HOMD Banner
Taxonomy: V4.3   |  16S rRNA RefSeq: V16.03   |  Genomic RefSeq: V11.03   |  Viruses: V1.2

BAKTAGenome Explorer: Porphyromonas pasteri (GCA_905372325.1)

Select a Genome:
BAKTA Annotations for GCA_905372325.1
Genome Selected: Porphyromonas pasteri
ContigsBases CDSrRNA tmRNAtRNA
157 2,168,486 1674 0 1 44
[Table]   [AA Fasta]      [Browser]   [Text]   [Excel]  
Search & Sort all 3453 Records
Search These Records: Clear
Sort Column:   Molecule   PID   NA   AA   Gene  Gene Product  Reverse
Annotation Table [page:5]    |    Number of Records Found: 3453 [7 Pages]    |    Previous Page <==> Next Page    |    Jump to Page: [ 1  2  3  4  5  6  7  ]
Notes:   1- Column headers only sort the current page. 2- Select [NA] or [AA] links to show sequences.
Region Protein-ID Type Genome
Viewer		 Range
(bp)		 Show Sequences
(length) NA / AA		 BAKTA
Gene		 BAKTA
GeneProduct
2001 CAJPOX010000046.1 GCA905372325_00997 gene open 8684-10759
2002 CAJPOX010000046.1 GCA905372325_00998 gene open 10769-11563
2003 CAJPOX010000046.1 GCA905372325_00999 gene open 11657-12418 truA
2004 CAJPOX010000046.1 GCA905372325_01000 gene open 12426-14777 topA
2005 CAJPOX010000046.1 GCA905372325_01001 gene open 14966-15039 trnA
2006 CAJPOX010000046.1 GCA905372325_01002 gene open 15057-15130 trnI
2007 CAJPOX010000046.1 GCA905372325_01001 tRNA open 14966-15039 trnA tRNA-Ala(tgc)
2008 CAJPOX010000046.1 GCA905372325_01002 tRNA open 15057-15130 trnI tRNA-Ile(gat)
2009 CAJPOX010000047.1 GCA905372325_01003 CDS open 572-1288 _na     238_aa DUF4476 domain-containing protein
2010 CAJPOX010000047.1 GCA905372325_01004 CDS open 1404-2828 _na     474_aa omlA SmpA / OmlA family protein
2011 CAJPOX010000047.1 GCA905372325_01005 CDS open 2931-3425 _na     164_aa N-acetyltransferase
2012 CAJPOX010000047.1 GCA905372325_01006 CDS open 3511-3969 _na     152_aa ATP synthase subunit C
2013 CAJPOX010000047.1 GCA905372325_01007 CDS open 4008-5837 _na     609_aa V-type ATP synthase subunit I
2014 CAJPOX010000047.1 GCA905372325_01008 CDS open 5834-6394 _na     186_aa V-type ATP synthase subunit D
2015 CAJPOX010000047.1 GCA905372325_01009 CDS open 6477-7106 _na     209_aa Type 1 glutamine amidotransferase-like domain-containing protein
2016 CAJPOX010000047.1 GCA905372325_01010 CDS open 7189-8550 _na     453_aa V-type ATP synthase subunit B
2017 CAJPOX010000047.1 GCA905372325_01011 CDS open 8519-10297 _na     592_aa V-type ATP synthase alpha chain
2018 CAJPOX010000047.1 GCA905372325_01012 CDS open 10360-11340 _na     326_aa DUF2764 domain-containing protein
2019 CAJPOX010000047.1 GCA905372325_01013 CDS open 11369-11959 _na     196_aa ATP synthase%2C subunit E
2020 CAJPOX010000047.1 GCA905372325_01014 CDS open 12269-14398 _na     709_aa Dipeptidyl-peptidase
2021 CAJPOX010000047.1 GCA905372325_01003 gene open 572-1288
2022 CAJPOX010000047.1 GCA905372325_01004 gene open 1404-2828 omlA
2023 CAJPOX010000047.1 GCA905372325_01005 gene open 2931-3425
2024 CAJPOX010000047.1 GCA905372325_01006 gene open 3511-3969
2025 CAJPOX010000047.1 GCA905372325_01007 gene open 4008-5837
2026 CAJPOX010000047.1 GCA905372325_01008 gene open 5834-6394
2027 CAJPOX010000047.1 GCA905372325_01009 gene open 6477-7106
2028 CAJPOX010000047.1 GCA905372325_01010 gene open 7189-8550
2029 CAJPOX010000047.1 GCA905372325_01011 gene open 8519-10297
2030 CAJPOX010000047.1 GCA905372325_01012 gene open 10360-11340
2031 CAJPOX010000047.1 GCA905372325_01013 gene open 11369-11959
2032 CAJPOX010000047.1 GCA905372325_01014 gene open 12269-14398
2033 CAJPOX010000048.1 GCA905372325_01015 CDS open 57-725 _na     222_aa korA 2-oxoglutarate oxidoreductase subunit KorA
2034 CAJPOX010000048.1 GCA905372325_01016 CDS open 730-1764 _na     344_aa Thiamine pyrophosphate enzyme%2C TPP binding domain protein
2035 CAJPOX010000048.1 GCA905372325_01017 CDS open 1851-2867 _na     338_aa gldN Gliding motility-associated protein GldN
2036 CAJPOX010000048.1 GCA905372325_01018 CDS open 2899-4446 _na     515_aa gldM Gliding motility-associated protein GldM
2037 CAJPOX010000048.1 GCA905372325_01019 CDS open 4458-5096 _na     212_aa gldL gliding motility protein GldL
2038 CAJPOX010000048.1 GCA905372325_01020 CDS open 5129-6562 _na     477_aa gldK Putative gliding motility-associated lipoprotein GldK
2039 CAJPOX010000048.1 GCA905372325_01021 CDS open 6580-7527 _na     315_aa Bacteroidetes-specific putative membrane protein
2040 CAJPOX010000048.1 GCA905372325_01022 CDS open 7557-7778 _na     73_aa PF11387 family protein
2041 CAJPOX010000048.1 GCA905372325_01023 CDS open 7909-8196 _na     95_aa hypothetical protein
2042 CAJPOX010000048.1 GCA905372325_01024 CDS open 8241-9782 _na     513_aa Mg chelatase-like protein
2043 CAJPOX010000048.1 GCA905372325_01025 CDS open 9831-10532 _na     233_aa Lipoprotein
2044 CAJPOX010000048.1 GCA905372325_01026 CDS open 10519-12627 _na     702_aa PF03629 domain protein
2045 CAJPOX010000048.1 GCA905372325_01027 CDS open 12644-13252 _na     202_aa DUF4294 domain-containing protein
2046 CAJPOX010000048.1 GCA905372325_01028 CDS open 13277-14503 _na     408_aa L-serine ammonia-lyase
2047 CAJPOX010000048.1 GCA905372325_01015 gene open 57-725 korA
2048 CAJPOX010000048.1 GCA905372325_01016 gene open 730-1764
2049 CAJPOX010000048.1 GCA905372325_01017 gene open 1851-2867 gldN
2050 CAJPOX010000048.1 GCA905372325_01018 gene open 2899-4446 gldM
2051 CAJPOX010000048.1 GCA905372325_01019 gene open 4458-5096 gldL
2052 CAJPOX010000048.1 GCA905372325_01020 gene open 5129-6562 gldK
2053 CAJPOX010000048.1 GCA905372325_01021 gene open 6580-7527
2054 CAJPOX010000048.1 GCA905372325_01022 gene open 7557-7778
2055 CAJPOX010000048.1 GCA905372325_01023 gene open 7909-8196
2056 CAJPOX010000048.1 GCA905372325_01024 gene open 8241-9782
2057 CAJPOX010000048.1 GCA905372325_01025 gene open 9831-10532
2058 CAJPOX010000048.1 GCA905372325_01026 gene open 10519-12627
2059 CAJPOX010000048.1 GCA905372325_01027 gene open 12644-13252
2060 CAJPOX010000048.1 GCA905372325_01028 gene open 13277-14503
2061 CAJPOX010000049.1 GCA905372325_01029 CDS open 195-2627 _na     810_aa Outer membrane protein%2C OMP85 family
2062 CAJPOX010000049.1 GCA905372325_01030 CDS open 2664-7457 _na     1597_aa asmA AsmA domain-containing protein
2063 CAJPOX010000049.1 GCA905372325_01031 CDS open 7486-8574 _na     362_aa GDP-L-fucose synthase
2064 CAJPOX010000049.1 GCA905372325_01032 CDS open 8574-9641 _na     355_aa gmd GDP-mannose 4%2C6-dehydratase
2065 CAJPOX010000049.1 GCA905372325_01033 CDS open 9696-12044 _na     782_aa peptidoglycan glycosyltransferase
2066 CAJPOX010000049.1 GCA905372325_01034 CDS open 12328-14580 _na     750_aa beta-N-acetylhexosaminidase
2067 CAJPOX010000049.1 GCA905372325_01029 gene open 195-2627
2068 CAJPOX010000049.1 GCA905372325_01030 gene open 2664-7457 asmA
2069 CAJPOX010000049.1 GCA905372325_01031 gene open 7486-8574
2070 CAJPOX010000049.1 GCA905372325_01032 gene open 8574-9641 gmd
2071 CAJPOX010000049.1 GCA905372325_01033 gene open 9696-12044
2072 CAJPOX010000049.1 GCA905372325_01034 gene open 12328-14580
2073 CAJPOX010000050.1 GCA905372325_01035 CDS open 265-1434 _na     389_aa Lipoprotein
2074 CAJPOX010000050.1 GCA905372325_01036 CDS open 1593-3344 _na     583_aa Putative phosphoglucomutase
2075 CAJPOX010000050.1 GCA905372325_01037 CDS open 3425-4138 _na     237_aa putative 2-phosphosulfolactate phosphatase
2076 CAJPOX010000050.1 GCA905372325_01038 CDS open 4244-4747 _na     167_aa tpx thiol peroxidase
2077 CAJPOX010000050.1 GCA905372325_01039 CDS open 4853-7135 _na     760_aa Outer membrane protein%2C OMP85 family
2078 CAJPOX010000050.1 GCA905372325_01040 CDS open 7122-7880 _na     252_aa Putative shikimate dehydrogenase
2079 CAJPOX010000050.1 GCA905372325_01041 CDS open 7896-9065 _na     389_aa cbiT Precorrin-6y C5%2C15-methyltransferase (Decarboxylating)%2C CbiE subunit / precorrin-6Y C5%2C15-methyltransferase (Decarboxylating)%2C CbiT subunit multi-domain protein
2080 CAJPOX010000050.1 GCA905372325_01042 CDS open 9608-12673 _na     1021_aa TonB-dependent receptor plug domain-containing protein
2081 CAJPOX010000050.1 GCA905372325_01043 CDS open 12767-14404 _na     545_aa susD SusD family protein
2082 CAJPOX010000050.1 GCA905372325_01035 gene open 265-1434
2083 CAJPOX010000050.1 GCA905372325_01036 gene open 1593-3344
2084 CAJPOX010000050.1 GCA905372325_01037 gene open 3425-4138
2085 CAJPOX010000050.1 GCA905372325_01038 gene open 4244-4747 tpx
2086 CAJPOX010000050.1 GCA905372325_01039 gene open 4853-7135
2087 CAJPOX010000050.1 GCA905372325_01040 gene open 7122-7880
2088 CAJPOX010000050.1 GCA905372325_01041 gene open 7896-9065 cbiT
2089 CAJPOX010000050.1 GCA905372325_01042 gene open 9608-12673
2090 CAJPOX010000050.1 GCA905372325_01043 gene open 12767-14404 susD
2091 CAJPOX010000051.1 GCA905372325_01044 CDS open 1250-1372 _na     40_aa hypothetical protein
2092 CAJPOX010000051.1 GCA905372325_01045 CDS open 1982-2563 _na     193_aa hypothetical protein
2093 CAJPOX010000051.1 GCA905372325_01046 CDS open 2560-3390 _na     276_aa ABC 3 transport family protein
2094 CAJPOX010000051.1 GCA905372325_01047 CDS open 3417-3887 _na     156_aa Phospholipase
2095 CAJPOX010000051.1 GCA905372325_01048 CDS open 4262-5434 _na     390_aa Phosphate-selective porin O and P
2096 CAJPOX010000051.1 GCA905372325_01049 CDS open 5474-6769 _na     431_aa Putative glucose-1-phosphatase
2097 CAJPOX010000051.1 GCA905372325_01050 CDS open 7532-9661 _na     709_aa Alpha-glucosidase
2098 CAJPOX010000051.1 GCA905372325_01051 CDS open 9759-12749 _na     996_aa TonB-dependent receptor plug domain protein
2099 CAJPOX010000051.1 GCA905372325_01052 CDS open 12765-14330 _na     521_aa susD SusD family protein
2100 CAJPOX010000051.1 GCA905372325_01044 gene open 1250-1372
2101 CAJPOX010000051.1 GCA905372325_01045 gene open 1982-2563
2102 CAJPOX010000051.1 GCA905372325_01046 gene open 2560-3390
2103 CAJPOX010000051.1 GCA905372325_01047 gene open 3417-3887
2104 CAJPOX010000051.1 GCA905372325_01048 gene open 4262-5434
2105 CAJPOX010000051.1 GCA905372325_01049 gene open 5474-6769
2106 CAJPOX010000051.1 GCA905372325_01050 gene open 7532-9661
2107 CAJPOX010000051.1 GCA905372325_01051 gene open 9759-12749
2108 CAJPOX010000051.1 GCA905372325_01052 gene open 12765-14330 susD
2109 CAJPOX010000052.1 GCA905372325_01053 CDS open 361-819 _na     152_aa hypothetical protein
2110 CAJPOX010000052.1 GCA905372325_01054 CDS open 816-1547 _na     243_aa Lipoprotein
2111 CAJPOX010000052.1 GCA905372325_01055 CDS open 1670-3466 _na     598_aa Thiol-activated cytolysin
2112 CAJPOX010000052.1 GCA905372325_01056 CDS open 3504-5336 _na     610_aa Thiol-activated cytolysin domain protein
2113 CAJPOX010000052.1 GCA905372325_01057 CDS open 6001-6567 _na     188_aa hypothetical protein
2114 CAJPOX010000052.1 GCA905372325_01059 CDS open 6760-7827 _na     355_aa Endonuclease/exonuclease/phosphatase family protein
2115 CAJPOX010000052.1 GCA905372325_01060 CDS open 7937-8938 _na     333_aa Lactate/malate dehydrogenase%2C NAD binding domain protein
2116 CAJPOX010000052.1 GCA905372325_01061 CDS open 9080-13570 _na     1496_aa tamB Translocation/assembly module TamB
2117 CAJPOX010000052.1 GCA905372325_01053 gene open 361-819
2118 CAJPOX010000052.1 GCA905372325_01054 gene open 816-1547
2119 CAJPOX010000052.1 GCA905372325_01055 gene open 1670-3466
2120 CAJPOX010000052.1 GCA905372325_01056 gene open 3504-5336
2121 CAJPOX010000052.1 GCA905372325_01057 gene open 6001-6567
2122 CAJPOX010000052.1 GCA905372325_01059 gene open 6760-7827
2123 CAJPOX010000052.1 GCA905372325_01060 gene open 7937-8938
2124 CAJPOX010000052.1 GCA905372325_01061 gene open 9080-13570 tamB
2125 CAJPOX010000052.1 GCA905372325_01058 gene open 6615-6687 trnT
2126 CAJPOX010000052.1 GCA905372325_01058 tRNA open 6615-6687 trnT tRNA-Thr(cgt)
2127 CAJPOX010000053.1 GCA905372325_01062 CDS open 537-1142 _na     201_aa hypothetical protein
2128 CAJPOX010000053.1 GCA905372325_01063 CDS open 1245-1505 _na     86_aa hypothetical protein
2129 CAJPOX010000053.1 GCA905372325_01064 CDS open 1870-3981 _na     703_aa Alpha-glucosidase
2130 CAJPOX010000053.1 GCA905372325_01065 CDS open 4145-5596 _na     483_aa Alpha galactosidase C-terminal beta sandwich domain-containing protein
2131 CAJPOX010000053.1 GCA905372325_01066 CDS open 5625-7184 _na     519_aa Outer membrane protein SusF/SusE-like C-terminal domain-containing protein
2132 CAJPOX010000053.1 GCA905372325_01067 CDS open 7231-8943 _na     570_aa susD SusD family protein
2133 CAJPOX010000053.1 GCA905372325_01068 CDS open 9001-11988 _na     995_aa TonB-dependent receptor plug domain protein
2134 CAJPOX010000053.1 GCA905372325_01069 CDS open 12202-13959 _na     585_aa Tetratricopeptide repeat protein
2135 CAJPOX010000053.1 GCA905372325_01062 gene open 537-1142
2136 CAJPOX010000053.1 GCA905372325_01063 gene open 1245-1505
2137 CAJPOX010000053.1 GCA905372325_01064 gene open 1870-3981
2138 CAJPOX010000053.1 GCA905372325_01065 gene open 4145-5596
2139 CAJPOX010000053.1 GCA905372325_01066 gene open 5625-7184
2140 CAJPOX010000053.1 GCA905372325_01067 gene open 7231-8943 susD
2141 CAJPOX010000053.1 GCA905372325_01068 gene open 9001-11988
2142 CAJPOX010000053.1 GCA905372325_01069 gene open 12202-13959
2143 CAJPOX010000054.1 GCA905372325_01071 CDS open 548-1735 _na     395_aa tuf elongation factor Tu
2144 CAJPOX010000054.1 GCA905372325_01073 CDS open 1889-2095 _na     68_aa secE preprotein translocase subunit SecE
2145 CAJPOX010000054.1 GCA905372325_01074 CDS open 2119-2670 _na     183_aa nusG transcription termination/antitermination protein NusG
2146 CAJPOX010000054.1 GCA905372325_01075 CDS open 2730-3170 _na     146_aa rplK 50S ribosomal protein L11
2147 CAJPOX010000054.1 GCA905372325_01076 CDS open 3182-3877 _na     231_aa rplA 50S ribosomal protein L1
2148 CAJPOX010000054.1 GCA905372325_01077 CDS open 3895-4407 _na     170_aa rplJ 50S ribosomal protein L10
2149 CAJPOX010000054.1 GCA905372325_01078 CDS open 4464-4832 _na     122_aa rplL 50S ribosomal protein L7/L12
2150 CAJPOX010000054.1 GCA905372325_01079 CDS open 4949-8761 _na     1270_aa rpoB DNA-directed RNA polymerase subunit beta
2151 CAJPOX010000054.1 GCA905372325_01080 CDS open 8787-13142 _na     1451_aa rpoC DNA-directed RNA polymerase subunit beta'
2152 CAJPOX010000054.1 GCA905372325_01071 gene open 548-1735 tuf
2153 CAJPOX010000054.1 GCA905372325_01073 gene open 1889-2095 secE
2154 CAJPOX010000054.1 GCA905372325_01074 gene open 2119-2670 nusG
2155 CAJPOX010000054.1 GCA905372325_01075 gene open 2730-3170 rplK
2156 CAJPOX010000054.1 GCA905372325_01076 gene open 3182-3877 rplA
2157 CAJPOX010000054.1 GCA905372325_01077 gene open 3895-4407 rplJ
2158 CAJPOX010000054.1 GCA905372325_01078 gene open 4464-4832 rplL
2159 CAJPOX010000054.1 GCA905372325_01079 gene open 4949-8761 rpoB
2160 CAJPOX010000054.1 GCA905372325_01080 gene open 8787-13142 rpoC
2161 CAJPOX010000054.1 GCA905372325_01070 gene open 403-474 trnT
2162 CAJPOX010000054.1 GCA905372325_01072 gene open 1799-1871 trnW
2163 CAJPOX010000054.1 GCA905372325_01070 tRNA open 403-474 trnT tRNA-Thr(ggt)
2164 CAJPOX010000054.1 GCA905372325_01072 tRNA open 1799-1871 trnW tRNA-Trp(cca)
2165 CAJPOX010000055.1 GCA905372325_01081 CDS open 15-1622 _na     535_aa 4-alpha-glucanotransferase
2166 CAJPOX010000055.1 GCA905372325_01082 CDS open 1627-2622 _na     331_aa PhoH-like protein
2167 CAJPOX010000055.1 GCA905372325_01083 CDS open 2627-3568 _na     313_aa phosphoribosylaminoimidazolesuccinocarboxamide synthase
2168 CAJPOX010000055.1 GCA905372325_01084 CDS open 4036-4752 _na     238_aa NAD-dependent protein deacylase
2169 CAJPOX010000055.1 GCA905372325_01085 CDS open 4749-6902 _na     717_aa Dipeptidyl-peptidase
2170 CAJPOX010000055.1 GCA905372325_01086 CDS open 6962-7552 _na     196_aa 4'-phosphopantetheinyl transferase domain-containing protein
2171 CAJPOX010000055.1 GCA905372325_01087 CDS open 7549-8838 _na     429_aa gldE Gliding motility-associated protein GldE
2172 CAJPOX010000055.1 GCA905372325_01088 CDS open 8893-10176 _na     427_aa WD40-like protein
2173 CAJPOX010000055.1 GCA905372325_01089 CDS open 10186-11496 _na     436_aa Porin
2174 CAJPOX010000055.1 GCA905372325_01090 CDS open 11657-13192 _na     511_aa Peptidase Do
2175 CAJPOX010000055.1 GCA905372325_01081 gene open 15-1622
2176 CAJPOX010000055.1 GCA905372325_01082 gene open 1627-2622
2177 CAJPOX010000055.1 GCA905372325_01083 gene open 2627-3568
2178 CAJPOX010000055.1 GCA905372325_01084 gene open 4036-4752
2179 CAJPOX010000055.1 GCA905372325_01085 gene open 4749-6902
2180 CAJPOX010000055.1 GCA905372325_01086 gene open 6962-7552
2181 CAJPOX010000055.1 GCA905372325_01087 gene open 7549-8838 gldE
2182 CAJPOX010000055.1 GCA905372325_01088 gene open 8893-10176
2183 CAJPOX010000055.1 GCA905372325_01089 gene open 10186-11496
2184 CAJPOX010000055.1 GCA905372325_01090 gene open 11657-13192
2185 CAJPOX010000056.1 GCA905372325_01091 CDS open 445-1371 _na     308_aa oxyR Putative oxidative stress regulatory protein OxyR
2186 CAJPOX010000056.1 GCA905372325_01092 CDS open 1381-2361 _na     326_aa glycosyltransferase
2187 CAJPOX010000056.1 GCA905372325_01093 CDS open 2373-3482 _na     369_aa Glycosyltransferase family 4 protein
2188 CAJPOX010000056.1 GCA905372325_01096 CDS open 4467-5501 _na     344_aa branched-chain amino acid aminotransferase
2189 CAJPOX010000056.1 GCA905372325_01097 CDS open 5598-6905 _na     435_aa DUF4302 domain-containing protein
2190 CAJPOX010000056.1 GCA905372325_01098 CDS open 6902-7957 _na     351_aa Substrate import-associated zinc metallohydrolase lipoprotein
2191 CAJPOX010000056.1 GCA905372325_01099 CDS open 7987-9558 _na     523_aa SusD-like N-terminal domain-containing protein
2192 CAJPOX010000056.1 GCA905372325_01100 CDS open 9572-12685 _na     1037_aa TonB-dependent receptor plug domain protein
2193 CAJPOX010000056.1 GCA905372325_01101 CDS open 12937-13188 _na     83_aa rpmE2 type B 50S ribosomal protein L31
2194 CAJPOX010000056.1 GCA905372325_01091 gene open 445-1371 oxyR
2195 CAJPOX010000056.1 GCA905372325_01092 gene open 1381-2361
2196 CAJPOX010000056.1 GCA905372325_01093 gene open 2373-3482
2197 CAJPOX010000056.1 GCA905372325_01096 gene open 4467-5501
2198 CAJPOX010000056.1 GCA905372325_01097 gene open 5598-6905
2199 CAJPOX010000056.1 GCA905372325_01098 gene open 6902-7957
2200 CAJPOX010000056.1 GCA905372325_01099 gene open 7987-9558
2201 CAJPOX010000056.1 GCA905372325_01100 gene open 9572-12685
2202 CAJPOX010000056.1 GCA905372325_01101 gene open 12937-13188 rpmE2
2203 CAJPOX010000056.1 GCA905372325_01094 gene open 3733-3805 trnF
2204 CAJPOX010000056.1 GCA905372325_01095 gene open 3832-3918 trnS
2205 CAJPOX010000056.1 GCA905372325_01094 tRNA open 3733-3805 trnF tRNA-Phe(gaa)
2206 CAJPOX010000056.1 GCA905372325_01095 tRNA open 3832-3918 trnS tRNA-Ser(gct)
2207 CAJPOX010000057.1 GCA905372325_01102 CDS open 304-879 _na     191_aa 50S ribosomal protein L25/general stress protein Ctc
2208 CAJPOX010000057.1 GCA905372325_01103 CDS open 1022-2563 _na     513_aa dacB D-alanyl-D-alanine carboxypeptidase/D-alanyl-D-alanine-endopeptidase
2209 CAJPOX010000057.1 GCA905372325_01104 CDS open 2823-3821 _na     332_aa porV type IX secretion system outer membrane channel protein PorV
2210 CAJPOX010000057.1 GCA905372325_01105 CDS open 3827-4324 _na     165_aa 2-C-methyl-D-erythritol 2%2C4-cyclodiphosphate synthase
2211 CAJPOX010000057.1 GCA905372325_01106 CDS open 4413-5501 _na     362_aa Putative mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase
2212 CAJPOX010000057.1 GCA905372325_01107 CDS open 5879-6172 _na     97_aa DUF1294 domain-containing protein
2213 CAJPOX010000057.1 GCA905372325_01108 CDS open 6169-6573 _na     134_aa Peptidyl-prolyl cis-trans isomerase
2214 CAJPOX010000057.1 GCA905372325_01109 CDS open 6671-7615 _na     314_aa ribose-phosphate diphosphokinase
2215 CAJPOX010000057.1 GCA905372325_01110 CDS open 7659-9686 _na     675_aa 1%2C4-alpha-glucan branching enzyme
2216 CAJPOX010000057.1 GCA905372325_01111 CDS open 9738-11996 _na     752_aa Transporter%2C CPA2 family
2217 CAJPOX010000057.1 GCA905372325_01112 CDS open 12306-12728 _na     140_aa mscL large-conductance mechanosensitive channel protein MscL
2218 CAJPOX010000057.1 GCA905372325_01102 gene open 304-879
2219 CAJPOX010000057.1 GCA905372325_01103 gene open 1022-2563 dacB
2220 CAJPOX010000057.1 GCA905372325_01104 gene open 2823-3821 porV
2221 CAJPOX010000057.1 GCA905372325_01105 gene open 3827-4324
2222 CAJPOX010000057.1 GCA905372325_01106 gene open 4413-5501
2223 CAJPOX010000057.1 GCA905372325_01107 gene open 5879-6172
2224 CAJPOX010000057.1 GCA905372325_01108 gene open 6169-6573
2225 CAJPOX010000057.1 GCA905372325_01109 gene open 6671-7615
2226 CAJPOX010000057.1 GCA905372325_01110 gene open 7659-9686
2227 CAJPOX010000057.1 GCA905372325_01111 gene open 9738-11996
2228 CAJPOX010000057.1 GCA905372325_01112 gene open 12306-12728 mscL
2229 CAJPOX010000058.1 repeat_region open 11786-12081 CRISPR array with 4 repeats of length 51%2C consensus sequence CCAGCTGTATTAGCAAGTATGAAGGTACGAAATCTGAAAGCTAATCACAGC and spacer length 27
2230 CAJPOX010000058.1 repeat_region open 12256-13012 CRISPR array with 10 repeats of length 48%2C consensus sequence GCTGTATTAGCAAGTGTGAAGGTACGAAATCTGAAAGCTAATCACAGC and spacer length 29
2231 CAJPOX010000058.1 GCA905372325_01113 CDS open 155-2746 _na     863_aa hypothetical protein
2232 CAJPOX010000058.1 GCA905372325_01114 CDS open 2875-4212 _na     445_aa gdhA NADP-specific glutamate dehydrogenase
2233 CAJPOX010000058.1 GCA905372325_01115 CDS open 4540-5772 _na     410_aa Efflux ABC transporter%2C permease protein
2234 CAJPOX010000058.1 GCA905372325_01116 CDS open 5804-6133 _na     109_aa Ribosome-binding factor A
2235 CAJPOX010000058.1 GCA905372325_01117 CDS open 6410-6925 _na     171_aa Lipoprotein
2236 CAJPOX010000058.1 GCA905372325_01118 CDS open 7480-11103 _na     1207_aa cas9 type II CRISPR RNA-guided endonuclease Cas9
2237 CAJPOX010000058.1 GCA905372325_01119 CDS open 11119-11391 _na     90_aa CRISP-associated protein Cas1
2238 CAJPOX010000058.1 GCA905372325_01120 CDS open 11468-11674 _na     68_aa hypothetical protein
2239 CAJPOX010000058.1 GCA905372325_01113 gene open 155-2746
2240 CAJPOX010000058.1 GCA905372325_01114 gene open 2875-4212 gdhA
2241 CAJPOX010000058.1 GCA905372325_01115 gene open 4540-5772
2242 CAJPOX010000058.1 GCA905372325_01116 gene open 5804-6133
2243 CAJPOX010000058.1 GCA905372325_01117 gene open 6410-6925
2244 CAJPOX010000058.1 GCA905372325_01118 gene open 7480-11103 cas9
2245 CAJPOX010000058.1 GCA905372325_01119 gene open 11119-11391
2246 CAJPOX010000058.1 GCA905372325_01120 gene open 11468-11674
2247 CAJPOX010000059.1 GCA905372325_01121 CDS open 125-580 _na     151_aa Pyridoxamine 5'-phosphate oxidase family protein
2248 CAJPOX010000059.1 GCA905372325_01122 CDS open 600-2417 _na     605_aa Arylsulfatase
2249 CAJPOX010000059.1 GCA905372325_01123 CDS open 2591-2779 _na     62_aa hypothetical protein
2250 CAJPOX010000059.1 GCA905372325_01124 CDS open 2792-3766 _na     324_aa hemB porphobilinogen synthase
2251 CAJPOX010000059.1 GCA905372325_01125 CDS open 3772-4476 _na     234_aa Competence protein ComEA helix-hairpin-helix repeat region
2252 CAJPOX010000059.1 GCA905372325_01126 CDS open 4489-5190 _na     233_aa Putative lipoprotein releasing system%2C ATP-binding protein
2253 CAJPOX010000059.1 GCA905372325_01127 CDS open 5187-5957 _na     256_aa thiF ThiF family protein
2254 CAJPOX010000059.1 GCA905372325_01128 CDS open 5954-7060 _na     368_aa Endolytic murein transglycosylase
2255 CAJPOX010000059.1 GCA905372325_01129 CDS open 7079-8224 _na     381_aa DUF4369 domain-containing protein
2256 CAJPOX010000059.1 GCA905372325_01130 CDS open 8260-9273 _na     337_aa dusB tRNA dihydrouridine synthase DusB
2257 CAJPOX010000059.1 GCA905372325_01131 CDS open 9270-10964 _na     564_aa Sulfate permease
2258 CAJPOX010000059.1 GCA905372325_01132 CDS open 11303-12013 _na     236_aa hypothetical protein
2259 CAJPOX010000059.1 GCA905372325_01121 gene open 125-580
2260 CAJPOX010000059.1 GCA905372325_01122 gene open 600-2417
2261 CAJPOX010000059.1 GCA905372325_01123 gene open 2591-2779
2262 CAJPOX010000059.1 GCA905372325_01124 gene open 2792-3766 hemB
2263 CAJPOX010000059.1 GCA905372325_01125 gene open 3772-4476
2264 CAJPOX010000059.1 GCA905372325_01126 gene open 4489-5190
2265 CAJPOX010000059.1 GCA905372325_01127 gene open 5187-5957 thiF
2266 CAJPOX010000059.1 GCA905372325_01128 gene open 5954-7060
2267 CAJPOX010000059.1 GCA905372325_01129 gene open 7079-8224
2268 CAJPOX010000059.1 GCA905372325_01130 gene open 8260-9273 dusB
2269 CAJPOX010000059.1 GCA905372325_01131 gene open 9270-10964
2270 CAJPOX010000059.1 GCA905372325_01132 gene open 11303-12013
2271 CAJPOX010000060.1 GCA905372325_01133 CDS open 187-1449 _na     420_aa DUF4929 domain-containing protein
2272 CAJPOX010000060.1 GCA905372325_01134 CDS open 1479-2918 _na     479_aa susD SusD family protein
2273 CAJPOX010000060.1 GCA905372325_01135 CDS open 2918-6046 _na     1042_aa TonB-dependent receptor plug domain protein
2274 CAJPOX010000060.1 GCA905372325_01136 CDS open 6065-6397 _na     110_aa DUF2149 domain-containing protein
2275 CAJPOX010000060.1 GCA905372325_01137 CDS open 6433-7032 _na     199_aa MotA/TolQ/ExbB proton channel domain-containing protein
2276 CAJPOX010000060.1 GCA905372325_01138 CDS open 7048-7731 _na     227_aa Beta-carotene 15%2C15'-monooxygenase
2277 CAJPOX010000060.1 GCA905372325_01139 CDS open 7769-12037 _na     1422_aa CobN/magnesium chelatase domain protein
2278 CAJPOX010000060.1 GCA905372325_01133 gene open 187-1449
2279 CAJPOX010000060.1 GCA905372325_01134 gene open 1479-2918 susD
2280 CAJPOX010000060.1 GCA905372325_01135 gene open 2918-6046
2281 CAJPOX010000060.1 GCA905372325_01136 gene open 6065-6397
2282 CAJPOX010000060.1 GCA905372325_01137 gene open 6433-7032
2283 CAJPOX010000060.1 GCA905372325_01138 gene open 7048-7731
2284 CAJPOX010000060.1 GCA905372325_01139 gene open 7769-12037
2285 CAJPOX010000061.1 GCA905372325_01140 CDS open 215-1882 _na     555_aa recN DNA repair protein RecN
2286 CAJPOX010000061.1 GCA905372325_01141 CDS open 1901-2797 _na     298_aa DUF4835 domain-containing protein
2287 CAJPOX010000061.1 GCA905372325_01142 CDS open 2832-4040 _na     402_aa coaBC bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC
2288 CAJPOX010000061.1 GCA905372325_01143 CDS open 4040-4810 _na     256_aa Exonuclease
2289 CAJPOX010000061.1 GCA905372325_01144 CDS open 4841-5980 _na     379_aa dnaN DNA polymerase III subunit beta
2290 CAJPOX010000061.1 GCA905372325_01145 CDS open 6554-7165 _na     203_aa luxR Transcriptional regulator%2C LuxR family
2291 CAJPOX010000061.1 GCA905372325_01146 CDS open 7256-7975 _na     239_aa Hemerythrin HHE cation binding domain protein
2292 CAJPOX010000061.1 GCA905372325_01147 CDS open 8267-9148 _na     293_aa pfkB Kinase%2C PfkB family
2293 CAJPOX010000061.1 GCA905372325_01148 CDS open 9197-10057 _na     286_aa hypothetical protein
2294 CAJPOX010000061.1 GCA905372325_01149 CDS open 10193-10444 _na     83_aa ytxH YtxH domain-containing protein
2295 CAJPOX010000061.1 GCA905372325_01150 CDS open 11210-11944 _na     244_aa Lipoprotein
2296 CAJPOX010000061.1 GCA905372325_01140 gene open 215-1882 recN
2297 CAJPOX010000061.1 GCA905372325_01141 gene open 1901-2797
2298 CAJPOX010000061.1 GCA905372325_01142 gene open 2832-4040 coaBC
2299 CAJPOX010000061.1 GCA905372325_01143 gene open 4040-4810
2300 CAJPOX010000061.1 GCA905372325_01144 gene open 4841-5980 dnaN
2301 CAJPOX010000061.1 GCA905372325_01145 gene open 6554-7165 luxR
2302 CAJPOX010000061.1 GCA905372325_01146 gene open 7256-7975
2303 CAJPOX010000061.1 GCA905372325_01147 gene open 8267-9148 pfkB
2304 CAJPOX010000061.1 GCA905372325_01148 gene open 9197-10057
2305 CAJPOX010000061.1 GCA905372325_01149 gene open 10193-10444 ytxH
2306 CAJPOX010000061.1 GCA905372325_01150 gene open 11210-11944
2307 CAJPOX010000062.1 GCA905372325_01151 CDS open 220-1578 _na     452_aa lpdA dihydrolipoyl dehydrogenase
2308 CAJPOX010000062.1 GCA905372325_01152 CDS open 1633-2934 _na     433_aa Dihydrolipoamide acetyltransferase component of pyruvate dehydrogenase complex
2309 CAJPOX010000062.1 GCA905372325_01153 CDS open 2937-4982 _na     681_aa 3-methyl-2-oxobutanoate dehydrogenase (2-methylpropanoyl-transferring)
2310 CAJPOX010000062.1 GCA905372325_01154 CDS open 5002-5511 _na     169_aa flavodoxin
2311 CAJPOX010000062.1 GCA905372325_01155 CDS open 6334-8907 _na     857_aa yfhO Bacterial membrane protein YfhO
2312 CAJPOX010000062.1 GCA905372325_01156 CDS open 8936-10639 _na     567_aa Tetratricopeptide repeat protein
2313 CAJPOX010000062.1 GCA905372325_01157 CDS open 10764-11720 _na     318_aa fmt methionyl-tRNA formyltransferase
2314 CAJPOX010000062.1 GCA905372325_01151 gene open 220-1578 lpdA
2315 CAJPOX010000062.1 GCA905372325_01152 gene open 1633-2934
2316 CAJPOX010000062.1 GCA905372325_01153 gene open 2937-4982
2317 CAJPOX010000062.1 GCA905372325_01154 gene open 5002-5511
2318 CAJPOX010000062.1 GCA905372325_01155 gene open 6334-8907 yfhO
2319 CAJPOX010000062.1 GCA905372325_01156 gene open 8936-10639
2320 CAJPOX010000062.1 GCA905372325_01157 gene open 10764-11720 fmt
2321 CAJPOX010000063.1 GCA905372325_01158 CDS open 337-2790 _na     817_aa Pyridine nucleotide-disulfide oxidoreductase
2322 CAJPOX010000063.1 GCA905372325_01159 CDS open 2800-3171 _na     123_aa marR Transcriptional regulator%2C MarR family
2323 CAJPOX010000063.1 GCA905372325_01160 CDS open 3483-5132 _na     549_aa lamin tail domain-containing protein
2324 CAJPOX010000063.1 GCA905372325_01161 CDS open 5110-6039 _na     309_aa Phage integrase%2C SAM-like domain protein
2325 CAJPOX010000063.1 GCA905372325_01162 CDS open 6051-6701 _na     216_aa pdxH pyridoxamine 5'-phosphate oxidase
2326 CAJPOX010000063.1 GCA905372325_01163 CDS open 6726-8018 _na     430_aa Glycosyl hydrolase%2C family 57
2327 CAJPOX010000063.1 GCA905372325_01164 CDS open 8048-9307 _na     419_aa Glycosyltransferase%2C group 1 family protein
2328 CAJPOX010000063.1 GCA905372325_01165 CDS open 9304-11280 _na     658_aa Putative glycogen debranching enzyme%2C type
2329 CAJPOX010000063.1 GCA905372325_01158 gene open 337-2790
2330 CAJPOX010000063.1 GCA905372325_01159 gene open 2800-3171 marR
2331 CAJPOX010000063.1 GCA905372325_01160 gene open 3483-5132
2332 CAJPOX010000063.1 GCA905372325_01161 gene open 5110-6039
2333 CAJPOX010000063.1 GCA905372325_01162 gene open 6051-6701 pdxH
2334 CAJPOX010000063.1 GCA905372325_01163 gene open 6726-8018
2335 CAJPOX010000063.1 GCA905372325_01164 gene open 8048-9307
2336 CAJPOX010000063.1 GCA905372325_01165 gene open 9304-11280
2337 CAJPOX010000064.1 GCA905372325_01166 CDS open 184-3036 _na     950_aa Peptidase%2C M16 family
2338 CAJPOX010000064.1 GCA905372325_01167 CDS open 3190-3714 _na     174_aa Putative thioredoxin
2339 CAJPOX010000064.1 GCA905372325_01168 CDS open 3818-5104 _na     428_aa serS serine--tRNA ligase
2340 CAJPOX010000064.1 GCA905372325_01169 CDS open 5206-5463 _na     85_aa rpmA 50S ribosomal protein L27
2341 CAJPOX010000064.1 GCA905372325_01170 CDS open 5500-5817 _na     105_aa rplU 50S ribosomal protein L21
2342 CAJPOX010000064.1 GCA905372325_01171 CDS open 6313-9237 _na     974_aa infB translation initiation factor IF-2
2343 CAJPOX010000064.1 GCA905372325_01172 CDS open 9364-10695 _na     443_aa nusA Transcription termination/antitermination protein NusA
2344 CAJPOX010000064.1 GCA905372325_01173 CDS open 10743-11213 _na     156_aa rimP ribosome assembly cofactor RimP
2345 CAJPOX010000064.1 GCA905372325_01166 gene open 184-3036
2346 CAJPOX010000064.1 GCA905372325_01167 gene open 3190-3714
2347 CAJPOX010000064.1 GCA905372325_01168 gene open 3818-5104 serS
2348 CAJPOX010000064.1 GCA905372325_01169 gene open 5206-5463 rpmA
2349 CAJPOX010000064.1 GCA905372325_01170 gene open 5500-5817 rplU
2350 CAJPOX010000064.1 GCA905372325_01171 gene open 6313-9237 infB
2351 CAJPOX010000064.1 GCA905372325_01172 gene open 9364-10695 nusA
2352 CAJPOX010000064.1 GCA905372325_01173 gene open 10743-11213 rimP
2353 CAJPOX010000065.1 GCA905372325_01174 CDS open 238-792 _na     184_aa aaxB Pyruvoyl-dependent arginine decarboxylase AaxB
2354 CAJPOX010000065.1 GCA905372325_01175 CDS open 933-1808 _na     291_aa TIGR00255 family protein
2355 CAJPOX010000065.1 GCA905372325_01176 CDS open 1900-2553 _na     217_aa Outer membrane protein beta-barrel domain-containing protein
2356 CAJPOX010000065.1 GCA905372325_01177 CDS open 2833-3462 _na     209_aa Ribonuclease H
2357 CAJPOX010000065.1 GCA905372325_01178 CDS open 3736-5094 _na     452_aa Amino acid carrier protein
2358 CAJPOX010000065.1 GCA905372325_01179 CDS open 5176-5685 _na     169_aa hypothetical protein
2359 CAJPOX010000065.1 GCA905372325_01180 CDS open 5961-7739 _na     592_aa 5'-nucleotidase protein
2360 CAJPOX010000065.1 GCA905372325_01181 CDS open 7784-9826 _na     680_aa metG methionine--tRNA ligase
2361 CAJPOX010000065.1 GCA905372325_01182 CDS open 9908-10942 _na     344_aa galE UDP-glucose 4-epimerase GalE
2362 CAJPOX010000065.1 GCA905372325_01183 CDS open 10964-11560 _na     198_aa yihA ribosome biogenesis GTP-binding protein YihA/YsxC
2363 CAJPOX010000065.1 GCA905372325_01174 gene open 238-792 aaxB
2364 CAJPOX010000065.1 GCA905372325_01175 gene open 933-1808
2365 CAJPOX010000065.1 GCA905372325_01176 gene open 1900-2553
2366 CAJPOX010000065.1 GCA905372325_01177 gene open 2833-3462
2367 CAJPOX010000065.1 GCA905372325_01178 gene open 3736-5094
2368 CAJPOX010000065.1 GCA905372325_01179 gene open 5176-5685
2369 CAJPOX010000065.1 GCA905372325_01180 gene open 5961-7739
2370 CAJPOX010000065.1 GCA905372325_01181 gene open 7784-9826 metG
2371 CAJPOX010000065.1 GCA905372325_01182 gene open 9908-10942 galE
2372 CAJPOX010000065.1 GCA905372325_01183 gene open 10964-11560 yihA
2373 CAJPOX010000066.1 GCA905372325_01184 CDS open 216-1526 _na     436_aa der ribosome biogenesis GTPase Der
2374 CAJPOX010000066.1 GCA905372325_01185 CDS open 1564-2466 _na     300_aa era GTPase Era
2375 CAJPOX010000066.1 GCA905372325_01186 CDS open 2560-3561 _na     333_aa Beta-ketoacyl-[acyl-carrier-protein] synthase III
2376 CAJPOX010000066.1 GCA905372325_01187 CDS open 3884-4429 _na     181_aa DUF177 domain-containing protein
2377 CAJPOX010000066.1 GCA905372325_01188 CDS open 4553-5566 _na     337_aa NAD dependent epimerase/dehydratase family protein
2378 CAJPOX010000066.1 GCA905372325_01189 CDS open 5591-6469 _na     292_aa Mce/MlaD domain-containing protein
2379 CAJPOX010000066.1 GCA905372325_01190 CDS open 6509-7744 _na     411_aa N-acetylmuramoyl-L-alanine amidase
2380 CAJPOX010000066.1 GCA905372325_01191 CDS open 7929-9233 _na     434_aa Putative permease
2381 CAJPOX010000066.1 GCA905372325_01192 CDS open 9250-9957 _na     235_aa DUF5020 domain-containing protein
2382 CAJPOX010000066.1 GCA905372325_01193 CDS open 9982-11205 _na     407_aa Putative uracil permease
2383 CAJPOX010000066.1 GCA905372325_01184 gene open 216-1526 der
2384 CAJPOX010000066.1 GCA905372325_01185 gene open 1564-2466 era
2385 CAJPOX010000066.1 GCA905372325_01186 gene open 2560-3561
2386 CAJPOX010000066.1 GCA905372325_01187 gene open 3884-4429
2387 CAJPOX010000066.1 GCA905372325_01188 gene open 4553-5566
2388 CAJPOX010000066.1 GCA905372325_01189 gene open 5591-6469
2389 CAJPOX010000066.1 GCA905372325_01190 gene open 6509-7744
2390 CAJPOX010000066.1 GCA905372325_01191 gene open 7929-9233
2391 CAJPOX010000066.1 GCA905372325_01192 gene open 9250-9957
2392 CAJPOX010000066.1 GCA905372325_01193 gene open 9982-11205
2393 CAJPOX010000067.1 GCA905372325_01194 CDS open 333-590 _na     85_aa hypothetical protein
2394 CAJPOX010000067.1 GCA905372325_01195 CDS open 905-1804 _na     299_aa DUF4292 domain-containing protein
2395 CAJPOX010000067.1 GCA905372325_01196 CDS open 1811-3628 _na     605_aa Tetratricopeptide repeat protein
2396 CAJPOX010000067.1 GCA905372325_01197 CDS open 4079-5455 _na     458_aa radA DNA repair protein RadA
2397 CAJPOX010000067.1 GCA905372325_01198 CDS open 5620-5949 _na     109_aa rpsF 30S ribosomal protein S6
2398 CAJPOX010000067.1 GCA905372325_01199 CDS open 5976-6242 _na     88_aa rpsR 30S ribosomal protein S18
2399 CAJPOX010000067.1 GCA905372325_01200 CDS open 6303-6827 _na     174_aa rplI 50S ribosomal protein L9
2400 CAJPOX010000067.1 GCA905372325_01201 CDS open 7037-7510 _na     157_aa DNA protection during starvation protein
2401 CAJPOX010000067.1 GCA905372325_01202 CDS open 7658-8653 _na     331_aa Polyprenyl synthetase
2402 CAJPOX010000067.1 GCA905372325_01203 CDS open 8685-9272 _na     195_aa Histidine kinase
2403 CAJPOX010000067.1 GCA905372325_01204 CDS open 9276-10772 _na     498_aa Ser/Thr phosphatase family protein
2404 CAJPOX010000067.1 GCA905372325_01205 CDS open 10810-11148 _na     112_aa TM2 domain protein
2405 CAJPOX010000067.1 GCA905372325_01194 gene open 333-590
2406 CAJPOX010000067.1 GCA905372325_01195 gene open 905-1804
2407 CAJPOX010000067.1 GCA905372325_01196 gene open 1811-3628
2408 CAJPOX010000067.1 GCA905372325_01197 gene open 4079-5455 radA
2409 CAJPOX010000067.1 GCA905372325_01198 gene open 5620-5949 rpsF
2410 CAJPOX010000067.1 GCA905372325_01199 gene open 5976-6242 rpsR
2411 CAJPOX010000067.1 GCA905372325_01200 gene open 6303-6827 rplI
2412 CAJPOX010000067.1 GCA905372325_01201 gene open 7037-7510
2413 CAJPOX010000067.1 GCA905372325_01202 gene open 7658-8653
2414 CAJPOX010000067.1 GCA905372325_01203 gene open 8685-9272
2415 CAJPOX010000067.1 GCA905372325_01204 gene open 9276-10772
2416 CAJPOX010000067.1 GCA905372325_01205 gene open 10810-11148
2417 CAJPOX010000068.1 GCA905372325_01206 CDS open 293-1636 _na     447_aa Pyridine nucleotide-disulfide oxidoreductase
2418 CAJPOX010000068.1 GCA905372325_01207 CDS open 1745-4225 _na     826_aa DUF4906 domain-containing protein
2419 CAJPOX010000068.1 GCA905372325_01208 CDS open 5037-7697 _na     886_aa mutS DNA mismatch repair protein MutS
2420 CAJPOX010000068.1 GCA905372325_01209 CDS open 7746-8132 _na     128_aa Acyl-CoA thioester hydrolase%2C YbgC/YbaW family
2421 CAJPOX010000068.1 GCA905372325_01210 CDS open 9071-10153 _na     360_aa IS5 family transposase
2422 CAJPOX010000068.1 GCA905372325_01211 CDS open 10366-10998 _na     210_aa Acid-resistance membrane protein
2423 CAJPOX010000068.1 GCA905372325_01206 gene open 293-1636
2424 CAJPOX010000068.1 GCA905372325_01207 gene open 1745-4225
2425 CAJPOX010000068.1 GCA905372325_01208 gene open 5037-7697 mutS
2426 CAJPOX010000068.1 GCA905372325_01209 gene open 7746-8132
2427 CAJPOX010000068.1 GCA905372325_01210 gene open 9071-10153
2428 CAJPOX010000068.1 GCA905372325_01211 gene open 10366-10998
2429 CAJPOX010000069.1 GCA905372325_01212 CDS open 756-1010 _na     84_aa rpsN 30S ribosomal protein S14
2430 CAJPOX010000069.1 GCA905372325_01213 CDS open 1031-1591 _na     186_aa rplE 50S ribosomal protein L5
2431 CAJPOX010000069.1 GCA905372325_01214 CDS open 1591-1911 _na     106_aa rplX 50S ribosomal protein L24
2432 CAJPOX010000069.1 GCA905372325_01215 CDS open 1933-2298 _na     121_aa rplN 50S ribosomal protein L14
2433 CAJPOX010000069.1 GCA905372325_01216 CDS open 2302-2559 _na     85_aa rpsQ 30S ribosomal protein S17
2434 CAJPOX010000069.1 GCA905372325_01217 CDS open 2572-2769 _na     65_aa rpmC 50S ribosomal protein L29
2435 CAJPOX010000069.1 GCA905372325_01218 CDS open 2778-3212 _na     144_aa rplP 50S ribosomal protein L16
2436 CAJPOX010000069.1 GCA905372325_01219 CDS open 3235-3984 _na     249_aa rpsC 30S ribosomal protein S3
2437 CAJPOX010000069.1 GCA905372325_01220 CDS open 3990-4394 _na     134_aa rplV 50S ribosomal protein L22
2438 CAJPOX010000069.1 GCA905372325_01221 CDS open 4438-4644 _na     68_aa Small ribosomal subunit protein uS19
2439 CAJPOX010000069.1 GCA905372325_01222 CDS open 4728-5552 _na     274_aa rplB 50S ribosomal protein L2
2440 CAJPOX010000069.1 GCA905372325_01223 CDS open 5561-5854 _na     97_aa rplW 50S ribosomal protein L23
2441 CAJPOX010000069.1 GCA905372325_01224 CDS open 5874-6503 _na     209_aa rplD 50S ribosomal protein L4
2442 CAJPOX010000069.1 GCA905372325_01225 CDS open 6504-7094 _na     196_aa rplC 50S ribosomal protein L3
2443 CAJPOX010000069.1 GCA905372325_01226 CDS open 7144-7449 _na     101_aa rpsJ 30S ribosomal protein S10
2444 CAJPOX010000069.1 GCA905372325_01227 CDS open 7469-9592 _na     707_aa fusA elongation factor G
2445 CAJPOX010000069.1 GCA905372325_01228 CDS open 9608-10084 _na     158_aa rpsG 30S ribosomal protein S7
2446 CAJPOX010000069.1 GCA905372325_01229 CDS open 10310-10717 _na     135_aa rpsL 30S ribosomal protein S12
2447 CAJPOX010000069.1 GCA905372325_01212 gene open 756-1010 rpsN
2448 CAJPOX010000069.1 GCA905372325_01213 gene open 1031-1591 rplE
2449 CAJPOX010000069.1 GCA905372325_01214 gene open 1591-1911 rplX
2450 CAJPOX010000069.1 GCA905372325_01215 gene open 1933-2298 rplN
2451 CAJPOX010000069.1 GCA905372325_01216 gene open 2302-2559 rpsQ
2452 CAJPOX010000069.1 GCA905372325_01217 gene open 2572-2769 rpmC
2453 CAJPOX010000069.1 GCA905372325_01218 gene open 2778-3212 rplP
2454 CAJPOX010000069.1 GCA905372325_01219 gene open 3235-3984 rpsC
2455 CAJPOX010000069.1 GCA905372325_01220 gene open 3990-4394 rplV
2456 CAJPOX010000069.1 GCA905372325_01221 gene open 4438-4644
2457 CAJPOX010000069.1 GCA905372325_01222 gene open 4728-5552 rplB
2458 CAJPOX010000069.1 GCA905372325_01223 gene open 5561-5854 rplW
2459 CAJPOX010000069.1 GCA905372325_01224 gene open 5874-6503 rplD
2460 CAJPOX010000069.1 GCA905372325_01225 gene open 6504-7094 rplC
2461 CAJPOX010000069.1 GCA905372325_01226 gene open 7144-7449 rpsJ
2462 CAJPOX010000069.1 GCA905372325_01227 gene open 7469-9592 fusA
2463 CAJPOX010000069.1 GCA905372325_01228 gene open 9608-10084 rpsG
2464 CAJPOX010000069.1 GCA905372325_01229 gene open 10310-10717 rpsL
2465 CAJPOX010000070.1 regulatory_region open 4892-4996 TPP riboswitch aptamer (THI element)
2466 CAJPOX010000070.1 GCA905372325_01230 CDS open 452-1330 _na     292_aa Uridine phosphorylase
2467 CAJPOX010000070.1 GCA905372325_01231 CDS open 1351-1743 _na     130_aa crcB fluoride efflux transporter CrcB
2468 CAJPOX010000070.1 GCA905372325_01232 CDS open 1761-4601 _na     946_aa Peptidase C10 family protein
2469 CAJPOX010000070.1 GCA905372325_01234 CDS open 5034-7340 _na     768_aa TonB-dependent receptor
2470 CAJPOX010000070.1 GCA905372325_01235 CDS open 7359-7970 _na     203_aa pnuC nicotinamide riboside transporter PnuC
2471 CAJPOX010000070.1 GCA905372325_01236 CDS open 7987-8658 _na     223_aa thiamine diphosphokinase
2472 CAJPOX010000070.1 GCA905372325_01237 CDS open 8651-9415 _na     254_aa DNA-binding protein%2C methylated-DNA-[protein]-cysteine S-methyltransferase family
2473 CAJPOX010000070.1 GCA905372325_01238 CDS open 9593-10927 _na     444_aa NADH:ubiquinone reductase (non-electrogenic)
2474 CAJPOX010000070.1 GCA905372325_01230 gene open 452-1330
2475 CAJPOX010000070.1 GCA905372325_01231 gene open 1351-1743 crcB
2476 CAJPOX010000070.1 GCA905372325_01232 gene open 1761-4601
2477 CAJPOX010000070.1 GCA905372325_01234 gene open 5034-7340
2478 CAJPOX010000070.1 GCA905372325_01235 gene open 7359-7970 pnuC
2479 CAJPOX010000070.1 GCA905372325_01236 gene open 7987-8658
2480 CAJPOX010000070.1 GCA905372325_01237 gene open 8651-9415
2481 CAJPOX010000070.1 GCA905372325_01238 gene open 9593-10927
2482 CAJPOX010000070.1 GCA905372325_01233 gene open 4694-4775 trnL
2483 CAJPOX010000070.1 GCA905372325_01233 tRNA open 4694-4775 trnL tRNA-Leu(tag)
2484 CAJPOX010000071.1 GCA905372325_01239 CDS open 283-1572 _na     429_aa Collagenase
2485 CAJPOX010000071.1 GCA905372325_01240 CDS open 1699-3414 _na     571_aa pafA alkaline phosphatase PafA
2486 CAJPOX010000071.1 GCA905372325_01241 CDS open 3447-4319 _na     290_aa prmA 50S ribosomal protein L11 methyltransferase
2487 CAJPOX010000071.1 GCA905372325_01242 CDS open 4354-5655 _na     433_aa hemL glutamate-1-semialdehyde 2%2C1-aminomutase
2488 CAJPOX010000071.1 GCA905372325_01243 CDS open 5942-6751 _na     269_aa ADP-ribosylglycohydrolase
2489 CAJPOX010000071.1 GCA905372325_01244 CDS open 6882-8756 _na     624_aa mnmG tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG
2490 CAJPOX010000071.1 GCA905372325_01245 CDS open 8756-9859 _na     367_aa ychF redox-regulated ATPase YchF
2491 CAJPOX010000071.1 GCA905372325_01246 CDS open 10000-10551 _na     183_aa Lipocalin-like domain-containing protein
2492 CAJPOX010000071.1 GCA905372325_01239 gene open 283-1572
2493 CAJPOX010000071.1 GCA905372325_01240 gene open 1699-3414 pafA
2494 CAJPOX010000071.1 GCA905372325_01241 gene open 3447-4319 prmA
2495 CAJPOX010000071.1 GCA905372325_01242 gene open 4354-5655 hemL
2496 CAJPOX010000071.1 GCA905372325_01243 gene open 5942-6751
2497 CAJPOX010000071.1 GCA905372325_01244 gene open 6882-8756 mnmG
2498 CAJPOX010000071.1 GCA905372325_01245 gene open 8756-9859 ychF
2499 CAJPOX010000071.1 GCA905372325_01246 gene open 10000-10551
2500 CAJPOX010000072.1 GCA905372325_01247 CDS open 378-1133 _na     251_aa hypothetical protein