HOMD Banner
Taxonomy: V4.3   |  16S rRNA RefSeq: V16.03   |  Genomic RefSeq: V11.03   |  Viruses: V1.2

BAKTAGenome Explorer: Aggregatibacter segnis (GCA_920939465.1)

Select a Genome:
BAKTA Annotations for GCA_920939465.1
Genome Selected: Aggregatibacter segnis
ContigsBases CDSrRNA tmRNAtRNA
1 2,071,265 1926 19 1 59
[Table]   [AA Fasta]      [Browser]   [Text]   [Excel]  
Search & Sort all 4064 Records
Search These Records: Clear
Sort Column:   Molecule   PID   NA   AA   Gene  Gene Product  Reverse
Annotation Table [page:1]    |    Number of Records Found: 4064 [9 Pages]    |    Previous Page <==> Next Page    |    Jump to Page: [ 1  2  3  4  5  6  7  8  9  ]
Notes:   1- Column headers only sort the current page. 2- Select [NA] or [AA] links to show sequences.
Region Protein-ID Type Genome
Viewer		 Range
(bp)		 Show Sequences
(length) NA / AA		 BAKTA
Gene		 BAKTA
GeneProduct
1 OV100759.1 GCA920939465_01053 gene open 1102605-1102970 ssrA
2 OV100759.1 GCA920939465_01053 tmRNA open 1102605-1102970 ssrA transfer-messenger RNA%2C SsrA
3 OV100759.1 rep_origin open 1144518-1144948
4 OV100759.1 GCA920939465_00008 gene open 3770-3854 sRNA-Xcc1
5 OV100759.1 GCA920939465_00062 gene open 67239-67321 AaHKsRNA69
6 OV100759.1 GCA920939465_00130 gene open 138788-138887 AaHKsRNA22
7 OV100759.1 GCA920939465_00144 gene open 156375-156615 JA03
8 OV100759.1 GCA920939465_00183 gene open 203425-203813 RNaseP_bact_a
9 OV100759.1 GCA920939465_00270 gene open 289247-289324 AaHKsRNA20
10 OV100759.1 GCA920939465_00299 gene open 322489-322587 Bacteria_small_SRP
11 OV100759.1 GCA920939465_00563 gene open 617839-617954 rrf
12 OV100759.1 GCA920939465_00564 gene open 618100-620996 rrl
13 OV100759.1 GCA920939465_00566 gene open 621419-622958 rrs
14 OV100759.1 GCA920939465_00590 gene open 647847-647962 rrf
15 OV100759.1 GCA920939465_00591 gene open 648109-651005 rrl
16 OV100759.1 GCA920939465_00593 gene open 651428-652967 rrs
17 OV100759.1 GCA920939465_00823 gene open 881929-882046 AaHKsRNA54
18 OV100759.1 GCA920939465_00965 gene open 1010052-1010167 rrf
19 OV100759.1 GCA920939465_00966 gene open 1010223-1010338 rrf
20 OV100759.1 GCA920939465_00967 gene open 1010485-1013381 rrl
21 OV100759.1 GCA920939465_00970 gene open 1014070-1015609 rrs
22 OV100759.1 GCA920939465_01038 gene open 1084604-1084683 JA04
23 OV100759.1 GCA920939465_01047 gene open 1095953-1096068 rrf
24 OV100759.1 GCA920939465_01048 gene open 1096215-1099111 rrl
25 OV100759.1 GCA920939465_01051 gene open 1099800-1101339 rrs
26 OV100759.1 GCA920939465_01296 gene open 1343070-1344609 rrs
27 OV100759.1 GCA920939465_01298 gene open 1345032-1347928 rrl
28 OV100759.1 GCA920939465_01299 gene open 1348075-1348190 rrf
29 OV100759.1 GCA920939465_01332 gene open 1376779-1376865 t44
30 OV100759.1 GCA920939465_01387 gene open 1434736-1434919 6S
31 OV100759.1 GCA920939465_01459 gene open 1510442-1510530 C4
32 OV100759.1 GCA920939465_01536 gene open 1578477-1578567 AaHKsRNA22
33 OV100759.1 GCA920939465_01557 gene open 1598113-1598244 hrrF
34 OV100759.1 GCA920939465_01776 gene open 1840966-1841082 AaHKsRNA96
35 OV100759.1 GCA920939465_01875 gene open 1930515-1932054 rrs
36 OV100759.1 GCA920939465_01878 gene open 1932743-1935639 rrl
37 OV100759.1 GCA920939465_01879 gene open 1935786-1935901 rrf
38 OV100759.1 GCA920939465_01911 gene open 1964533-1964722 gcvB
39 OV100759.1 GCA920939465_00008 ncRNA open 3770-3854 sRNA-Xcc1
40 OV100759.1 GCA920939465_00062 ncRNA open 67239-67321 Aggregatibacter sRNA 69
41 OV100759.1 GCA920939465_00130 ncRNA open 138788-138887 Aggregatibacter sRNA 22
42 OV100759.1 GCA920939465_00144 ncRNA open 156375-156615 Aggregatibacter sRNA JA03
43 OV100759.1 GCA920939465_00183 ncRNA open 203425-203813 Bacterial RNase P class A
44 OV100759.1 GCA920939465_00270 ncRNA open 289247-289324 Aggregatibacter sRNA 20
45 OV100759.1 GCA920939465_00299 ncRNA open 322489-322587 Bacterial small signal recognition particle RNA
46 OV100759.1 GCA920939465_00823 ncRNA open 881929-882046 Aggregatibacter sRNA 54
47 OV100759.1 GCA920939465_01038 ncRNA open 1084604-1084683 Aggregatibacter sRNA JA04
48 OV100759.1 GCA920939465_01332 ncRNA open 1376779-1376865 t44 RNA
49 OV100759.1 GCA920939465_01387 ncRNA open 1434736-1434919 6S / SsrS RNA
50 OV100759.1 GCA920939465_01459 ncRNA open 1510442-1510530 C4 antisense RNA
51 OV100759.1 GCA920939465_01536 ncRNA open 1578477-1578567 Aggregatibacter sRNA 22
52 OV100759.1 GCA920939465_01557 ncRNA open 1598113-1598244 hrrF Haemophilus regulatory RNA responsive to iron
53 OV100759.1 GCA920939465_01776 ncRNA open 1840966-1841082 Aggregatibacter sRNA 96
54 OV100759.1 GCA920939465_01911 ncRNA open 1964533-1964722 gcvB GcvB RNA
55 OV100759.1 regulatory_region open 238100-238261 Molybdenum/Tungsten riboswitch aptamer (Moco RNA motif)
56 OV100759.1 regulatory_region open 582726-582770 PreQ1 (pre queuosine) riboswitch aptamer
57 OV100759.1 regulatory_region open 753514-753634 Ribosomal S15 leader
58 OV100759.1 regulatory_region open 872760-872845 RpsF leader
59 OV100759.1 regulatory_region open 893444-893506 L31-Gammaproteobacteria ribosomal protein leader
60 OV100759.1 regulatory_region open 968834-968946 Alpha operon ribosome binding site
61 OV100759.1 regulatory_region open 1296786-1296885 TPP riboswitch aptamer (THI element)
62 OV100759.1 regulatory_region open 1300344-1300483 Histidine operon leader
63 OV100759.1 regulatory_region open 1338845-1338992 FMN riboswitch aptamer (RFN element)
64 OV100759.1 regulatory_region open 1485207-1485294 TPP riboswitch aptamer (THI element)
65 OV100759.1 regulatory_region open 1583594-1583724 Glycine riboswitch aptamer
66 OV100759.1 regulatory_region open 1661563-1661691 Histidine operon leader
67 OV100759.1 regulatory_region open 1684968-1685083 CpoB/ybgF ICR thermometer
68 OV100759.1 regulatory_region open 1744146-1744248 TPP riboswitch aptamer (THI element)
69 OV100759.1 regulatory_region open 1830598-1830685 TPP riboswitch aptamer (THI element)
70 OV100759.1 regulatory_region open 1978029-1978087 Selenocysteine insertion sequence 3
71 OV100759.1 regulatory_region open 2034920-2035093 Lysine riboswitch aptamer
72 OV100759.1 GCA920939465_00563 rRNA open 617839-617954 rrf 5S ribosomal RNA
73 OV100759.1 GCA920939465_00564 rRNA open 618100-620996 rrl 23S ribosomal RNA
74 OV100759.1 GCA920939465_00566 rRNA open 621419-622958 rrs 16S ribosomal RNA
75 OV100759.1 GCA920939465_00590 rRNA open 647847-647962 rrf 5S ribosomal RNA
76 OV100759.1 GCA920939465_00591 rRNA open 648109-651005 rrl 23S ribosomal RNA
77 OV100759.1 GCA920939465_00593 rRNA open 651428-652967 rrs 16S ribosomal RNA
78 OV100759.1 GCA920939465_00965 rRNA open 1010052-1010167 rrf 5S ribosomal RNA
79 OV100759.1 GCA920939465_00966 rRNA open 1010223-1010338 rrf 5S ribosomal RNA
80 OV100759.1 GCA920939465_00967 rRNA open 1010485-1013381 rrl 23S ribosomal RNA
81 OV100759.1 GCA920939465_00970 rRNA open 1014070-1015609 rrs 16S ribosomal RNA
82 OV100759.1 GCA920939465_01047 rRNA open 1095953-1096068 rrf 5S ribosomal RNA
83 OV100759.1 GCA920939465_01048 rRNA open 1096215-1099111 rrl 23S ribosomal RNA
84 OV100759.1 GCA920939465_01051 rRNA open 1099800-1101339 rrs 16S ribosomal RNA
85 OV100759.1 GCA920939465_01296 rRNA open 1343070-1344609 rrs 16S ribosomal RNA
86 OV100759.1 GCA920939465_01298 rRNA open 1345032-1347928 rrl 23S ribosomal RNA
87 OV100759.1 GCA920939465_01299 rRNA open 1348075-1348190 rrf 5S ribosomal RNA
88 OV100759.1 GCA920939465_01875 rRNA open 1930515-1932054 rrs 16S ribosomal RNA
89 OV100759.1 GCA920939465_01878 rRNA open 1932743-1935639 rrl 23S ribosomal RNA
90 OV100759.1 GCA920939465_01879 rRNA open 1935786-1935901 rrf 5S ribosomal RNA
91 OV100759.1 repeat_region open 1760431-1766664 CRISPR array with 104 repeats of length 28%2C consensus sequence TTTCTAAGCTGCCTATTCGGCAGTGAAG and spacer length 32
92 OV100759.1 repeat_region open 1766747-1766906 CRISPR array with 3 repeats of length 31%2C consensus sequence ATTTCTAAGCTGCCTATTCGGCAGTGAAGAC and spacer length 29
93 OV100759.1 repeat_region open 1766987-1769487 CRISPR array with 42 repeats of length 28%2C consensus sequence TTTCTAAGCTGCCTATTCGGCAGTGAAG and spacer length 32
94 OV100759.1 repeat_region open 1830321-1830496 CRISPR array with 3 repeats of length 35%2C consensus sequence AGCAGCCACCTTCGGGTGGCTGTGTGTTGAAACTT and spacer length 31
95 OV100759.1 GCA920939465_00001 CDS open 3-239 _na     78_aa hypothetical protein
96 OV100759.1 GCA920939465_00002 CDS open 243-896 _na     217_aa Phage protein
97 OV100759.1 GCA920939465_00003 CDS open 955-1362 _na     135_aa Phage tail protein
98 OV100759.1 GCA920939465_00004 CDS open 1407-1637 _na     76_aa Phage protein
99 OV100759.1 GCA920939465_00005 CDS open 1762-2280 _na     172_aa phage antirepressor N-terminal domain-containing protein
100 OV100759.1 GCA920939465_00006 CDS open 2284-2829 _na     181_aa hypothetical protein
101 OV100759.1 GCA920939465_00007 CDS open 3048-3587 _na     179_aa Lipoprotein
102 OV100759.1 GCA920939465_00009 CDS open 3899-4582 _na     227_aa KilA-N domain-containing protein
103 OV100759.1 GCA920939465_00010 CDS open 4679-4915 _na     78_aa hypothetical protein
104 OV100759.1 GCA920939465_00011 CDS open 4974-8399 _na     1141_aa tape measure protein
105 OV100759.1 GCA920939465_00012 CDS open 8396-8722 _na     108_aa phage tail protein
106 OV100759.1 GCA920939465_00013 CDS open 8722-9435 _na     237_aa phage minor tail protein L
107 OV100759.1 GCA920939465_00014 CDS open 9498-10187 _na     229_aa C40 family peptidase
108 OV100759.1 GCA920939465_00015 CDS open 10289-10723 _na     144_aa Bacteriophage lambda tail assembly protein I
109 OV100759.1 GCA920939465_00016 CDS open 10780-14142 _na     1120_aa host specificity protein J
110 OV100759.1 GCA920939465_00017 CDS open 14178-14516 _na     112_aa hypothetical protein
111 OV100759.1 GCA920939465_00018 CDS open 14864-16174 _na     436_aa nCS2 NCS2 family nucleobase:cation symporter-2
112 OV100759.1 GCA920939465_00019 CDS open 16180-16536 _na     118_aa dsrE DsrE family protein
113 OV100759.1 GCA920939465_00020 CDS open 16607-20269 _na     1220_aa recB exodeoxyribonuclease V subunit beta
114 OV100759.1 GCA920939465_00021 CDS open 20269-22248 _na     659_aa recD exodeoxyribonuclease V subunit alpha
115 OV100759.1 GCA920939465_00022 CDS open 22259-22855 _na     198_aa Thiopurine S-methyltransferase
116 OV100759.1 GCA920939465_00023 CDS open 23097-23525 _na     142_aa rplM 50S ribosomal protein L13
117 OV100759.1 GCA920939465_00024 CDS open 23543-23935 _na     130_aa rpsI 30S ribosomal protein S9
118 OV100759.1 GCA920939465_00025 CDS open 24086-24871 _na     261_aa truA tRNA pseudouridine(38-40) synthase TruA
119 OV100759.1 GCA920939465_00026 CDS open 24972-26429 _na     485_aa citT CitT protein
120 OV100759.1 GCA920939465_00027 CDS open 26639-27415 _na     258_aa mmcQ MmcQ family protein
121 OV100759.1 GCA920939465_00028 CDS open 27493-28977 _na     494_aa adhE Aldehyde dehydrogenase
122 OV100759.1 GCA920939465_00029 CDS open 29274-30722 _na     482_aa pspE tRNA sulfurtransferase
123 OV100759.1 GCA920939465_00030 CDS open 30821-31525 _na     234_aa pepE dipeptidase PepE
124 OV100759.1 GCA920939465_00031 CDS open 31691-32278 _na     195_aa Aminotransferase%2C class IV
125 OV100759.1 GCA920939465_00032 CDS open 32281-33258 _na     325_aa aminodeoxychorismate synthase component I
126 OV100759.1 GCA920939465_00033 CDS open 33353-33919 _na     188_aa anthranilate synthase component II
127 OV100759.1 GCA920939465_00034 CDS open 34072-35016 _na     314_aa ldhA 2-hydroxyacid dehydrogenase
128 OV100759.1 GCA920939465_00035 CDS open 35105-37051 _na     648_aa OMR family outer membrane cobalamin receptor
129 OV100759.1 GCA920939465_00036 CDS open 37118-37957 _na     279_aa Helical backbone metal receptor
130 OV100759.1 GCA920939465_00037 CDS open 38183-39160 _na     325_aa Vitamin B12 ABC superfamily ATP binding cassette transporter%2C permease protein
131 OV100759.1 GCA920939465_00038 CDS open 39165-39926 _na     253_aa Hemin ABC superfamily ATP binding cassette transporter%2C ABC protein
132 OV100759.1 GCA920939465_00039 CDS open 40101-41171 _na     356_aa potA Spermidine/putrescine import ATP-binding protein PotA
133 OV100759.1 GCA920939465_00040 CDS open 41168-42037 _na     289_aa potB Spermidine/putrescine ABC transporter membrane protein
134 OV100759.1 GCA920939465_00041 CDS open 42034-42885 _na     283_aa potC PotC protein
135 OV100759.1 GCA920939465_00042 CDS open 42905-43996 _na     363_aa ynjB Extracellular solute-binding protein
136 OV100759.1 GCA920939465_00043 CDS open 44129-45961 _na     610_aa uvrC excinuclease ABC subunit UvrC
137 OV100759.1 GCA920939465_00044 CDS open 46065-46838 _na     257_aa kdsB 3-deoxy-manno-octulosonate cytidylyltransferase
138 OV100759.1 GCA920939465_00045 CDS open 46840-47019 _na     59_aa UPF0434 protein HMPREF9064_0792
139 OV100759.1 GCA920939465_00046 CDS open 47026-48006 _na     326_aa lpxK tetraacyldisaccharide 4'-kinase
140 OV100759.1 GCA920939465_00047 CDS open 48025-49854 _na     609_aa msbA lipid A ABC transporter ATP-binding protein/permease MsbA
141 OV100759.1 GCA920939465_00048 CDS open 49818-52247 _na     809_aa DNA internalization-related competence protein ComEC/Rec2
142 OV100759.1 GCA920939465_00049 CDS open 52541-52978 _na     145_aa dksA RNA polymerase-binding protein DksA
143 OV100759.1 GCA920939465_00050 CDS open 53262-54551 _na     429_aa pcnB Poly(A) polymerase I
144 OV100759.1 GCA920939465_00051 CDS open 54544-55050 _na     168_aa folK 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase
145 OV100759.1 GCA920939465_00052 CDS open 55190-57325 _na     711_aa pta phosphate acetyltransferase
146 OV100759.1 GCA920939465_00053 CDS open 57397-58599 _na     400_aa ackA Acetate kinase
147 OV100759.1 GCA920939465_00054 CDS open 58893-59336 _na     147_aa yfbV terminus macrodomain insulation protein YfbV
148 OV100759.1 GCA920939465_00055 CDS open 59514-60059 _na     181_aa Colicin V production protein
149 OV100759.1 GCA920939465_00056 CDS open 60073-61584 _na     503_aa purF amidophosphoribosyltransferase
150 OV100759.1 GCA920939465_00057 CDS open 61762-62724 _na     320_aa Outer membrane protein
151 OV100759.1 GCA920939465_00058 CDS open 62880-63608 _na     242_aa moeB molybdopterin-synthase adenylyltransferase MoeB
152 OV100759.1 GCA920939465_00059 CDS open 63624-64838 _na     404_aa moeA molybdopterin molybdotransferase MoeA
153 OV100759.1 GCA920939465_00060 CDS open 65031-65687 _na     218_aa folE GTP cyclohydrolase I FolE
154 OV100759.1 GCA920939465_00061 CDS open 65801-67243 _na     480_aa dacB serine-type D-Ala-D-Ala carboxypeptidase
155 OV100759.1 GCA920939465_00063 CDS open 67403-67879 _na     158_aa greA transcription elongation factor GreA
156 OV100759.1 GCA920939465_00064 CDS open 67947-68249 _na     100_aa yhbY ribosome assembly RNA-binding protein YhbY
157 OV100759.1 GCA920939465_00065 CDS open 68350-68964 _na     204_aa riboflavin synthase subunit alpha
158 OV100759.1 GCA920939465_00066 CDS open 68989-70386 _na     465_aa Multidrug-efflux transporter
159 OV100759.1 GCA920939465_00067 CDS open 70544-72775 _na     743_aa Ferric hydroxamate uptake
160 OV100759.1 GCA920939465_00068 CDS open 72831-74576 _na     581_aa ABC superfamily ATP binding cassette transporter%2C membrane protein
161 OV100759.1 GCA920939465_00069 CDS open 74693-75172 _na     159_aa ybaK Cys-tRNA(Pro) deacylase
162 OV100759.1 GCA920939465_00070 CDS open 75233-76204 _na     323_aa oxidoreductase
163 OV100759.1 GCA920939465_00071 CDS open 76263-76892 _na     209_aa Polysaccharide biosynthesis protein
164 OV100759.1 GCA920939465_00072 CDS open 76966-77448 _na     160_aa Thioredoxin domain-containing protein
165 OV100759.1 GCA920939465_00073 CDS open 77474-78115 _na     213_aa ccdA Cytochrome C-type biogenesis protein CcdA
166 OV100759.1 GCA920939465_00074 CDS open 78119-79189 _na     356_aa msrAB bifunctional methionine sulfoxide reductase B/A protein
167 OV100759.1 GCA920939465_00075 CDS open 79401-80093 _na     230_aa can carbonate dehydratase
168 OV100759.1 GCA920939465_00076 CDS open 80164-80751 _na     195_aa dolP division/outer membrane stress-associated lipid-binding lipoprotein
169 OV100759.1 GCA920939465_00077 CDS open 80817-81407 _na     196_aa Phosphoheptose isomerase
170 OV100759.1 GCA920939465_00078 CDS open 81407-81766 _na     119_aa yraN YraN family protein
171 OV100759.1 GCA920939465_00079 CDS open 81776-83494 _na     572_aa lpoA Penicillin-binding protein activator LpoA
172 OV100759.1 GCA920939465_00080 CDS open 83571-84419 _na     282_aa rsmI 16S rRNA (cytidine(1402)-2'-O)-methyltransferase
173 OV100759.1 GCA920939465_00081 CDS open 84550-86049 _na     499_aa glpK glycerol kinase GlpK
174 OV100759.1 GCA920939465_00082 CDS open 86084-86878 _na     264_aa glpF MIP family glycerol uptake facilitator protein GlpF
175 OV100759.1 GCA920939465_00083 CDS open 87197-88786 _na     529_aa glpA Aerobic glycerol-3-phosphate dehydrogenase
176 OV100759.1 GCA920939465_00084 CDS open 89045-90382 _na     445_aa ndh NADH dehydrogenase
177 OV100759.1 GCA920939465_00085 CDS open 90473-91063 _na     196_aa FMN dependent NADH:quinone oxidoreductase
178 OV100759.1 GCA920939465_00086 CDS open 91263-92321 _na     352_aa sohB protease SohB
179 OV100759.1 GCA920939465_00087 CDS open 92380-93255 _na     291_aa fN3K Fructosamine kinase
180 OV100759.1 GCA920939465_00088 CDS open 93495-95426 _na     643_aa thrS threonine--tRNA ligase
181 OV100759.1 GCA920939465_00089 CDS open 95808-96272 _na     154_aa infC translation initiation factor IF-3
182 OV100759.1 GCA920939465_00090 CDS open 96481-96678 _na     65_aa rpmI 50S ribosomal protein L35
183 OV100759.1 GCA920939465_00091 CDS open 96734-97087 _na     117_aa rplT 50S ribosomal protein L20
184 OV100759.1 GCA920939465_00092 CDS open 97478-99334 _na     618_aa dxs 1-deoxy-D-xylulose-5-phosphate synthase
185 OV100759.1 GCA920939465_00093 CDS open 99418-100308 _na     296_aa ispA (2E%2C6E)-farnesyl diphosphate synthase
186 OV100759.1 GCA920939465_00094 CDS open 100319-100564 _na     81_aa xseB exodeoxyribonuclease VII small subunit
187 OV100759.1 GCA920939465_00095 CDS open 100703-101653 _na     316_aa Putative esterase
188 OV100759.1 GCA920939465_00096 CDS open 101850-102737 _na     295_aa accD acetyl-CoA carboxylase%2C carboxyltransferase subunit beta
189 OV100759.1 GCA920939465_00097 CDS open 102740-104086 _na     448_aa folC bifunctional tetrahydrofolate synthase/dihydrofolate synthase
190 OV100759.1 GCA920939465_00098 CDS open 104146-104787 _na     213_aa Phosphoglycerate mutase
191 OV100759.1 GCA920939465_00099 CDS open 104846-106303 _na     485_aa cls cardiolipin synthase
192 OV100759.1 GCA920939465_00100 CDS open 106317-107225 _na     302_aa Membrane protein
193 OV100759.1 GCA920939465_00101 CDS open 107365-108045 _na     226_aa Ribosomal large subunit pseudouridine synthase C
194 OV100759.1 GCA920939465_00102 CDS open 108090-108971 _na     293_aa eamA EamA domain-containing protein
195 OV100759.1 GCA920939465_00103 CDS open 109045-109368 _na     107_aa Alkylphosphonate utilization protein
196 OV100759.1 GCA920939465_00104 CDS open 109485-111026 _na     513_aa subtype B tannase
197 OV100759.1 GCA920939465_00105 CDS open 111192-112562 _na     456_aa tdeA toxin/drug exporter TdeA
198 OV100759.1 GCA920939465_00106 CDS open 112649-114580 _na     643_aa pvdT Pyoverdine export ATP-binding/permease protein PvdT
199 OV100759.1 GCA920939465_00107 CDS open 114600-115775 _na     391_aa macA Macrolide-specific efflux protein MacA
200 OV100759.1 GCA920939465_00108 CDS open 115983-116255 _na     90_aa type II toxin-antitoxin system RelB/DinJ family antitoxin
201 OV100759.1 GCA920939465_00109 CDS open 116256-116528 _na     90_aa yafQ type II toxin-antitoxin system YafQ family toxin
202 OV100759.1 GCA920939465_00110 CDS open 116622-118292 _na     556_aa glnS glutamine--tRNA ligase
203 OV100759.1 GCA920939465_00111 CDS open 118485-118724 _na     79_aa hypothetical protein
204 OV100759.1 GCA920939465_00112 CDS open 118928-119263 _na     111_aa Type II toxin-antitoxin system PemK/MazF family toxin
205 OV100759.1 GCA920939465_00113 CDS open 119724-119945 _na     73_aa hypothetical protein
206 OV100759.1 GCA920939465_00114 CDS open 120151-120384 _na     77_aa hypothetical protein
207 OV100759.1 GCA920939465_00115 CDS open 120602-121045 _na     147_aa lysM peptidoglycan-binding protein LysM
208 OV100759.1 GCA920939465_00116 CDS open 121184-122011 _na     275_aa Neutral zinc metallopeptidase
209 OV100759.1 GCA920939465_00117 CDS open 122172-122606 _na     144_aa hypothetical protein
210 OV100759.1 GCA920939465_00118 CDS open 123297-123971 _na     224_aa Lipoprotein
211 OV100759.1 GCA920939465_00119 CDS open 123968-124378 _na     136_aa xerC Tyrosine recombinase XerC
212 OV100759.1 GCA920939465_00120 CDS open 124389-125054 _na     221_aa csgG Curli production assembly/transport component CsgG
213 OV100759.1 GCA920939465_00121 CDS open 125255-125959 _na     234_aa DUF6882 domain-containing protein
214 OV100759.1 GCA920939465_00122 CDS open 126181-127506 _na     441_aa uhpC Phosphoglycerate transporter family protein
215 OV100759.1 GCA920939465_00123 CDS open 127759-128985 _na     408_aa codB cytosine permease
216 OV100759.1 GCA920939465_00124 CDS open 128995-130257 _na     420_aa Cytosine deaminase
217 OV100759.1 GCA920939465_00125 CDS open 130431-130880 _na     149_aa ycgN YcgN family cysteine cluster protein
218 OV100759.1 GCA920939465_00126 CDS open 131126-133219 _na     697_aa malQ 4-alpha-glucanotransferase
219 OV100759.1 GCA920939465_00127 CDS open 133232-135421 _na     729_aa glgB 1%2C4-alpha-glucan branching protein GlgB
220 OV100759.1 GCA920939465_00128 CDS open 135425-137440 _na     671_aa glgX glycogen debranching protein GlgX
221 OV100759.1 GCA920939465_00129 CDS open 137462-138760 _na     432_aa glgC glucose-1-phosphate adenylyltransferase
222 OV100759.1 GCA920939465_00131 CDS open 139014-140453 _na     479_aa glgA glycogen synthase GlgA
223 OV100759.1 GCA920939465_00132 CDS open 140571-143036 _na     821_aa glgP Alpha-1%2C4 glucan phosphorylase
224 OV100759.1 GCA920939465_00133 CDS open 143128-143736 _na     202_aa dedA DedA family membrane protein
225 OV100759.1 GCA920939465_00134 CDS open 143950-144237 _na     95_aa rplY 50S ribosomal protein L25
226 OV100759.1 GCA920939465_00135 CDS open 144375-144956 _na     193_aa hlpB Lipoprotein HlpB
227 OV100759.1 GCA920939465_00136 CDS open 145106-145984 _na     292_aa Serine-type D-Ala-D-Ala carboxypeptidase
228 OV100759.1 GCA920939465_00137 CDS open 146119-147441 _na     440_aa mukF chromosome partition protein MukF
229 OV100759.1 GCA920939465_00138 CDS open 147531-148271 _na     246_aa mukE chromosome partition protein MukE
230 OV100759.1 GCA920939465_00139 CDS open 148271-152764 _na     1497_aa mukB chromosome partition protein MukB
231 OV100759.1 GCA920939465_00140 CDS open 152834-153730 _na     298_aa Mrr restriction system protein
232 OV100759.1 GCA920939465_00141 CDS open 153751-154623 _na     290_aa eamA EamA domain-containing protein
233 OV100759.1 GCA920939465_00142 CDS open 154638-156062 _na     474_aa sbcB exodeoxyribonuclease I
234 OV100759.1 GCA920939465_00143 CDS open 156328-156438 _na     36_aa hypothetical protein
235 OV100759.1 GCA920939465_00145 CDS open 156947-157432 _na     161_aa ftnA non-heme ferritin
236 OV100759.1 GCA920939465_00146 CDS open 157449-157946 _na     165_aa ftnA non-heme ferritin
237 OV100759.1 GCA920939465_00147 CDS open 158005-158175 _na     56_aa hypothetical protein
238 OV100759.1 GCA920939465_00148 CDS open 158283-159056 _na     257_aa fnr Anaerobic regulatory protein
239 OV100759.1 GCA920939465_00149 CDS open 159169-160101 _na     310_aa uspE universal stress protein UspE
240 OV100759.1 GCA920939465_00150 CDS open 160259-160912 _na     217_aa tnp IS1595 family transposase
241 OV100759.1 GCA920939465_00151 CDS open 160985-163591 _na     868_aa topA type I DNA topoisomerase
242 OV100759.1 GCA920939465_00152 CDS open 163690-164586 _na     298_aa lysR LysR substrate binding domain protein
243 OV100759.1 GCA920939465_00153 CDS open 164633-165469 _na     278_aa S-adenosylmethionine:tRNA ribosyltransferase-isomerase
244 OV100759.1 GCA920939465_00154 CDS open 165477-166496 _na     339_aa pyrD quinone-dependent dihydroorotate dehydrogenase
245 OV100759.1 GCA920939465_00155 CDS open 166573-169182 _na     869_aa pepN aminopeptidase N
246 OV100759.1 GCA920939465_00156 CDS open 169334-169831 _na     165_aa N5-carboxyaminoimidazole ribonucleotide mutase
247 OV100759.1 GCA920939465_00157 CDS open 169971-171059 _na     362_aa purK 5-(carboxyamino)imidazole ribonucleotide synthase
248 OV100759.1 GCA920939465_00158 CDS open 171149-172339 _na     396_aa tyrB Aminotransferase
249 OV100759.1 GCA920939465_00159 CDS open 172458-172871 _na     137_aa HicB-like antitoxin of toxin-antitoxin system domain-containing protein
250 OV100759.1 GCA920939465_00160 CDS open 173472-174458 _na     328_aa Iron(III) ABC superfamily ATP binding cassette transporter%2C membrane protein
251 OV100759.1 GCA920939465_00161 CDS open 174468-175256 _na     262_aa ABC superfamily ATP binding cassette transporter%2C ABC protein
252 OV100759.1 GCA920939465_00162 CDS open 175269-176303 _na     344_aa Iron chelating ABC superfamily ATP binding cassette transporter substrate-binding protein
253 OV100759.1 GCA920939465_00163 CDS open 176392-176601 _na     69_aa modE Molybdenum transport regulatory protein ModE
254 OV100759.1 GCA920939465_00164 CDS open 176721-179129 _na     802_aa Ferric enterobactin receptor
255 OV100759.1 GCA920939465_00165 CDS open 179376-180356 _na     326_aa hlyD HlyD family secretion protein
256 OV100759.1 GCA920939465_00166 CDS open 180359-183103 _na     914_aa rbbA ribosome-associated ATPase/putative transporter RbbA
257 OV100759.1 GCA920939465_00167 CDS open 183105-184232 _na     375_aa yhhJ Inner membrane transport permease yhhJ
258 OV100759.1 GCA920939465_00168 CDS open 184247-185659 _na     470_aa tolC TolC family protein
259 OV100759.1 GCA920939465_00169 CDS open 185747-186496 _na     249_aa Iron chelate ABC superfamily ATP binding cassette transporter%2C ABC protein
260 OV100759.1 GCA920939465_00170 CDS open 186493-187506 _na     337_aa Hemin ABC superfamily ATP binding cassette transporter%2C membrane protein
261 OV100759.1 GCA920939465_00171 CDS open 187506-188510 _na     334_aa Iron chelate ABC superfamily ATP binding cassette transporter%2C binding protein
262 OV100759.1 GCA920939465_00172 CDS open 188669-189163 _na     164_aa Chemotaxis protein
263 OV100759.1 GCA920939465_00173 CDS open 189165-191219 _na     684_aa TonB-dependent receptor
264 OV100759.1 GCA920939465_00174 CDS open 191279-192553 _na     424_aa citrate synthase
265 OV100759.1 GCA920939465_00175 CDS open 192819-194063 _na     414_aa icd NADP-dependent isocitrate dehydrogenase
266 OV100759.1 GCA920939465_00176 CDS open 194109-196715 _na     868_aa acnB bifunctional aconitate hydratase 2/2-methylisocitrate dehydratase
267 OV100759.1 GCA920939465_00177 CDS open 196838-197803 _na     321_aa ttcA tRNA 2-thiocytidine(32) synthetase TtcA
268 OV100759.1 GCA920939465_00178 CDS open 197905-198387 _na     160_aa nlpC Lipoprotein NlpC
269 OV100759.1 GCA920939465_00179 CDS open 198454-198750 _na     98_aa hupA integration host factor subunit alpha
270 OV100759.1 GCA920939465_00180 CDS open 198754-201144 _na     796_aa pheT phenylalanine--tRNA ligase subunit beta
271 OV100759.1 GCA920939465_00181 CDS open 201164-202153 _na     329_aa pheS phenylalanine--tRNA ligase subunit alpha
272 OV100759.1 GCA920939465_00182 CDS open 202393-203262 _na     289_aa htpX protease HtpX
273 OV100759.1 GCA920939465_00184 CDS open 203937-204872 _na     311_aa gutQ Arabinose 5-phosphate isomerase
274 OV100759.1 GCA920939465_00185 CDS open 204872-205426 _na     184_aa kdsC 3-deoxy-D-manno-octulosonate 8-phosphate phosphatase KdsC
275 OV100759.1 GCA920939465_00186 CDS open 205608-207155 _na     515_aa trpE anthranilate synthase component 1
276 OV100759.1 GCA920939465_00187 CDS open 207166-207750 _na     194_aa pabA anthranilate synthase
277 OV100759.1 GCA920939465_00188 CDS open 207807-208199 _na     130_aa Tautomerase enzyme
278 OV100759.1 GCA920939465_00189 CDS open 208211-209212 _na     333_aa Anthranilate phosphoribosyltransferase
279 OV100759.1 GCA920939465_00190 CDS open 209247-210677 _na     476_aa trpF bifunctional indole-3-glycerol-phosphate synthase TrpC/phosphoribosylanthranilate isomerase TrpF
280 OV100759.1 GCA920939465_00191 CDS open 210987-212135 _na     382_aa hybO hydrogenase 2 small subunit
281 OV100759.1 GCA920939465_00192 CDS open 212137-213177 _na     346_aa hybA hydrogenase 2 operon protein HybA
282 OV100759.1 GCA920939465_00193 CDS open 213170-214396 _na     408_aa hybB Ni/Fe-hydrogenase cytochrome b subunit
283 OV100759.1 GCA920939465_00194 CDS open 214396-216105 _na     569_aa hybC hydrogenase 2 large subunit
284 OV100759.1 GCA920939465_00195 CDS open 216105-216584 _na     159_aa HyaD/HybD family hydrogenase maturation endopeptidase
285 OV100759.1 GCA920939465_00196 CDS open 216727-217236 _na     169_aa hybE hydrogenase-2 assembly chaperone
286 OV100759.1 GCA920939465_00197 CDS open 217267-217542 _na     91_aa hybG hydrogenase maturation factor HybG
287 OV100759.1 GCA920939465_00198 CDS open 217662-217826 _na     54_aa hypothetical protein
288 OV100759.1 GCA920939465_00199 CDS open 218017-218238 _na     73_aa hypothetical protein
289 OV100759.1 GCA920939465_00200 CDS open 218365-218754 _na     129_aa DNA-binding helix-turn-helix protein
290 OV100759.1 GCA920939465_00201 CDS open 219025-219270 _na     81_aa L-lactate dehydrogenase
291 OV100759.1 GCA920939465_00202 CDS open 219492-219758 _na     88_aa oadG putative oxaloacetate decarboxylase gamma chain
292 OV100759.1 GCA920939465_00203 CDS open 219775-221571 _na     598_aa oadA sodium-extruding oxaloacetate decarboxylase subunit alpha
293 OV100759.1 GCA920939465_00204 CDS open 221582-222886 _na     434_aa oadB Oxaloacetate decarboxylase beta chain
294 OV100759.1 GCA920939465_00205 CDS open 223149-223904 _na     251_aa ydfG NADP-dependent 3-hydroxy acid dehydrogenase YdfG
295 OV100759.1 GCA920939465_00206 CDS open 223921-225120 _na     399_aa trpB tryptophan synthase subunit beta
296 OV100759.1 GCA920939465_00207 CDS open 225117-225923 _na     268_aa tryptophan synthase subunit alpha
297 OV100759.1 GCA920939465_00208 CDS open 226139-227827 _na     562_aa nrdA ribonucleoside-diphosphate reductase subunit alpha
298 OV100759.1 GCA920939465_00209 CDS open 227962-228951 _na     329_aa nrdB ribonucleoside-diphosphate reductase
299 OV100759.1 GCA920939465_00210 CDS open 229196-230635 _na     479_aa pyk pyruvate kinase
300 OV100759.1 GCA920939465_00211 CDS open 230768-231496 _na     242_aa bioD dethiobiotin synthase
301 OV100759.1 GCA920939465_00212 CDS open 231590-232798 _na     402_aa NagC-like transcriptional regulator Mlc
302 OV100759.1 GCA920939465_00213 CDS open 232995-234398 _na     467_aa asnS asparagine--tRNA ligase
303 OV100759.1 GCA920939465_00214 CDS open 234561-235001 _na     146_aa ClpXP protease specificity-enhancing factor
304 OV100759.1 GCA920939465_00215 CDS open 235013-235654 _na     213_aa sspA stringent starvation protein SspA
305 OV100759.1 GCA920939465_00216 CDS open 235862-236317 _na     151_aa moaE molybdopterin synthase catalytic subunit MoaE
306 OV100759.1 GCA920939465_00217 CDS open 236318-236563 _na     81_aa moaD molybdopterin synthase sulfur carrier subunit
307 OV100759.1 GCA920939465_00218 CDS open 236563-237003 _na     146_aa moaC cyclic pyranopterin monophosphate synthase MoaC
308 OV100759.1 GCA920939465_00219 CDS open 237098-238111 _na     337_aa moaA GTP 3'%2C8-cyclase MoaA
309 OV100759.1 GCA920939465_00220 CDS open 238458-239456 _na     332_aa Putative gluconeogenesis factor
310 OV100759.1 GCA920939465_00221 CDS open 239506-240930 _na     474_aa lpdA dihydrolipoyl dehydrogenase
311 OV100759.1 GCA920939465_00222 CDS open 241031-242911 _na     626_aa aceF pyruvate dehydrogenase complex dihydrolipoyllysine-residue acetyltransferase
312 OV100759.1 GCA920939465_00223 CDS open 242985-245642 _na     885_aa aceE pyruvate dehydrogenase (acetyl-transferring)%2C homodimeric type
313 OV100759.1 GCA920939465_00224 CDS open 246079-246939 _na     286_aa tehB SAM-dependent methyltransferase TehB
314 OV100759.1 GCA920939465_00225 CDS open 247012-247839 _na     275_aa dapD 2%2C3%2C4%2C5-tetrahydropyridine-2%2C6-dicarboxylate N-succinyltransferase
315 OV100759.1 GCA920939465_00226 CDS open 247883-248854 _na     323_aa cysB HTH-type transcriptional regulator CysB
316 OV100759.1 GCA920939465_00227 CDS open 248889-249875 _na     328_aa rluB 23S rRNA pseudouridine(2605) synthase RluB
317 OV100759.1 GCA920939465_00228 CDS open 249921-250544 _na     207_aa L-threonylcarbamoyladenylate synthase
318 OV100759.1 GCA920939465_00229 CDS open 250624-251748 _na     374_aa tyrA bifunctional chorismate mutase/prephenate dehydrogenase
319 OV100759.1 GCA920939465_00230 CDS open 251788-253674 _na     628_aa sppA signal peptide peptidase SppA
320 OV100759.1 GCA920939465_00231 CDS open 253809-254363 _na     184_aa NAD(P)H nitroreductase
321 OV100759.1 GCA920939465_00232 CDS open 254602-254793 _na     63_aa DUF2892 domain-containing protein
322 OV100759.1 GCA920939465_00233 CDS open 254867-255397 _na     176_aa rhodanese family protein
323 OV100759.1 GCA920939465_00234 CDS open 255511-255813 _na     100_aa arsR ArsR family transcriptional regulator
324 OV100759.1 GCA920939465_00235 CDS open 255887-256915 _na     342_aa rfbB dTDP-glucose 4%2C6-dehydratase
325 OV100759.1 GCA920939465_00236 CDS open 256922-257710 _na     262_aa TIGR01619 family protein
326 OV100759.1 GCA920939465_00237 CDS open 257710-258513 _na     267_aa xthA exodeoxyribonuclease III
327 OV100759.1 GCA920939465_00238 CDS open 258534-259652 _na     372_aa Lytic transglycosylase
328 OV100759.1 GCA920939465_00239 CDS open 259656-260555 _na     299_aa amsE Amylovoran biosynthesis glycosyltransferase AmsE
329 OV100759.1 GCA920939465_00240 CDS open 260555-261436 _na     293_aa glycosyltransferase family 2 protein
330 OV100759.1 GCA920939465_00241 CDS open 261436-262629 _na     397_aa Brp/Blh family beta-carotene 15%2C15'-monooxygenase
331 OV100759.1 GCA920939465_00242 CDS open 262638-263408 _na     256_aa Glycosyltransferase
332 OV100759.1 GCA920939465_00243 CDS open 263557-265080 _na     507_aa Transmembrane protein
333 OV100759.1 GCA920939465_00244 CDS open 265077-266042 _na     321_aa yvfF Polysaccharide pyruvyl transferase YvfF
334 OV100759.1 GCA920939465_00245 CDS open 266074-266817 _na     247_aa DUF218 domain-containing protein
335 OV100759.1 GCA920939465_00246 CDS open 266993-267823 _na     276_aa DNA ligase
336 OV100759.1 GCA920939465_00247 CDS open 267861-268781 _na     306_aa truB tRNA pseudouridine(55) synthase TruB
337 OV100759.1 GCA920939465_00248 CDS open 268781-269167 _na     128_aa rbfA 30S ribosome-binding factor RbfA
338 OV100759.1 GCA920939465_00249 CDS open 269315-271804 _na     829_aa infB translation initiation factor IF-2
339 OV100759.1 GCA920939465_00250 CDS open 271820-273316 _na     498_aa nusA Transcription termination/antitermination protein NusA
340 OV100759.1 GCA920939465_00251 CDS open 273341-273796 _na     151_aa rimP ribosome maturation factor RimP
341 OV100759.1 GCA920939465_00253 CDS open 274129-274380 _na     83_aa ycgL YcgL domain-containing protein HMPREF9064-0750
342 OV100759.1 GCA920939465_00254 CDS open 274466-275128 _na     220_aa minC septum site-determining protein MinC
343 OV100759.1 GCA920939465_00255 CDS open 275147-275638 _na     163_aa Histone
344 OV100759.1 GCA920939465_00256 CDS open 275734-276204 _na     156_aa sixA phosphohistidine phosphatase SixA
345 OV100759.1 GCA920939465_00257 CDS open 276223-277557 _na     444_aa glmM phosphoglucosamine mutase
346 OV100759.1 GCA920939465_00258 CDS open 277650-278477 _na     275_aa folP dihydropteroate synthase
347 OV100759.1 GCA920939465_00259 CDS open 278568-279674 _na     368_aa dinB DNA polymerase IV
348 OV100759.1 GCA920939465_00260 CDS open 279749-280258 _na     169_aa DUF4352 domain-containing protein
349 OV100759.1 GCA920939465_00261 CDS open 280384-281622 _na     412_aa sstT serine/threonine transporter SstT
350 OV100759.1 GCA920939465_00262 CDS open 281940-282389 _na     149_aa impA ImpA protein
351 OV100759.1 GCA920939465_00263 CDS open 282476-282988 _na     170_aa NlpC/P60 domain-containing protein
352 OV100759.1 GCA920939465_00264 CDS open 283165-284019 _na     284_aa kdsA 3-deoxy-8-phosphooctulonate synthase
353 OV100759.1 GCA920939465_00265 CDS open 284029-284928 _na     299_aa prmC peptide chain release factor N(5)-glutamine methyltransferase
354 OV100759.1 GCA920939465_00266 CDS open 284974-286056 _na     360_aa prfA peptide chain release factor 1
355 OV100759.1 GCA920939465_00267 CDS open 286194-286649 _na     151_aa slyB SlyB protein
356 OV100759.1 GCA920939465_00268 CDS open 286746-287333 _na     195_aa VOC family protein
357 OV100759.1 GCA920939465_00269 CDS open 287433-289166 _na     577_aa argS arginine--tRNA ligase
358 OV100759.1 GCA920939465_00271 CDS open 289523-290959 _na     478_aa GTP-binding protein
359 OV100759.1 GCA920939465_00272 CDS open 291300-293201 _na     633_aa dnaK molecular chaperone DnaK
360 OV100759.1 GCA920939465_00273 CDS open 293322-293720 _na     132_aa GyrI-like domain-containing protein
361 OV100759.1 GCA920939465_00274 CDS open 293796-295064 _na     422_aa mET17 Cystathionine gamma-synthase
362 OV100759.1 GCA920939465_00275 CDS open 295335-296462 _na     375_aa dnaJ molecular chaperone DnaJ
363 OV100759.1 GCA920939465_00276 CDS open 296594-297682 _na     362_aa porin
364 OV100759.1 GCA920939465_00277 CDS open 297883-299076 _na     397_aa metC cystathionine beta-lyase
365 OV100759.1 GCA920939465_00278 CDS open 299260-299817 _na     185_aa pgsA CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase
366 OV100759.1 GCA920939465_00282 CDS open 301179-302564 _na     461_aa Cytochrome-c peroxidase
367 OV100759.1 GCA920939465_00283 CDS open 302649-303806 _na     385_aa rnd ribonuclease D
368 OV100759.1 GCA920939465_00284 CDS open 303870-305561 _na     563_aa fadD long-chain-fatty-acid--CoA ligase FadD
369 OV100759.1 GCA920939465_00285 CDS open 305628-306182 _na     184_aa Slp family lipoprotein
370 OV100759.1 GCA920939465_00286 CDS open 306214-306936 _na     240_aa tsaB tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB
371 OV100759.1 GCA920939465_00287 CDS open 306939-308885 _na     648_aa dinG DNA 5'-3' helicase
372 OV100759.1 GCA920939465_00288 CDS open 308960-309778 _na     272_aa Putative glucose-6-phosphate 1-epimerase
373 OV100759.1 GCA920939465_00289 CDS open 310373-310639 _na     88_aa DDE-type integrase/transposase/recombinase
374 OV100759.1 GCA920939465_00290 CDS open 310649-312643 _na     664_aa Restriction endonuclease
375 OV100759.1 GCA920939465_00291 CDS open 312645-312866 _na     73_aa putative transcriptional regulator
376 OV100759.1 GCA920939465_00292 CDS open 313069-314301 _na     410_aa Type I site-specific deoxyribonuclease chain R
377 OV100759.1 GCA920939465_00293 CDS open 314509-314877 _na     122_aa Rhodanese domain protein
378 OV100759.1 GCA920939465_00294 CDS open 315075-316601 _na     508_aa katA Catalase
379 OV100759.1 GCA920939465_00295 CDS open 317006-317863 _na     285_aa cnoX Co-chaperone YbbN
380 OV100759.1 GCA920939465_00296 CDS open 317917-318873 _na     318_aa trxB thioredoxin-disulfide reductase
381 OV100759.1 GCA920939465_00297 CDS open 318969-320732 _na     587_aa cydD heme ABC transporter permease/ATP-binding protein CydD
382 OV100759.1 GCA920939465_00298 CDS open 320732-322465 _na     577_aa cydC heme ABC transporter ATP-binding protein/permease CydC
383 OV100759.1 GCA920939465_00300 CDS open 322723-323589 _na     288_aa tesB acyl-CoA thioesterase II
384 OV100759.1 GCA920939465_00301 CDS open 323606-324478 _na     290_aa Ferritin-like domain-containing protein
385 OV100759.1 GCA920939465_00302 CDS open 324520-324642 _na     40_aa hypothetical protein
386 OV100759.1 GCA920939465_00303 CDS open 324643-325380 _na     245_aa Protein kinase domain-containing protein
387 OV100759.1 GCA920939465_00304 CDS open 325447-326103 _na     218_aa Lipoprotein
388 OV100759.1 GCA920939465_00305 CDS open 326188-326772 _na     194_aa DUF1439 domain-containing protein
389 OV100759.1 GCA920939465_00306 CDS open 326829-327743 _na     304_aa nagK N-acetylglucosamine kinase
390 OV100759.1 GCA920939465_00307 CDS open 327804-328544 _na     246_aa undecaprenyl-diphosphate phosphatase
391 OV100759.1 GCA920939465_00308 CDS open 328620-329273 _na     217_aa ribA GTP cyclohydrolase-2
392 OV100759.1 GCA920939465_00309 CDS open 329408-330946 _na     512_aa Oligopeptide ABC superfamily ATP binding cassette transporter%2C binding protein
393 OV100759.1 GCA920939465_00310 CDS open 330999-331364 _na     121_aa Inner membrane protein
394 OV100759.1 GCA920939465_00311 CDS open 331486-333525 _na     679_aa prlC oligopeptidase A
395 OV100759.1 GCA920939465_00312 CDS open 333650-334150 _na     166_aa crr PTS glucose transporter subunit IIA
396 OV100759.1 GCA920939465_00313 CDS open 334214-335941 _na     575_aa ptsI phosphoenolpyruvate-protein phosphotransferase PtsI
397 OV100759.1 GCA920939465_00314 CDS open 336080-336337 _na     85_aa ptsH phosphocarrier protein Hpr
398 OV100759.1 GCA920939465_00315 CDS open 336544-337584 _na     346_aa rsgA small ribosomal subunit biogenesis GTPase RsgA
399 OV100759.1 GCA920939465_00316 CDS open 337657-338205 _na     182_aa orn oligoribonuclease
400 OV100759.1 GCA920939465_00319 CDS open 338639-339115 _na     158_aa tsaE tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE
401 OV100759.1 GCA920939465_00320 CDS open 339143-340717 _na     524_aa amiB putative N-acetylmuramoyl-L-alanine amidase AmiB
402 OV100759.1 GCA920939465_00321 CDS open 340717-342564 _na     615_aa mutL DNA mismatch repair endonuclease MutL
403 OV100759.1 GCA920939465_00322 CDS open 342567-343511 _na     314_aa miaA tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA
404 OV100759.1 GCA920939465_00323 CDS open 343628-343921 _na     97_aa hfq RNA chaperone Hfq
405 OV100759.1 GCA920939465_00324 CDS open 343936-345333 _na     465_aa hflX ribosome rescue GTPase HflX
406 OV100759.1 GCA920939465_00325 CDS open 345330-346289 _na     319_aa tyrR HTH-type transcriptional regulatory protein TyrR
407 OV100759.1 GCA920939465_00326 CDS open 346391-347470 _na     359_aa UPF0283 membrane protein HMPREF9064_0682
408 OV100759.1 GCA920939465_00327 CDS open 347485-348891 _na     468_aa ycjX YcjX family protein
409 OV100759.1 GCA920939465_00328 CDS open 349110-350804 _na     564_aa Peptide ABC superfamily ATP binding cassette transporter%2C binding protein
410 OV100759.1 GCA920939465_00329 CDS open 350804-351769 _na     321_aa Peptide ABC superfamily ATP binding cassette transporter%2C permease protein
411 OV100759.1 GCA920939465_00330 CDS open 351759-352646 _na     295_aa Peptide ABC superfamily ATP binding cassette transporter%2C permease protein
412 OV100759.1 GCA920939465_00331 CDS open 352653-353702 _na     349_aa sapD Glutathione import ATP-binding protein GsiA
413 OV100759.1 GCA920939465_00332 CDS open 353713-354516 _na     267_aa Peptide ABC superfamily ATP binding cassette transporter%2C ABC protein
414 OV100759.1 GCA920939465_00337 CDS open 355236-356459 _na     407_aa nagC ROK family protein
415 OV100759.1 GCA920939465_00338 CDS open 356522-357826 _na     434_aa hemA glutamyl-tRNA reductase
416 OV100759.1 GCA920939465_00339 CDS open 358014-358715 _na     233_aa gloB hydroxyacylglutathione hydrolase
417 OV100759.1 GCA920939465_00340 CDS open 358733-359431 _na     232_aa Methyltransferase domain protein
418 OV100759.1 GCA920939465_00341 CDS open 359503-360996 _na     497_aa ptsG2 PTS family glucose porter%2C IICBA component
419 OV100759.1 GCA920939465_00342 CDS open 361427-362629 _na     400_aa manA mannose-6-phosphate isomerase%2C class I
420 OV100759.1 GCA920939465_00343 CDS open 362728-364491 _na     587_aa ycaO 30S ribosomal protein S12 methylthiotransferase accessory factor YcaO
421 OV100759.1 GCA920939465_00344 CDS open 364648-365055 _na     135_aa Z-ring associated protein G
422 OV100759.1 GCA920939465_00345 CDS open 365246-366631 _na     461_aa Protease do
423 OV100759.1 GCA920939465_00346 CDS open 366711-368753 _na     680_aa uvrB excinuclease ABC subunit UvrB
424 OV100759.1 GCA920939465_00348 CDS open 369363-370385 _na     340_aa zevB zinc transporter permease subunit ZevB
425 OV100759.1 GCA920939465_00349 CDS open 370400-371032 _na     210_aa zevA zinc transporter binding subunit ZevA
426 OV100759.1 GCA920939465_00350 CDS open 371114-371230 _na     38_aa hypothetical protein
427 OV100759.1 GCA920939465_00351 CDS open 371469-373139 _na     556_aa ettA energy-dependent translational throttle protein EttA
428 OV100759.1 GCA920939465_00352 CDS open 373344-373715 _na     123_aa dsrE Sulfur reduction protein DsrE
429 OV100759.1 GCA920939465_00353 CDS open 373798-374475 _na     225_aa ytfE iron-sulfur cluster repair protein YtfE
430 OV100759.1 GCA920939465_00354 CDS open 374672-375835 _na     387_aa mauG Methylamine utilization protein MauG
431 OV100759.1 GCA920939465_00355 CDS open 375960-377858 _na     632_aa parE DNA topoisomerase IV subunit B
432 OV100759.1 GCA920939465_00356 CDS open 378019-380271 _na     750_aa parC DNA topoisomerase IV subunit A
433 OV100759.1 GCA920939465_00357 CDS open 380417-381148 _na     243_aa Sel1 repeat superfamily protein
434 OV100759.1 GCA920939465_00358 CDS open 381135-381851 _na     238_aa YwiC-like protein
435 OV100759.1 GCA920939465_00359 CDS open 381969-382847 _na     292_aa endonuclease/exonuclease/phosphatase family protein
436 OV100759.1 GCA920939465_00360 CDS open 382847-384892 _na     681_aa dnaX DNA polymerase III subunit gamma/tau
437 OV100759.1 GCA920939465_00361 CDS open 384918-385460 _na     180_aa apt adenine phosphoribosyltransferase
438 OV100759.1 GCA920939465_00362 CDS open 385552-386508 _na     318_aa lpxM lauroyl-Kdo(2)-lipid IV(A) myristoyltransferase
439 OV100759.1 GCA920939465_00363 CDS open 386545-387312 _na     255_aa tauE putative membrane transporter protein
440 OV100759.1 GCA920939465_00364 CDS open 387316-388188 _na     290_aa mepA penicillin-insensitive murein endopeptidase
441 OV100759.1 GCA920939465_00365 CDS open 388209-389282 _na     357_aa aroC chorismate synthase
442 OV100759.1 GCA920939465_00366 CDS open 389305-392631 _na     1108_aa mscK mechanosensitive channel MscK
443 OV100759.1 GCA920939465_00367 CDS open 392634-394055 _na     473_aa menE o-succinylbenzoate--CoA ligase
444 OV100759.1 GCA920939465_00368 CDS open 394061-394678 _na     205_aa seqA replication initiation negative regulator SeqA
445 OV100759.1 GCA920939465_00369 CDS open 394765-395565 _na     266_aa Alpha/beta fold hydrolase
446 OV100759.1 GCA920939465_00370 CDS open 395660-395962 _na     100_aa ybfE LexA regulated protein
447 OV100759.1 GCA920939465_00371 CDS open 395971-396495 _na     174_aa fldA flavodoxin FldA
448 OV100759.1 GCA920939465_00372 CDS open 396515-396955 _na     146_aa fur ferric iron uptake transcriptional regulator
449 OV100759.1 GCA920939465_00373 CDS open 397124-399781 _na     885_aa gyrA DNA topoisomerase (ATP-hydrolyzing) subunit A
450 OV100759.1 GCA920939465_00374 CDS open 399842-400192 _na     116_aa sirB Invasion gene expression up-regulator SirB
451 OV100759.1 GCA920939465_00375 CDS open 400223-400540 _na     105_aa yciH stress response translation initiation inhibitor YciH
452 OV100759.1 GCA920939465_00376 CDS open 400547-401239 _na     230_aa pyrF orotidine-5'-phosphate decarboxylase
453 OV100759.1 GCA920939465_00377 CDS open 401273-402463 _na     396_aa lapB lipopolysaccharide assembly protein LapB
454 OV100759.1 GCA920939465_00378 CDS open 402463-402759 _na     98_aa putative lipopolysaccharide assembly protein A
455 OV100759.1 GCA920939465_00379 CDS open 402857-403141 _na     94_aa hupA integration host factor subunit beta
456 OV100759.1 GCA920939465_00380 CDS open 403202-404848 _na     548_aa rpsA 30S ribosomal protein S1
457 OV100759.1 GCA920939465_00381 CDS open 404945-405622 _na     225_aa cmk (d)CMP kinase
458 OV100759.1 GCA920939465_00382 CDS open 405615-406496 _na     293_aa DUF535 domain-containing protein
459 OV100759.1 GCA920939465_00383 CDS open 406659-406991 _na     110_aa azlD Branched-chain amino acid transporter AzlD
460 OV100759.1 GCA920939465_00384 CDS open 406992-407720 _na     242_aa azlC Branched-chain amino acid transporter AzlC
461 OV100759.1 GCA920939465_00385 CDS open 407725-408657 _na     310_aa metR HTH-type transcriptional regulator MetR
462 OV100759.1 GCA920939465_00386 CDS open 408929-411202 _na     757_aa metE 5-methyltetrahydropteroyltriglutamate--homocysteine S-methyltransferase
463 OV100759.1 GCA920939465_00387 CDS open 411337-412107 _na     256_aa Trehalose operon transcriptional repressor
464 OV100759.1 GCA920939465_00388 CDS open 412249-416022 _na     1257_aa malQ 4-alpha-glucanotransferase
465 OV100759.1 GCA920939465_00389 CDS open 416032-416823 _na     263_aa Endonuclease/exonuclease/phosphatase
466 OV100759.1 GCA920939465_00390 CDS open 416834-418498 _na     554_aa PTS system%2C glucose-specific IIABC component
467 OV100759.1 GCA920939465_00391 CDS open 418874-419536 _na     220_aa ybhL BAX inhibitor protein
468 OV100759.1 GCA920939465_00392 CDS open 419628-419957 _na     109_aa dsrC Sulfurtransferase
469 OV100759.1 GCA920939465_00393 CDS open 420057-420938 _na     293_aa afeA iron ABC transporter substrate-binding protein AfeA
470 OV100759.1 GCA920939465_00394 CDS open 420938-421828 _na     296_aa afeB ironABC transporter ATP-binding protein AfeB
471 OV100759.1 GCA920939465_00395 CDS open 421828-422685 _na     285_aa afeC iron ABC transporter permease subunit AfeC
472 OV100759.1 GCA920939465_00396 CDS open 422682-423530 _na     282_aa yfeD Iron (Fe3+) ABC superfamily ATP binding cassette transporter%2C membrane protein YfeD
473 OV100759.1 GCA920939465_00397 CDS open 423505-423777 _na     90_aa acylphosphatase
474 OV100759.1 GCA920939465_00398 CDS open 423934-424608 _na     224_aa curli polymerization inhibitor CsgI-related protein
475 OV100759.1 GCA920939465_00399 CDS open 424682-425140 _na     152_aa mgsA methylglyoxal synthase
476 OV100759.1 GCA920939465_00400 CDS open 425149-425604 _na     151_aa yccF YccF domain-containing protein
477 OV100759.1 GCA920939465_00401 CDS open 425627-427768 _na     713_aa TIGR01666 family membrane protein
478 OV100759.1 GCA920939465_00402 CDS open 427765-428271 _na     168_aa smrB endonuclease SmrB
479 OV100759.1 GCA920939465_00403 CDS open 428334-429284 _na     316_aa prmB 50S ribosomal protein L3 N(5)-glutamine methyltransferase
480 OV100759.1 GCA920939465_00404 CDS open 429365-430237 _na     290_aa sucD succinate--CoA ligase subunit alpha
481 OV100759.1 GCA920939465_00405 CDS open 430249-431418 _na     389_aa sucC ADP-forming succinate--CoA ligase subunit beta
482 OV100759.1 GCA920939465_00406 CDS open 431505-432710 _na     401_aa odhB 2-oxoglutarate dehydrogenase complex dihydrolipoyllysine-residue succinyltransferase
483 OV100759.1 GCA920939465_00407 CDS open 432827-435631 _na     934_aa sucA 2-oxoglutarate dehydrogenase E1 component
484 OV100759.1 GCA920939465_00408 CDS open 435854-436495 _na     213_aa Metallo-beta-lactamase
485 OV100759.1 GCA920939465_00409 CDS open 436565-437125 _na     186_aa Twin-arginine translocation pathway signal
486 OV100759.1 GCA920939465_00410 CDS open 437193-438656 _na     487_aa L%2CD-TPase catalytic domain-containing protein
487 OV100759.1 GCA920939465_00411 CDS open 438731-440788 _na     685_aa prc carboxy terminal-processing peptidase
488 OV100759.1 GCA920939465_00412 CDS open 440861-441469 _na     202_aa proQ RNA chaperone ProQ
489 OV100759.1 GCA920939465_00413 CDS open 441692-442972 _na     426_aa Paraquat-inducible protein A
490 OV100759.1 GCA920939465_00414 CDS open 442938-445580 _na     880_aa Paraquat-inducible protein B
491 OV100759.1 GCA920939465_00415 CDS open 445739-446083 _na     114_aa Bacterial OB-fold domain-containing protein
492 OV100759.1 GCA920939465_00416 CDS open 446192-447433 _na     413_aa pepT peptidase T
493 OV100759.1 GCA920939465_00417 CDS open 447700-448818 _na     372_aa potA spermidine/putrescine ABC transporter ATP-binding protein PotA
494 OV100759.1 GCA920939465_00418 CDS open 448802-449662 _na     286_aa potB spermidine/putrescine ABC transporter permease PotB
495 OV100759.1 GCA920939465_00419 CDS open 449662-450435 _na     257_aa potC spermidine/putrescine ABC transporter permease PotC
496 OV100759.1 GCA920939465_00420 CDS open 450566-451663 _na     365_aa potD Putrescine-binding periplasmic protein
497 OV100759.1 GCA920939465_00421 CDS open 451778-452674 _na     298_aa cdd cytidine deaminase
498 OV100759.1 GCA920939465_00422 CDS open 452756-454072 _na     438_aa serS serine--tRNA ligase
499 OV100759.1 GCA920939465_00423 CDS open 454381-456048 _na     555_aa dcuA Transporter%2C anaerobic C4-dicarboxylate uptake (Dcu) family
500 OV100759.1 GCA920939465_00424 CDS open 456178-457518 _na     446_aa rarA Replication-associated recombination protein A