 GCA905372255_01753 gene open 2628-4022
3525 CAJPOK010000035.1 GCA905372255_01754 gene open 4649-6499
3526 CAJPOK010000035.1 GCA905372255_01755 gene open 6999-7406 osmC
3527 CAJPOK010000035.1 GCA905372255_01756 gene open 7726-8439
3528 CAJPOK010000035.1 GCA905372255_01757 gene open 8454-8666
3529 CAJPOK010000035.1 GCA905372255_01758 gene open 8906-11725
3530 CAJPOK010000035.1 GCA905372255_01759 gene open 12766-13443 hmuY
3531 CAJPOK010000035.1 GCA905372255_01760 gene open 13565-15886
3532 CAJPOK010000035.1 GCA905372255_01761 gene open 16025-20434 cobN
3533 CAJPOK010000035.1 GCA905372255_01762 gene open 20442-21140
3534 CAJPOK010000035.1 GCA905372255_01763 gene open 21190-21786
3535 CAJPOK010000035.1 GCA905372255_01764 gene open 21790-22125
3536 CAJPOK010000035.1 GCA905372255_01765 gene open 22107-22592
3537 CAJPOK010000035.1 GCA905372255_01766 gene open 22914-23072
3538 CAJPOK010000035.1 GCA905372255_01767 gene open 23200-23433
3539 CAJPOK010000035.1 GCA905372255_01768 gene open 23704-24948
3540 CAJPOK010000035.1 GCA905372255_01769 gene open 24962-26275
3541 CAJPOK010000036.1 GCA905372255_01770 CDS open 168-1400 _na     410_aa ATPase
3542 CAJPOK010000036.1 GCA905372255_01771 CDS open 1436-1549 _na     37_aa hypothetical protein
3543 CAJPOK010000036.1 GCA905372255_01772 CDS open 1710-2240 _na     176_aa WG repeat-containing protein
3544 CAJPOK010000036.1 GCA905372255_01773 CDS open 2348-2629 _na     93_aa Secreted protein
3545 CAJPOK010000036.1 GCA905372255_01774 CDS open 3152-4015 _na     287_aa map type I methionyl aminopeptidase
3546 CAJPOK010000036.1 GCA905372255_01775 CDS open 4108-5142 _na     344_aa tsaD tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD
3547 CAJPOK010000036.1 GCA905372255_01776 CDS open 5155-5703 _na     182_aa cinA C-terminal domain of CinA type S
3548 CAJPOK010000036.1 GCA905372255_01777 CDS open 6636-6812 _na     58_aa hypothetical protein
3549 CAJPOK010000036.1 GCA905372255_01778 CDS open 6852-7016 _na     54_aa rubredoxin
3550 CAJPOK010000036.1 GCA905372255_01779 CDS open 7125-9512 _na     795_aa Ferric aerobactin receptor
3551 CAJPOK010000036.1 GCA905372255_01780 CDS open 9516-10367 _na     283_aa DUF4827 domain-containing protein
3552 CAJPOK010000036.1 GCA905372255_01781 CDS open 10434-11825 _na     463_aa glmM phosphoglucosamine mutase
3553 CAJPOK010000036.1 GCA905372255_01782 CDS open 11836-12450 _na     204_aa yihA ribosome biogenesis GTP-binding protein YihA/YsxC
3554 CAJPOK010000036.1 GCA905372255_01783 CDS open 12454-14235 _na     593_aa abc-f ribosomal protection-like ABC-F family protein
3555 CAJPOK010000036.1 GCA905372255_01784 CDS open 14657-16036 _na     459_aa radA DNA repair protein RadA
3556 CAJPOK010000036.1 GCA905372255_01785 CDS open 16103-17002 _na     299_aa SsuA/THI5-like domain-containing protein
3557 CAJPOK010000036.1 GCA905372255_01786 CDS open 17104-19254 _na     716_aa Tetratricopeptide repeat protein
3558 CAJPOK010000036.1 GCA905372255_01787 CDS open 19243-19554 _na     103_aa hypothetical protein
3559 CAJPOK010000036.1 GCA905372255_01788 CDS open 19631-20434 _na     267_aa MBL fold metallo-hydrolase
3560 CAJPOK010000036.1 GCA905372255_01789 CDS open 20557-22830 _na     757_aa Bacterial surface antigen (D15) domain-containing protein
3561 CAJPOK010000036.1 GCA905372255_01790 CDS open 22867-23667 _na     266_aa Putative tRNA/rRNA methyltransferase (SpoU)
3562 CAJPOK010000036.1 GCA905372255_01791 CDS open 23703-24278 _na     191_aa hypothetical protein
3563 CAJPOK010000036.1 GCA905372255_01770 gene open 168-1400
3564 CAJPOK010000036.1 GCA905372255_01771 gene open 1436-1549
3565 CAJPOK010000036.1 GCA905372255_01772 gene open 1710-2240
3566 CAJPOK010000036.1 GCA905372255_01773 gene open 2348-2629
3567 CAJPOK010000036.1 GCA905372255_01774 gene open 3152-4015 map
3568 CAJPOK010000036.1 GCA905372255_01775 gene open 4108-5142 tsaD
3569 CAJPOK010000036.1 GCA905372255_01776 gene open 5155-5703 cinA
3570 CAJPOK010000036.1 GCA905372255_01777 gene open 6636-6812
3571 CAJPOK010000036.1 GCA905372255_01778 gene open 6852-7016
3572 CAJPOK010000036.1 GCA905372255_01779 gene open 7125-9512
3573 CAJPOK010000036.1 GCA905372255_01780 gene open 9516-10367
3574 CAJPOK010000036.1 GCA905372255_01781 gene open 10434-11825 glmM
3575 CAJPOK010000036.1 GCA905372255_01782 gene open 11836-12450 yihA
3576 CAJPOK010000036.1 GCA905372255_01783 gene open 12454-14235 abc-f
3577 CAJPOK010000036.1 GCA905372255_01784 gene open 14657-16036 radA
3578 CAJPOK010000036.1 GCA905372255_01785 gene open 16103-17002
3579 CAJPOK010000036.1 GCA905372255_01786 gene open 17104-19254
3580 CAJPOK010000036.1 GCA905372255_01787 gene open 19243-19554
3581 CAJPOK010000036.1 GCA905372255_01788 gene open 19631-20434
3582 CAJPOK010000036.1 GCA905372255_01789 gene open 20557-22830
3583 CAJPOK010000036.1 GCA905372255_01790 gene open 22867-23667
3584 CAJPOK010000036.1 GCA905372255_01791 gene open 23703-24278
3585 CAJPOK010000037.1 GCA905372255_01792 CDS open 263-1744 _na     493_aa proS proline--tRNA ligase
3586 CAJPOK010000037.1 GCA905372255_01793 CDS open 2014-2694 _na     226_aa OmpA-like domain-containing protein
3587 CAJPOK010000037.1 GCA905372255_01794 CDS open 3185-4222 _na     345_aa Membrane protein
3588 CAJPOK010000037.1 GCA905372255_01795 CDS open 4509-6983 _na     824_aa feoB ferrous iron transport protein B
3589 CAJPOK010000037.1 GCA905372255_01796 CDS open 7101-8243 _na     380_aa Penicillin-binding protein 2
3590 CAJPOK010000037.1 GCA905372255_01797 CDS open 8484-9335 _na     283_aa patatin family protein
3591 CAJPOK010000037.1 GCA905372255_01798 CDS open 9220-9456 _na     78_aa hypothetical protein
3592 CAJPOK010000037.1 GCA905372255_01799 CDS open 9733-11832 _na     699_aa nrdD anaerobic ribonucleoside-triphosphate reductase
3593 CAJPOK010000037.1 GCA905372255_01800 CDS open 11954-12421 _na     155_aa nrdG anaerobic ribonucleoside-triphosphate reductase activating protein
3594 CAJPOK010000037.1 GCA905372255_01801 CDS open 12784-13413 _na     209_aa DUF4143 domain-containing protein
3595 CAJPOK010000037.1 GCA905372255_01802 CDS open 13353-14075 _na     240_aa AAA family ATPase
3596 CAJPOK010000037.1 GCA905372255_01803 CDS open 14758-15411 _na     217_aa rbr rubrerythrin
3597 CAJPOK010000037.1 GCA905372255_01804 CDS open 16378-16842 _na     154_aa Enoyl-CoA hydratase
3598 CAJPOK010000037.1 GCA905372255_01805 CDS open 17049-17840 _na     263_aa pflA pyruvate formate-lyase-activating protein
3599 CAJPOK010000037.1 GCA905372255_01806 CDS open 18077-20323 _na     748_aa pflB formate C-acetyltransferase
3600 CAJPOK010000037.1 GCA905372255_01807 CDS open 21186-21929 _na     247_aa CHAT domain-containing protein
3601 CAJPOK010000037.1 GCA905372255_01808 CDS open 22000-22512 _na     170_aa hypothetical protein
3602 CAJPOK010000037.1 GCA905372255_01809 CDS open 22515-22841 _na     108_aa hypothetical protein
3603 CAJPOK010000037.1 GCA905372255_01810 CDS open 22921-23697 _na     258_aa hypothetical protein
3604 CAJPOK010000037.1 GCA905372255_01792 gene open 263-1744 proS
3605 CAJPOK010000037.1 GCA905372255_01793 gene open 2014-2694
3606 CAJPOK010000037.1 GCA905372255_01794 gene open 3185-4222
3607 CAJPOK010000037.1 GCA905372255_01795 gene open 4509-6983 feoB
3608 CAJPOK010000037.1 GCA905372255_01796 gene open 7101-8243
3609 CAJPOK010000037.1 GCA905372255_01797 gene open 8484-9335
3610 CAJPOK010000037.1 GCA905372255_01798 gene open 9220-9456
3611 CAJPOK010000037.1 GCA905372255_01799 gene open 9733-11832 nrdD
3612 CAJPOK010000037.1 GCA905372255_01800 gene open 11954-12421 nrdG
3613 CAJPOK010000037.1 GCA905372255_01801 gene open 12784-13413
3614 CAJPOK010000037.1 GCA905372255_01802 gene open 13353-14075
3615 CAJPOK010000037.1 GCA905372255_01803 gene open 14758-15411 rbr
3616 CAJPOK010000037.1 GCA905372255_01804 gene open 16378-16842
3617 CAJPOK010000037.1 GCA905372255_01805 gene open 17049-17840 pflA
3618 CAJPOK010000037.1 GCA905372255_01806 gene open 18077-20323 pflB
3619 CAJPOK010000037.1 GCA905372255_01807 gene open 21186-21929
3620 CAJPOK010000037.1 GCA905372255_01808 gene open 22000-22512
3621 CAJPOK010000037.1 GCA905372255_01809 gene open 22515-22841
3622 CAJPOK010000037.1 GCA905372255_01810 gene open 22921-23697
3623 CAJPOK010000038.1 rep_origin open 2104-2591
3624 CAJPOK010000038.1 GCA905372255_01811 CDS open 406-2103 _na     565_aa Ribosomal large subunit pseudouridine synthase A
3625 CAJPOK010000038.1 GCA905372255_01812 CDS open 2592-3401 _na     269_aa DUF3108 domain-containing protein
3626 CAJPOK010000038.1 GCA905372255_01813 CDS open 3503-5974 _na     823_aa Outer membrane protein beta-barrel family
3627 CAJPOK010000038.1 GCA905372255_01814 CDS open 6028-6216 _na     62_aa hypothetical protein
3628 CAJPOK010000038.1 GCA905372255_01815 CDS open 6508-8409 _na     633_aa 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase
3629 CAJPOK010000038.1 GCA905372255_01816 CDS open 8528-9034 _na     168_aa N5-carboxyaminoimidazole ribonucleotide mutase
3630 CAJPOK010000038.1 GCA905372255_01817 CDS open 9061-9678 _na     205_aa Phosphatidic acid phosphatase type 2/haloperoxidase domain-containing protein
3631 CAJPOK010000038.1 GCA905372255_01818 CDS open 9713-11224 _na     503_aa rpoN RNA polymerase factor sigma-54
3632 CAJPOK010000038.1 GCA905372255_01819 CDS open 11270-11917 _na     215_aa dnaD DnaD domain-containing protein
3633 CAJPOK010000038.1 GCA905372255_01820 CDS open 12074-12865 _na     263_aa Methyltransferase domain-containing protein
3634 CAJPOK010000038.1 GCA905372255_01821 CDS open 12884-13417 _na     177_aa HXXEE domain-containing protein
3635 CAJPOK010000038.1 GCA905372255_01822 CDS open 13433-13993 _na     186_aa [ribosomal protein uS5]-alanine N-acetyltransferase
3636 CAJPOK010000038.1 GCA905372255_01823 CDS open 14053-14586 _na     177_aa ClbS/DfsB family four-helix bundle protein
3637 CAJPOK010000038.1 GCA905372255_01824 CDS open 14595-15395 _na     266_aa Kinase
3638 CAJPOK010000038.1 GCA905372255_01825 CDS open 15890-17311 _na     473_aa ATPase AAA-type core domain-containing protein
3639 CAJPOK010000038.1 GCA905372255_01826 CDS open 17630-18712 _na     360_aa Relaxase/mobilization nuclease domain protein
3640 CAJPOK010000038.1 GCA905372255_01827 CDS open 18696-19127 _na     143_aa copG Ribbon-helix-helix protein%2C copG family
3641 CAJPOK010000038.1 GCA905372255_01828 CDS open 19487-19948 _na     153_aa DUF3408 domain-containing protein
3642 CAJPOK010000038.1 GCA905372255_01829 CDS open 19953-20921 _na     322_aa Zinc finger CHC2-type domain-containing protein
3643 CAJPOK010000038.1 GCA905372255_01830 CDS open 21102-22538 _na     478_aa Virulence-associated protein E-like domain-containing protein
3644 CAJPOK010000038.1 GCA905372255_01831 CDS open 23016-23306 _na     96_aa Helix-turn-helix domain-containing protein
3645 CAJPOK010000038.1 GCA905372255_01832 CDS open 23306-23593 _na     95_aa Helix-turn-helix domain-containing protein
3646 CAJPOK010000038.1 GCA905372255_01811 gene open 406-2103
3647 CAJPOK010000038.1 GCA905372255_01812 gene open 2592-3401
3648 CAJPOK010000038.1 GCA905372255_01813 gene open 3503-5974
3649 CAJPOK010000038.1 GCA905372255_01814 gene open 6028-6216
3650 CAJPOK010000038.1 GCA905372255_01815 gene open 6508-8409
3651 CAJPOK010000038.1 GCA905372255_01816 gene open 8528-9034
3652 CAJPOK010000038.1 GCA905372255_01817 gene open 9061-9678
3653 CAJPOK010000038.1 GCA905372255_01818 gene open 9713-11224 rpoN
3654 CAJPOK010000038.1 GCA905372255_01819 gene open 11270-11917 dnaD
3655 CAJPOK010000038.1 GCA905372255_01820 gene open 12074-12865
3656 CAJPOK010000038.1 GCA905372255_01821 gene open 12884-13417
3657 CAJPOK010000038.1 GCA905372255_01822 gene open 13433-13993
3658 CAJPOK010000038.1 GCA905372255_01823 gene open 14053-14586
3659 CAJPOK010000038.1 GCA905372255_01824 gene open 14595-15395
3660 CAJPOK010000038.1 GCA905372255_01825 gene open 15890-17311
3661 CAJPOK010000038.1 GCA905372255_01826 gene open 17630-18712
3662 CAJPOK010000038.1 GCA905372255_01827 gene open 18696-19127 copG
3663 CAJPOK010000038.1 GCA905372255_01828 gene open 19487-19948
3664 CAJPOK010000038.1 GCA905372255_01829 gene open 19953-20921
3665 CAJPOK010000038.1 GCA905372255_01830 gene open 21102-22538
3666 CAJPOK010000038.1 GCA905372255_01831 gene open 23016-23306
3667 CAJPOK010000038.1 GCA905372255_01832 gene open 23306-23593
3668 CAJPOK010000039.1 GCA905372255_01833 CDS open 479-1321 _na     280_aa lgt prolipoprotein diacylglyceryl transferase
3669 CAJPOK010000039.1 GCA905372255_01834 CDS open 1340-2443 _na     367_aa ychF redox-regulated ATPase YchF
3670 CAJPOK010000039.1 GCA905372255_01835 CDS open 2582-3541 _na     319_aa rnc ribonuclease III
3671 CAJPOK010000039.1 GCA905372255_01836 CDS open 3531-4793 _na     420_aa fabF beta-ketoacyl-ACP synthase II
3672 CAJPOK010000039.1 GCA905372255_01837 CDS open 5049-5285 _na     78_aa acpP acyl carrier protein
3673 CAJPOK010000039.1 GCA905372255_01838 CDS open 5303-5482 _na     59_aa hypothetical protein
3674 CAJPOK010000039.1 GCA905372255_01839 CDS open 5653-6255 _na     200_aa DUF4254 domain-containing protein
3675 CAJPOK010000039.1 GCA905372255_01840 CDS open 6298-7299 _na     333_aa Glycosyl transferase family 1
3676 CAJPOK010000039.1 GCA905372255_01841 CDS open 7983-10832 _na     949_aa leuS leucine--tRNA ligase
3677 CAJPOK010000039.1 GCA905372255_01842 CDS open 10876-11880 _na     334_aa yitT YitT family protein
3678 CAJPOK010000039.1 GCA905372255_01843 CDS open 11882-12460 _na     192_aa non-canonical purine NTP diphosphatase
3679 CAJPOK010000039.1 GCA905372255_01844 CDS open 12460-13350 _na     296_aa Glycosyltransferase 2-like domain-containing protein
3680 CAJPOK010000039.1 GCA905372255_01845 CDS open 13347-15374 _na     675_aa porZ TSS9 PorZ N-terminal beta-propeller domain-containing protein
3681 CAJPOK010000039.1 GCA905372255_01846 CDS open 15350-16360 _na     336_aa Acyltransferase
3682 CAJPOK010000039.1 GCA905372255_01847 CDS open 16748-16999 _na     83_aa Arm DNA-binding domain-containing protein
3683 CAJPOK010000039.1 GCA905372255_01848 CDS open 16996-17982 _na     328_aa Mobile element protein
3684 CAJPOK010000039.1 GCA905372255_01849 CDS open 17979-18383 _na     134_aa Virulence protein
3685 CAJPOK010000039.1 GCA905372255_01850 CDS open 18580-19887 _na     435_aa Phosphate-selective porin
3686 CAJPOK010000039.1 GCA905372255_01851 CDS open 19889-20668 _na     259_aa Outer membrane lipoprotein-sorting protein
3687 CAJPOK010000039.1 GCA905372255_01852 CDS open 20792-23143 _na     783_aa SSD domain-containing protein
3688 CAJPOK010000039.1 GCA905372255_01833 gene open 479-1321 lgt
3689 CAJPOK010000039.1 GCA905372255_01834 gene open 1340-2443 ychF
3690 CAJPOK010000039.1 GCA905372255_01835 gene open 2582-3541 rnc
3691 CAJPOK010000039.1 GCA905372255_01836 gene open 3531-4793 fabF
3692 CAJPOK010000039.1 GCA905372255_01837 gene open 5049-5285 acpP
3693 CAJPOK010000039.1 GCA905372255_01838 gene open 5303-5482
3694 CAJPOK010000039.1 GCA905372255_01839 gene open 5653-6255
3695 CAJPOK010000039.1 GCA905372255_01840 gene open 6298-7299
3696 CAJPOK010000039.1 GCA905372255_01841 gene open 7983-10832 leuS
3697 CAJPOK010000039.1 GCA905372255_01842 gene open 10876-11880 yitT
3698 CAJPOK010000039.1 GCA905372255_01843 gene open 11882-12460
3699 CAJPOK010000039.1 GCA905372255_01844 gene open 12460-13350
3700 CAJPOK010000039.1 GCA905372255_01845 gene open 13347-15374 porZ
3701 CAJPOK010000039.1 GCA905372255_01846 gene open 15350-16360
3702 CAJPOK010000039.1 GCA905372255_01847 gene open 16748-16999
3703 CAJPOK010000039.1 GCA905372255_01848 gene open 16996-17982
3704 CAJPOK010000039.1 GCA905372255_01849 gene open 17979-18383
3705 CAJPOK010000039.1 GCA905372255_01850 gene open 18580-19887
3706 CAJPOK010000039.1 GCA905372255_01851 gene open 19889-20668
3707 CAJPOK010000039.1 GCA905372255_01852 gene open 20792-23143
3708 CAJPOK010000040.1 repeat_region open 1-2606 CRISPR array with 34 repeats of length 47%2C consensus sequence GTTGTATTTACTAATGCAAAGATACTAATTTTAAAGCTAATCACAAC and spacer length 29
3709 CAJPOK010000040.1 GCA905372255_01853 CDS open 3252-5099 _na     615_aa Sulfatase N-terminal domain-containing protein
3710 CAJPOK010000040.1 GCA905372255_01854 CDS open 5126-6265 _na     379_aa Acyltransferase 3 domain-containing protein
3711 CAJPOK010000040.1 GCA905372255_01855 CDS open 6267-7289 _na     340_aa Acyltransferase 3 domain-containing protein
3712 CAJPOK010000040.1 GCA905372255_01856 CDS open 7294-8172 _na     292_aa decaprenyl-phosphate phosphoribosyltransferase
3713 CAJPOK010000040.1 GCA905372255_01857 CDS open 8174-9136 _na     320_aa putative HAD-superfamily hydrolase
3714 CAJPOK010000040.1 GCA905372255_01858 CDS open 9222-10571 _na     449_aa DUF6080 domain-containing protein
3715 CAJPOK010000040.1 GCA905372255_01859 CDS open 10568-12004 _na     478_aa gtrA GtrA family protein
3716 CAJPOK010000040.1 GCA905372255_01860 CDS open 12018-12977 _na     319_aa putative glycosyl transferase family 2
3717 CAJPOK010000040.1 GCA905372255_01861 CDS open 13045-14484 _na     479_aa wzxC Lipopolysaccharide biosynthesis protein WzxC
3718 CAJPOK010000040.1 GCA905372255_01862 CDS open 14551-15132 _na     193_aa nadD nicotinate (nicotinamide) nucleotide adenylyltransferase
3719 CAJPOK010000040.1 GCA905372255_01863 CDS open 15140-15712 _na     190_aa gmk guanylate kinase
3720 CAJPOK010000040.1 GCA905372255_01864 CDS open 15724-16602 _na     292_aa yicC YicC family protein
3721 CAJPOK010000040.1 GCA905372255_01865 CDS open 16718-17104 _na     128_aa Metal-dependent hydrolase
3722 CAJPOK010000040.1 GCA905372255_01866 CDS open 17516-17641 _na     41_aa hypothetical protein
3723 CAJPOK010000040.1 GCA905372255_01867 CDS open 17890-21642 _na     1250_aa purL phosphoribosylformylglycinamidine synthase
3724 CAJPOK010000040.1 GCA905372255_01868 CDS open 21645-22259 _na     204_aa Chromate transporter
3725 CAJPOK010000040.1 GCA905372255_01869 CDS open 22262-22837 _na     191_aa Chromate transporter
3726 CAJPOK010000040.1 GCA905372255_01853 gene open 3252-5099
3727 CAJPOK010000040.1 GCA905372255_01854 gene open 5126-6265
3728 CAJPOK010000040.1 GCA905372255_01855 gene open 6267-7289
3729 CAJPOK010000040.1 GCA905372255_01856 gene open 7294-8172
3730 CAJPOK010000040.1 GCA905372255_01857 gene open 8174-9136
3731 CAJPOK010000040.1 GCA905372255_01858 gene open 9222-10571
3732 CAJPOK010000040.1 GCA905372255_01859 gene open 10568-12004 gtrA
3733 CAJPOK010000040.1 GCA905372255_01860 gene open 12018-12977
3734 CAJPOK010000040.1 GCA905372255_01861 gene open 13045-14484 wzxC
3735 CAJPOK010000040.1 GCA905372255_01862 gene open 14551-15132 nadD
3736 CAJPOK010000040.1 GCA905372255_01863 gene open 15140-15712 gmk
3737 CAJPOK010000040.1 GCA905372255_01864 gene open 15724-16602 yicC
3738 CAJPOK010000040.1 GCA905372255_01865 gene open 16718-17104
3739 CAJPOK010000040.1 GCA905372255_01866 gene open 17516-17641
3740 CAJPOK010000040.1 GCA905372255_01867 gene open 17890-21642 purL
3741 CAJPOK010000040.1 GCA905372255_01868 gene open 21645-22259
3742 CAJPOK010000040.1 GCA905372255_01869 gene open 22262-22837
3743 CAJPOK010000041.1 GCA905372255_01870 CDS open 370-1431 _na     353_aa Capsular biosynthesis protein
3744 CAJPOK010000041.1 GCA905372255_01871 CDS open 1444-2601 _na     385_aa wecB non-hydrolyzing UDP-N-acetylglucosamine 2-epimerase
3745 CAJPOK010000041.1 GCA905372255_01872 CDS open 2598-3743 _na     381_aa Lipopolysaccharide biosynthesis protein
3746 CAJPOK010000041.1 GCA905372255_01873 CDS open 3743-5053 _na     436_aa Oligosaccharide repeat unit polymerase
3747 CAJPOK010000041.1 GCA905372255_01874 CDS open 5044-6591 _na     515_aa Polysaccharide biosynthesis protein C-terminal domain-containing protein
3748 CAJPOK010000041.1 GCA905372255_01875 CDS open 6599-7636 _na     345_aa Chain length determinant protein
3749 CAJPOK010000041.1 GCA905372255_01876 CDS open 7810-10437 _na     875_aa Soluble ligand binding domain-containing protein
3750 CAJPOK010000041.1 GCA905372255_01877 CDS open 10444-11064 _na     206_aa Bacterial sugar transferase
3751 CAJPOK010000041.1 GCA905372255_01878 CDS open 11288-12325 _na     345_aa dinB DNA polymerase IV
3752 CAJPOK010000041.1 GCA905372255_01879 CDS open 12849-14267 _na     472_aa MalT-like TPR region domain-containing protein
3753 CAJPOK010000041.1 GCA905372255_01880 CDS open 14428-14904 _na     158_aa Secretion protein
3754 CAJPOK010000041.1 GCA905372255_01881 CDS open 14960-15673 _na     237_aa DUF1566 domain-containing protein
3755 CAJPOK010000041.1 GCA905372255_01882 CDS open 15685-16398 _na     237_aa Fibrobacter succinogenes major paralogous domain-containing protein
3756 CAJPOK010000041.1 GCA905372255_01883 CDS open 16936-18183 _na     415_aa serB phosphoserine phosphatase SerB
3757 CAJPOK010000041.1 GCA905372255_01884 CDS open 18256-19047 _na     263_aa DUF4738 domain-containing protein
3758 CAJPOK010000041.1 GCA905372255_01885 CDS open 19063-19614 _na     183_aa rfbC dTDP-4-dehydrorhamnose 3%2C5-epimerase
3759 CAJPOK010000041.1 GCA905372255_01886 CDS open 19907-20638 _na     243_aa Cysteine-rich domain-containing protein
3760 CAJPOK010000041.1 GCA905372255_01887 CDS open 20658-22052 _na     464_aa Electron transport protein
3761 CAJPOK010000041.1 GCA905372255_01888 CDS open 22104-22679 _na     191_aa LUD domain-containing protein
3762 CAJPOK010000041.1 GCA905372255_01870 gene open 370-1431
3763 CAJPOK010000041.1 GCA905372255_01871 gene open 1444-2601 wecB
3764 CAJPOK010000041.1 GCA905372255_01872 gene open 2598-3743
3765 CAJPOK010000041.1 GCA905372255_01873 gene open 3743-5053
3766 CAJPOK010000041.1 GCA905372255_01874 gene open 5044-6591
3767 CAJPOK010000041.1 GCA905372255_01875 gene open 6599-7636
3768 CAJPOK010000041.1 GCA905372255_01876 gene open 7810-10437
3769 CAJPOK010000041.1 GCA905372255_01877 gene open 10444-11064
3770 CAJPOK010000041.1 GCA905372255_01878 gene open 11288-12325 dinB
3771 CAJPOK010000041.1 GCA905372255_01879 gene open 12849-14267
3772 CAJPOK010000041.1 GCA905372255_01880 gene open 14428-14904
3773 CAJPOK010000041.1 GCA905372255_01881 gene open 14960-15673
3774 CAJPOK010000041.1 GCA905372255_01882 gene open 15685-16398
3775 CAJPOK010000041.1 GCA905372255_01883 gene open 16936-18183 serB
3776 CAJPOK010000041.1 GCA905372255_01884 gene open 18256-19047
3777 CAJPOK010000041.1 GCA905372255_01885 gene open 19063-19614 rfbC
3778 CAJPOK010000041.1 GCA905372255_01886 gene open 19907-20638
3779 CAJPOK010000041.1 GCA905372255_01887 gene open 20658-22052
3780 CAJPOK010000041.1 GCA905372255_01888 gene open 22104-22679
3781 CAJPOK010000042.1 GCA905372255_01903 gene open 17262-17450 Bacteroidales-1
3782 CAJPOK010000042.1 GCA905372255_01903 ncRNA open 17262-17450 Bacteroidales-1 6S-Bacteroidales RNA suggested
3783 CAJPOK010000042.1 GCA905372255_01889 CDS open 510-2231 _na     573_aa glutamine--tRNA ligase/YqeY domain fusion protein
3784 CAJPOK010000042.1 GCA905372255_01890 CDS open 2238-3467 _na     409_aa Tetratricopeptide repeat protein
3785 CAJPOK010000042.1 GCA905372255_01891 CDS open 3497-4186 _na     229_aa RNA polymerase sigma-70 domain-containing protein
3786 CAJPOK010000042.1 GCA905372255_01892 CDS open 4206-5228 _na     340_aa Phytase-like domain-containing protein
3787 CAJPOK010000042.1 GCA905372255_01893 CDS open 5662-6747 _na     361_aa gmd GDP-mannose 4%2C6-dehydratase
3788 CAJPOK010000042.1 GCA905372255_01894 CDS open 6802-7869 _na     355_aa Mannose-1-phosphate guanylyltransferase
3789 CAJPOK010000042.1 GCA905372255_01895 CDS open 7963-8292 _na     109_aa DNA-binding protein
3790 CAJPOK010000042.1 GCA905372255_01896 CDS open 8349-8630 _na     93_aa Winged helix-turn-helix domain-containing protein
3791 CAJPOK010000042.1 GCA905372255_01897 CDS open 8803-10563 _na     586_aa aspS aspartate--tRNA ligase
3792 CAJPOK010000042.1 GCA905372255_01898 CDS open 11273-13675 _na     800_aa Colicin I receptor
3793 CAJPOK010000042.1 GCA905372255_01899 CDS open 13699-14940 _na     413_aa Lipoprotein
3794 CAJPOK010000042.1 GCA905372255_01900 CDS open 14982-15599 _na     205_aa HTH tetR-type domain-containing protein
3795 CAJPOK010000042.1 GCA905372255_01901 CDS open 15931-16419 _na     162_aa tonB TonB C-terminal domain-containing protein
3796 CAJPOK010000042.1 GCA905372255_01902 CDS open 16542-17147 _na     201_aa riboflavin synthase
3797 CAJPOK010000042.1 GCA905372255_01904 CDS open 17511-18869 _na     452_aa lpdA dihydrolipoyl dehydrogenase
3798 CAJPOK010000042.1 GCA905372255_01905 CDS open 18890-20368 _na     492_aa gcvPB aminomethyl-transferring glycine dehydrogenase subunit GcvPB
3799 CAJPOK010000042.1 GCA905372255_01906 CDS open 20418-21728 _na     436_aa gcvPA aminomethyl-transferring glycine dehydrogenase subunit GcvPA
3800 CAJPOK010000042.1 GCA905372255_01907 CDS open 21844-22224 _na     126_aa gcvH glycine cleavage system protein GcvH
3801 CAJPOK010000042.1 GCA905372255_01889 gene open 510-2231
3802 CAJPOK010000042.1 GCA905372255_01890 gene open 2238-3467
3803 CAJPOK010000042.1 GCA905372255_01891 gene open 3497-4186
3804 CAJPOK010000042.1 GCA905372255_01892 gene open 4206-5228
3805 CAJPOK010000042.1 GCA905372255_01893 gene open 5662-6747 gmd
3806 CAJPOK010000042.1 GCA905372255_01894 gene open 6802-7869
3807 CAJPOK010000042.1 GCA905372255_01895 gene open 7963-8292
3808 CAJPOK010000042.1 GCA905372255_01896 gene open 8349-8630
3809 CAJPOK010000042.1 GCA905372255_01897 gene open 8803-10563 aspS
3810 CAJPOK010000042.1 GCA905372255_01898 gene open 11273-13675
3811 CAJPOK010000042.1 GCA905372255_01899 gene open 13699-14940
3812 CAJPOK010000042.1 GCA905372255_01900 gene open 14982-15599
3813 CAJPOK010000042.1 GCA905372255_01901 gene open 15931-16419 tonB
3814 CAJPOK010000042.1 GCA905372255_01902 gene open 16542-17147
3815 CAJPOK010000042.1 GCA905372255_01904 gene open 17511-18869 lpdA
3816 CAJPOK010000042.1 GCA905372255_01905 gene open 18890-20368 gcvPB
3817 CAJPOK010000042.1 GCA905372255_01906 gene open 20418-21728 gcvPA
3818 CAJPOK010000042.1 GCA905372255_01907 gene open 21844-22224 gcvH
3819 CAJPOK010000043.1 GCA905372255_01908 CDS open 43-798 _na     251_aa Glycosyltransferase 2-like domain-containing protein
3820 CAJPOK010000043.1 GCA905372255_01909 CDS open 945-2057 _na     370_aa Undecaprenyl/decaprenyl-phosphate alpha-N-acetylglucosaminyl 1-phosphate transferase
3821 CAJPOK010000043.1 GCA905372255_01910 CDS open 2088-2531 _na     147_aa Lipocalin-like domain-containing protein
3822 CAJPOK010000043.1 GCA905372255_01911 CDS open 2538-4133 _na     531_aa Capsule assembly Wzi family protein
3823 CAJPOK010000043.1 GCA905372255_01912 CDS open 4827-6434 _na     535_aa CTP synthase
3824 CAJPOK010000043.1 GCA905372255_01913 CDS open 6438-8354 _na     638_aa yidC membrane protein insertase YidC
3825 CAJPOK010000043.1 GCA905372255_01914 CDS open 8363-10534 _na     723_aa Peptidase S9 prolyl oligopeptidase catalytic domain-containing protein
3826 CAJPOK010000043.1 GCA905372255_01915 CDS open 10594-12216 _na     540_aa Lysosomal dipeptide transporter MFSD1
3827 CAJPOK010000043.1 GCA905372255_01916 CDS open 12644-13105 _na     153_aa hypothetical protein
3828 CAJPOK010000043.1 GCA905372255_01917 CDS open 13232-13933 _na     233_aa HAD superfamily hydrolase
3829 CAJPOK010000043.1 GCA905372255_01918 CDS open 14053-14979 _na     308_aa HTH lysR-type domain-containing protein
3830 CAJPOK010000043.1 GCA905372255_01919 CDS open 15316-16623 _na     435_aa eno phosphopyruvate hydratase
3831 CAJPOK010000043.1 GCA905372255_01920 CDS open 16973-17539 _na     188_aa ahpC alkyl hydroperoxide reductase subunit C
3832 CAJPOK010000043.1 GCA905372255_01921 CDS open 17733-19292 _na     519_aa ahpF alkyl hydroperoxide reductase subunit F
3833 CAJPOK010000043.1 GCA905372255_01908 gene open 43-798
3834 CAJPOK010000043.1 GCA905372255_01909 gene open 945-2057
3835 CAJPOK010000043.1 GCA905372255_01910 gene open 2088-2531
3836 CAJPOK010000043.1 GCA905372255_01911 gene open 2538-4133
3837 CAJPOK010000043.1 GCA905372255_01912 gene open 4827-6434
3838 CAJPOK010000043.1 GCA905372255_01913 gene open 6438-8354 yidC
3839 CAJPOK010000043.1 GCA905372255_01914 gene open 8363-10534
3840 CAJPOK010000043.1 GCA905372255_01915 gene open 10594-12216
3841 CAJPOK010000043.1 GCA905372255_01916 gene open 12644-13105
3842 CAJPOK010000043.1 GCA905372255_01917 gene open 13232-13933
3843 CAJPOK010000043.1 GCA905372255_01918 gene open 14053-14979
3844 CAJPOK010000043.1 GCA905372255_01919 gene open 15316-16623 eno
3845 CAJPOK010000043.1 GCA905372255_01920 gene open 16973-17539 ahpC
3846 CAJPOK010000043.1 GCA905372255_01921 gene open 17733-19292 ahpF
3847 CAJPOK010000044.1 GCA905372255_01922 CDS open 205-2196 _na     663_aa DNA-binding protein
3848 CAJPOK010000044.1 GCA905372255_01923 CDS open 2722-3333 _na     203_aa Class I SAM-dependent methyltransferase
3849 CAJPOK010000044.1 GCA905372255_01924 CDS open 3347-3904 _na     185_aa Corrinoid adenosyltransferase
3850 CAJPOK010000044.1 GCA905372255_01925 CDS open 3960-4181 _na     73_aa DUF2795 domain-containing protein
3851 CAJPOK010000044.1 GCA905372255_01926 CDS open 4200-5252 _na     350_aa Type IX secretion system membrane protein PorP/SprF
3852 CAJPOK010000044.1 GCA905372255_01927 CDS open 5268-6752 _na     494_aa gldK Gliding motility-associated lipoprotein GldK
3853 CAJPOK010000044.1 GCA905372255_01928 CDS open 6752-7552 _na     266_aa gldL Gliding motility protein GldL
3854 CAJPOK010000044.1 GCA905372255_01929 CDS open 7663-9252 _na     529_aa gldM Gliding motility-associated protein GldM
3855 CAJPOK010000044.1 GCA905372255_01930 CDS open 9330-10379 _na     349_aa gldN Gliding motility protein GldN
3856 CAJPOK010000044.1 GCA905372255_01931 CDS open 10478-11098 _na     206_aa Outer membrane protein beta-barrel domain-containing protein
3857 CAJPOK010000044.1 GCA905372255_01932 CDS open 11451-14141 _na     896_aa Ferric aerobactin receptor
3858 CAJPOK010000044.1 GCA905372255_01933 CDS open 14159-15097 _na     312_aa fecR FecR protein domain-containing protein
3859 CAJPOK010000044.1 GCA905372255_01934 CDS open 15094-15642 _na     182_aa RNA polymerase sigma-70 factor
3860 CAJPOK010000044.1 GCA905372255_01935 CDS open 15936-16778 _na     280_aa DUF3737 domain-containing protein
3861 CAJPOK010000044.1 GCA905372255_01936 CDS open 16797-17969 _na     390_aa cysteine-S-conjugate beta-lyase
3862 CAJPOK010000044.1 GCA905372255_01937 CDS open 18129-18746 _na     205_aa DUF3298 domain-containing protein
3863 CAJPOK010000044.1 GCA905372255_01922 gene open 205-2196
3864 CAJPOK010000044.1 GCA905372255_01923 gene open 2722-3333
3865 CAJPOK010000044.1 GCA905372255_01924 gene open 3347-3904
3866 CAJPOK010000044.1 GCA905372255_01925 gene open 3960-4181
3867 CAJPOK010000044.1 GCA905372255_01926 gene open 4200-5252
3868 CAJPOK010000044.1 GCA905372255_01927 gene open 5268-6752 gldK
3869 CAJPOK010000044.1 GCA905372255_01928 gene open 6752-7552 gldL
3870 CAJPOK010000044.1 GCA905372255_01929 gene open 7663-9252 gldM
3871 CAJPOK010000044.1 GCA905372255_01930 gene open 9330-10379 gldN
3872 CAJPOK010000044.1 GCA905372255_01931 gene open 10478-11098
3873 CAJPOK010000044.1 GCA905372255_01932 gene open 11451-14141
3874 CAJPOK010000044.1 GCA905372255_01933 gene open 14159-15097 fecR
3875 CAJPOK010000044.1 GCA905372255_01934 gene open 15094-15642
3876 CAJPOK010000044.1 GCA905372255_01935 gene open 15936-16778
3877 CAJPOK010000044.1 GCA905372255_01936 gene open 16797-17969
3878 CAJPOK010000044.1 GCA905372255_01937 gene open 18129-18746
3879 CAJPOK010000045.1 GCA905372255_01938 CDS open 49-417 _na     122_aa GTP-binding protein
3880 CAJPOK010000045.1 GCA905372255_01939 CDS open 436-1116 _na     226_aa peptidylprolyl isomerase
3881 CAJPOK010000045.1 GCA905372255_01940 CDS open 1344-3206 _na     620_aa Phospho-sugar mutase
3882 CAJPOK010000045.1 GCA905372255_01941 CDS open 3312-3623 _na     103_aa DUF4491 domain-containing protein
3883 CAJPOK010000045.1 GCA905372255_01942 CDS open 3620-4090 _na     156_aa rlmH 23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH
3884 CAJPOK010000045.1 GCA905372255_01943 CDS open 3947-4405 _na     152_aa hypothetical protein
3885 CAJPOK010000045.1 GCA905372255_01944 CDS open 4633-5112 _na     159_aa smpB SsrA-binding protein SmpB
3886 CAJPOK010000045.1 GCA905372255_01945 CDS open 5105-5614 _na     169_aa DUF4375 domain-containing protein
3887 CAJPOK010000045.1 GCA905372255_01946 CDS open 5655-6815 _na     386_aa Initiator Rep protein WH1 domain-containing protein
3888 CAJPOK010000045.1 GCA905372255_01947 CDS open 7689-8600 _na     303_aa Nucleotidyltransferase
3889 CAJPOK010000045.1 GCA905372255_01948 CDS open 8677-9720 _na     347_aa DDH domain-containing protein
3890 CAJPOK010000045.1 GCA905372255_01949 CDS open 9693-9863 _na     56_aa hypothetical protein
3891 CAJPOK010000045.1 GCA905372255_01950 CDS open 9876-11915 _na     679_aa rho transcription termination factor Rho
3892 CAJPOK010000045.1 GCA905372255_01951 CDS open 12184-13392 _na     402_aa L-serine ammonia-lyase
3893 CAJPOK010000045.1 GCA905372255_01952 CDS open 13485-13877 _na     130_aa Transglycosylase SLT domain-containing protein
3894 CAJPOK010000045.1 GCA905372255_01954 CDS open 14579-14767 _na     62_aa hypothetical protein
3895 CAJPOK010000045.1 GCA905372255_01955 CDS open 14831-15364 _na     177_aa hypothetical protein
3896 CAJPOK010000045.1 GCA905372255_01956 CDS open 15594-15710 _na     38_aa 50S ribosomal protein L7/L12
3897 CAJPOK010000045.1 GCA905372255_01957 CDS open 16149-17924 _na     591_aa rpsA 30S ribosomal protein S1
3898 CAJPOK010000045.1 GCA905372255_01938 gene open 49-417
3899 CAJPOK010000045.1 GCA905372255_01939 gene open 436-1116
3900 CAJPOK010000045.1 GCA905372255_01940 gene open 1344-3206
3901 CAJPOK010000045.1 GCA905372255_01941 gene open 3312-3623
3902 CAJPOK010000045.1 GCA905372255_01942 gene open 3620-4090 rlmH
3903 CAJPOK010000045.1 GCA905372255_01943 gene open 3947-4405
3904 CAJPOK010000045.1 GCA905372255_01944 gene open 4633-5112 smpB
3905 CAJPOK010000045.1 GCA905372255_01945 gene open 5105-5614
3906 CAJPOK010000045.1 GCA905372255_01946 gene open 5655-6815
3907 CAJPOK010000045.1 GCA905372255_01947 gene open 7689-8600
3908 CAJPOK010000045.1 GCA905372255_01948 gene open 8677-9720
3909 CAJPOK010000045.1 GCA905372255_01949 gene open 9693-9863
3910 CAJPOK010000045.1 GCA905372255_01950 gene open 9876-11915 rho
3911 CAJPOK010000045.1 GCA905372255_01951 gene open 12184-13392
3912 CAJPOK010000045.1 GCA905372255_01952 gene open 13485-13877
3913 CAJPOK010000045.1 GCA905372255_01954 gene open 14579-14767
3914 CAJPOK010000045.1 GCA905372255_01955 gene open 14831-15364
3915 CAJPOK010000045.1 GCA905372255_01956 gene open 15594-15710
3916 CAJPOK010000045.1 GCA905372255_01957 gene open 16149-17924 rpsA
3917 CAJPOK010000045.1 GCA905372255_01953 gene open 14305-14378 trnR
3918 CAJPOK010000045.1 GCA905372255_01953 tRNA open 14305-14378 trnR tRNA-Arg(ccg)
3919 CAJPOK010000046.1 GCA905372255_01958 CDS open 100-909 _na     269_aa DUF4412 domain-containing protein
3920 CAJPOK010000046.1 GCA905372255_01959 CDS open 921-3197 _na     758_aa rnr ribonuclease R
3921 CAJPOK010000046.1 GCA905372255_01960 CDS open 3249-4283 _na     344_aa NAD dependent epimerase/dehydratase
3922 CAJPOK010000046.1 GCA905372255_01961 CDS open 4314-5288 _na     324_aa Inositolphosphotransferase Aur1/Ipt1 domain-containing protein
3923 CAJPOK010000046.1 GCA905372255_01962 CDS open 5803-6936 _na     377_aa ATPase domain-containing protein
3924 CAJPOK010000046.1 GCA905372255_01963 CDS open 7087-9111 _na     674_aa sbsA SbsA Ig-like domain-containing protein
3925 CAJPOK010000046.1 GCA905372255_01964 CDS open 9187-10710 _na     507_aa GH3 auxin-responsive promoter family protein
3926 CAJPOK010000046.1 GCA905372255_01965 CDS open 10960-11577 _na     205_aa ykuD YkuD domain-containing protein
3927 CAJPOK010000046.1 GCA905372255_01966 CDS open 11584-12183 _na     199_aa Lipoprotein
3928 CAJPOK010000046.1 GCA905372255_01967 CDS open 12751-14412 _na     553_aa putative transporter
3929 CAJPOK010000046.1 GCA905372255_01968 CDS open 14530-16071 _na     513_aa comM Competence protein ComM
3930 CAJPOK010000046.1 GCA905372255_01969 CDS open 16072-17064 _na     330_aa AhpC/TSA family antioxidant
3931 CAJPOK010000046.1 GCA905372255_01958 gene open 100-909
3932 CAJPOK010000046.1 GCA905372255_01959 gene open 921-3197 rnr
3933 CAJPOK010000046.1 GCA905372255_01960 gene open 3249-4283
3934 CAJPOK010000046.1 GCA905372255_01961 gene open 4314-5288
3935 CAJPOK010000046.1 GCA905372255_01962 gene open 5803-6936
3936 CAJPOK010000046.1 GCA905372255_01963 gene open 7087-9111 sbsA
3937 CAJPOK010000046.1 GCA905372255_01964 gene open 9187-10710
3938 CAJPOK010000046.1 GCA905372255_01965 gene open 10960-11577 ykuD
3939 CAJPOK010000046.1 GCA905372255_01966 gene open 11584-12183
3940 CAJPOK010000046.1 GCA905372255_01967 gene open 12751-14412
3941 CAJPOK010000046.1 GCA905372255_01968 gene open 14530-16071 comM
3942 CAJPOK010000046.1 GCA905372255_01969 gene open 16072-17064
3943 CAJPOK010000046.1 GCA905372255_01970 gene open 17174-17242
3944 CAJPOK010000046.1 GCA905372255_01970 tRNA open 17174-17242 tRNA-Xxx
3945 CAJPOK010000047.1 GCA905372255_01971 CDS open 1010-1153 _na     47_aa hypothetical protein
3946 CAJPOK010000047.1 GCA905372255_01972 CDS open 1565-1780 _na     71_aa hypothetical protein
3947 CAJPOK010000047.1 GCA905372255_01973 CDS open 3493-3744 _na     83_aa hypothetical protein
3948 CAJPOK010000047.1 GCA905372255_01974 CDS open 3906-4322 _na     138_aa hypothetical protein
3949 CAJPOK010000047.1 GCA905372255_01975 CDS open 4444-4818 _na     124_aa Bona fide RidA/YjgF/TdcF/RutC subgroup
3950 CAJPOK010000047.1 GCA905372255_01976 CDS open 4860-5228 _na     122_aa Secreted protein
3951 CAJPOK010000047.1 GCA905372255_01977 CDS open 5215-5661 _na     148_aa hypothetical protein
3952 CAJPOK010000047.1 GCA905372255_01978 CDS open 6162-6365 _na     67_aa Helix-turn-helix motif
3953 CAJPOK010000047.1 GCA905372255_01979 CDS open 6362-6703 _na     113_aa hipA HipA N-terminal subdomain 1 domain-containing protein
3954 CAJPOK010000047.1 GCA905372255_01980 CDS open 6696-7634 _na     312_aa HipA-like C-terminal domain-containing protein
3955 CAJPOK010000047.1 GCA905372255_01981 CDS open 7707-8885 _na     392_aa HTH araC/xylS-type domain-containing protein
3956 CAJPOK010000047.1 GCA905372255_01982 CDS open 10095-10529 _na     144_aa Peptidase M15
3957 CAJPOK010000047.1 GCA905372255_01983 CDS open 10707-11033 _na     108_aa Viral histone-like protein
3958 CAJPOK010000047.1 GCA905372255_01984 CDS open 12004-12435 _na     143_aa putative transcriptional regulator Fur family
3959 CAJPOK010000047.1 GCA905372255_01985 CDS open 12725-13084 _na     119_aa HTH marR-type domain-containing protein
3960 CAJPOK010000047.1 GCA905372255_01986 CDS open 13104-13589 _na     161_aa trxA thioredoxin
3961 CAJPOK010000047.1 GCA905372255_01987 CDS open 14836-15228 _na     130_aa peptidase
3962 CAJPOK010000047.1 GCA905372255_01988 CDS open 15379-15642 _na     87_aa hypothetical protein
3963 CAJPOK010000047.1 GCA905372255_01971 gene open 1010-1153
3964 CAJPOK010000047.1 GCA905372255_01972 gene open 1565-1780
3965 CAJPOK010000047.1 GCA905372255_01973 gene open 3493-3744
3966 CAJPOK010000047.1 GCA905372255_01974 gene open 3906-4322
3967 CAJPOK010000047.1 GCA905372255_01975 gene open 4444-4818
3968 CAJPOK010000047.1 GCA905372255_01976 gene open 4860-5228
3969 CAJPOK010000047.1 GCA905372255_01977 gene open 5215-5661
3970 CAJPOK010000047.1 GCA905372255_01978 gene open 6162-6365
3971 CAJPOK010000047.1 GCA905372255_01979 gene open 6362-6703 hipA
3972 CAJPOK010000047.1 GCA905372255_01980 gene open 6696-7634
3973 CAJPOK010000047.1 GCA905372255_01981 gene open 7707-8885
3974 CAJPOK010000047.1 GCA905372255_01982 gene open 10095-10529
3975 CAJPOK010000047.1 GCA905372255_01983 gene open 10707-11033
3976 CAJPOK010000047.1 GCA905372255_01984 gene open 12004-12435
3977 CAJPOK010000047.1 GCA905372255_01985 gene open 12725-13084
3978 CAJPOK010000047.1 GCA905372255_01986 gene open 13104-13589 trxA
3979 CAJPOK010000047.1 GCA905372255_01987 gene open 14836-15228
3980 CAJPOK010000047.1 GCA905372255_01988 gene open 15379-15642
3981 CAJPOK010000048.1 GCA905372255_01989 CDS open 111-1589 _na     492_aa MBOAT family protein
3982 CAJPOK010000048.1 GCA905372255_01990 CDS open 1598-2356 _na     252_aa SGNH hydrolase-type esterase domain-containing protein
3983 CAJPOK010000048.1 GCA905372255_01991 CDS open 2362-3114 _na     250_aa exodeoxyribonuclease III
3984 CAJPOK010000048.1 GCA905372255_01992 CDS open 3176-3769 _na     197_aa folE GTP cyclohydrolase I FolE
3985 CAJPOK010000048.1 GCA905372255_01993 CDS open 4015-4680 _na     221_aa SPOR domain-containing protein
3986 CAJPOK010000048.1 GCA905372255_01994 CDS open 4760-6880 _na     706_aa tpiA triose-phosphate isomerase
3987 CAJPOK010000048.1 GCA905372255_01995 CDS open 6873-7424 _na     183_aa Nucleotide modification associated domain-containing protein
3988 CAJPOK010000048.1 GCA905372255_01996 CDS open 7613-8500 _na     295_aa 50S ribosomal protein L7/L12
3989 CAJPOK010000048.1 GCA905372255_01997 CDS open 9039-11552 _na     837_aa Membrane protein 6-pyruvoyl-tetrahydropterin synthase-related domain-containing protein
3990 CAJPOK010000048.1 GCA905372255_01998 CDS open 11651-12349 _na     232_aa 5'-methylthioadenosine/adenosylhomocysteine nucleosidase
3991 CAJPOK010000048.1 GCA905372255_01999 CDS open 12364-12852 _na     162_aa S-ribosylhomocysteine lyase
3992 CAJPOK010000048.1 GCA905372255_02000 CDS open 13039-14523 _na     494_aa Bacterial surface protein 26-residue
3993 CAJPOK010000048.1 GCA905372255_01989 gene open 111-1589
3994 CAJPOK010000048.1 GCA905372255_01990 gene open 1598-2356
3995 CAJPOK010000048.1 GCA905372255_01991 gene open 2362-3114
3996 CAJPOK010000048.1 GCA905372255_01992 gene open 3176-3769 folE
3997 CAJPOK010000048.1 GCA905372255_01993 gene open 4015-4680
3998 CAJPOK010000048.1 GCA905372255_01994 gene open 4760-6880 tpiA
3999 CAJPOK010000048.1 GCA905372255_01995 gene open 6873-7424
4000 CAJPOK010000048.1 GCA905372255_01996 gene open 7613-8500