HOMD Banner
Taxonomy: V4.3   |  16S rRNA RefSeq: V16.03   |  Genomic RefSeq: V11.03   |  Viruses: V1.2

BAKTAGenome Explorer: Alloprevotella sp. HMT-413 (GCA_916720475.1)

Select a Genome:
BAKTA Annotations for GCA_916720475.1
Genome Selected: Alloprevotella sp. HMT-413
ContigsBases CDSrRNA tmRNAtRNA
95 2737121 2087 0 1 36
[Table]   [AA Fasta]      [Browser]   [Text]   [Excel]  
Search & Sort all 4260 Records
Search These Records: Clear
Sort Column:   Molecule   PID   NA   AA   Gene  Gene Product  Reverse
Annotation Table [page:8]    |    Number of Records Found: 4260 [9 Pages]    |    Previous Page <==> Next Page    |    Jump to Page: [ 1  2  3  4  5  6  7  8  9  ]
Notes:   1- Column headers only sort the current page. 2- Select [NA] or [AA] links to show sequences.
Region Protein-ID Type Genome
Viewer		 Range
(bp)		 Show Sequences
(length) NA / AA		 BAKTA
Gene		 BAKTA
GeneProduct
3501 CAKARG010000035.1 GCA916720475_01753 CDS open 7082-10927 _na     1281_aa rpoB DNA-directed RNA polymerase subunit beta
3502 CAKARG010000035.1 GCA916720475_01754 CDS open 11229-11603 _na     124_aa rplL 50S ribosomal protein L7/L12
3503 CAKARG010000035.1 GCA916720475_01755 CDS open 11735-12256 _na     173_aa rplJ 50S ribosomal protein L10
3504 CAKARG010000035.1 GCA916720475_01756 CDS open 12271-12969 _na     232_aa rplA 50S ribosomal protein L1
3505 CAKARG010000035.1 GCA916720475_01757 CDS open 12995-13432 _na     145_aa rplK 50S ribosomal protein L11
3506 CAKARG010000035.1 GCA916720475_01758 CDS open 13493-14035 _na     180_aa nusG transcription termination/antitermination protein NusG
3507 CAKARG010000035.1 GCA916720475_01760 CDS open 14397-15578 _na     393_aa tuf elongation factor Tu
3508 CAKARG010000035.1 GCA916720475_01750 gene open 282-620
3509 CAKARG010000035.1 GCA916720475_01751 gene open 1846-2571
3510 CAKARG010000035.1 GCA916720475_01752 gene open 2789-7045 rpoC
3511 CAKARG010000035.1 GCA916720475_01753 gene open 7082-10927 rpoB
3512 CAKARG010000035.1 GCA916720475_01754 gene open 11229-11603 rplL
3513 CAKARG010000035.1 GCA916720475_01755 gene open 11735-12256 rplJ
3514 CAKARG010000035.1 GCA916720475_01756 gene open 12271-12969 rplA
3515 CAKARG010000035.1 GCA916720475_01757 gene open 12995-13432 rplK
3516 CAKARG010000035.1 GCA916720475_01758 gene open 13493-14035 nusG
3517 CAKARG010000035.1 GCA916720475_01760 gene open 14397-15578 tuf
3518 CAKARG010000035.1 GCA916720475_01759 gene open 14252-14324 trnW
3519 CAKARG010000035.1 GCA916720475_01759 tRNA open 14252-14324 trnW tRNA-Trp(cca)
3520 CAKARG010000036.1 GCA916720475_01761 CDS open 140-1693 _na     517_aa gldM Gliding motility-associated protein GldM
3521 CAKARG010000036.1 GCA916720475_01762 CDS open 1753-2811 _na     352_aa gldL Gliding motility-associated protein GldL
3522 CAKARG010000036.1 GCA916720475_01763 CDS open 2952-4415 _na     487_aa gldK Putative gliding motility-associated lipoprotein GldK
3523 CAKARG010000036.1 GCA916720475_01764 CDS open 4460-5446 _na     328_aa Bacteroidetes-specific putative membrane protein
3524 CAKARG010000036.1 GCA916720475_01765 CDS open 5642-5911 _na     89_aa rpsO 30S ribosomal protein S15
3525 CAKARG010000036.1 GCA916720475_01766 CDS open 6893-7582 _na     229_aa hypothetical protein
3526 CAKARG010000036.1 GCA916720475_01767 CDS open 7815-8498 _na     227_aa hypothetical protein
3527 CAKARG010000036.1 GCA916720475_01768 CDS open 8840-11632 _na     930_aa Outer membrane protein beta-barrel domain-containing protein
3528 CAKARG010000036.1 GCA916720475_01769 CDS open 11773-11964 _na     63_aa hypothetical protein
3529 CAKARG010000036.1 GCA916720475_01770 CDS open 13680-14018 _na     112_aa hypothetical protein
3530 CAKARG010000036.1 GCA916720475_01761 gene open 140-1693 gldM
3531 CAKARG010000036.1 GCA916720475_01762 gene open 1753-2811 gldL
3532 CAKARG010000036.1 GCA916720475_01763 gene open 2952-4415 gldK
3533 CAKARG010000036.1 GCA916720475_01764 gene open 4460-5446
3534 CAKARG010000036.1 GCA916720475_01765 gene open 5642-5911 rpsO
3535 CAKARG010000036.1 GCA916720475_01766 gene open 6893-7582
3536 CAKARG010000036.1 GCA916720475_01767 gene open 7815-8498
3537 CAKARG010000036.1 GCA916720475_01768 gene open 8840-11632
3538 CAKARG010000036.1 GCA916720475_01769 gene open 11773-11964
3539 CAKARG010000036.1 GCA916720475_01770 gene open 13680-14018
3540 CAKARG010000037.1 regulatory_region open 2060-2158 TPP riboswitch aptamer (THI element)
3541 CAKARG010000037.1 GCA916720475_01771 CDS open 867-1643 _na     258_aa helix-hairpin-helix domain-containing protein
3542 CAKARG010000037.1 GCA916720475_01772 CDS open 2157-4334 _na     725_aa TonB-dependent receptor
3543 CAKARG010000037.1 GCA916720475_01773 CDS open 4478-5140 _na     220_aa pnuC nicotinamide riboside transporter PnuC
3544 CAKARG010000037.1 GCA916720475_01774 CDS open 5200-5808 _na     202_aa thiamine diphosphokinase
3545 CAKARG010000037.1 GCA916720475_01775 CDS open 6381-9107 _na     908_aa ppdK pyruvate%2C phosphate dikinase
3546 CAKARG010000037.1 GCA916720475_01776 CDS open 9564-11579 _na     671_aa RelA/SpoT family protein
3547 CAKARG010000037.1 GCA916720475_01777 CDS open 11719-13371 _na     550_aa Dipeptidase
3548 CAKARG010000037.1 GCA916720475_01778 CDS open 13913-14152 _na     79_aa hypothetical protein
3549 CAKARG010000037.1 GCA916720475_01771 gene open 867-1643
3550 CAKARG010000037.1 GCA916720475_01772 gene open 2157-4334
3551 CAKARG010000037.1 GCA916720475_01773 gene open 4478-5140 pnuC
3552 CAKARG010000037.1 GCA916720475_01774 gene open 5200-5808
3553 CAKARG010000037.1 GCA916720475_01775 gene open 6381-9107 ppdK
3554 CAKARG010000037.1 GCA916720475_01776 gene open 9564-11579
3555 CAKARG010000037.1 GCA916720475_01777 gene open 11719-13371
3556 CAKARG010000037.1 GCA916720475_01778 gene open 13913-14152
3557 CAKARG010000038.1 GCA916720475_01779 CDS open 73-858 _na     261_aa hypothetical protein
3558 CAKARG010000038.1 GCA916720475_01780 CDS open 855-1949 _na     364_aa Major fimbrial subunit protein N-terminal domain-containing protein
3559 CAKARG010000038.1 GCA916720475_01781 CDS open 2055-3089 _na     344_aa hypothetical protein
3560 CAKARG010000038.1 GCA916720475_01782 CDS open 3331-4098 _na     255_aa Sporulation initiation inhibitor protein Soj
3561 CAKARG010000038.1 GCA916720475_01783 CDS open 4166-5050 _na     294_aa Putative stage 0 sporulation protein J
3562 CAKARG010000038.1 GCA916720475_01784 CDS open 5157-5966 _na     269_aa DUF5683 domain-containing protein
3563 CAKARG010000038.1 GCA916720475_01785 CDS open 6084-7535 _na     483_aa transglycosylase SLT domain-containing protein
3564 CAKARG010000038.1 GCA916720475_01786 CDS open 7757-10003 _na     748_aa RelA/SpoT family protein
3565 CAKARG010000038.1 GCA916720475_01787 CDS open 10065-11237 _na     390_aa DUF262 domain-containing protein
3566 CAKARG010000038.1 GCA916720475_01788 CDS open 11355-12209 _na     284_aa hypothetical protein
3567 CAKARG010000038.1 GCA916720475_01779 gene open 73-858
3568 CAKARG010000038.1 GCA916720475_01780 gene open 855-1949
3569 CAKARG010000038.1 GCA916720475_01781 gene open 2055-3089
3570 CAKARG010000038.1 GCA916720475_01782 gene open 3331-4098
3571 CAKARG010000038.1 GCA916720475_01783 gene open 4166-5050
3572 CAKARG010000038.1 GCA916720475_01784 gene open 5157-5966
3573 CAKARG010000038.1 GCA916720475_01785 gene open 6084-7535
3574 CAKARG010000038.1 GCA916720475_01786 gene open 7757-10003
3575 CAKARG010000038.1 GCA916720475_01787 gene open 10065-11237
3576 CAKARG010000038.1 GCA916720475_01788 gene open 11355-12209
3577 CAKARG010000039.1 GCA916720475_01789 CDS open 33-1118 _na     361_aa TonB-dependent receptor
3578 CAKARG010000039.1 GCA916720475_01790 CDS open 1168-2565 _na     465_aa DUF5017 domain-containing protein
3579 CAKARG010000039.1 GCA916720475_01791 CDS open 3074-4996 _na     640_aa Permease%2C YjgP/YjgQ family
3580 CAKARG010000039.1 GCA916720475_01792 CDS open 5137-6351 _na     404_aa bifunctional 3%2C4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II
3581 CAKARG010000039.1 GCA916720475_01793 CDS open 6767-7483 _na     238_aa ybhL Inner membrane protein YbhL
3582 CAKARG010000039.1 GCA916720475_01794 CDS open 7645-8835 _na     396_aa Aminotransferase
3583 CAKARG010000039.1 GCA916720475_01795 CDS open 9251-10909 _na     552_aa Sulfate permease
3584 CAKARG010000039.1 GCA916720475_01796 CDS open 11587-12291 _na     234_aa Crp/Fnr family transcriptional regulator
3585 CAKARG010000039.1 GCA916720475_01797 CDS open 12395-12679 _na     94_aa hypothetical protein
3586 CAKARG010000039.1 GCA916720475_01789 gene open 33-1118
3587 CAKARG010000039.1 GCA916720475_01790 gene open 1168-2565
3588 CAKARG010000039.1 GCA916720475_01791 gene open 3074-4996
3589 CAKARG010000039.1 GCA916720475_01792 gene open 5137-6351
3590 CAKARG010000039.1 GCA916720475_01793 gene open 6767-7483 ybhL
3591 CAKARG010000039.1 GCA916720475_01794 gene open 7645-8835
3592 CAKARG010000039.1 GCA916720475_01795 gene open 9251-10909
3593 CAKARG010000039.1 GCA916720475_01796 gene open 11587-12291
3594 CAKARG010000039.1 GCA916720475_01797 gene open 12395-12679
3595 CAKARG010000040.1 GCA916720475_01798 CDS open 229-924 _na     231_aa hypothetical protein
3596 CAKARG010000040.1 GCA916720475_01799 CDS open 1408-1791 _na     127_aa rpsL 30S ribosomal protein S12
3597 CAKARG010000040.1 GCA916720475_01800 CDS open 2091-2567 _na     158_aa rpsG 30S ribosomal protein S7
3598 CAKARG010000040.1 GCA916720475_01801 CDS open 2599-4719 _na     706_aa fusA elongation factor G
3599 CAKARG010000040.1 GCA916720475_01802 CDS open 4828-5133 _na     101_aa rpsJ 30S ribosomal protein S10
3600 CAKARG010000040.1 GCA916720475_01803 CDS open 5710-6072 _na     120_aa rplS 50S ribosomal protein L19
3601 CAKARG010000040.1 GCA916720475_01804 CDS open 6329-9943 _na     1204_aa Ig-like domain-containing protein
3602 CAKARG010000040.1 GCA916720475_01798 gene open 229-924
3603 CAKARG010000040.1 GCA916720475_01799 gene open 1408-1791 rpsL
3604 CAKARG010000040.1 GCA916720475_01800 gene open 2091-2567 rpsG
3605 CAKARG010000040.1 GCA916720475_01801 gene open 2599-4719 fusA
3606 CAKARG010000040.1 GCA916720475_01802 gene open 4828-5133 rpsJ
3607 CAKARG010000040.1 GCA916720475_01803 gene open 5710-6072 rplS
3608 CAKARG010000040.1 GCA916720475_01804 gene open 6329-9943
3609 CAKARG010000041.1 GCA916720475_01805 CDS open 520-723 _na     67_aa hypothetical protein
3610 CAKARG010000041.1 GCA916720475_01806 CDS open 816-1097 _na     93_aa hypothetical protein
3611 CAKARG010000041.1 GCA916720475_01807 CDS open 1111-1464 _na     117_aa VRR-NUC domain-containing protein
3612 CAKARG010000041.1 GCA916720475_01808 CDS open 1461-1871 _na     136_aa hypothetical protein
3613 CAKARG010000041.1 GCA916720475_01809 CDS open 1849-2163 _na     104_aa hypothetical protein
3614 CAKARG010000041.1 GCA916720475_01810 CDS open 2193-2858 _na     221_aa hypothetical protein
3615 CAKARG010000041.1 GCA916720475_01811 CDS open 2951-3925 _na     324_aa recT Recombinase%2C phage RecT family
3616 CAKARG010000041.1 GCA916720475_01812 CDS open 3953-4249 _na     98_aa hypothetical protein
3617 CAKARG010000041.1 GCA916720475_01813 CDS open 4262-6199 _na     645_aa hypothetical protein
3618 CAKARG010000041.1 GCA916720475_01814 CDS open 6226-6411 _na     61_aa hypothetical protein
3619 CAKARG010000041.1 GCA916720475_01815 CDS open 6551-6763 _na     70_aa hypothetical protein
3620 CAKARG010000041.1 GCA916720475_01816 CDS open 7295-7618 _na     107_aa hypothetical protein
3621 CAKARG010000041.1 GCA916720475_01817 CDS open 7619-7858 _na     79_aa hypothetical protein
3622 CAKARG010000041.1 GCA916720475_01818 CDS open 7891-8250 _na     119_aa hypothetical protein
3623 CAKARG010000041.1 GCA916720475_01819 CDS open 8326-8655 _na     109_aa hypothetical protein
3624 CAKARG010000041.1 GCA916720475_01820 CDS open 8652-9041 _na     129_aa hypothetical protein
3625 CAKARG010000041.1 GCA916720475_01821 CDS open 9193-9888 _na     231_aa hypothetical protein
3626 CAKARG010000041.1 GCA916720475_01822 CDS open 9893-10723 _na     276_aa hypothetical protein
3627 CAKARG010000041.1 GCA916720475_01823 CDS open 10884-12044 _na     386_aa hypothetical protein
3628 CAKARG010000041.1 GCA916720475_01805 gene open 520-723
3629 CAKARG010000041.1 GCA916720475_01806 gene open 816-1097
3630 CAKARG010000041.1 GCA916720475_01807 gene open 1111-1464
3631 CAKARG010000041.1 GCA916720475_01808 gene open 1461-1871
3632 CAKARG010000041.1 GCA916720475_01809 gene open 1849-2163
3633 CAKARG010000041.1 GCA916720475_01810 gene open 2193-2858
3634 CAKARG010000041.1 GCA916720475_01811 gene open 2951-3925 recT
3635 CAKARG010000041.1 GCA916720475_01812 gene open 3953-4249
3636 CAKARG010000041.1 GCA916720475_01813 gene open 4262-6199
3637 CAKARG010000041.1 GCA916720475_01814 gene open 6226-6411
3638 CAKARG010000041.1 GCA916720475_01815 gene open 6551-6763
3639 CAKARG010000041.1 GCA916720475_01816 gene open 7295-7618
3640 CAKARG010000041.1 GCA916720475_01817 gene open 7619-7858
3641 CAKARG010000041.1 GCA916720475_01818 gene open 7891-8250
3642 CAKARG010000041.1 GCA916720475_01819 gene open 8326-8655
3643 CAKARG010000041.1 GCA916720475_01820 gene open 8652-9041
3644 CAKARG010000041.1 GCA916720475_01821 gene open 9193-9888
3645 CAKARG010000041.1 GCA916720475_01822 gene open 9893-10723
3646 CAKARG010000041.1 GCA916720475_01823 gene open 10884-12044
3647 CAKARG010000042.1 GCA916720475_01824 CDS open 188-1489 _na     433_aa IS1380 family transposase
3648 CAKARG010000042.1 GCA916720475_01825 CDS open 2174-2374 _na     66_aa hypothetical protein
3649 CAKARG010000042.1 GCA916720475_01826 CDS open 2687-3805 _na     372_aa dprA DNA-processing protein DprA
3650 CAKARG010000042.1 GCA916720475_01827 CDS open 3865-4698 _na     277_aa HAD hydrolase%2C family IA%2C variant 3
3651 CAKARG010000042.1 GCA916720475_01828 CDS open 4799-6133 _na     444_aa glucose-6-phosphate isomerase
3652 CAKARG010000042.1 GCA916720475_01829 CDS open 6342-7802 _na     486_aa Xaa-His dipeptidase
3653 CAKARG010000042.1 GCA916720475_01830 CDS open 7827-8834 _na     335_aa Lysylphosphatidylglycerol synthase TM region
3654 CAKARG010000042.1 GCA916720475_01831 CDS open 8997-9815 _na     272_aa rsmA 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA
3655 CAKARG010000042.1 GCA916720475_01832 CDS open 10025-10447 _na     140_aa DUF1934 domain-containing protein
3656 CAKARG010000042.1 GCA916720475_01824 gene open 188-1489
3657 CAKARG010000042.1 GCA916720475_01825 gene open 2174-2374
3658 CAKARG010000042.1 GCA916720475_01826 gene open 2687-3805 dprA
3659 CAKARG010000042.1 GCA916720475_01827 gene open 3865-4698
3660 CAKARG010000042.1 GCA916720475_01828 gene open 4799-6133
3661 CAKARG010000042.1 GCA916720475_01829 gene open 6342-7802
3662 CAKARG010000042.1 GCA916720475_01830 gene open 7827-8834
3663 CAKARG010000042.1 GCA916720475_01831 gene open 8997-9815 rsmA
3664 CAKARG010000042.1 GCA916720475_01832 gene open 10025-10447
3665 CAKARG010000043.1 GCA916720475_01833 CDS open 939-4106 _na     1055_aa outer membrane beta-barrel protein
3666 CAKARG010000043.1 GCA916720475_01834 CDS open 4445-5122 _na     225_aa Peptidase S24-like protein
3667 CAKARG010000043.1 GCA916720475_01835 CDS open 5729-6904 _na     391_aa PepSY-associated TM helix domain-containing protein
3668 CAKARG010000043.1 GCA916720475_01836 CDS open 7028-8434 _na     468_aa DUF4374 domain-containing protein
3669 CAKARG010000043.1 GCA916720475_01837 CDS open 8476-10926 _na     816_aa TonB-dependent receptor
3670 CAKARG010000043.1 GCA916720475_01838 CDS open 11547-11699 _na     50_aa hypothetical protein
3671 CAKARG010000043.1 GCA916720475_01833 gene open 939-4106
3672 CAKARG010000043.1 GCA916720475_01834 gene open 4445-5122
3673 CAKARG010000043.1 GCA916720475_01835 gene open 5729-6904
3674 CAKARG010000043.1 GCA916720475_01836 gene open 7028-8434
3675 CAKARG010000043.1 GCA916720475_01837 gene open 8476-10926
3676 CAKARG010000043.1 GCA916720475_01838 gene open 11547-11699
3677 CAKARG010000044.1 GCA916720475_01839 CDS open 221-1150 _na     309_aa hypothetical protein
3678 CAKARG010000044.1 GCA916720475_01840 CDS open 1230-2498 _na     422_aa Glycosyltransferase%2C group 1 family protein
3679 CAKARG010000044.1 GCA916720475_01841 CDS open 2541-4469 _na     642_aa Amylo-alpha-1%2C6-glucosidase
3680 CAKARG010000044.1 GCA916720475_01842 CDS open 5349-5675 _na     108_aa hypothetical protein
3681 CAKARG010000044.1 GCA916720475_01843 CDS open 5779-6867 _na     362_aa Metallo-beta-lactamase domain-containing protein
3682 CAKARG010000044.1 GCA916720475_01844 CDS open 7045-8025 _na     326_aa Aldose 1-epimerase
3683 CAKARG010000044.1 GCA916720475_01845 CDS open 8134-9030 _na     298_aa helix-turn-helix transcriptional regulator
3684 CAKARG010000044.1 GCA916720475_01846 CDS open 10369-10641 _na     90_aa hypothetical protein
3685 CAKARG010000044.1 GCA916720475_01847 CDS open 10852-11139 _na     95_aa hypothetical protein
3686 CAKARG010000044.1 GCA916720475_01839 gene open 221-1150
3687 CAKARG010000044.1 GCA916720475_01840 gene open 1230-2498
3688 CAKARG010000044.1 GCA916720475_01841 gene open 2541-4469
3689 CAKARG010000044.1 GCA916720475_01842 gene open 5349-5675
3690 CAKARG010000044.1 GCA916720475_01843 gene open 5779-6867
3691 CAKARG010000044.1 GCA916720475_01844 gene open 7045-8025
3692 CAKARG010000044.1 GCA916720475_01845 gene open 8134-9030
3693 CAKARG010000044.1 GCA916720475_01846 gene open 10369-10641
3694 CAKARG010000044.1 GCA916720475_01847 gene open 10852-11139
3695 CAKARG010000045.1 GCA916720475_01848 CDS open 35-589 _na     184_aa Mobilization protein
3696 CAKARG010000045.1 GCA916720475_01849 CDS open 460-720 _na     86_aa hypothetical protein
3697 CAKARG010000045.1 GCA916720475_01850 CDS open 849-1211 _na     120_aa Excisionase
3698 CAKARG010000045.1 GCA916720475_01851 CDS open 1218-2594 _na     458_aa DUF3987 domain-containing protein
3699 CAKARG010000045.1 GCA916720475_01852 CDS open 2608-3753 _na     381_aa DUF6371 domain-containing protein
3700 CAKARG010000045.1 GCA916720475_01853 CDS open 3853-4206 _na     117_aa mobC Plasmid mobilization relaxosome protein MobC
3701 CAKARG010000045.1 GCA916720475_01854 CDS open 4203-5129 _na     308_aa traI Conjugal transfer relaxase TraI
3702 CAKARG010000045.1 GCA916720475_01855 CDS open 5126-5821 _na     231_aa Viral A-type inclusion protein
3703 CAKARG010000045.1 GCA916720475_01856 CDS open 5870-6010 _na     46_aa hypothetical protein
3704 CAKARG010000045.1 GCA916720475_01857 CDS open 6017-7132 _na     371_aa Type I restriction modification DNA specificity domain-containing protein
3705 CAKARG010000045.1 GCA916720475_01858 CDS open 7150-9195 _na     681_aa site-specific DNA-methyltransferase (adenine-specific)
3706 CAKARG010000045.1 GCA916720475_01859 CDS open 9224-10174 _na     316_aa hipA Serine/threonine-protein kinase HipA
3707 CAKARG010000045.1 GCA916720475_01860 CDS open 10164-10499 _na     111_aa hipA Serine/threonine-protein kinase HipA
3708 CAKARG010000045.1 GCA916720475_01861 CDS open 10496-10720 _na     74_aa aF2118 Transcriptional regulator%2C putative
3709 CAKARG010000045.1 GCA916720475_01848 gene open 35-589
3710 CAKARG010000045.1 GCA916720475_01849 gene open 460-720
3711 CAKARG010000045.1 GCA916720475_01850 gene open 849-1211
3712 CAKARG010000045.1 GCA916720475_01851 gene open 1218-2594
3713 CAKARG010000045.1 GCA916720475_01852 gene open 2608-3753
3714 CAKARG010000045.1 GCA916720475_01853 gene open 3853-4206 mobC
3715 CAKARG010000045.1 GCA916720475_01854 gene open 4203-5129 traI
3716 CAKARG010000045.1 GCA916720475_01855 gene open 5126-5821
3717 CAKARG010000045.1 GCA916720475_01856 gene open 5870-6010
3718 CAKARG010000045.1 GCA916720475_01857 gene open 6017-7132
3719 CAKARG010000045.1 GCA916720475_01858 gene open 7150-9195
3720 CAKARG010000045.1 GCA916720475_01859 gene open 9224-10174 hipA
3721 CAKARG010000045.1 GCA916720475_01860 gene open 10164-10499 hipA
3722 CAKARG010000045.1 GCA916720475_01861 gene open 10496-10720 aF2118
3723 CAKARG010000046.1 GCA916720475_01862 CDS open 292-843 _na     183_aa hypothetical protein
3724 CAKARG010000046.1 GCA916720475_01863 CDS open 1025-3493 _na     822_aa hypothetical protein
3725 CAKARG010000046.1 GCA916720475_01864 CDS open 3983-4183 _na     66_aa hypothetical protein
3726 CAKARG010000046.1 GCA916720475_01865 CDS open 4560-4985 _na     141_aa HU family DNA-binding protein
3727 CAKARG010000046.1 GCA916720475_01866 CDS open 5831-6175 _na     114_aa marR MarR family winged helix-turn-helix transcriptional regulator
3728 CAKARG010000046.1 GCA916720475_01867 CDS open 6212-6397 _na     61_aa pilN Type IV pilus biogenesis protein PilN family protein
3729 CAKARG010000046.1 GCA916720475_01868 CDS open 6631-6996 _na     121_aa trxA thioredoxin
3730 CAKARG010000046.1 GCA916720475_01869 CDS open 7550-7990 _na     146_aa hypothetical protein
3731 CAKARG010000046.1 GCA916720475_01870 CDS open 7990-8505 _na     171_aa Panacea domain-containing protein
3732 CAKARG010000046.1 GCA916720475_01871 CDS open 8619-9599 _na     326_aa hypothetical protein
3733 CAKARG010000046.1 GCA916720475_01872 CDS open 9826-10668 _na     280_aa hypothetical protein
3734 CAKARG010000046.1 GCA916720475_01862 gene open 292-843
3735 CAKARG010000046.1 GCA916720475_01863 gene open 1025-3493
3736 CAKARG010000046.1 GCA916720475_01864 gene open 3983-4183
3737 CAKARG010000046.1 GCA916720475_01865 gene open 4560-4985
3738 CAKARG010000046.1 GCA916720475_01866 gene open 5831-6175 marR
3739 CAKARG010000046.1 GCA916720475_01867 gene open 6212-6397 pilN
3740 CAKARG010000046.1 GCA916720475_01868 gene open 6631-6996 trxA
3741 CAKARG010000046.1 GCA916720475_01869 gene open 7550-7990
3742 CAKARG010000046.1 GCA916720475_01870 gene open 7990-8505
3743 CAKARG010000046.1 GCA916720475_01871 gene open 8619-9599
3744 CAKARG010000046.1 GCA916720475_01872 gene open 9826-10668
3745 CAKARG010000047.1 GCA916720475_01873 CDS open 112-2172 _na     686_aa helix-hairpin-helix domain-containing protein
3746 CAKARG010000047.1 GCA916720475_01874 CDS open 2332-2853 _na     173_aa porin family protein
3747 CAKARG010000047.1 GCA916720475_01875 CDS open 2871-3080 _na     69_aa hypothetical protein
3748 CAKARG010000047.1 GCA916720475_01876 CDS open 2989-3606 _na     205_aa metal ABC transporter ATP-binding protein
3749 CAKARG010000047.1 GCA916720475_01877 CDS open 3606-4478 _na     290_aa metal ABC transporter solute-binding protein%2C Zn/Mn family
3750 CAKARG010000047.1 GCA916720475_01878 CDS open 4495-4956 _na     153_aa yqaA Inner membrane protein YqaA family protein
3751 CAKARG010000047.1 GCA916720475_01879 CDS open 4932-5882 _na     316_aa Beta-carotene 15%2C15'-monooxygenase
3752 CAKARG010000047.1 GCA916720475_01880 CDS open 6029-7294 _na     421_aa Phosphoribosylamine--glycine ligase
3753 CAKARG010000047.1 GCA916720475_01881 CDS open 7348-9021 _na     557_aa Peptidase%2C S41 family
3754 CAKARG010000047.1 GCA916720475_01882 CDS open 9180-10274 _na     364_aa pfkB Kinase%2C PfkB family
3755 CAKARG010000047.1 GCA916720475_01873 gene open 112-2172
3756 CAKARG010000047.1 GCA916720475_01874 gene open 2332-2853
3757 CAKARG010000047.1 GCA916720475_01875 gene open 2871-3080
3758 CAKARG010000047.1 GCA916720475_01876 gene open 2989-3606
3759 CAKARG010000047.1 GCA916720475_01877 gene open 3606-4478
3760 CAKARG010000047.1 GCA916720475_01878 gene open 4495-4956 yqaA
3761 CAKARG010000047.1 GCA916720475_01879 gene open 4932-5882
3762 CAKARG010000047.1 GCA916720475_01880 gene open 6029-7294
3763 CAKARG010000047.1 GCA916720475_01881 gene open 7348-9021
3764 CAKARG010000047.1 GCA916720475_01882 gene open 9180-10274 pfkB
3765 CAKARG010000048.1 GCA916720475_01883 CDS open 170-2260 _na     696_aa DNA topoisomerase III
3766 CAKARG010000048.1 GCA916720475_01884 CDS open 2421-2633 _na     70_aa hypothetical protein
3767 CAKARG010000048.1 GCA916720475_01885 CDS open 2566-3978 _na     470_aa DUF4099 domain-containing protein
3768 CAKARG010000048.1 GCA916720475_01886 CDS open 4659-8186 _na     1175_aa YobI-like P-loop NTPase domain-containing protein
3769 CAKARG010000048.1 GCA916720475_01887 CDS open 8194-8373 _na     59_aa traG Conjugal transfer protein TraG
3770 CAKARG010000048.1 GCA916720475_01883 gene open 170-2260
3771 CAKARG010000048.1 GCA916720475_01884 gene open 2421-2633
3772 CAKARG010000048.1 GCA916720475_01885 gene open 2566-3978
3773 CAKARG010000048.1 GCA916720475_01886 gene open 4659-8186
3774 CAKARG010000048.1 GCA916720475_01887 gene open 8194-8373 traG
3775 CAKARG010000049.1 GCA916720475_01888 CDS open 13-222 _na     69_aa hypothetical protein
3776 CAKARG010000049.1 GCA916720475_01889 CDS open 499-654 _na     51_aa hypothetical protein
3777 CAKARG010000049.1 GCA916720475_01890 CDS open 651-1463 _na     270_aa Dinitrogenase reductase
3778 CAKARG010000049.1 GCA916720475_01891 CDS open 1722-2999 _na     425_aa nupG Putative nucleoside permease NupG
3779 CAKARG010000049.1 GCA916720475_01892 CDS open 3279-4568 _na     429_aa O-acetylhomoserine aminocarboxypropyltransferase
3780 CAKARG010000049.1 GCA916720475_01893 CDS open 4608-5552 _na     314_aa miaA tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA
3781 CAKARG010000049.1 GCA916720475_01895 CDS open 6243-6647 _na     134_aa hypothetical protein
3782 CAKARG010000049.1 GCA916720475_01896 CDS open 7608-7862 _na     84_aa hypothetical protein
3783 CAKARG010000049.1 GCA916720475_01897 CDS open 7917-8630 _na     237_aa hypothetical protein
3784 CAKARG010000049.1 GCA916720475_01898 CDS open 8871-9305 _na     144_aa hypothetical protein
3785 CAKARG010000049.1 GCA916720475_01899 CDS open 9756-9950 _na     64_aa hypothetical protein
3786 CAKARG010000049.1 GCA916720475_01888 gene open 13-222
3787 CAKARG010000049.1 GCA916720475_01889 gene open 499-654
3788 CAKARG010000049.1 GCA916720475_01890 gene open 651-1463
3789 CAKARG010000049.1 GCA916720475_01891 gene open 1722-2999 nupG
3790 CAKARG010000049.1 GCA916720475_01892 gene open 3279-4568
3791 CAKARG010000049.1 GCA916720475_01893 gene open 4608-5552 miaA
3792 CAKARG010000049.1 GCA916720475_01895 gene open 6243-6647
3793 CAKARG010000049.1 GCA916720475_01896 gene open 7608-7862
3794 CAKARG010000049.1 GCA916720475_01897 gene open 7917-8630
3795 CAKARG010000049.1 GCA916720475_01898 gene open 8871-9305
3796 CAKARG010000049.1 GCA916720475_01899 gene open 9756-9950
3797 CAKARG010000049.1 GCA916720475_01894 gene open 5752-5825 trnM
3798 CAKARG010000049.1 GCA916720475_01894 tRNA open 5752-5825 trnM tRNA-Met(cat)
3799 CAKARG010000050.1 GCA916720475_01900 CDS open 59-1279 _na     406_aa ISL3 family transposase
3800 CAKARG010000050.1 GCA916720475_01901 CDS open 2015-2614 _na     199_aa Acyltransferase
3801 CAKARG010000050.1 GCA916720475_01902 CDS open 2607-4118 _na     503_aa Polysaccharide biosynthesis protein
3802 CAKARG010000050.1 GCA916720475_01903 CDS open 4214-5344 _na     376_aa hypothetical protein
3803 CAKARG010000050.1 GCA916720475_01904 CDS open 5574-6344 _na     256_aa glycosyltransferase family 2 protein
3804 CAKARG010000050.1 GCA916720475_01905 CDS open 6341-6880 _na     179_aa Colanic acid biosynthesis acetyltransferase
3805 CAKARG010000050.1 GCA916720475_01906 CDS open 6828-7793 _na     321_aa Glycosyl transferase family protein
3806 CAKARG010000050.1 GCA916720475_01907 CDS open 7786-8883 _na     365_aa Nucleotidyltransferase family protein
3807 CAKARG010000050.1 GCA916720475_01908 CDS open 8873-9673 _na     266_aa Glycosyl transferase family protein
3808 CAKARG010000050.1 GCA916720475_01900 gene open 59-1279
3809 CAKARG010000050.1 GCA916720475_01901 gene open 2015-2614
3810 CAKARG010000050.1 GCA916720475_01902 gene open 2607-4118
3811 CAKARG010000050.1 GCA916720475_01903 gene open 4214-5344
3812 CAKARG010000050.1 GCA916720475_01904 gene open 5574-6344
3813 CAKARG010000050.1 GCA916720475_01905 gene open 6341-6880
3814 CAKARG010000050.1 GCA916720475_01906 gene open 6828-7793
3815 CAKARG010000050.1 GCA916720475_01907 gene open 7786-8883
3816 CAKARG010000050.1 GCA916720475_01908 gene open 8873-9673
3817 CAKARG010000051.1 GCA916720475_01909 CDS open 140-1687 _na     515_aa type I restriction-modification system subunit M
3818 CAKARG010000051.1 GCA916720475_01910 CDS open 3234-4157 _na     307_aa 5'-nucleotidase
3819 CAKARG010000051.1 GCA916720475_01911 CDS open 4524-5108 _na     194_aa Arm DNA-binding domain-containing protein
3820 CAKARG010000051.1 GCA916720475_01912 CDS open 5071-5820 _na     249_aa Phage integrase SAM-like domain-containing protein
3821 CAKARG010000051.1 GCA916720475_01913 CDS open 5832-7115 _na     427_aa DUF1016 domain-containing protein
3822 CAKARG010000051.1 GCA916720475_01914 CDS open 7178-8530 _na     450_aa ATP-binding protein
3823 CAKARG010000051.1 GCA916720475_01915 CDS open 9002-9571 _na     189_aa hypothetical protein
3824 CAKARG010000051.1 GCA916720475_01909 gene open 140-1687
3825 CAKARG010000051.1 GCA916720475_01910 gene open 3234-4157
3826 CAKARG010000051.1 GCA916720475_01911 gene open 4524-5108
3827 CAKARG010000051.1 GCA916720475_01912 gene open 5071-5820
3828 CAKARG010000051.1 GCA916720475_01913 gene open 5832-7115
3829 CAKARG010000051.1 GCA916720475_01914 gene open 7178-8530
3830 CAKARG010000051.1 GCA916720475_01915 gene open 9002-9571
3831 CAKARG010000052.1 GCA916720475_01916 CDS open 270-1292 _na     340_aa PQQ enzyme repeat protein
3832 CAKARG010000052.1 GCA916720475_01917 CDS open 1300-2655 _na     451_aa PKD domain protein
3833 CAKARG010000052.1 GCA916720475_01918 CDS open 2670-4358 _na     562_aa Outer membrane protein beta-barrel domain-containing protein
3834 CAKARG010000052.1 GCA916720475_01919 CDS open 4385-5863 _na     492_aa RagB/SusD family nutrient uptake outer membrane protein
3835 CAKARG010000052.1 GCA916720475_01920 CDS open 5853-7856 _na     667_aa virD4 YWFCY domain-containing protein
3836 CAKARG010000052.1 GCA916720475_01921 CDS open 7911-9245 _na     444_aa Relaxase/mobilization nuclease domain protein
3837 CAKARG010000052.1 GCA916720475_01922 CDS open 9242-9505 _na     87_aa hypothetical protein
3838 CAKARG010000052.1 GCA916720475_01916 gene open 270-1292
3839 CAKARG010000052.1 GCA916720475_01917 gene open 1300-2655
3840 CAKARG010000052.1 GCA916720475_01918 gene open 2670-4358
3841 CAKARG010000052.1 GCA916720475_01919 gene open 4385-5863
3842 CAKARG010000052.1 GCA916720475_01920 gene open 5853-7856 virD4
3843 CAKARG010000052.1 GCA916720475_01921 gene open 7911-9245
3844 CAKARG010000052.1 GCA916720475_01922 gene open 9242-9505
3845 CAKARG010000053.1 GCA916720475_01923 CDS open 242-1474 _na     410_aa serine protease
3846 CAKARG010000053.1 GCA916720475_01924 CDS open 1511-2731 _na     406_aa ribD bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD
3847 CAKARG010000053.1 GCA916720475_01925 CDS open 2819-4315 _na     498_aa cysS cysteine--tRNA ligase
3848 CAKARG010000053.1 GCA916720475_01926 CDS open 4475-6187 _na     570_aa exo-alpha-sialidase
3849 CAKARG010000053.1 GCA916720475_01927 CDS open 6231-6536 _na     101_aa hypothetical protein
3850 CAKARG010000053.1 GCA916720475_01928 CDS open 6645-7592 _na     315_aa Transmembrane protein
3851 CAKARG010000053.1 GCA916720475_01929 CDS open 8016-9272 _na     418_aa Putative uracil permease
3852 CAKARG010000053.1 GCA916720475_01923 gene open 242-1474
3853 CAKARG010000053.1 GCA916720475_01924 gene open 1511-2731 ribD
3854 CAKARG010000053.1 GCA916720475_01925 gene open 2819-4315 cysS
3855 CAKARG010000053.1 GCA916720475_01926 gene open 4475-6187
3856 CAKARG010000053.1 GCA916720475_01927 gene open 6231-6536
3857 CAKARG010000053.1 GCA916720475_01928 gene open 6645-7592
3858 CAKARG010000053.1 GCA916720475_01929 gene open 8016-9272
3859 CAKARG010000054.1 GCA916720475_01930 CDS open 3-1136 _na     377_aa yhcG YhcG family protein
3860 CAKARG010000054.1 GCA916720475_01931 CDS open 1155-2456 _na     433_aa hypothetical protein
3861 CAKARG010000054.1 GCA916720475_01932 CDS open 2488-3147 _na     219_aa Mobilization protein
3862 CAKARG010000054.1 GCA916720475_01933 CDS open 3169-4095 _na     308_aa Mobilization protein
3863 CAKARG010000054.1 GCA916720475_01934 CDS open 4092-4439 _na     115_aa Mobilization protein
3864 CAKARG010000054.1 GCA916720475_01935 CDS open 4713-5930 _na     405_aa IS4 family transposase
3865 CAKARG010000054.1 GCA916720475_01936 CDS open 6659-7642 _na     327_aa hypothetical protein
3866 CAKARG010000054.1 GCA916720475_01937 CDS open 7644-8537 _na     297_aa Phage abortive infection protein
3867 CAKARG010000054.1 GCA916720475_01930 gene open 3-1136 yhcG
3868 CAKARG010000054.1 GCA916720475_01931 gene open 1155-2456
3869 CAKARG010000054.1 GCA916720475_01932 gene open 2488-3147
3870 CAKARG010000054.1 GCA916720475_01933 gene open 3169-4095
3871 CAKARG010000054.1 GCA916720475_01934 gene open 4092-4439
3872 CAKARG010000054.1 GCA916720475_01935 gene open 4713-5930
3873 CAKARG010000054.1 GCA916720475_01936 gene open 6659-7642
3874 CAKARG010000054.1 GCA916720475_01937 gene open 7644-8537
3875 CAKARG010000055.1 GCA916720475_01938 CDS open 24-983 _na     319_aa M23 family metallopeptidase
3876 CAKARG010000055.1 GCA916720475_01939 CDS open 1234-2925 _na     563_aa glycosyltransferase
3877 CAKARG010000055.1 GCA916720475_01940 CDS open 2952-5591 _na     879_aa Alpha-glucan phosphorylase
3878 CAKARG010000055.1 GCA916720475_01941 CDS open 6419-6553 _na     44_aa hypothetical protein
3879 CAKARG010000055.1 GCA916720475_01942 CDS open 6628-6786 _na     52_aa hypothetical protein
3880 CAKARG010000055.1 GCA916720475_01938 gene open 24-983
3881 CAKARG010000055.1 GCA916720475_01939 gene open 1234-2925
3882 CAKARG010000055.1 GCA916720475_01940 gene open 2952-5591
3883 CAKARG010000055.1 GCA916720475_01941 gene open 6419-6553
3884 CAKARG010000055.1 GCA916720475_01942 gene open 6628-6786
3885 CAKARG010000056.1 GCA916720475_01943 CDS open 84-4562 _na     1492_aa tamB translocation/assembly module TamB domain-containing protein
3886 CAKARG010000056.1 GCA916720475_01944 CDS open 4667-7255 _na     862_aa BamA/TamA family outer membrane protein
3887 CAKARG010000056.1 GCA916720475_01945 CDS open 7512-7904 _na     130_aa hypothetical protein
3888 CAKARG010000056.1 GCA916720475_01943 gene open 84-4562 tamB
3889 CAKARG010000056.1 GCA916720475_01944 gene open 4667-7255
3890 CAKARG010000056.1 GCA916720475_01945 gene open 7512-7904
3891 CAKARG010000057.1 GCA916720475_01946 CDS open 285-914 _na     209_aa traI Conjugative transposon protein TraI
3892 CAKARG010000057.1 GCA916720475_01947 CDS open 908-1963 _na     351_aa traJ conjugative transposon protein TraJ
3893 CAKARG010000057.1 GCA916720475_01948 CDS open 1981-2604 _na     207_aa traK conjugative transposon protein TraK
3894 CAKARG010000057.1 GCA916720475_01949 CDS open 2882-4138 _na     418_aa traM conjugative transposon protein TraM
3895 CAKARG010000057.1 GCA916720475_01950 CDS open 4163-5116 _na     317_aa traN conjugative transposon protein TraN
3896 CAKARG010000057.1 GCA916720475_01951 CDS open 5110-5706 _na     198_aa Outer membrane insertion signal domain protein
3897 CAKARG010000057.1 GCA916720475_01952 CDS open 5718-6206 _na     162_aa Conjugal transfer protein
3898 CAKARG010000057.1 GCA916720475_01953 CDS open 6199-6699 _na     166_aa Lysozyme
3899 CAKARG010000057.1 GCA916720475_01954 CDS open 6834-8141 _na     435_aa hypothetical protein
3900 CAKARG010000057.1 GCA916720475_01946 gene open 285-914 traI
3901 CAKARG010000057.1 GCA916720475_01947 gene open 908-1963 traJ
3902 CAKARG010000057.1 GCA916720475_01948 gene open 1981-2604 traK
3903 CAKARG010000057.1 GCA916720475_01949 gene open 2882-4138 traM
3904 CAKARG010000057.1 GCA916720475_01950 gene open 4163-5116 traN
3905 CAKARG010000057.1 GCA916720475_01951 gene open 5110-5706
3906 CAKARG010000057.1 GCA916720475_01952 gene open 5718-6206
3907 CAKARG010000057.1 GCA916720475_01953 gene open 6199-6699
3908 CAKARG010000057.1 GCA916720475_01954 gene open 6834-8141
3909 CAKARG010000058.1 GCA916720475_01955 CDS open 194-481 _na     95_aa hypothetical protein
3910 CAKARG010000058.1 GCA916720475_01956 CDS open 536-970 _na     144_aa hypothetical protein
3911 CAKARG010000058.1 GCA916720475_01957 CDS open 991-1413 _na     140_aa hypothetical protein
3912 CAKARG010000058.1 GCA916720475_01958 CDS open 2014-2481 _na     155_aa hypothetical protein
3913 CAKARG010000058.1 GCA916720475_01959 CDS open 2450-4537 _na     695_aa Terminase
3914 CAKARG010000058.1 GCA916720475_01960 CDS open 4544-6502 _na     652_aa Phage portal protein
3915 CAKARG010000058.1 GCA916720475_01961 CDS open 6558-7934 _na     458_aa hypothetical protein
3916 CAKARG010000058.1 GCA916720475_01955 gene open 194-481
3917 CAKARG010000058.1 GCA916720475_01956 gene open 536-970
3918 CAKARG010000058.1 GCA916720475_01957 gene open 991-1413
3919 CAKARG010000058.1 GCA916720475_01958 gene open 2014-2481
3920 CAKARG010000058.1 GCA916720475_01959 gene open 2450-4537
3921 CAKARG010000058.1 GCA916720475_01960 gene open 4544-6502
3922 CAKARG010000058.1 GCA916720475_01961 gene open 6558-7934
3923 CAKARG010000059.1 GCA916720475_01962 CDS open 318-923 _na     201_aa Toprim domain protein
3924 CAKARG010000059.1 GCA916720475_01963 CDS open 911-1216 _na     101_aa DNA binding domain%2C excisionase family
3925 CAKARG010000059.1 GCA916720475_01964 CDS open 1434-2735 _na     433_aa ATP-binding protein
3926 CAKARG010000059.1 GCA916720475_01965 CDS open 2739-3326 _na     195_aa rloB RloB domain-containing protein
3927 CAKARG010000059.1 GCA916720475_01966 CDS open 3424-7935 _na     1503_aa site-specific DNA-methyltransferase (adenine-specific)
3928 CAKARG010000059.1 GCA916720475_01962 gene open 318-923
3929 CAKARG010000059.1 GCA916720475_01963 gene open 911-1216
3930 CAKARG010000059.1 GCA916720475_01964 gene open 1434-2735
3931 CAKARG010000059.1 GCA916720475_01965 gene open 2739-3326 rloB
3932 CAKARG010000059.1 GCA916720475_01966 gene open 3424-7935
3933 CAKARG010000060.1 GCA916720475_01967 CDS open 385-855 _na     156_aa hypothetical protein
3934 CAKARG010000060.1 GCA916720475_01968 CDS open 866-1462 _na     198_aa traK Conjugative transposon TraK protein
3935 CAKARG010000060.1 GCA916720475_01969 CDS open 1482-2804 _na     440_aa hypothetical protein
3936 CAKARG010000060.1 GCA916720475_01970 CDS open 2832-3500 _na     222_aa hypothetical protein
3937 CAKARG010000060.1 GCA916720475_01971 CDS open 3497-4159 _na     220_aa hypothetical protein
3938 CAKARG010000060.1 GCA916720475_01972 CDS open 4163-4885 _na     240_aa hypothetical protein
3939 CAKARG010000060.1 GCA916720475_01973 CDS open 4876-7716 _na     946_aa traG TraG P-loop domain-containing protein
3940 CAKARG010000060.1 GCA916720475_01967 gene open 385-855
3941 CAKARG010000060.1 GCA916720475_01968 gene open 866-1462 traK
3942 CAKARG010000060.1 GCA916720475_01969 gene open 1482-2804
3943 CAKARG010000060.1 GCA916720475_01970 gene open 2832-3500
3944 CAKARG010000060.1 GCA916720475_01971 gene open 3497-4159
3945 CAKARG010000060.1 GCA916720475_01972 gene open 4163-4885
3946 CAKARG010000060.1 GCA916720475_01973 gene open 4876-7716 traG
3947 CAKARG010000061.1 GCA916720475_01974 CDS open 535-819 _na     94_aa hypothetical protein
3948 CAKARG010000061.1 GCA916720475_01975 CDS open 832-1923 _na     363_aa hypothetical protein
3949 CAKARG010000061.1 GCA916720475_01976 CDS open 1928-2644 _na     238_aa hypothetical protein
3950 CAKARG010000061.1 GCA916720475_01977 CDS open 2655-3371 _na     238_aa hypothetical protein
3951 CAKARG010000061.1 GCA916720475_01978 CDS open 3384-3842 _na     152_aa hypothetical protein
3952 CAKARG010000061.1 GCA916720475_01979 CDS open 3934-5454 _na     506_aa BACON domain-containing protein
3953 CAKARG010000061.1 GCA916720475_01980 CDS open 5488-6204 _na     238_aa hypothetical protein
3954 CAKARG010000061.1 GCA916720475_01981 CDS open 6429-6722 _na     97_aa Terminase small subunit
3955 CAKARG010000061.1 GCA916720475_01982 CDS open 6791-7672 _na     293_aa hypothetical protein
3956 CAKARG010000061.1 GCA916720475_01974 gene open 535-819
3957 CAKARG010000061.1 GCA916720475_01975 gene open 832-1923
3958 CAKARG010000061.1 GCA916720475_01976 gene open 1928-2644
3959 CAKARG010000061.1 GCA916720475_01977 gene open 2655-3371
3960 CAKARG010000061.1 GCA916720475_01978 gene open 3384-3842
3961 CAKARG010000061.1 GCA916720475_01979 gene open 3934-5454
3962 CAKARG010000061.1 GCA916720475_01980 gene open 5488-6204
3963 CAKARG010000061.1 GCA916720475_01981 gene open 6429-6722
3964 CAKARG010000061.1 GCA916720475_01982 gene open 6791-7672
3965 CAKARG010000062.1 GCA916720475_01983 CDS open 749-4042 _na     1097_aa Type I restriction enzyme endonuclease subunit
3966 CAKARG010000062.1 GCA916720475_01984 CDS open 4058-5185 _na     375_aa Type I restriction modification DNA specificity domain-containing protein
3967 CAKARG010000062.1 GCA916720475_01985 CDS open 5480-6784 _na     434_aa hypothetical protein
3968 CAKARG010000062.1 GCA916720475_01986 CDS open 6818-6970 _na     50_aa hypothetical protein
3969 CAKARG010000062.1 GCA916720475_01987 CDS open 6967-7191 _na     74_aa Helix-turn-helix transcriptional regulator
3970 CAKARG010000062.1 GCA916720475_01983 gene open 749-4042
3971 CAKARG010000062.1 GCA916720475_01984 gene open 4058-5185
3972 CAKARG010000062.1 GCA916720475_01985 gene open 5480-6784
3973 CAKARG010000062.1 GCA916720475_01986 gene open 6818-6970
3974 CAKARG010000062.1 GCA916720475_01987 gene open 6967-7191
3975 CAKARG010000063.1 GCA916720475_01988 CDS open 880-1092 _na     70_aa hypothetical protein
3976 CAKARG010000063.1 GCA916720475_01989 CDS open 1255-2034 _na     259_aa hypothetical protein
3977 CAKARG010000063.1 GCA916720475_01990 CDS open 2095-3219 _na     374_aa hypothetical protein
3978 CAKARG010000063.1 GCA916720475_01991 CDS open 3225-3866 _na     213_aa hypothetical protein
3979 CAKARG010000063.1 GCA916720475_01992 CDS open 3938-4183 _na     81_aa hypothetical protein
3980 CAKARG010000063.1 GCA916720475_01993 CDS open 4564-4953 _na     129_aa hypothetical protein
3981 CAKARG010000063.1 GCA916720475_01994 CDS open 4950-7097 _na     715_aa YWFCY domain-containing protein
3982 CAKARG010000063.1 GCA916720475_01988 gene open 880-1092
3983 CAKARG010000063.1 GCA916720475_01989 gene open 1255-2034
3984 CAKARG010000063.1 GCA916720475_01990 gene open 2095-3219
3985 CAKARG010000063.1 GCA916720475_01991 gene open 3225-3866
3986 CAKARG010000063.1 GCA916720475_01992 gene open 3938-4183
3987 CAKARG010000063.1 GCA916720475_01993 gene open 4564-4953
3988 CAKARG010000063.1 GCA916720475_01994 gene open 4950-7097
3989 CAKARG010000064.1 repeat_region open 155-386 CRISPR array with 4 repeats of length 21%2C consensus sequence GTTTCAATTCACGCAGCCCAA and spacer length 45
3990 CAKARG010000064.1 GCA916720475_01995 CDS open 862-1575 _na     237_aa cas5c type I-C CRISPR-associated protein Cas5c
3991 CAKARG010000064.1 GCA916720475_01996 CDS open 1572-3491 _na     639_aa cas8c type I-C CRISPR-associated protein Cas8c/Csd1
3992 CAKARG010000064.1 GCA916720475_01997 CDS open 3688-4530 _na     280_aa cas7c type I-C CRISPR-associated protein Cas7/Csd2
3993 CAKARG010000064.1 GCA916720475_01998 CDS open 4653-5330 _na     225_aa cas4 CRISPR-associated protein Cas4
3994 CAKARG010000064.1 GCA916720475_01999 CDS open 5362-6390 _na     342_aa cas1c type I-C CRISPR-associated endonuclease Cas1c
3995 CAKARG010000064.1 GCA916720475_02000 CDS open 6413-6703 _na     96_aa cas2 CRISPR-associated endonuclease Cas2
3996 CAKARG010000064.1 GCA916720475_01995 gene open 862-1575 cas5c
3997 CAKARG010000064.1 GCA916720475_01996 gene open 1572-3491 cas8c
3998 CAKARG010000064.1 GCA916720475_01997 gene open 3688-4530 cas7c
3999 CAKARG010000064.1 GCA916720475_01998 gene open 4653-5330 cas4
4000 CAKARG010000064.1 GCA916720475_01999 gene open 5362-6390 cas1c